Detection of nucleic acids

Hetero-orthogonal signal amplification methods using distinct enzymatic and non-enzymatic techniques address sensitivity and specificity issues in multiplex nucleic acid detection, enhancing detection efficiency and reducing interference.

WO2025251111A1PCT designated stage Publication Date: 2025-12-11AVICENA SYST LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/AU2025/050595
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-03
Filing Date
2025-06-03
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Existing multiplex nucleic acid detection methods face challenges in sensitivity and specificity due to competition for reagents, enzyme limitations, and interference between different target amplicons, leading to sub-optimal detection, especially when using homo-orthogonal detection chemistries.

Method used

Employ hetero-orthogonal signal amplification methods that combine distinct enzymatic and non-enzymatic detection signal amplification techniques to detect multiple target nucleic acid sequences in a single isothermal reaction, using different amplification chemistries for each sequence.

Benefits of technology

Enhances sensitivity and specificity of multiplex nucleic acid detection without increasing complexity, allowing for reliable detection of multiple targets with improved signal-to-noise ratios and reduced interference.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000056_0001
    Figure IMGF000056_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
  • Figure IMGF000037_0001
    Figure IMGF000037_0001
Patent Text Reader

Abstract

Disclosed herein are methods of detecting multiple target nucleic acids in multiplex detection reactions using hetero-orthogonal detection. Also disclosed are assay kits that allow the detection of multiple target nucleic acids in multiplex detection reactions using hetero-orthogonal detection. Such multiplex detection using hetero-orthogonal signal detection methods allows for identification of low efficiency amplification targets in combination with isothermal amplification protocols allowing detection of multiple select target nucleic acid sequences.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]DETECTION OF NUCLEIC ACIDS FIELD OF THE INVENTION This invention generally relates to methods of detecting multiple target nucleic acids in multiplex detection reactions using hetero-orthogonal detection methods in the same assay. Multiplex detection using hetero-orthogonal signal detection methods allows for identification of low efficiency amplification targets in combination with isothermal amplification protocols and can be employed to detect multiple select target nucleic acid sequences, whether all of the target sequences are themselves amplified in the multiplex reaction or not. BACKGROUND Multiple fluorescence-based detection approaches exist which allow multiplexed readouts of distinct nucleic acid target sequences amplified from multiple isothermal assays conducted in a single vessel. Such distinct nucleic acid target sequences are also termed “target amplicons” herein. A non-exhaustive list of such methods includes: detection of amplification by release of quenching (DARQ), mediator displacement (MD), quenching probe (QProbe) quenching of unincorporated amplification of signal reporters (QUASR), fluorescence of loop primer upon self-dequenching (FLOS), high-fidelity DNA polymerase- mediated fluorescent probe (HFman probe), alternately binding quenching probe competitive LAMP (ABC-LAMP), one-step strand displacement (OSD), (Becherer, N. et al., Anal. Methods-UK 12 (2020) 717–746; Tanner, Y. et al., BioTechniques 53 (2012) 81–89; Zhang, N., A. Tanner, BioTechniques 73 (2022) 247–255; Becherer et al., Anal. Chem.90 (2018) 4741–4748). Additionally, other enzymatic signal amplification methods have been combined with LAMP in an effort to improve sensitivity of amplification and / or detection. These signal amplifiers include multiple endonuclease restriction real-time (MERT), and Tth endonuclease IV cleavage (TEC / LEC), HFman Pobes, Proofman and LANTERN (Zhang, et al., Diagnostics 13 (2023) 1530). An additional variation of multiplex detection using signal amplification is known as iFRET (Li et al., Sens. Actuators B: Chem.345 (2021) 130351). iFRET can provide improved signal / noise ratios over conventional molecular beacon or displacement probes using dual fluorophore / quencher labels, since in iFRET, the only source of excitation of fluorophores associated with the target amplicon (i.e., the amplification product) is through energy transfer from a proximal dye molecule acting as a FRET donor. Such iFRET acceptor fluorophores therefore themselves require no direct excitation illumination, reducing background, especially if these acceptors have peak emission spectra in the longer (red to near infrared) wavelengths associated with lower background noise from autofluorescence of biological molecules in the reaction. A key challenge in multiplexed molecular diagnostics is the reduction in sensitivity and / or specificity of detection of a given target amplicon that is observed when multiple distinct target nucleic acid sequences are detected simultaneously, especially when such sequences are amplified and / or detected using the same or similar chemistries. This reduction in sensitivity and / or specificity results in sub-optimal performance in these types of multiplex assays, due to a range of factors such as competition in the combined reaction for reagents, enzymes etc., shared by each amplification (each of which can become limiting), or in the case of an optical signal amplification strategies such as iFRET, or antenna-effect LRET / up- converting nanoparticles (UCNP), multiple acceptor fluorophores may compete for energy transfer from the same energy harvesting donor fluorophores in the vicinity or be quenched. An additional challenge with detecting multiple target amplicons with the same chemistry is the potential for interference or cross reactivity between related components of the individual reactions. These limitations can cause more efficient amplifications to exhaust common components at the expense of less efficient amplifications in the same reaction. For example, the sensitivity of detection of each of the target amplicons at early timepoints in multiplexed Loop Medicated Isothermal Amplification (LAMP) assays can be lower than the sensitivity of detection of the same target amplicons when carried out using separate amplification reactions. This issue is due to the production of target amplicons from less efficient reactions being more retarded than other target amplicons in the same reaction (which can be accounted for in separate amplification reactions). These approaches often require optimization approaches which favour detection of low abundance target amplicons or those target amplicons which are less efficiently amplified in multiplex reactions, but nevertheless result in sub-optimal detection sensitivity. A variety of optimization approaches are therefore used to address these sensitivity challenges including extending incubation time to compensate for lower efficiency, optimization of relative primer concentrations (to stop reagent ‘cannibalization’ by most efficient chemistries), optimization of fluorophore dyes with increased quantum efficiencies to compensate for low efficiency amplifications, and the adoption of orthogonal biosensor detection of target amplicons of the original isothermal amplification (for example using CRISPR, Argonaute, DNAzyme or HFman Probes or a Nanoparticle Amplifier) (Zeng, J. et al., Front. Microbiol.15 (2024); Choi, et al., Expert Rev. Mol. Diagn.23 (2023) 9–28). Despite such mitigating efforts being applied to increase sensitivity / specificity in enzymatic multiplex assays, success has proved difficult to achieve reliably by merely by optimizing target amplicon detection to improve the sensitivity and / or specificity of detection of low efficiency targets (i.e., target amplicons amplified with low efficiency, as compared to other target amplicons in the multiplex reaction detected using the same modality). Frequently, optimization efforts in these cases result in the detection of one or more individual target amplicons being sub-optimal, either in their cognate signal and / or noise in combined reactions, when compared to detection of the same amplicons from individual reactions in separate vessels (where such confounding factors are reduced). Challenges also remain when combining multiple similar optical methods for detection of multiple target amplicons in multiplex assays. For example, multiple nanoparticle-based detectors for different analytes canexhibit increased propensity to aggregate or interfere with one another, including by causing increased signal quenching or by producing overlapping signals which are difficult to distinguish from one another. Recently, enzymatic signal amplification approaches using CRISPR-based, DNAzyme based or ARGONAUTE-based amplifications, have been employed successfully for the multiplex detection of target nucleic acids (i.e., target amplicons) in a single reaction vessel (Santiago- Frangos, et al., Methods 205 (2022) 1–10). A disadvantage of these approaches relates to the relatively poor enzymatic activity of CRISPR and / or Argonaute enzymes alone (Feng, et al, Anal. Chem.95 (2023) 206–217). This relatively poor activity limits the extent of secondary amplification which can be achieved with conventional fluorescent reporter substrates. Moreover, for optimal performance, the orthogonal enzymatic detection chemistry used with these enzymatic amplification techniques (e.g., CRISPR or Argonaute) often requires additional sequential steps (rather than running concurrently), adding to the overall time required to complete the assay. These limitations have meant that generally, the limit of detection of enzymatic amplification detection chemistries rarely reaches the Atto molar limit without greatly scaling the overall reaction volume, or without employing additional signal amplification steps such as by using an autocatalytic substrate. In one example, the SHERLOCKv2 system exploits activation of the CRISPR- associated type III effector nuclease Csm6 by the linear adenine homopolymers terminated with a 2′,3′-cyclic phosphate produced by the Cas13 enzymes in SHERLOCKv2 LwaCas13a and PsmCas13, to achieve a catalytic amplification. However, using this system to detect multiple target amplicons in parallel requires design of multiplex orthogonal CRISPR reporters which can distinguish target dinucleotide preferences of the constituent CAS13 isoforms LwaCas13a, CcaCas13b, LbaCas13a, and PsmCas13b. These challenges limit the flexibility of detection and greatly increase the cost and complexity of implementation due to the requirements for inclusion of multiple enzymes and reporters. Additionally, further constraints are imposed by each of these systems which require inclusion of particular nucleic acid target sequences for recognition by each CAS isoform In an alternative example, a cyclic autocatalytic CRISPR Cas12 substrate is employed for rapid amplification of signals from CRISPR Cas12 ribonuclear complexes which have been activated by interaction with double stranded DNA target sequences [Deng, F. et al., Nat. Commun.15, 1818 (2024). One of the challenges in exploiting the collateral cleavage activity of CRISPR Cas12 or CRISPR Cas13-based systems for multiplexing via cleavage of reporters corresponding to each target amplicon, is that this nuclease activity is less discriminating than the enzyme activation itself, leading to increased potential for loss of specificity. Crucially, to address such challenges, these enzymatic detection systems typically require increased complexity for multiplexing, such as use of variants within an enzyme family of orthogonal chemistries (or the same combination of chemistries), to achieve multiplex detection, albeit using distinct enzymatic isoforms or distinct programming of each detector to achieve specificity. This in turn creates technical challenges resulting in increased complexity in assay design. For example by combining CRISPR-Cas 12 and 13 based orthogonal detector modules into a hybrid bivalent enzyme capable of cleaving distinct RNA and DNA-based target probes respectively (Guk, et al., Biosens Bioelectron 219 (2023)), or alternatively by employing multiple CAS13 isoforms (LwaCas13a, CcaCas13b, LbaCas13a, and PsmCas13b) as outlined above. Similarly, multiplexing can be achieved by using distinct DNAzyme-based reporters recognized by programmed Argonaute nucleases with distinct cleavage preferences (Li, et al., Biosens. Bioelectron.244 (2024)). Likewise, multiplexing can be achieved enzymatically using HFman Probes (Dong, Y. et al., Acs Sensors 7) or similarly using an alternative enzymatic amplification approach such as, Dual Hairpin Ligation Induced Isothermal Amplification (DHLA) (Li, Y. et al., Anal. Chem.93 (2021) 3315–3323.) or LEC-LAMP (Higgins). However, these latter approaches to multiplex detection also introduce considerable complexity in design and practical feasibility, by failing to avoid residual issues of interference, competition and / or product inhibition which commonly result from using similar chemistries for amplification of signals arising from the detection of distinct target amplicons. Further examples of multiplex detection of target amplicons produced from nucleic acid amplification methods, including isothermal methods, employ “homo-orthogonal” detection methods. Homo-orthogonal detection methods as described herein employ the same or similar chemistry platforms for detection of each target amplicon produced in a multiplexed reaction. Such homo-orthogonal detection can be subject to a number of limitations since each of the target amplicons to be detected may be competing for common reactants or cofactors, may be subject to inhibition due to accumulation of common reaction products or may be prone to exhibit cross-reactions in specificity. Addressing these limitations often increases the complexity in design or testing of candidate combinations of similar detection signal amplifiers to minimize interference. Sensitivity challenges can also be introduced by only using the same optical signal detection modalities as the sole means of detecting each of the target amplicons. For example, one challenge with reliance solely on iFRET-based signal detection from an intercalating / minor groove binding dye (such as Syto-9 , Syto-82, Sybr-Green, EvaGreen) acting as the FRET donor, is that only a limited number of efficient FRET acceptor fluorophore dyes are available for use for a given intercalating donor fluorophore For example, these RET acceptors fluorophore dyes must combine sufficient overlap in excitation spectrum with the emission spectrum of the cognate FRET donor intercalating fluorophore) dye to allow them to function as efficient FRET acceptors, while also having sufficient difference in their cognate emission spectra to allow them to be distinguished from one another. This inherent design constraint makes it difficult to perform this kind of iFRET from the same intercalator donor fluorophore, while still allowing clear differentiation between signals corresponding to multiple distinct target amplicons or other targeted nucleic acid sequences detected by iFRET. Simularly, other non-enzymatic signal enhancers have been devised based on hybridisation probes or molecular beacons conjugated to light-up excimers which can donate energy to adjacent hybridisation probes conjugated to FRET acceptor dyes. Similar challenges are encountered when solely employing UCNPs for multiplex detection of signals corresponding to each target amplicon or (other target nucleic acid sequence), given the limited combinations of UCNPs that are available and other feasibility challenges, such as a common tendency to increased particle aggregation as the multiple nanoparticles that are included in the same reaction increases. Analogous challenges using homo-orthogonal detection are exemplified using multiple energy harvesting nano-plasmodic and / or antenna-effect nanoparticles to amplify signals corresponding to multiple amplicons or other target nucleic acid sequences for multiplexing. Accordingly, it is an object of the present invention to go at least some way towards providing a feasible method for multiplex amplification and detection of a plurality of target amplicons or other target nucleic acid sequences that allows for increased sensitivity and / or selectivity of detection of particular amplicons and / or sequences, especially those corresponding to targets amplicons requiring improvements in limit-of-detection (i.e. sensitivity) and / or specificity and / or to at least provide the public with a useful choice. SUMMARY OF THE INVENTION In one aspect, the present invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using an enzymatic detection signal amplification method, AND b) detecting at least one second target amplicon or second nucleic acid sequence using an optical non-enzymatic detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b), wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the method further comprises the multiplex detection of at least one fourth target nucleic acid sequence, wherein the at least one fourth target nucleic acid sequence has not been amplified. In one embodiment the first, second, third and / or fourth target nucleic acid sequences are different from each other. In one embodiment the first, second, third and / or fourth target nucleic acid sequences are different from each other. In one embodiment, the detection signal amplification method in c) is a non-enzymatic optical detection signal amplification method. Another aspect of the invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using a non-enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a distinct non-enzymatic optical detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b) wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In another aspect the invention relates to an assay system for detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, the system comprising: a) reagents for detecting at least one first target amplicon or first target nucleic acid sequence by enzymatic detection signal amplification, b) reagents for detecting at least one second target amplicon or second target nucleic acid sequence by non-enzymatic optical detection signal amplification, and c) optionally, reagents for detecting at least one third target amplicon or third target nucleic acid sequence by enzymatic or non-enzymatic detection signal amplification, wherein the enzymatic or non-enzymatic detection signal amplification is distinct from either a) or b), and wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the assay system further comprises reagents for multiplex detection of at least one fourth nucleic acid sequence, wherein the at least one fourth target nucleic acid sequence has not been amplified. In one embodiment the first, second, third and / or fourth target nucleic acid sequences are different from each other. In one embodiment, the detection signal amplification in c) is a non-enzymatic optical detection signal amplification. Various embodiments of the different aspects of the invention as discussed above are also set out below in the detailed description of the invention, but the invention is not limited thereto. Other aspects of the invention may become apparent from the following description that is given by way of example only and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described with reference to the figures in the accompanying drawings. Figure 1. An alignment of indicative CRISPR targets with compatible LAMP N-Gene amplicons examples. Examples of compatible RT-LAMP primer sets based on those disclosed by Y. Zhang, et al., BioTechniques 69 (2020) (Figure 1a, Figure 1b). For example the ‘Salivision’ N2 primer set corresponds to the primers disclosed in DeFina, et al., Sci Rep- Uk 12 (2022) (Table 2). Figure 2.18S LAMP Primers Mapped onto the Human 18S LAMP Target sequence. F1c + F2 is forward inner primer, F3 is forward outer primer, LF is forward loop primer, LB backward loop primer, B1c+B2 is backward inner primer, B3 is backward outer primer. Target sequence in Bold. Figure 3 – 6-FAM dT modified nucleotide for inclusion in oligonucleotide primers Figure 4 – Influenza A H5 clade 2.3.4.4b primers from Filaire et al.2024 Figure 5 – Influenza A LAMP primers from Takayama et al., 2019 Figure 6 – Influenza B LAMP primers from Heitoff et al., 2022 DETAILED DESCRIPTION OF THE INVENTION Definitions The following definitions are presented to better define the present invention and as a guide for those of ordinary skill in the art in the practice of the present invention. Unless otherwise specified, all technical and scientific terms used herein are to be understood as having the same meanings as is understood by one of ordinary skill in the relevant art to which this disclosure pertains. The term “comprising” as used in this specification and claims means “consisting at least in part of”; that is to say when interpreting statements in this specification and claims which include “comprising”, the features prefaced by this term in each statement all need to be present but other features can also be present. Related terms such as “comprise” and “comprised” are to be interpreted in a similar manner. The term "consisting essentially of" as used herein means the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting of” as used herein means the specified materials or steps of the claimed invention, excluding any element, step, or ingredient not specified in the claim. The term “homo-orthogonal signal amplification” and grammatical variations thereof as used herein refers to amplification of the detection signal that is used to detect at least two different target amplicons or target nucleic acid sequences within a single multiplex nucleic acid amplification and signal detection reaction, wherein amplification of the detection signal for each target is carried out using equivalent detection chemistry as described herein. As an illustrative example, but not limited thereto, the amplified detection signal for a first target amplicon or target nucleic acid sequence may be detection signal that is amplified enzymatically (i.e., an enzymatic detection) or non-enzymatically (i.e., a non-enzymatic detection), and the amplified detection signal for a second target amplicon or target nucleic acid sequence may also be a detection signal that is amplified enzymatically (i.e., an enzymatic detection) or non-enzymatically (i.e., a non-enzymatic detection), as long as the detection signals for both targets are amplified using equivalent chemistry as described herein. Examples of enzymatic and non-enzymatic methods of amplifying a detection signal are described herein and include the methods set out in Table 1. As an illustrative example, of homo-orthogonal signal amplification, but not limited thereto, amplification of the detection signal used to detect both a first and a second target may be by non-enzymatic detection signal amplification that results in a fluorescence signal that is used to detect the two different target nucleic acid sequences, which are then distinguished from one another using distinct emission wavelengths or the same emission wavelengths with distinct excitation. Herein, the term “hetero-orthogonal signal amplification” and grammatical variations thereof refers to amplification of the detection signal used to detect at least two different target amplicons or target nucleic acid sequences within a single multiplex nucleic acid amplification and signal detection reaction wherein amplification of the detection signal for each target is not carried out using equivalent detection chemistry. As an illustrative example, but not limited thereto, the amplified detection signal for a first target amplicon or target nucleic acid sequence may be a detection signal that is amplified enzymatically (i.e., an enzymatic detection) and the amplified detection signal for a second target amplicon or target nucleic acid sequence may be a detection signal that is amplified non-enzymatically (i.e., a non-enzymatic detection). Examples of enzymatic and non-enzymatic methods of amplifying a detection signal are described herein and include the methods set out in Table 1. The term, “target amplification” and grammatical variations thereof as used herein encompasses any means of increasing the number of copies of a target nucleic acid (i.e., increasing the number of copies of a target amplicon) in a multiplex nucleic acid amplification reaction, regardless of whether additional detection signal amplification modalities are also applied to increase the likelihood of detection of an amplified or unamplified target nucleic acid within the reaction. The term “target amplicon” and grammatical variations thereof as used herein means a target nucleic acid sequence that has been amplified in a multiplex nucleic acid amplification reaction, preferably an isothermal multiplex nucleic acid amplification reaction. The term ‘isothermal amplification’ as used herein refers to any nucleic acid amplification technology which operates at a constant temperature and that acts to increase the number of copies of a target nucleic acid sequence, including when acting non-specifically to amplify the total nucleic acid present in a nucleic acid amplification reaction. Isothermal amplification methods include, but are not limited to enzyme-mediated nucleic acid polymerisation approaches such LAMP (Loop medicated Isothermal Amplification), NASBA (Nucleic acid sequence-based amplification, EXPAR (Exponential Amplification Reaction), HDA (Helicase Dependent Amplification), iSDA (Isothermal Strand Displacement Amplification) RCA (Rolling Circle Amplification), RPA Recombinase Polymerase Amplification), MDA (Multiple Displacement Amplification) and TMA (Transcription Mediated ), SMART (Signal Mediated Amplification of RNA Technology), NER (Nicking Extension Amplification Reaction), ICAN (isothermal and chimeric primer-initiated amplification of nucleic acids), PHAMP (Hairpin Assisted Isothermal Amplification) , HDMIA (Hairpin DNA-mediated Isothermal Amplification) CPA (Cross Priming Amplification), SIAM (self-amplification priming hairpin mediated isothermal amplification), PSA (Polymerase Spiral Amplification), SIBA (Strand invasion based amplification), QPA (Quadruplex Priming Amplification), HIP (hinge-initiated primer- dependent amplification), iTPA (Isothermal Chain Amplification)., GEAR (Genome Exponential Amplification Reaction)., DHLA (Dual Hairpin Ligation Induced Isothermal Amplification) SMAP2 (Smart Amplification Process), SATIC (ternary initiation complexes) and isothermal variants of the polymerase chain reactions (PCR). A person of skill in the art recognizes that any number of different isothermal nucleic acid amplification technologies are applicable to methods and assay systems described herein (Olivera, et al., Frontiers Sensors 2, 752600 (2021); Obande, K.K.B. Singh, Infect Drug Resist 13 (2020). Moreover, a person of skill in the art is aware of a range of non-enzymatic forms of isothermal amplification of nucleic acids, including Hybridization Chain Reaction (HCR), Autoligation Chain Reaction (ACR) Catalytic Hairpin Assembly (CHA), and Entropy- Driven Circut (EDC), but not limited thereto. Some of these methods of isothermal amplification typically amplify reporter DNA sequence modules, which are assigned to detect particular target nucleic acid sequences through toehold-mediated strand displacement mechanisms, including cascade mechanisms employing more than one enzyme free amplification approaches in sequence – e.g. CHA followed by HCA, or alternatively CHA followed by HCR, which frequently use nucleic acid aptamers for target recognition allowing detection of protein as well as nucleic acid targets. Accordingly, it is believed that the choice of an appropriate isothermal nucleic acid amplification technique for use in the methods described herein and / or for inclusion in the assay systems described herein can be made by the skilled person as appropriate to amplify nucleic acids in a given sample and / or from a given source. The term “specifically binds” as used herein with reference to an oligonucleotide primer binding a nucleic acid, particularly DNA, means annealing of the specified primer to portions of a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the primer. The degree of complementarity between the nucleic acid and the oligonucleotide primer will normally be determined by the conditions under which they come into contact; that is to say the oligonucleotide primer may bind, and thereby allow the initiation of amplification, to portions of the nucleic acid that are at least partially complementary, preferably fully complementary, across the entire length of the primer, or part thereof. The phrase, “selectively amplifying” as used herein with reference to a nucleic acid, particularly a DNA, means to preferentially replicate, using LAMP, specific target nucleic acid sequences from a sample. Related terms such as “selective amplification” and “selectively amplified” are to be interpreted in a similar manner. The terms, “signal amplification modality” and “detection signal amplification modality” and grammatical variations of either as used herein refer to increasing the detection signal of a target amplicon or target nucleic acid sequence in a multiplex nucleic acid detection assay, regardless of whether the target nucleic acid sequence itself is also amplified by a target nucleic acid sequence amplification approach as defined above, i.e., detection signal amplification relates to increasing the detectable signal per se and is target independent. This means that signal amplification can occur whether the target nucleic acid is amplified prior to detection using the detection signal or not. In some cases, for example, when using FRET or LRET probes with peak emissions in the far red or near infra-red spectral range, amplification of the detectable signal can be achieved, not by increasing absolute signal amplitude per se, but instead by reducing associated background noise, allowing the signal to be distinguished from this background through improved signal / noise ratio. The term, “detection signal amplification” and grammatical variations thereof as used herein refers to the specific and selective amplification of a target nucleic acid sequence, wherein amplification is confirmed using a detectable signal. The term “distinct target nucleic acid sequence” and grammatical variations thereof as used herein refers to a target nucleic acid sequence that has a defined primary nucleic acid sequence which is required for detection of the target sequence and does not include non- specific detection of nucleic acid sequences generally where no primary nucleic acid sequence has been defined. It is intended that reference to a range of numbers disclosed herein (for example 1 to 10) also incorporates reference to all related numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents; or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. Detailed Description Disclosed herein are hetero-orthogonal signal amplification methods that employ a novel approach to enhancing the sensitivity of detection of multiple different target nucleic acid sequences in single multiplexed nucleic acid detection assays. The hetero-orthogonal signal amplification methods disclosed herein operate by combining completely distinct signal amplification methods, employing unrelated signal amplifiers to detect multiple, distinct target nucleic acid sequences. Various non-limiting examples of hetero-orthogonal signal detection are illustrated herein by combining an enzymatic signal amplification method from Table 1, section A with a non-enzymatic signal amplification method from Table 1, section B. As will be appreciated by the skilled worker this means that hetero-orthogonal signal amplification may be carried out by combining any of the methods in A1, A2 or A3 with any of the methods in B1, B2 or B3. Exemplary combinations may include methods combined as follows: A1 + B1, A1 + B2, A1 + B3, A2 + B1, A2 + B2, A2 + B3, A3 + B1, A3 + B2 and A3 + B3. Using these combinations in a hetero-orthogonal method as described herein allows the skilled person to augment the sensitivity of detection of two or more different target nucleic acid sequences from a single isothermal amplification assay, without compromising specific and accelerated assay readouts. The inventors have also determined that the hetero-orthogonal signal amplification methods disclosed herein can operate by combining completely distinct non-enzymatic detection signal amplification methods from Table 1, section B. Again, as will be appreciated by the skilled worker this means that hetero-orthogonal signal amplification may be carried out by combining any of the methods in B1, B2 or B3. Exemplary combinations may include methods combined as follows: B1+B2, B1+B3 or B2+B3. Using these combinations in a hetero-orthogonal method as described herein allows the skilled person to augment the sensitivity of detection of two or more different target nucleic acid sequences arising from a single isothermal amplification assay, without compromising specific and accelerated assay readouts. As used herein the term “single isothermal amplification assay” encompasses isothermal amplification of multiple targets in a single reaction tube or vessel. However, as will be appreciated by the skilled person, a single isothermal amplification assay may also encompass a single assay for multiple target nucleic acid sequences that is performed sequentially where the products of a first multiplex isothermal nucleic acid amplification are used in subsequent isothermal nucleic acid detection assays, where the products of each of the target isothermal amplifications are then detected which arose from a single reaction tube or vessel in parallel or sequentially. Without wishing to be bound by theory, the inventors believe that the use of hetero- orthogonal signal amplification methodology as described herein provides the skilled worker with an effective solution that circumvents the challenges inherent in the multiplex detection of different target nucleic acid sequences using homo-orthogonal approaches, including an increase in design complexity and / or assay cost. One non-limiting example of such a challenge is seen when using CAS based enzymatic homo-orthogonal multiplex detection of different target nucleic acid sequences in a single assay. This methodology requires complex selection of different isoforms of CAS13 (LwaCas13a, CcaCas13b,LbaCas13a and PsmCas13b ) in combination with as12a (Cpf1), in an effort to confer more sequence specificity on the trans-cleavage to distinguish cleavage of different reporter substrates. Skilled artesans are also familiar with complexity introduced by including multiple enzyme free signal amplifiers of a similar kind (taken from column B of Table 1 for example). Such constraints can require complex signal capture and analysis approaches, including but not limited to time resolved fluorescence, photochromic switching energy fluorophores as energy acceptors, or AI powered data transformation approaches to decovolute overlapping signlals. Table 1 – Examples of Enzymatic and Non-Enzymatic Detection Signal Amplifiers The inventors believe that in contrast to other approaches described in the literature, the hetero-orthogonal detection signal amplification methods described here are not reliant on devising new amplification or multiplex detection strategies per se which can increase complexity of detection as more taregets are added. Likewise, the hetero-orthogonal detection signal amplification methods described herein do not comprise simply combining any distinct isothermal amplification chemistries in the same reaction. Rather, hetero- orthogonal signal amplification (also termed signal detection amplification herein) as the examples described herein instead employ a diversity of detection signal amplification modalities on products originally arising from a single multiplex reaction in a hetero- orthogonal approach that provides improved selectivity and / or specificity over known homo- orthogonal multiplex detection approaches, which all employ variations on the same detection signal amplification modality (as the final detection step) to discriminate between the products of multiplexed reactions. This commonly used approach can become more challenging as more targets are detected with the same signal amplifying modality. As described herein, the inventors have combined a plurality of distinct, unrelated signal amplification modalities used in parallel at the ultimate detection layer of a single multiplex amplification reaction, to distinguish detection signals corresponding to different target nucleic acid sequences (which may be target amplicons that amplified in same reaction and / or target nucleic acid sequences that are not amplified in the reaction). This hetero-orthogonal approach overcomes the known limitation of insufficient sensitivity typically observed in multiplexed reactions using homo-orthogonal signal amplification approaches. For example, there is a marked drop in sensitivity observed in many multiplexed reactions (versus that observed in the corresponding independent reactions) such that one or more of the targets can no longer detected with sufficient sensitivity to reliably inform diagnostic decisions (within accepted clinical guidelines). The methods and assay systems described herein do not require the use of more that one distinct target amplification method or set of reagents prior to the use of hetero-orthogonal detection signal amplification approaches which are applied / used to detect each target amplicon or target nucleic acid sequence, regardless of whether a common method is used for initial or concurrent amplification of those target amplicons or sequences. Therefore, if following an initial isothermal target amplification of at least one target, additional isothermal target amplification procedures are employed upstream of the ultimate detection signal amplification steps, the chemistries used in the additional target amplification procedures may be either related or unrelated. Non-limiting examples include where initial amplification of select target nucleic acid sequences is carried out using a LAMP reaction followed by upstream amplification of select target nucleic acid sequences also using LAMP (i.e., related) or alternatively where upstream amplification of select target nucleic acid sequences is carried out using a different amplification chemistry (unrelated) such as HDA or RCA. In either case, multiplex detection of select nucleic acid target sequences is still successfully carried out using a hetero-orthogonal approach as described herein, by employing distinct, unrelated isothermal signal detection chemistries, post-amplification (i.e., downstream) to distinguish the products of each amplified target (i.e., target amplicons). Additionally, in some embodiments the target nucleic acid sequences may be non-amplified nucleic acid sequences present in the multiplex reaction which can also optionally be detected using a signal amplification method as outlined herein. In some embodiments, the signal detection system for at least one of the targets may not itself be amplified, such as in detection of specific products of LAMP reactions using DARQ probes (Tanner, N. A., Zhang, Y. & Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. BioTechniques 53, 81–89 (2012).] or using standard quenched hybridization probes which are not enzymatically cleaved to increase the signal / noise ratio ([ Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse-transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 247–255 (2022) ]. Classes of Hetero-orthogonal Signal Amplification Further, without wishing to be bound by theory, the inventors believe that different classes of homo-orthogonal nucleic acid target amplification modalities can be selected as appropriate for use together with various different combinations of detection signal amplification modalities to provide effective hetero-orthogonal methods of detection and hetero-orthogonal assay systems. Selection of each modality (among groups of both nucleic acid target amplification modalities and among distinct detection signal amplification modalities) will depend on a number of factors which may be unique to the system from which detection of preferred target nucleic acid sequences is required. These combinations of modalities may be judiciously selected to suit different use cases requiring the distinct detection advantages provided by the hetero orthogonal detection signal amplification methods described herein. Enzymatic / Non-Enzymatic amplification of signals corresponding to distinct targets The simplest form of hetero-orthogonal amplification involves multiplex isothermal reactions in which an enzymatic signal amplification modality chosen from A1 – A3 in Table 1, is employed to amplify the detection signal corresponding to a first target amplicon while the detection signal corresponding to a second different target amplicon in the same isothermal reaction is amplified either simultaneously or sequentially using a non-enzymatic detection signal amplification modality chosen from B1 – B3 of Table 1. In a preferred embodiment the non-enzymatic detection signal amplification modality is an optical signal detection modality. This approach is a very good way to overcome the known disadvantages observed when multiplex detection of target nucleic acids is carried out using combinations of equivalent detection signal amplification modalities, i.e., using the same or equivalent detection signal chemistry. The term “equivalent detection signal amplification modalities” and grammatical variations thereof refers to detection signal amplification modalities that are the same in terms of amplification chemistries as disclosed herein. For clarity, the enzymatic detection signal amplification modalities shown in A1, A2 and A3 in Table 1 are considered equivalent detection amplification modalities herein. Likewise, the non-enzymatic detection signal amplification modalities shown in B1, B2 and B3 in Table 1 are considered equivalent detection amplification modalities herein. A) Potential for interference between non-enzymatic optical signal amplification systems In one non-limiting example, when equivalent non-enzymatic optical amplification modalities are employed for detection of different target amplicons then the potential for optical interference (e.g. from signal quenching, cross-talk and / or saturation of detectors) is increased. Mitigating this risk greatly increases the complexity of a multiplex assay and associated detector design, which in turn limits the flexibility of the assay considerably. This is a significant disadvantage of this “homo-orthogonal" detection approach. B) Potential for interference between related enzymatic signal amplification systems. In another non-limiting example, when equivalent enzymatic detection signal amplification modalities are employed to amplify the detection signal arising from two different target amplicons (e.g., variations of CRISPR), then there is increased potential for interference occurring between detection signals. For example, each distinct CRISPR enzyme once activated may trigger collateral cleavage of the sample fluorophore reporter substrates, limiting the potential to distinguish between the targets. Mitigating this risk greatly increases the complexity of multiplex assay design, for example by requiring the choice of different CAS isoforms and / or guide RNAs with distinct specificities, in an effort to minimise cross- reaction. C) Potential for increased complexity in adapting a non-multiplexed assay In another non-limiting example multiple target amplicons and / or nucleic acid target sequences are detected with a non-specific dye such Syto-9 or SybrGreen, to achieve sensitive detection of at least one distinct analyte (target nucleic acid sequences including target amplicons) with high sensitivity in a format allowing discrimination between distinct targets. Accordingly, in a first aspect the present invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using an enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a non-enzymatic optical detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b), wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the method comprises a), b) and c). In one embodiment the detection signal amplification method in c) that is distinct from the method of a) or b) operates using a different chemistry than either a) or b). In one embodiment the method further comprises d), the multiplex detection of at least one fourth target amplicon or target nucleic acid sequence. In one embodiment the first, second, third and fourth target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the at least one second target nucleic acid sequence is an internal control. In one embodiment the at least one second target nucleic acid sequence has not been amplified. In one embodiment the at least one third target nucleic acid sequence is an internal control. In one embodiment the at least one third target nucleic acid sequence has not been amplified. In one embodiment the at least one fourth target nucleic acid sequence is an internal control. In one embodiment the at least one fourth target nucleic acid sequence has not been amplified. In one embodiment the enzymatic detection signal amplification method in a) is selected from the enzymatic detection signal amplification methods set out in A1, A2 or A3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in b) is selected from the non-enzymatic optical detection methods set out in B1, B2 or B3 in Table 1. In one embodiment the method is an enzymatic detection signal amplification method selected from A1, A2 or A3 in Table 1. In one embodiment, the method comprises c) wherein c) comprises an enzymatic detection signal amplification method selected from A1, A2 or A3 in Table 1. In one embodiment the method comprises c) wherein c) comprises a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1. In another embodiment, the method comprises a), b) and e), wherein e) comprises detecting a target analyte using a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1, wherein the target analyte is a different target nucleic acid sequence than any of the target amplicons or target nucleic acid sequences in a), b), c) or d) or is a ligand or a protein. In one embodiment the ligand or protein is an antigen, a hapten or an antibody. In some embodiments the method comprises a), b), c) and e). In some embodiments the method comprises a), b), c), d) and e). The choice of a particular detection signal amplifier modality (i.e., any one of A1-A3 and B1- B3) can be tailored to match the sensitivity required for a given multiplex assay based on a number of factors including the initial copy number of a target nucleic acid, the total amount of nucleic acid available to be amplified in a sample, the selectivity and / or efficiency of amplification primers, or other considerations which may be known to the skilled worker, but not necessarily limited thereto. In one embodiment, the enzymatic detection signal amplification method in a) is a catalytic CRISPR substrate amplification method or a catalytic argonaute substrate amplification method, preferably a catalytic CRISPR substrate amplification method. In one embodiment, the enzymatic detection signal amplification method in a) is a TEC- LAMP or LEC-LAMP. Thus, in one non-limiting example, the most sensitive detection signal amplification modality can be reserved to detect rarely occurring nucleic acid sequences in a sample, such as nucleic acid sequences diagnostic for a desired pathogen, which may be present in lower numbers than the nucleic acid sequences diagnostic for another pathogen which may also be present in the sample and can be detected using a less sensitive detection signal amplification modality. In one non-limiting example, the less sensitive detection signal amplification modality may be a non-enzymatic optical detection signal amplification modality. In one embodiment the non-enzymatic optical detection signal amplification method in b) is iFRET. In one embodiment the non-enzymatic optical detection signal amplification method in b) is a nanoamplified molecular beacon (NAB), preferably where the NAB acts as an FRET energy donor to a distinct energy acceptor probe. In one embodiment the non-enzymatic optical detection signal amplification method in b) is fluorogenic amplified cascaded templated reaction (FACTR). In one embodiment the non-enzymatic optical detection signal amplification method in b) is a nanoparticle-based method exploiting intrinsic luminescent or plasmonic optical properties of nanomaterials, preferably wherein the nanoparticle-based method is luminescence resonance energy transfer (LRET) or surface plasmon (SPs) effects or a combination thereof. Suitable nanomaterials for such detection signal amplification include Quantum Dots (QDs), Upconverting Nanoparticles (UCNPs), gold (AUNPs) and / or organic dye-based NPs and nano-antenna based plasmonic amplifiers, each of which is contemplated as an embodiment of a non-enzymatic optical detection signal amplification method as described herein. In one embodiment the non-enzymatic optical detection signal amplification method in b) is detection of amplification by release of quenching (DARQ), Fluorescence of Loop Primer Upon Self Dequenching (FLOS) or mediator displacement probes (MD) or throught the use of standard quenched hybridization probes [ Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse-transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 235–243 (2022)] including hybridization probes incorporating LNA residues [Li, Z. et al. Extraction-free LAMP assays for generic detection of Old World Orthopoxviruses and specific detection of Mpox virus. Sci. Rep.13, 21093 (2023)]. In one embodiment the non-enzymatic optical detection signal amplification method in c) is iFRET or DARQ or standard quenched hybridization probes. In one embodiment the non-enzymatic detection signal amplification method in c) is a combination of iFRET and DARQ or standard quenched hybridization probes.. In one embodiment the combination of iFRET and DARQ is used in c) to detect two different target amplicons or target nucleic acid sequences. In one embodiment c) comprises enzymatic detection signal amplification of least two target amplicons or nucleic acid target sequences, preferably of at least two different target amplicons or nucleic acid target sequences, preferably wherein enzymatic detection signal amplification of each different target amplicon or nucleic acid target sequence comprises using different enzymatic detection signal amplification methods. In one embodiment enzymatic detection signal amplification comprises two different methods selected from the enzymatic detection signal amplification method examples set out in A1, A2 or A3 in Table 1. In one embodiment the two different enzymatic detection signal amplification methods are CRISPR / Cas and Argonaut. In a second aspect the invention relates to an assay system for detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, the system comprising: a) reagents for detecting at least one first target amplicon or first target nucleic acid sequence by enzymatic detection signal amplification, b) reagents for detecting at least one second target amplicon or second target nucleic acid sequence by non-enzymatic optical detection signal amplification, and c) optionally, reagents for detecting at least one third target amplicon or third target nucleic acid sequence by enzymatic or non-enzymatic detection signal amplification, wherein the reagents in c) are distinct from the reagents in either a) or b), and wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the assay system comprises a), b) and c). In one embodiment the reagents in c) are reagents that operate using a different chemistry than either a) or b). In one embodiment the assay system further comprises d) reagents for the multiplex detection of at least one fourth target amplicon or target nucleic acid sequence. In one embodiment the first, second, third and fourth target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the at least one second target nucleic acid sequence is an internal control. In one embodiment the at least one second target nucleic acid sequence has not been amplified. In one embodiment the at least one third target nucleic acid sequence is an internal control. In one embodiment the at least one third target nucleic acid sequence has not been amplified. In one embodiment the at least one fourth target nucleic acid sequence is an internal control. In one embodiment the at least one fourth target nucleic acid sequence has not been amplified. In one embodiment the reagents in a) are reagents required to carry out enzymatic detection signal amplification following the methods set out in A1, A2 or A3 in Table 1. In one embodiment reagents in b) are reagents required to carry out enzymatic detection signal amplification following the methods set out in B1, B2 or B3 in Table 1. In one embodiment the reagents in c) are reagents that are required to carry out a non- enzymatic detection signal amplification following a method selected from B1, B2 or B3 in Table 1. In one embodiment the reagents in c) are reagents that are required to carry out an enzymatic detection signal amplification following a method selected from A1, A2 or A3 in Table 1. In another embodiment, the assay system comprises a), b) and e), wherein e) are reagents required for detecting a target analyte using a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1, wherein the target analyte is a different target nucleic acid sequence than any of the target amplicons or target nucleic acid sequences in a), b), c) or d) or is a ligand or a protein. In one embodiment the ligand or protein is an antigen, a hapten or an antibody. In some embodiments the assay system comprises a), b), c) and e). In some embodiments the assay system comprises a), b), c), d) and e). In some embodiments the assay system is a kit comprising a), b), c), d) and e) or any combination thereof comprising at least a) and b), wherein the kit is comprised in a package that is arranged to required the addition of a), b), c), d) and / or e) to a single vessel multiplex nucleic acid and signal detection amplification reaction in a defined order. The choice of reagents for a particular detection signal amplifier modality (i.e., any one of A1- A3 and B1-B3) can be tailored to match the sensitivity required for a given multiplex assay based on a number of factors including the initial copy number of a target nucleic acid, the total amount of nucleic acid available to be amplified in a sample, the selectivity and / or efficiency of amplification primers, or other considerations which may be known to the skilled worker, but not necessarily limited thereto. In one embodiment a) comprises the reagents to carry out a catalytic CRISPR substrate amplification method or a catalytic argonaut substrate amplification method, preferably a catalytic CRISPR substrate amplification method. In one embodiment a) comprises the reagents to carry out a TEC-LAMP or LEC-LAMP substrate amplification method, preferably a LEC-LAMP amplification method. In one non-limiting example, the assay system is configured so that the most sensitive detection signal amplification modality is reserved to detect rarely occurring nucleic acid sequences in a sample, such as nucleic acid sequences diagnostic for a desired pathogen, which may be present in lower numbers than the nucleic acid sequences diagnostic for another pathogen which may also be present in the sample and can be detected using a less sensitive detection signal amplification modality. In one non-limiting example, the less sensitive detection signal amplification modality may be a non-enzymatic optical detection signal amplification modality. In one embodiment b) comprises the reagents required to carry out detection signal amplification using iFRET. In one embodiment b) comprises the reagents required to carry out detection signal amplification by a nanoamplified molecular beacon as an FRET energy donor to a distinct energy acceptor probe. In one embodiment b) comprises the reagents required to carry out detection signal amplification by fluorogenic amplified cascaded templated reaction (FACTR). In one embodiment b) comprises the reagents required to carry out detection signal amplification by a nanoparticle-based method exploiting intrinsic luminescent or plasmonic optical properties of nanomaterials, preferably wherein the nanoparticle-based method is luminescence resonance energy transfer (LRET) or surface plasmon (SPs) effects or a combination thereof. Suitable reagents for using such nanomaterials for such detection signal amplification include Quantum Dots (QDs), Upconverting Nanoparticles (UCNPs), gold (AUNPs) and / or organic dye-based NPs and nano-antenna based plasmonic amplifiers may be included in the assay system in b), wherein inclusion of each is contemplated as an embodiment of an assay system as described herein. In some embodiments, the reagents in c) comprise the reagents required for non-enzymatic optical detection signal amplification using detection of amplification by release of quenching (DARQ), Fluorescence of Loop Primer Upon Self Dequenching (FLOS) or mediator displacement probes (MD). In one embodiment the reagents in c) comprise the reagents for iFRET or DARQ. In one embodiment the reagents in c) comprise the reagents for iFRET and DARQ. In one embodiment the reagents iFRET and DARQ reagents in c) are used to detect two different target amplicons or target nucleic acid sequences. In one embodiment the assay system comprises reagents for d), the multiplex detection of at least two target amplicons or nucleic acid target sequences using enzymatic detection signal amplification wherein the reagents that belong to entirely distinct enzymatic classes and mediate enzymatic detection signal amplification of two different target amplicons or target nucleic acid sequences. In one embodiment c) comprises reagents for enzymatic detection signal amplification of least two target amplicons or nucleic acid target sequences, preferably of at least two different target amplicons or nucleic acid target sequences, preferably wherein the enzymes used for enzymatic detection signal amplification of each different target amplicon or nucleic acid target sequence are different from each other. In one embodiment reagents in c) are reagents required to carry out enzymatic detection signal amplification following the methods set out in B1, B2 or B3 in Table 1. In one embodiment reagents in c) are reagents required to carry out CRISPR / Cas and Argonaut enzymatic detection signal amplification. In another aspect the invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in sequential multiplex isothermal nucleic acid amplification reactions, wherein the method comprises: a) amplifying at least one first target amplicon or first target nucleic acid sequence in a first isothermal nucleic acid amplification reaction, b) transferring at least part of the first isothermal nucleic acid amplification reaction in a) to a second isothermal nucleic acid amplification reaction, and c) detecting in b) i) the at least one first target amplicon or first target nucleic acid sequence from a) using an enzymatic or non-enzymatic optical detection signal amplification method and ii) at least one second target amplicon or second nucleic acid sequence using an enzymatic or non-enzymatic optical detection signal amplification method in a second isothermal nucleic acid amplification reaction, wherein the method optionally comprises d) detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either b),i) or b),ii). wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other, and wherein detecting i) and i) in c) is done using different non- enzymatic optical detection signal amplification methods. In one embodiment the method comprises a), b) and c). In one embodiment the isothermal amplification method in a) and b) operate using different chemistry. In one embodiment the isothermal amplification method in a) comprises the use of LAMP. In one embodiment the LAMP reaction in a) comprises some or all of the steps and primers set out in example 10. In one embodiment the isothermal amplification method in b) comprises the use of CRISPR. In one embodiment the CRISPR reaction in b) comprises some or all of the steps or primers set out in example 10. In one embodiment detecting in c), i) operates using a different chemistry than c), ii). In one embodiment detecting in d) operates using a different chemistry than in c), i) or c), ii). In one embodiment the method further comprises d), the multiplex detection of at least one fourth target amplicon or target nucleic acid sequence. In one embodiment the first, second, third and fourth target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the at least one second, third or fourth target nucleic acid sequence is an internal control. In one embodiment the at least one second, third or fourth target nucleic acid sequence has not been amplified. In one embodiment the enzymatic detection signal amplification method in a) is selected from the enzymatic detection signal amplification methods set out in A1, A2 or A3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in c), i) or c), i) or both is selected from the non-enzymatic optical detection methods set out in B1, B2 or B3 in Table 1. In one embodiment the enzymatic detection signal amplification method in d) selected from A1, A2 or A3 in Table 1. In another embodiment, the method comprises a), b) and e), wherein e) comprises detecting a target analyte using a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1, wherein the target analyte is a different target nucleic acid sequence than any of the target amplicons or target nucleic acid sequences in a), b), or d) or is a ligand or a protein. In one embodiment the ligand or protein is an antigen, a hapten or an antibody. In some embodiments the method comprises a), b), d) and e). In some embodiments the method comprises a), b), c), d) and e). The choice of a particular detection signal amplifier modality (i.e., any one of A1-A3 and B1- B3) can be tailored to match the sensitivity required for a given multiplex assay based on a number of factors including the initial copy number of a target nucleic acid, the total amount of nucleic acid available to be amplified in a sample, the selectivity and / or efficiency of amplification primers, or other considerations which may be known to the skilled worker, but not necessarily limited thereto. In one embodiment, the enzymatic detection signal amplification method in c), i) is an autocatalytic CRISPR substrate amplification method or a catalytic argonaute substrate amplification method, preferably an autocatalytic CRISPR substrate amplification method. In one embodiment detection of the amplified CRISPR substrate is by FRET. In one embodiment the non-enzymatic optical detection signal amplification method in c), ii) is detection of a quenched hybridization probe. In one embodiment the quenched hybridization probe comprises Cy5. Thus, in one non-limiting example, the most sensitive detection signal amplification modality can be reserved to detect rarely occurring nucleic acid sequences in a sample, such as nucleic acid sequences diagnostic for a desired pathogen, which may be present in lower numbers than the nucleic acid sequences diagnostic for another pathogen which may also be present in the sample and can be detected using a less sensitive detection signal amplification modality. In one non-limiting example, the less sensitive detection signal amplification modality may be a non-enzymatic optical detection signal amplification modality. In one embodiment the non-enzymatic optical detection signal amplification method in c), i) or c), ii) or both is iFRET. In one embodiment the non-enzymatic optical detection signal amplification method in c), i) or c), ii) or both is a nanoamplified molecular beacon. In one embodiment the nanoamplified molecular beacon is a quantum dot. In another embodiment the nanoamplified molecular beacon is a pyrene tethered hybridization probe employed in combination with an adjacent fluorophore acceptor probe. In one embodiment the non-enzymatic optical detection signal amplification method in c), i) or c), ii) or both is fluorogenic amplified cascaded templated reaction (FACTR). In one embodiment the non-enzymatic optical detection signal amplification method in c), i) or c), ii) or both is a nanoparticle-based method exploiting intrinsic luminescent or plasmonic optical properties of nanomaterials, preferably wherein the nanoparticle-based method is luminescence resonance energy transfer (LRET) or surface plasmon (SPs) effects or a combination thereof. Suitable nanomaterials for such detection signal amplification include Quantum Dots (QDs), Upconverting Nanoparticles (UCNPs), gold (AUNPs) and / or organic dye-based NPs and nano-antenna based plasmonic amplifiers, each of which is contemplated as an embodiment of a non-enzymatic optical detection signal amplification method as described herein. In one embodiment the non-enzymatic optical detection signal amplification method in c), i) or c), ii) or both is detection of amplification by release of quenching (DARQ), Fluorescence of Loop Primer Upon Self Dequenching (FLOS) or mediator displacement probes (MD) or throught the use of standard quenched hybridization probes [ Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse-transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 235–243 (2022)] including hybridization probes incorporating LNA residues [Li, Z. et al. Extraction-free LAMP assays for generic detection of Old World Orthopoxviruses and specific detection of Mpox virus. Sci. Rep.13, 21093 (2023)]. In one embodiment the non-enzymatic optical detection signal amplification method in d) is iFRET or DARQ or standard quenched hybridization probes or unquenched hybridization probes employing adjacent hybridization probes as FRET donors. In one embodiment the non-enzymatic detection signal amplification method in d) is a combination of iFRET and DARQ or standard quenched hybridization probes or unquenched hybridization probes employing adjacent hybridization probes as FRET donors. In one embodiment the combination of iFRET and DARQ is used in d) to detect two different target amplicons or target nucleic acid sequences. In another embodiment the non-enzymatic detection signal amplification method is FACTR. In another embodiment the non-enzymatic detection signal amplification method employs DNA probe-tethered intercalating dyes as FRET donors or acceptors. In another embodiment the non-enzymatic detection signal amplification method employs DNA probe-tethered excimer dyes as FRET donors to distinct acceptor probes. In another embodiment one of the unquenched hybridization probes involves tethered intercalator dye molecules as FRET donors In another embodiment one of the unquenched hybridization probes involves a tethered excimer dyes as FRET donors. In one embodiment d) comprises enzymatic detection signal amplification of least two target amplicons or nucleic acid target sequences, preferably of at least two different target amplicons or nucleic acid target sequences, preferably wherein enzymatic detection signal amplification of each different target amplicon or nucleic acid target sequence comprises using different enzymatic detection signal amplification methods. In one embodiment enzymatic detection signal amplification comprises two different methods selected from the enzymatic detection signal amplification method in c), i) or c), ii) or both, or d) is as set out in A1, A2 or A3 in Table 1. In another aspect the present invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences from a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using a non-enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a non-enzymatic optical detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b), wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the method comprises a), b) and c). In one embodiment the detection signal amplification method in c) that is distinct from the method of a) or b) operates using a different chemistry than either a) or b). In one embodiment the method further comprises d), the multiplex detection of at least one fourth target amplicon or target nucleic acid sequence. In one embodiment the first, second, third and fourth target amplicons and / or target nucleic acid sequences are different from each other. In one embodiment the at least one second, third or fourth target nucleic acid sequence is an internal control gene. In one embodiment the at least one second, third or fourth target nucleic acid sequence has not been amplified. In one embodiment the non-enzymatic detection signal amplification method in a) or b) is selected from the non-enzymatic optical detection methods set out in B1, B2 or B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B1 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B2 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in b) is selected from B1 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in b) is selected from B2 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in b) is selected from B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) and b) is selected from B1 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) and b) is selected from B2 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) and b) is selected from B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B1 and in b) is selected from B2 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B1 and in b) is selected from B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B2 and in b) is selected from B2 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B2 and in b) is selected from B3 in Table 1. In one embodiment the non-enzymatic detection signal amplification method in a) is selected from B3 and in b) is selected from B3 in Table 1. In one embodiment the method is an enzymatic detection signal amplification method in c) selected from A1, A2 or A3 in Table 1. In one embodiment, the method comprises c) wherein c) comprises an enzymatic detection signal amplification method selected from A1, A2 or A3 in Table 1. In one embodiment the method comprises c) wherein c) comprises a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1. In another embodiment, the method comprises a), b) and e), wherein e) comprises detecting a target analyte using a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1, wherein the target analyte is a different target nucleic acid sequence than any of the target amplicons or target nucleic acid sequences in a), b), c) or d) or is a ligand or a protein. In one embodiment the ligand or protein is an antigen, a hapten or an antibody. In some embodiments the method comprises a), b), c) and e). In some embodiments the method comprises a), b), c), d) and e). The choice of a particular detection signal amplifier modality (i.e., any one of A1-A3 and B1- B3) can be tailored to match the sensitivity required for a given multiplex assay based on a number of factors including the initial copy number of a target nucleic acid, the total amount of nucleic acid available to be amplified in a sample, the selectivity and / or efficiency of amplification primers, or other considerations which may be known to the skilled worker, but not necessarily limited thereto. In one embodiment, the enzymatic detection signal amplification method in d) is a catalytic CRISPR substrate amplification method or a catalytic argonaute substrate amplification method, preferably a catalytic CRISPR substrate amplification method. In one embodiment, the enzymatic detection signal amplification method in d) is a TEC- LAMP or LEC-LAMP. Thus, in one non-limiting example, the most sensitive detection signal amplification modality can be reserved to detect rarely occurring nucleic acid sequences in a sample, such as nucleic acid sequences diagnostic for a desired pathogen, which may be present in lower numbers than the nucleic acid sequences diagnostic for another pathogen which may also be present in the sample and can be detected using a less sensitive detection signal amplification modality. In one non-limiting example, the less sensitive detection signal amplification modality may be a non-enzymatic optical detection signal amplification modality. In one embodiment the non-enzymatic optical detection signal amplification method in a) or b) or both is iFRET. In one embodiment the non-enzymatic optical detection signal amplification method in a) or b) or both is a nanoamplified molecular beacon. In one embodiment the non-enzymatic optical detection signal amplification method in a) or b) or both is fluorogenic amplified cascaded templated reaction (FACTR). In one embodiment the non-enzymatic optical detection signal amplification method in a) or b) or both is a nanoparticle-based method exploiting intrinsic luminescent or plasmonic optical properties of nanomaterials, preferably wherein the nanoparticle-based method is luminescence resonance energy transfer (LRET) or surface plasmon (SPs) effects or a combination thereof. Suitable nanomaterials for such detection signal amplification include Quantum Dots (QDs), Upconverting Nanoparticles (UCNPs), gold (AUNPs) and / or organic dye-based NPs and nano-antenna based plasmonic amplifiers, each of which is contemplated as an embodiment of a non-enzymatic optical detection signal amplification method as described herein. In one embodiment the non-enzymatic optical detection signal amplification method in a) or b) or both is detection of amplification by release of quenching (DARQ), Fluorescence of Loop Primer Upon Self Dequenching (FLOS) or mediator displacement probes (MD) or throught the use of standard quenched hybridization probes [ Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse-transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 235–243 (2022)] including hybridization probes incorporating LNA residues [Li, Z. et al. Extraction-free LAMP assays for generic detection of Old World Orthopoxviruses and specific detection of Mpox virus. Sci. Rep.13, 21093 (2023)]. In one embodiment c) comprises non-enzymatic detection signal amplification of the at least one third target amplicon or target nucleic acid sequence. In one embodiment the non-enzymatic optical detection signal amplification method in c) is iFRET or DARQ or standard quenched hybridization probes. In one embodiment the non-enzymatic detection signal amplification method in c) is a combination of iFRET and DARQ or standard quenched hybridization probes.. In one embodiment the combination of iFRET and DARQ is used in c) to detect two different target amplicons or target nucleic acid sequences. In one embodiment c) comprises enzymatic detection signal amplification of least two target amplicons or nucleic acid target sequences, preferably of at least two different target amplicons or nucleic acid target sequences, preferably wherein enzymatic detection signal amplification of each different target amplicon or nucleic acid target sequence comprises using different enzymatic detection signal amplification methods. In one embodiment enzymatic detection signal amplification in c) comprises two different methods selected from the enzymatic detection signal amplification method examples set out in A1, A2 or A3 in Table 1. In one embodiment the two different enzymatic detection signal amplification methods are CRISPR / Cas and Argonaut. In another aspect the present invention relates to a method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences from a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a non-enzymatic optical detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b), wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodimemt, non-enzymatic detection signal amplification in a) or b) or both is by TEC-LAMP or LEC-LAMP. Specific reference to the examples disclosed herein is made. Specifically contemplated as further embodiments of this aspect of the invention are all the embodiments set forth in the first aspect of the invention. In another aspect the invention relates to an assay system for detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, the system comprising: a) reagents for detecting at least one first target amplicon or first target nucleic acid sequence by enzymatic or non-enzymatic detection signal amplification, b) reagents for detecting at least one second target amplicon or second target nucleic acid sequence by non-enzymatic optical detection signal amplification, and c) optionally, reagents for detecting at least one third target amplicon or third target nucleic acid sequence by enzymatic or non-enzymatic detection signal amplification, wherein the reagents in c) are distinct from the reagents in either a) or b), and wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other. In one embodimemt, the reagents in a) or b) or both allow for non-enzymatic detection signal amplification by TEC-LAMP or LEC-LAMP. Specific reference to the examples disclosed herein is made. Specifically contemplated as embodiments of this aspect of the invention are all the embodiments set forth in the second aspect of the invention. The invention will now be illustrated in a non-limiting way by reference to the following examples. While the examples should be considered non-limiting, the skilled worker appreciates that further embodiments of the invention specifically contemplated as embodiments of any of the aspects of the invention set forth above are to be found in the details set forth in the following examples. EXAMPLES Example 1 – CRISPR detection of amplified products of the N gene of SARS-CoV-2 Design of NanoCircle CRISPR probes for detection of RT-LAMP amplicons from within the SARS-CoV02 N-gene amplification reaction. The first indicative target sequence in this example is derived from part of the N-FIP amplicon (but not overlapping with the FIP primers themselves), of common N-gene amplicons SARS-CoV02 LAMP reactions as in (Y. Zhang, et al., Enhancing colorimetric loop- mediated isothermal amplification speed and sensitivity with guanidine chloride, BioTechniques 69 (2020) 178–185. (https: / / doi.org / 10.2144 / btn-2020-0078) Note additional sequences following the 14-mer target are shown to provide more sequence context (in brackets without bold font and can be included in the ssDNA linker): CRISPR TARGET SEQUENCE 1: GCCCCCAGCGCTTC (SEQ ID NO: 1) CRISPR TARGET SEQUENCE 1 with linkers included: ATTTGCCCCCAGCGCTTC (AGCG) (SEQ ID NO: 2) Method steps: • Set up a 20 microlitre reaction to amplify genomic material from SARS-CoV2 essentially using the “Salivision” method and primers (Table 2) disclosed by DeFina, et al., Sci Rep-Uk 12 (2022) (Figure 1a-b). • Include the CRISPR-Cas12 components essentially as described by Deng, Y. et al, Nat. Commun.15 (2024). • Include the following guide RNA sequence designed to recognize a PAM sequence within this N-gene amplicon (Table 3). Table 2 – influenza B LAMP primers TGCGGCCAATGTTTGTAATCAGAAAACCAAGGAAATTTGGGGAC Table 3 – Guide RNA sequence Name gRNA sequence Description • Label the NanoCircle reporter with Cy5 fluorophore and BH2Q quencher incorporated. • Add the sample to the reaction. • Perform the LAMP amplification reaction and the CRISPR signal detection concurrently or sequentially at 60°C (and optionally at 30-40°C), for up to 30 minutes. • Readout the amplified CRISPR detector signal corresponding to the N-gene using excitation at 650nm and emission at 670nM using a narrow band filter set (e.g. orange light excitation 640 / 30nm and deep red emission 690 / 50nm) for detection. Example 2 –Multiplex Detection of Influenza A / B using optical iFRET and DARQ FRET signal amplification probes • Set up a 20 microlitre LAMP reaction to amplify influenza A and / or B essentially according to Takayama et al., 2019 and Heithoff, et al., 2022, respectively. • Design unquenched iFRET probes by labelling the 5’ end of FIP / BIP and / or the Loop primers corresponding to the Flu A amplicon with the ATTO647N or the Cy5 deep red fluorophores. Design a quenched DARQ probe specific for the Flu B amplicon by labelling the loop primer corresponding to the 5’ end of FIP / BIP or loop primers for Flu B amplicons with the near infrared Texas Red fluorophore, quenched with a complementary displacement DARQ probe labelled with BH2 quencher. • Add the sample to the reaction. • Perform the FluA / B LAMP amplification reaction of example –1) but containing a Syto-9 fluorophore at a concentration of 250nM or an EvaGreen Plus fluorophore dye at a concentration of 300 nM to 1000 nM. • Readout the iFRET detector signal corresponding to the far red FluA label fluorophore (ATTO547N or Cy5) but using indirect blue light 470nm excitation and emission at 670nM, using a narrow band filter set (e.g. Excitation 470 / 30nm and deep red filter (e.g. emission 690 / 50nm) for detection. • Readout signal corresponding to the Texas Red flurophore corresponding to DARQ detection of Flu B amplicons using the filters for excitation centred on 595 nm and and emission filter centred on 615 nm, to maximise discrimination between orange / red and far red channels. • Simultaneously readout of amplicons corresponding to internal control primer sets to ensure the presence of sample read under excitation using a narrow band filter set with blue light excitation (e.g. Excitation 470 / 30nm and detecting green emission at 520 / 20nm corresponding to intercalating Eva Green or Syto-9 dye bound to double stranded amplicons (informative in the absence of amplification signals in the specific far-red or near infrared channels - eg. detecting LAMP probes corespoinding to the 18S rRNA, beta actin or the RNse P internal control genes). Example 3- Example of multiplex hetero-orthogonal detection of SARS-CoV02 and Influenza A / B using and enzymatically amplified CRISPR signal and optically amplified non-specific Syto-9 / EvaGreen signal together with interpretation via Boolean logic In this example multiplexed signals allowing the identification of two target amplicons in a combined SARS-CoV02 / Influenza A / B RT-LAMP assay are detected using: a. NanoCircle CRISPR amplification to detect the SARS-CoV2 N-gene amplicon (i.e. deep red signal in Channel A – e.g. Cy5) with Boolean logic interpretation of the non- specific green Syto-9 / EvaGreen signal used to infer the presence or absence of Influenza amplicon. Note this particular hetero-orthgonal assay can only be performed in the absence of an internal control LAMP primer set, the amplified product of which would be detected in the presence of sample, regardless of the presence or absence of amplification of SARS-CoV2 or Influenza A / B. Method: 1. Set up assay for LAMP CRISPR detection of amplified products of the N gene gene of SARS-CoV-2 as described in example 1 above. 2. Combine with the LAMP reaction to amplify influenza A and / or B essentially according to Takayama et al., (2019) and Heithoff, et al., (2022), respectively but only including unlabeled influenza LAMP primers. 3. Include EvaGreen Plus dye (preferably at a concentration of between 300nM to 900nM) or Syto-9 dye, preferably at a 250 nM concentration. 4. Add the sample to the reaction. 5. Incubate at 60°C for up to 30 minutes. 6. Detect the presence of CRISPR-amplified detection of SARS-CoV2 amplicons using the far red Cy5 channel (as outlined in example 1 above). 7. Detect presence of either amplicon (resulting from SARS-CoV2 and / or Influenza amplification) using the EvaGreen or Syto-9 intercalating dye (green signal in EvaGreen / Syto-9 channel). 8. Using ‘B NOT A’ Boolean logic to distinguish the presence of amplicons only from influenza (only green signal is detected in the absence of any red signal). Note that unlike some other examples outlined below, this particular embodiment of the invention does not allow detection of (rare) 2 target events of coinfection with both SARS-CoV2 AND influenza (i.e ‘A’ AND ‘B’ Boolean logic) in a way which can be be distinguished from detection of either amplicon (i.e ‘A’ OR ‘B’ Boolean logic) Example 4 – Multiplex detection of SARS-CoV02 and Influenza using an enzymatically amplified CRISPR signal and iFRET / DARQ In this example multiplexed signals allowing the identification of two target amplicons in a combined SARS-CoV02 / Influenza / RT-LAMP assay are detected as follows: a. Using NanoCircle CRISPR amplification to detect the first (SARS-CoV02) N-gene amplicon (e.g. signal detected in a first deep red channel A – e.g. Cy5) according to example 1 and 2 above. b. Using non-enzymatic iFRET and DARQ to detect the products of FluA and FluB respectively (according to example 2 above). Method 1. Set up assay for LAMP / CRISPR detection of amplified products of the N-gene of SARS-CoV-2 as described in example 1 above. 2. Combine with LAMP reaction set up to amplify influenza A and / or B essentially according to Takayama et al., (2019) and Heithoff, et al., (2022), respectively, but including labelled probes for FluA (iFRET) and FluB (DARQ) as outlined in example 2 above. 3. Include EvaGreen Plus dye (at a concentration of 300 nM to 1000 nM) or alternatively Syto-9 dye at 250 nM to 500 nM concentration. 4. Add Sample to Reaction 5. Incubate at 60°C for up to 30 minutes. b. Detect the presence of CRISPR-amplified detection of SARS-CoV2 amplicons using the deep red Cy5 channel under orange excitation light (as outlined in example 1 above). c. Detecting the presence of Influenza A LAMP amplicons using a ATTO647N probe excited by the iFRET from nearby intercalated dye (e.g. EvaGreen Plus or Syto-9), with the FRET signal detected under blue excitation in a second (red) Channel (distinguished from the Cy5 CRISPR readout requiring orange rather than blue excitation). d. Detecting the presence of Influenza B LAMP amplicons using a Texas Red labelled DARQ probe detected in a third (Texas Red) channel excited under amber excitation. e. Detecting the presence of both SARS-CoV02 and Influenza A LAMP products together in the same reaction (signals detected in the red channel and far red channels – ie. from both products directly from Cy5 and indirectly from FRET excited ATTO-647N, under sequential orange and blue light excitation, respectively). f. Detecting presence or absence of LAMP products from an internal control signal (using detection of EvaGreen Plus or Syto-9 of internal-control amplicons in the FAM channel C) under blue light excitation, in cases where no signal is observed in any of the specific (Atto647N, Cy5 or the Texas Red channels, providing reassurance of integrity of the sample collection, extraction and / or the lack of sample inhibition of the reaction. Applicable internal control amplicons known to those skilled in the art include those arising from isothermal amplification of target housekeeping genes and / or multicopy genes, such as as beta-actin or the 18S rRNA gene, exemplified by primer sets disclosed by Marino, et al., (2022) and by Zhang, Y. et al.2020, respectively. Example 5 – Catalytic, non-enzymatic optical signal enhancement of internal control. In this non-limiting example, the assay is carried out in the absence of an intercalating dye such as EvaGreen Plus or Syto-9, as alternative approach is used instead for specific detection of the internal control gene in the an orange channel which is useful to exclude the possibility that insufficient sample was added to the assay, in the absence of a signal in the specific channel. The strategy described herein exploits the high target copy number of chosen internal control genes (such as the 18S rDNA cluster in this example, which is present in many hundreds of copies per mammalian genome) allowing robust detection In this case amplified detection of the presence of the 18S rDNA control gene will be via hetero-orthogonal molecular beacon strand displacement of a probe linked to the FRET donor Pyrene transferring energy via FRET to an adjacent hybridization probe resulting in an orange signal in Channel B) a. Using NanoCircle CRISPR amplification to detect the first (SARS-CoV02) N-gene AMP amplicon (e.g. signal detected in first deep red channel A – eg. Cy5). b. Detection of Influenza amplicons a ROX-based DARQ displacement probe in a second channel – e.g. Channel B via an orange signal under yellow excitation. c. Detection of 18S rDNA internal control gene also in the distinct, hetero-orthogonal non-enzymatic strand displacement assay amplified by excimer conjugated molecular beacon detected by endpoint detection of signal in a third orange Channel B but distinguished from scenario ‘b’ (where Channel B is also orange), comparing detection of the 18S probe under UV illumination at 350 nm between the beginning and end of the incubation period. Note that detection of internal control signal is only pertinent in cases where no amplification of either specific target is observed in either ‘a’ or ‘b’ channels respectively, or order to exclude the absence of sufficient sample in the reaction as a possible cause of lack of amplification. Example 6 –Enzymatic detection of H5N1 influenza A in the first channel using LEC- LAMP and / or non-enzymatic signal detection of an 18S internal control LAMP amplicon in the Second Channel and / or detection of influenza B in the third channel. A variety of enzyme-based approaches to amplify signal / noise ratios in isothermal assays include FARPA [ Ma, Y. et al. FEN1-aided recombinase polymerase amplification (FARPA) for one-pot and multiplex detection of nucleic acids with an ultra-high specificity and sensitivity. Biosens. Bioelectron.237, 115456 (2023) and MERT; Wang, Y. et al. Multiple Endonuclease Restriction Real-Time Loop-Mediated Isothermal Amplification A Novel Analytically Rapid, Sensitive, Multiplex Loop-Mediated Isothermal Amplification Detection Technique. J. Mol. Diagn.17, 392–401 (2015)]. LEC-LAMP (Loop-primer endonuclease cleavage) [Higgins et al.2020], is a target-specific LAMP signal detection technology exploits allelic specificity of endonuclease IV cleavage of sequences surrounding an abasic site to detect one or more amplicon targets wth amplified signal / noise ratios. In some embodiments contemplated herein the enzyme-based approaches to amplify signal / noise ratios in isothermal assays include FARPA or MERT. In this example, LEC-LAMP is used to detect amplicons of the LAMP assay for H5N1 highly pathogenic clades of avian influenza A essentially as described by Filaire et al 2024. The LEC-LAMP probe below is based on the LB loop primer described by Filaire et al., 2024 (Figure 4), but includes a quencher at its 5' terminus, and an internal ATTO490LS fluorophore label separated by an internal C3 spacer as shown below (SEQ ID NO: 4). When this oligonucleotide as annealed to its cognate H5N1 target amplicon surrounding the abasic site, it becomes a substrate for cleavage by the AP-endonuclease Endonuclease IV (NEB) , which removes the quencher residue resulting in amplified fluorescence signal. 5’-EBQ / BHQ2* GGG(Spacer#)AAdT(ATTO490LS)GCCCCAAATACGTGA-3’ (SEQ ID NO: 10) *Quencher (can be either EQB or BHQ2) #Internal spacer can be Int-C3 spacer ATTO490LS is a long stokes shift dye which is excited by 480 nm blue light and emits red light with a peak of around 660 nm.#’C3’ denotes a synthetic 3 carbon spacer available as a phosphoramidite for incorporation into oligo synthesis. Note that an internal C3 residue is recognized as an abasic site for cleavage by endonuclease IV (Takeshita et al.1987). Method 1. Set up LAMP reaction to amplify influenza A H5 clade 2.3.4.4b essentially according to Filaire et al., 2024 and / or standard influenza A / B essentially according to Takegawa et al (2019) and Heithoff, et al., Jama Netw Open 5 (2022) but including labelled probes for H5N1 FluA (LEC-LAMP) and Influenza B (DARQ) - as outlined in example 2 above, but with the hybridization probe for influenza B being labelled in this case with the fluorophore ROX, and the DARQ quencher oligonucleotide labelled with BHQ-2 accordingly. 2. Include promers specific for 18SrRNA gene in the LAMP reaction as outlined in step 5 below). Primer sequences and locations as shown in Table 4 and Figure 2. 3. Include the endonuclease IV enzyme in the LAMP reaction as described by Higgins et al., 2020. 4. Add the sample to the reaction. 5. Incubate at 65°C for up to 30 minutes. 6. Detect the presence of H5N1 amplicons in RED channel using enzymatic LEC-LAMP amplification to detect the first (H5N1) amplicon (e.g. signal detected in first deep red channel). 7. Detection of 18S rDNA internal control gene amplicons via unquenching a FAM-based probe in a second channel – e.g. Channel B via a green signal, upon the probe annealing to the the target amplicon. 8. Detecting the presence of Influenza B LAMP amplicons using a 5-ROX DARQ probe detected in a third (orange) channel under a syellow excitation. As with example 5 and 6 above, this assay is carried out in the absence of an intercalating dye such as EvaGreen Plus or Syto-9, as the FAM channel is instead dedicated for specific detection of the internal control gene which is useful in the absence of a signal in the specific channel, to exclude the possibility that insufficient sample was added to the assay. However in this case (as opposed to the previous example) non-enzymatic specific signal amplification of LAMP amplified 18S rDNA control genes is achieved via unquenching upon hybridization of a non-extendable probe targeting the 18S LAMP amplicon below. Table 4 – Human 18s LAMP primers Primer Name Sequence 18S-rRNA-BIP GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG Example 7 – Detection of of H5N1 influenza A in the first channel using quantum dot amplified LB LAMP primer with non-enzymatic signal detection of an 18S internal control LAMP amplicon in the Second Channel and enzymatic detection of other clades of influenza A in the third channel using enzymatic LEC-LAMP. H5N1 specific probe In this case the LAMP probe below is also based on a modified LB primer, essentially as described by Filaire et al., 2024 (Figure 4), but being 3’ extended, including an unquenched internal atto647N fluorophore label as shown below. 5’- *GGGAATGCCCCAAATACGdT(Atto-647N)GA-3’ (SEQ ID NO: 10) Atto647N is a red dye normally excited by orange light which emits with a broad peak of around 670 nm. However, in this case the fluorophore can be excited by FRET via a biotinylated upstream hybridization probe labelled with QD625 Streptavidin (ThermoFisher / Molecular Probes™ Q22063) which is itself excited by 488 nm blue light. Quantum Dot Amplifier Probe: QD625-GTCAACCAAGTTGGTCCTTGCG-(3’Blocked) (SEQ ID NO: 18) Note: The 3’ end of this hybridization probe is ‘blocked’ to prevent primer extension. Method Set up LAMP reaction to amplify influenza A H5 clade 2.3.4.4b essentially according to Filaire et al., 2024 (Figure 4) but including an unquenched Atto647N labelled probe for detection of H5N1 FluA (LAMP), in combination with a LAMP primer set designed to recognise for all clades of influenza A essentially according to Takayama, I. et al. Development of real-time fluorescent reverse transcription loop-mediated isothermal amplification assay with quenching primer for influenza virus and respiratory syncytial virus. J. Virol. Methods 267, 53–58 (2019]. (Figure 5, Table 5), but with substitution of a specific LB LEC-LAMP primer internally labelled with Cy3 designed to recognize Influenza A designed as follows: 5’(BHQ-2)-CC(c3spacer)AGdT(Cy3)GAGCGAGGACTGC-3’ (SEQ ID NO: 19) Note in this case the spacer residue replaces variant ‘wobble’ residues in the primer set. Note that fluorophores and other functional groups like Biotin (for streptavidin conjugation) are often conjugated terminally or internally (via orthogonal dT residues as shown) during oligonucleotide synthesis. Table 5 – Influenza A LAMP primers (from Takayama et al, 2019). F3-1 Note that this includes sequence which are redundant; thus B3-1 and B3-2 are two variants of the same primer and F3-1 and F3-2 are two variants of the same primer. 1. Include primers specific for 18SrRNA gene in the LAMP reaction with primers outlined above in Table 4. 2. Include endonuclease IV in the LAMP reaction, as described by Higgins et al, 2020. 3. Add the sample to the reaction. 4. Incubate at 65°C for up to 30 minutes. 5. Detect the presence of H5N1-specific amplicons in far-RED channel using non-enzymatic quantum amplified LAMP to detect the first (H5N1) amplicon (e.g. signal detected in first, red channel), under blue excitation of the adjancently annealed FRET donor (QD625). 6. Detection of 18S rDNA internal control gene amplicons via unquenching of a FAM-based hybridization probe (as described in the previous example) allowing detection of the internal control signal in a second, green channel upon blue excitation, upon the probe annealing to the target amplicon. 7. Detecting the presence of all Influenza A LAMP amplicons using a Cy3 labelled LEC-LAMP probe detected in a third yellow channel centred at 569 nm (with a narrow filter width of 25nm), illuminated under a green (555 nm) light excitation. Example 8 –Detection of of H5N1 influenza A in the first channel using quantum dot amplified LAMP loop primer and enzymatic detection of influenza B in another channel using LEC-LAMP. H5N1 Specific Probe Design In this case the LAMP probe below is also based on a modified LB primer, essentially as described by Filaire et al., 2024 (Figure 4), but being 3’ extended, including an unquenched internal Atto647N fluorophore label as shown below. 5’- *GGGAATGCCCCAAATACGdT(Atto-647N)GA-3’ (SEQ ID NO: 10) Atto647N is a far red dye which is normally excited by orange / red light with broad peak of emission around 670 nm. However, in this case the fluorophore is indirectly excited by FRET from a biotinylated upstream hybridization probe labelled with QD625 Streptavidin (ThermoFisher / Molecular Probes™ Q22063), which is itself excited by 488 nm blue light. Quantum Dot Amplifier Probe: QD625-GTCAACCAAGTTGGTCCTTGCG-(3’Blocked) (SEQ ID NO: 18) Note: The 3’ end of hybridization amplifier probes are ‘blocked’ to prevent primer extension. Method (for example 8) 1. Set up LAMP reaction to amplify influenza A H5 clade 2.3.4.4b essentially according to Filaire et al., 2024 (Figure 4) but including an unquenched far red Atto647N labelled probe for detection of H5N1 FluA (LAMP) as shown above, in combination with an amplified LEC-LAMP primer set (Figure 6, Table 6) designed to recognise influenza B using a specific Alexafluor 488-labelled LP loop primer. An Influenza B-specific primer set (after Heitoff et al., 2022) used to design a LEC-LAMP probe (LEC-LAMP-LB) which is extended by 2 residues at the 5’ end to compensate for endonucleotide cleavage. The abasic spacer residue in the LEC-LAMP-LB probe replaces the first residue of the original primer. The abasic site is flanked by a 5’ quencher (BHQ1) and an internal label (ATTO-488), which has a green excitation and emission profile similar to FAM but is a brighter superior FRET acceptor. Note that fluorophores are normally conjugated terminally or internally (via orthogonal dT residues as shown) during oligo synthesis, but abasic C3 linkers are substituted for any residue. Table 6 – influenza B LAMP primers F3 AAGTCCTTATCAACTCTGCA (SEQ ID NO: 26) 2. Include endonuclease IV in the LAMP reaction, as described by Higgins et al, 2020. 3. Add the sample to the reaction. 4. Incubate at 65°C for up to 30 minutes. 5. Detect the presence of H5N1-specific amplicons in the red channel using non-enzymatic quantum amplified LAMP to detect the first (H5N1) amplicon (e.g. signal detected in first deep red channel at 680 nm), under blue excitation of the QD625 FRET donor 6. Detect the presence of influenza B in the green channel with a narrow band filter centred at 550 nm under violet illumination centred at 400nm. Example 9: Orthogonal Detection of Influenza A H5N1 and / or Influenza B via LRET from a UCNP energy donor, compatible with a signal amplified direct detection of a multicopy internal control target. using a FRET biosensor. This example exploits dual emission in two main peaks (540 nm and 650 nm) from a single upconverted nanoparticle UCNP-PAA (NaYF4:20%Yb,2%Er) under 980 nm near infra-red (NIR) excitation as described by [in Chen, Y. et al. Upconversion nanoparticle-assisted single-molecule assay for detecting circulating antigens of aggressive prostate cancer. Cytom. Part A 101, 400–410 (2022) ], in order to donate energy via LRET to distinct acceptor probes labelled with ATTO-740 (allowing detection of LAMP amplicons of the H5N1 influenza), as well as to TAMRA - [see: Chen, Y. et al. Exonuclease III-Assisted Upconversion Resonance Energy Transfer in a Wash-Free Suspension DNA Assay. Anal. Chem.90, 663–668 (2018)], allowing detection of LAMP amplicons to Influenza B. H5N1:Specific LRET Energy Acceptor Probe from an Upconverting Nanoparticle In this case the LAMP probe below is also based on a modified LB primer, essentially as described by Filaire et al., 2024, but being 3’ extended as described in above examples, including an unquenched internal fluorophore label as shown below. 5’- *GGGAATGCCCCAAATACGdT(Atto-ATTO740)GA-3’ (SEQ ID NO: 10) Atto740 is a far red emitting dye normally excited by red light with broad peak of emission centred around 740 nm. However, in this case the fluorophore can be efficiently excited by LRET via a biotinylated upstream hybridization probe labelled with UCNP-Streptavidin as an energy donor which is itself excited by 980 nm NIR light. UCNP-PAA (NaYF4:20%Yb,2%Er) Amplifier Probe 1: UCNP-GTCAACCAAGTTGGTCCTTGCG-(3’Blocked) (SEQ ID NO: 18) Note: The 3’ end of this hybridization probe is ‘blocked’ to prevent primer extension. Influenza B: Specific LEC-LAMP based Acceptor Probe LRET energy amplifier An Influenza B-specific primer set (after Heitoff et al., 2022) (Table 6) was used to design the highlighted LEC-LAMP probe (LEC-LAMP-LB) which is extended by 2 residues at the 5’ end to compensate for endonucleotide cleavage. The abasic spacer residue in the LEC-LAMP- LB probe replaces the first residue of the original primer. The abasic site is flanked by a 5’ quencher (BHQ1) and an internal label (TAMRA), which has an excitation and emission profile similar to Cy3. Note that fluorophores are normally conjugated terminally or internally (via orthogonal dT residues as shown) during oligo synthesis, but abasic C3 linkers are substituted for any residue. LEC-LAMP acceptor probe for influenza B LEC-LAMP -LB BHQ1-TC(c3Spacer)dT(TAMRA)AATGAAGGACATTCAAAGCC (SEQ ID NO: 32) UNCP amplifier for influenza B. UCNP -AAdT(UCNP)TCGAGCAGCTGAAACTGC-3’Blocked (SEQ ID NO: 33) Internal Control Probe Detection of the presence of a mammalian sample using an 18S rRNA internal control gene using an excimer amplified hairpin molecular beacon biosensor probe Unlike 18S rRNA gene probes for LAMP amplicons outlined in the above examples, this biosensor does not require prior amplification of the multicopy genomic target for detection. Instead this alternative 18S biosensor exploits target binding of a hairpin molecular beacon hybridisation oligo labelled with a pyrene-based light up excimer amplifier to efficiently donate energy to an unquenched sCy3-labelled loop primer located immediately downstream [ Aparin, O.V. Sergeeva, A.S. Mishin, E.V. Khaydukov, V.A. Korshun, T.S. Zatsepin, Excimer-FRET Cascade in Dual DNA Probes: Open Access to Large Stokes Shift, Enhanced Acceptor Light up, and Robust RNA Sensing, Anal. Chem.92 (2020) 7028–7036. The specificity of molecular beacon assays can be customized for each target by design of hairpin structures to recognize target-specific sequences, according to well known methods. Accordingly, a hairpin has been designed to be recognized by a unique target sequence, but for its repeated inclusion within the 18s rDNA cluster GenBank (accession nos. U13369.1). Since some molecular beacon displacement assays are normally run at lower temperatures such as room temperature, for simultaneous, rather than endpoint detection, some adjustment needs to be made in the length and GC-richness of the target-homologous hairpin sequences to ensure sufficient stability at higher temperatures compatible with LAMP assays such as 60°C. Such alternative probe designs with increased Tm can readily be designed by those skilled in the art without recourse to undue experimentation, using for example extended and / or XNA probe sequences). However for the purposes of exemplification below, an endpoint reading of the internal control is determined by detecting the fluorescence signal at 632 / 60 nm immediately after the addition of sample and after inclubation at room temperature for 5-10 minutes under excitation of 350 / 50 nm UV light, since this version of the biosensor probe is designed to operate at room temperature. Method (for example 9) 1. Synthesise oleaic acid capped up-converted nanuparticles (UCNP) which are excitable with NIR light - UCNP-PAA (NaYF4:20%Yb,2%Er) can be conjugated with Streptavidin via ligand exchange for susbsequent decoration with biotinylated hybridisation oligo by the methods outlined in [ Chen, Y. et al. Exonuclease III-Assisted Upconversion Resonance Energy Transfer in a Wash-Free Suspension DNA Assay. Anal. Chem.90, 663–668 (2018) and in Chen, Y. et al. Upconversion nanoparticle-assisted single- molecule assay for detecting circulating antigens of aggressive prostate cancer. Cytom. Part A 101, 400–410 (2022) ] – see step 2 below. Note that other efficient means for conjugation of oligonucleotides to nanoparticles are known to skilled artisans, including those outlined in methods summarised in the appendix of this disclosure. 2. Prepare two batches of UCNP-oligonucleotide conjugated UCNP (NaYF4:20%Yb,2%Er): i) the first - H5N1 UCNP Amplifier probe - to be decorated by conjugation of biotinylated oligonucleotide dT(Biotin)-GTCAACCAAGTTGGTCCTTGCG- (3’Blocked) (SEQ ID NO: 18) for linkage to Streptavidin-conjugated UPNP according to Chen et al., 2022). ii) The second - FluB UCNP Amplifier probe - to be decorated by conjugation of biotinylated oligonucleotide AAdT(biotin)TCGAGCAGCTGAAACTGC- 3’Blocked (SEQ ID NO: 33) for linkage to Streptavidin-conjugated UPNP according to Chen et al., 2022). 3. Set up LAMP reaction to amplify influenza A H5 clade 2.3.4.4b essentially according to Filaire et al., 2024 but including an unquenched Atto740 labelled LB loop primer probe for detection of H5N1 FluA (LAMP) as shown above, in combination with a TAMRA-amplified LEC-LAMP primer set designed to recognise influenza B using a specific probe in the context of the LAMP primer set described Heithoff et al, 2022), where the labelled LEC- LAMP-LB probe replaces the standard unlablelled LB primer, and non-extandable amplifier hybridization probes homologous to sequences of H5N1influenza A and influenza B are also added at comparable concentrations to the loop primers. Include components for a non-amplified biosensor for detection of 18S rRNA internal control gene in mammalian biological samples without prior amplification (including excimer labelled donor probes 18S1-4 and sulfo-Cy3 labelled acceptor probe sequences) following the details provided in Aparin et. al 2020. Note that that induced sCy3 dye fluorescence described therein can easily be distinguished from TAMRA (the other orange fluorophore described in this example), since TAMRA does not fluoresce significantly under UV light. This illustrates well a key advantage of using heteroorthogonal signal amplification, allowing detection of the same colour fluorophores excited (indirectly) by LRET and FRET donors illuminated at opposite ends of the spectrum NIR and UV, respectively. Add the sample to the reaction. Detect the initial sCy3 signal from the 18S initial rDNA biosensor at room temperature at under the UV excitation wavelength of 350 / 50 nm, while reading orange emission wavelength filtered via the 632 / 60 nm channel. Include endonuclease IV in the LAMP reaction, as described by Higgins et al, 2020. Detect the presence of H5N1-specific amplicons in the near infrared channel during incubation using a non-enzymatic quantum amplified LAMP assay to detect the first (H5N1) amplicon (e.g. signal detected in the far red 750 nm channel), under NIR excitation of the NIR 980 nm UCNP conjugated to a hybridization oligonucleotide probe annealed to an adjacent sequence in the H5N1 amplicon. Detect the presence of Influenza B LAMP amplicons in the orange channel at 650 nm during incubation using a TAMRA labelled LEC-LAMP probe, which is indirectly excited by LRET from an NIR 980 nm illuminated UCNP conjugated to a hybridization oligonucleotide probe annealed to an adjacent sequence in the influenza B amplicon. Incubate at room temperature for at least 5-30 minutes to allow the biosensor to function optimally (depending on sample concentration). 10. Read the final sCy3 (endopoint) signal from the 18S initial rDNA biosensor at room temperature at under the excitation wavelength of 350 / 50 nm, in the orange emission wavelength channel of 632 / 60 nm. 11. Subtract the final (endpoint) orange sCy3 signal from the initial sCy3 signal reading of the 18S initial rDNA biosensor at room temperature at under the UV excitation wavelength of 350 / 50 nm, reading with an emission filter of 632 / 50 nm to determine whether a difference in sCy3 dependent signal has emerged. Example 10 –CRISPR detection of amplified N gene of SARS-CoV-2 with parallel detection of Influenza A, and or Influenza B amplicons, detected with unamplified and amplified fluorescence hybridisation probes, respectively and detection of an internal control via signal amplified molecular beacon nanosensor probe Design of NanoCircle CRISPR probes for detection of RT-LAMP amplicons from the SARS- CoV02 N-gene amplification reaction. The first indicative target sequence in this example is derived from part of the N-FIP amplicon (but not overlapping with the FIP primers themselves), of common N-gene amplicons SARS-CoV02 LAMP reactions as in (Y. Zhang, et al., Enhancing colorimetric loop- mediated isothermal amplification speed and sensitivity with guanidine chloride, BioTechniques 69 (2020) 178–185. (https: / / doi.org / 10.2144 / btn-2020-0078) Note additional sequences following the 14-mer target are shown to provide more sequence context (in brackets without bold font and can be included in the ssDNA linker): CRISPR TARGET SEQUENCE 1: GCCCCCAGCGCTTC (SEQ ID NO: 1) CRISPR TARGET SEQUENCE 1 with linkers included: ATTTGCCCCCAGCGCTTC (AGCG) (SEQ ID NO: 2) Detection of Influenza A and / or B in the same reaction using hybridisation probes • Set up a 20 microlitre LAMP reaction to amplify influenza A and / or B essentially according to Takayama et al., (1989) and Heithoff, et al., Jama Netw Open 5 (2022), respectively. Quenched Flu A hybridisation probe • Design a non-extendable, quenched hybridization probe overlapping with the same strand of one of the Loop primers corresponding to the following consensus sequence of the Flu A amplicon (CMAGTGAGCGAGGACTG) (SEQ ID NO:34) , labelled at the 5’ end with the Atto488 fluorophore. This FluA probe sequence is designed to incorporate locked nucleic acid (LNA) residues, essentially as described by Zhang, Y., & Tanner, N. A. (2022). (ATTO488)CC+CA+GTG+AGC+GAG+GACTG( / 3IABkFQp) (SEQ ID NO: 35) Where the Atto488 fluorophore is at the 5’ end and its matching quencher is at a ‘blocked’ 3’ end. Unquenched Flu B Probe detection with an upstream quantum amplifier probe Design an unquenched probe specific for the Flu B amplicon by ATTO647N-labelling the 5’ end of a loop primer substituted for the LB unlabelled primer for the LAMP reaction amplifying influenza B. Unquenched Influenza B Loop B primer (ATTO647N)TTAATGAAGGACATTCAAAGCC (SEQ ID NO: 36) Note this is an extendable primer with an unblocked 3’ end. Quantum Amplifier Probe for FluB AAdT(QD625)TCGAGCAGCTGAAACTGC-3’Blocked (SEQ ID NO: 33 ) Method steps: • Set up a 20 microlitre reaction to amplify genomic material from SARS-CoV2 essentially using the “Salivision” method disclosed by DeFina, et al., Sci Rep-Uk 12 (2022). • Include the CRISPR-Cas12 components essentially as described by Deng, Y. et al, Nat. Commun.15 (2024). • Include the guide RNA sequence designed to recognize a PAM sequence within this N-gene amplicon of SARS-Cov2 (Table 2). • Label the NanoCircle reporter with Cy5 fluorophore and BH2Q quencher incorporated. • Perform the LAMP amplification reaction (and the CRISPR signal amplification / detection reactions concurrently or sequentially for up to 30 minutes (Optional) Sequential reaction: (Optionally) transfer an aliquot of from the multiplex LAMP reaction after 5 to 15 minutes of incubation at 60-65°C to a new vessel allowing them to contact CRISPR reagents at room temperature as well as contacting components for a non-amplified biosensor for detection of 18S rRNA internal control gene in mammalian biological samples without prior amplification (including excimer labelled donor probes 18S1-4 and sulfo-Cy3 labelled acceptor probe sequences), in the CRISPR reaction, essentially following the details provided in Aparin et. al 2020. Continue to incubate the both the multiplex LAMP and NanoCircle amplified LAMP / CRISPR reactions respectively at 60-65 and at 20-30 °C, for up to 30 minutes. • Readout signal corresponding to the Atto488 signal corresponding to the quenched hybridization probe detection of fluA amplicons in the LAMP reaction using an excitation filter 470 / 20 nm and an emission filter of 615 / 25nm. • Readout signal corresponding to LAMP amplified influenza B via the FluB primer linked fluorophore ATTO547N of the LAMP reaction using blue light 470nm excitation and emission at 670nM,using a narrow band filter set (e.g. Excitation 470 / 30nm and deep red filter (e.g. emission 700 / 50nm) for specific fluB detection • Detect the signal corresponding to amplification of the SARS-CoV2 N-gene in the Nanocircle LAMP / CRISPR reaction using excitation at 650nm and emission at 670nM using a narrow band filter set (e.g. orange / red light excitation 640 / 30nm and far red emission 690 / 30nm) for detection. • Incubate at room temperature for at least 5-30 minutes to allow the biosensor to function optimally • Read the final sCy3 (endopoint) signal from the the 18S initial rDNA biosensor at room temperature at, in the orange emission wavelength channel of 632 / 60 nm, only under the excitation wavelength of 350 / 50 nm. • Subtract the final (endpoint) orange sCy3 signal from the initial sCy3 signal reading of the 18S initial rDNA biosensor at room temperature at under the excitation wavelength of 350 / 50 nm, measuring emission wavelength 632 / 60 nm to determine whether a difference has emerged. This example illustrates the advantages of using hetero-orthogonal signal amplification approaches to avoid enzymatic and optical interference to allowing the use of probes of similar or overlapping emission wavelengths, which are differentially excited. APPENDICES Materials and methods used in the Examples above The appendices listed below show reference materials to standard approaches to detection of particular fluorophores as well as standard methods by which oligonucleotides can be conjugated to nanoparticles. Appendix A. Examples of Excitation / Emission Filter Sets for Detection: Dye / NP DETECTION (excitation* / emission filters) • Green Plus (480 / 519 nm) • ATTO-490-LS (480 / 660 nm) • ATTO-542 542 / 561 nm) • Cy3 (555 / 569 nm) • TAMRA (546 / 579 nm • Texas Red (595 / 615 nm) • Qdot® ITK™525 (350-488 / 525 nm) • QD625 (470 / 625 nm • Alexafluor 405 (405 / 450 nm • ATTO647N (647 / 667 nm) • ATTO740 (743 / 763 nm • UCNP-PAA (NaYF4:20%Yb,2%Erb) lanthanide doped (980 / 540 nm and 654 nm). *Note that where the acceptor fluorophore is detected by FRET / LRET (eg from Eva Green Plus, Qdot ITK525, Alexafluor 405, QD625 or UCNP as a donor), then the relevant excitation wavelength corresponds to the donor and the relelvant emission wavelength is that of the acceptor. Probe Concentrations in LAMP assays: The concentration of oligonucleotide primers in LAMP assays can be optimized, but is generally in the range of the following 0.2 μM F3, 0.2 μM B3, 1.6 μM FIP, 1.6 μM BIP, 0.4 μM Loop F, 0.4 μM Loop B with minor modifications as required to optimize particular primer sets. When one or both of the loop primers (LF and / or LF) are substituted for corresponding fluorophore-labelled versions, or (in the case of LEC LAMP), alternatively replaced with quenched labelled versions, those versions of the Loop Primers are used at comparable concentrations to their unlabelled equivalents. The design and optimization of hybridization primers is well known to those skilled in the art and can be achieved using software algorithms or manual calculations – see [1.Akhmetzianova, L. U. et al. LAMPrimers iQ: New primer design software for loop-mediated isothermal amplification (LAMP). Anal. Biochem.684, 115376 (2024) for review ]. Primer designs may optionally include locked nucleic acids (LNA) residues to increase their melting temperatures – Tm, for a given sequence length – for review see: 1.Mana, T., Bhattacharya, B., Lahiri, H. & Mukhopadhyay, R. XNAs: A Troubleshooter for Nucleic Acid Sensing. ACS Omega 7, 15296–15307 (2022).. Incorporation of LNA residues in probes can result in shorter probes with increased hybridization stringency. Hybridisation probes which anneal to the LAMP amplicon, are designed to have a similar Tm to the temperature of the isothermal reaction conditions. Once optimized, hybridisation probe oligos are generally included in LAMP reactions at concentrations between 0.5X and 1.5X of the the molar concentration of the LAMP Loop Primers. For example, 13-20 bp length LNA containing quenched hybridization probes have been designed with melting temparatures comparable to or slightly higher than LAMP reaction conditions and used at 0.625X the concentration of the Loop Primers [ Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse-transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 247–255 (2022) ]. Appendix B. Methods for conjugation of quantum dots or up-converting nanoparticles to oligonucleotides: Direct Oligo / Nanoparticle Conjugation methods Direct Method 1. Direct chemical conjugation of terminally thiolated oligonucleotides onto quantum dots is usually achieved by ligand exchange • Deng, et al., Robust DNA-Functionalized Core / Shell Quantum Dots with Fluorescent Emission Spanning from UV–vis to Near-IR and Compatible with DNA-Directed Self-Assembly, J. Am. Chem. Soc.134 (2012) 17424–17427. https: / / doi.org / 10.1021 / ja3081023. Direct Method 2. Higher loading of oligonucleotides on QDs has more recently been achieved non- covalently using simple dehydration / precipitation. • Chen, et al., Ultrafast dense DNA functionalization of quantum dots and rods for scalable 2D array fabrication with nanoscale precision, Sci. Adv.9 (2023) eadh8508. https: / / doi.org / 10.1126 / sciadv.adh8508 Indirect Protein-based Oligo / Nanoparticle Conjugation methods Protein-based methods include non-covalent attachment of biotinylated oligonucleotides to streptavidin conjugation nanoparticles such as quantum dots (See methods of commercial suppliers suchas Invitrogen / Thermofisher for details of streptavidin / avidin conjugation) as well as covalent conjugation methods outlined below based on the spycatcher / spytag system). Spytags can be readily conjugated to oligos during synthesis using efficient alkyne– azide cycloaddition (SPAAC) chemistry (conjugating an azide-modified spytag peptide to oligonucleotides with trained cyclooctyne (SCO) residue at their 5’ end. • Kröll, et al., Orthogonal protein decoration of DNA nanostructures based on SpyCatcher–SpyTag interaction, Chem. Commun.58 (2022) 13471–13474. https: / / doi.org / 10.1039 / d2cc05335g. • Kushnarova-Vakal, et al., Site-Specific Linking of an Oligonucleotide to Mono- and Bivalent Recombinant Antibodies with SpyCatcher-SpyTag System for Immuno- PCR, ACS Omega 5 (2020) 24927–24934. https: / / doi.org / 10.1021 / acsomega.0c03750. Various indirect approaches have been used for the conjugation of proteins such as spycatcher onto quantum dots, to allow facile ligation of oligos functionalised with spytag • Kim, et al., Compact and modular bioprobe: Integrating SpyCatcher / SpyTag recombinant proteins with zwitterionic polymer-coated quantum dots, J. Colloid Interface Sci.652 (2023) 184–194. https: / / doi.org / 10.1016 / j.jcis.2023.08.016. • Pedroso, et al., Immunotargeting of Nanocrystals by SpyCatcher Conjugation of Engineered Antibodies, ACS Nano 15 (2021) 18374– 18384. https: / / doi.org / 10.1021 / acsnano.1c07856. REFERENCES Melnychuk, et al., Light-Harvesting Nanoparticle Probes for FRET-Based Detection of Oligonucleotides with Single-Molecule Sensitivity, Angew. Chem. Int. Ed.59 (2020) 6811– 6818. https: / / doi.org / 10.1002 / anie.201913804. Xiao., et al, Light-Harvesting Fluorescent Spherical Nucleic Acids Self-Assembled from a DNA-Grafted Conjugated Polymer for Amplified Detection of Nucleic Acids, Angew. Chem. 134 (2022). https: / / doi.org / 10.1002 / ange.202115812. Egloff, et al., Enzyme-free amplified detection of cellular microRNA by light-harvesting fluorescent nanoparticle probes, Biosens. Bioelectron.179 (2021) 113084. https: / / doi.org / 10.1016 / j.bios.2021.113084. Song, et al., Zeptomole Imaging of Cytosolic MicroRNA Cancer Biomarkers with A Light- Controlled Nanoantenna, Nano-Micro Lett.13 (2021) 213. https: / / doi.org / 10.1007 / s40820- 021-00732-1. Melnychuk, A.S. Klymchenko, DNA-Functionalized Dye-Loaded Polymeric Nanoparticles: Ultrabright FRET Platform for Amplified Detection of Nucleic Acids, J. Am. Chem. Soc.140 (2018) 10856–10865. https: / / doi.org / 10.1021 / jacs.8b05840. Luan, et al., Ultrabright fluorescent nanoscale labels for the femtomolar detection of analytes with standard bioassays, Nat. Biomed. Eng.4 (2020) 518–530. https: / / doi.org / 10.1038 / s41551-020-0547-4. Trofymchuk et al., Giant light-harvesting nanoantenna for single-molecule detection in ambient light, Nat. Photonics 11 (2017) 657–663. https: / / doi.org / 10.1038 / s41566-017-0001- 7. Song, et al., Pathogenic Virus Detection by Optical Nanobiosensors, Cell Rep. Phys. Sci.2 (2021) 100288. https: / / doi.org / 10.1016 / j.xcrp.2020.100288. Sun, et al., Nanoparticle-based molecular beacon for directly detecting attomolar small RNA from plasma without purification, Talanta 260 (2023) 124602. https: / / doi.org / 10.1016 / j.talanta.2023.124602. Velema, E.T. Kool, Fluorogenic Templated Reaction Cascades for RNA Detection, J. Am. Chem. Soc.139 (2017) 5405–5411. https: / / doi.org / 10.1021 / jacs.7b00466 Zhang, Y. et al. Enhancing colorimetric loop-mediated isothermal amplification speed and sensitivity with guanidine chloride. BioTechniques 69, 178–185 (2020). DeFina, et al., Sci Rep-Uk 12 (2022). Heithoff, et al., Assessment of a Smartphone-Based Loop-Mediated Isothermal Amplification Assay for Detection of SARS-CoV-2 and Influenza Viruses, Jama Netw Open 5 (2022) e2145669. https: / / doi.org / 10.1001 / jamanetworkopen.2021.45669. Marino, et al.,. A rapid, specific, extraction-less, and cost-effective RT-LAMP test for the detection of SARS-CoV-2 in clinical specimens. PLoS ONE 17, e0266703 (2022). Tanner, N. A., Zhang, Y. & Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. BioTechniques 53, 81–89 (2012).] or using standard quenched hybridization probes Zhang, Y. & Tanner, N. A. Efficient multiplexing and variant discrimination in reverse- transcription loop-mediated isothermal amplification with sequence-specific hybridization probes. BioTechniques 73, 247–255 (2022) Mana, T., Bhattacharya, B., Lahiri, H. & Mukhopadhyay, R. XNAs: A Troubleshooter for Nucleic Acid Sensing. ACS Omega 7, 15296–15307 (2022). Ma, Y. et al. FEN1-aided recombinase polymerase amplification (FARPA) for one-pot and multiplex detection of nucleic acids with an ultra-high specificity and sensitivity. Biosens. Bioelectron.237, 115456 (2023) Wang, Y. et al. Multiple Endonuclease Restriction Real-Time Loop-Mediated Isothermal Amplification A Novel Analytically Rapid, Sensitive, Multiplex Loop-Mediated Isothermal Amplification Detection Technique. J. Mol. Diagn.17, 392–401 (2015) ] Deng, F. et al., Nat. Commun.15, 1818 (2024). Becherer, N. et al., Anal. Methods-UK 12 (2020) 717–746. Tanner, Y. et al., BioTechniques 53 (2012) 81–89; Zhang, N., A. Tanner, BioTechniques 73 (2022) 247–255. Becherer et al., Anal. Chem.90 (2018) 4741–4748. Zhang, et al., Diagnostics 13 (2023) 1530 Li et al., Sens. Actuators B: Chem.345 (2021) 130351 Zeng, J. et al., Front. Microbiol.15 (2024) Choi, et al., Expert Rev. Mol. Diagn.23 (2023) 9–28 Santiago-Frangos, et al., Methods 205 (2022) 1–10 Feng, et al, Anal. Chem.95 (2023) 206–217 Guk, et al., Biosens Bioelectron 219 (2023) Li, et al., Biosens. Bioelectron.244 (2024) Dong, Y. et al., Acs Sensors 7 Li, Y. et al., Anal. Chem.93 (2021) 3315–3323. Higgins, O. & Smith, T. J. Loop-Primer Endonuclease Cleavage–Loop-Mediated Isothermal Amplification Technology for Multiplex Pathogen Detection and Single-Nucleotide Polymorphism Identification. J. Mol. Diagn.22, 640–651 (2020) Filaire, F., Sécula, A., Lebre, L., Croville, G. & Guerin, J.-L. A real-time colourimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the rapid detection of highly pathogenic H5 clade 2.3.4.4b avian influenza viruses. Avian Pathol.53, 93–100 (2024) Takeshita M, Chang C N, Johnson F, Will S and Grollman A P 1987 Oligodeoxynucleotides containing synthetic abasic sites. Model substrates for DNA polymerases and apurinic / apyrimidinic endonucleases. J. Biol. Chem.26210171–9 Takayama, I, Nakauchi, M, Takahashi, H., Oba, K, Semba, S., Kaida, A., Kubo, H., Saito, S., Nagata, S., Odagiri, T., Kageyama, T., Development of real-time fluorescent reverse transcription loop-mediated isothermal amplification assay with quenching primer for influenza virus and respiratory syncytial virus, J. Virol. Methods 267 (2019) 53–58. INDUSTRIAL APPLICATION The hetero-orthogonal amplification detection methods according to the invention have industrial application in molecular biology in providing a rapid way to identify multiple target nucleic acids with improved signal / noise ratios to allow improved sensitivty and / or specificity.

Claims

What we claim is :

1. A method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using an enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a non-enzymatic optical detection signal amplification method, and c) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b), wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other.

2. The method of claim 1 wherein the detection signal amplification method in c) that is distinct from the method of a) or b) operates using a different chemistry than either a) or b).

3. The method of claim 1 or claim 2 wherein the method further comprises d), the multiplex detection of at least one fourth target amplicon or target nucleic acid sequence.

4. The method of any one of claims 1 to 3 wherein the first, second, third and fourth target amplicons and / or target nucleic acid sequences are different from each other.

5. The method of any one of claims 1 to 4 wherein the enzymatic detection method in a) is selected from the enzymatic detection methods set out in A1, A2 or A3 in Table 1.

6. The method of any one of claims 1 to 5 wherein the non-enzymatic detection method in b) is selected from the non-enzymatic optical detection methods set out in B1, B2 or B3 in Table 1.

7. The method of any one of claims 1 to 6 wherein the method comprises c) wherein c) comprises a non-enzymatic optical detection method selected from B1, B2 or B3 in Table 1.

8. The method of any one of claims 1 to 7 wherein the method comprises a), b) and e), wherein e) comprises detecting a target analyte using a non-enzymatic optical detection signal amplification method selected from B1, B2 or B3 in Table 1, wherein the target analyte is a different target nucleic acid sequence than any of the target amplicons or target nucleic acid sequences in a), b), c) or d) or is a ligand or a protein.

9. The method of claim 8 wherein the ligand or protein is an antigen, a hapten or an antibody.

10. The method of any one of claims 1 to 9 wherein the method comprises a), b), c) and e), preferably a), b), c), d) and e).

11. The method of any one of claims 1 to 10 wherein the enzymatic signal detection method in a) is a catalytic CRISPR substrate amplification method or a catalytic argonaute substrate amplification method, preferably a catalytic CRISPR substrate amplification method.

12. The method of any one of claims 1 to 11 wherein the non-enzymatic optical detection signal amplification method in b) is iFRET or is a nanoamplified molecular beacon or fluorogenic amplified cascaded templated reaction (FACTR).

13. The method of any one of claims 1 to 12 wherein the non-enzymatic optical detection signal amplification method in b) is a nanoparticle-based method exploiting intrinsic luminescent or plasmonic optical properties of nanomaterials, preferably wherein the nanoparticle-based method is luminescence resonance energy transfer (LRET) or surface plasmon (SPs) effects or a combination thereof.

14. The method of any one of claims 1 to 13 wherein the non-enzymatic optical detection signal amplification method in c) is detection of amplification by release of quenching (DARQ), Fluorescence of Loop Primer Upon Self Dequenching (FLOS) or mediator displacement probes (MD).

15. The method of claim 14 wherein the non-enzymatic detection signal amplification method in c) is a combination of iFRET and DARQ.

16. The method of claim 15 wherein the combination of iFRET and DARQ is used in c) to detect two different target amplicons or target nucleic acid sequences.

17. The method of claim 1 wherein c) comprises enzymatic detection signal amplification of least two target amplicons or nucleic acid target sequences, preferably of at least twodifferent target amplicons or nucleic acid target sequences, preferably wherein enzymatic detection signal amplification of each different target amplicon or nucleic acid target sequence comprises using different enzymatic detection signal amplification methods..

18. The method of claim 1 or claim 17 wherein the enzymatic detection signal amplification is selected from the enzymatic detection signal amplification methods set out in A1, A2 or A3 in Table 1.

19. The method of claim 1, 17 or 18 wherein the enzymatic detection signal amplification methods are CRISPR / Cas and Argonaut.

20. An assay system for detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, the system comprising: a) reagents for detecting at least one first target amplicon or first target nucleic acid sequence by enzymatic detection signal amplification, b) reagents for detecting at least one second target amplicon or second target nucleic acid sequence by non-enzymatic optical detection signal amplification, and c) optionally, reagents for detecting at least one third target amplicon or third target nucleic acid sequence by enzymatic or non-enzymatic detection signal amplification, wherein the reagents in c) are distinct from the reagents in either a) or b), and wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other.

21. A method of detecting a plurality of target amplicons or a plurality of target nucleic acid sequences in a single multiplex isothermal nucleic acid amplification reaction, wherein the method comprises: a) detecting at least one first target amplicon or first target nucleic acid sequence using a non-enzymatic detection signal amplification method, b) detecting at least one second target amplicon or second nucleic acid sequence using a distinct non-enzymatic optical detection signal amplification method, andc) optionally detecting at least one third target amplicon or third target nucleic acid sequence using an enzymatic or non-enzymatic detection signal amplification method that is distinct from either a) or b) wherein the first, second and third target amplicons and / or target nucleic acid sequences are different from each other.

22. The method of claim 21 wherein the enzymatic detection signal is selected from A2 or A3 and the non-enzymatic detection signal amplification is selected set out in B1, B2 or B3 from the detection signal amplification methods shown in Table 1.

Citation Information

Patent Citations

  • Multiplexed nucleic acid detection and modification systems and methods of use

    WO2024036319A2