Recombinant strain for producing dehydroepiandrosterone, construction method therefor, and use thereof
The recombinant strains modified by genetic engineering have solved the problems of complex DHEA production processes and excessive use of organic solvents in existing technologies, realizing microbial fermentation transformation without protection processes and promoting large-scale green production of DHEA.
Patent Information
- Application Number
- PCT/CN2024/123641
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-04
- Filing Date
- 2024-10-09
- Publication Date
- 2025-12-11
AI Technical Summary
Existing technologies for preparing DHEA require cumbersome protection-deprotection processes and large amounts of organic solvents, making it difficult to achieve large-scale green production.
By genetically modifying the microbial strains that can directly ferment and transform DHEA using phytosterols and/or cholesterol as substrates, cholesterol oxidase and/or 3β-hydroxysteroid dehydrogenase can be reduced or blocked.
This enables microbial fermentation and transformation without substrate/product protection, promoting large-scale green production of DHEA.
Smart Images

Figure CN2024123641_11122025_PF_FP_ABST
Abstract
Description
Recombinant strain for producing dehydroepiandrosterone and construction method and application thereof
[0001] Priority and Related Applications
[0002] The present disclosure claims priority to Chinese Patent Application No. 202410726144.9, filed on June 4, 2024, entitled “Recombinant strain for producing dehydroepiandrosterone and construction method and application thereof”, which includes the entire contents of the appendix, and is incorporated by reference into the present disclosure. TECHNICAL FIELD
[0003] The present disclosure relates to a recombinant strain for producing dehydroepiandrosterone and construction method and application thereof, and belongs to the field of biotechnology. BACKGROUND
[0004] As a steroid drug, dehydroepiandrosterone (DHEA) is often used as an anti-aging drug, because it is believed that the decrease of DHEA content in the body is closely related to the onset of a series of aging-related diseases. Some articles show that the DHEA content in the body of a person at the age of 80 is only 1 / 10 of that at the age of 25. It is generally believed that dehydroepiandrosterone sulfate (DHEAS) is a more stable form of DHEA. DHEA and DHEAS are considered to be the most important neurosteroids in the brain (Baulieu E E, Schumacher M. Progesterone as a neuroactive neurosteroid, with special reference to the effect of progesterone on myelination [J]. Steroids, 2000, 65(10-11): 605-612). DHEA is also a key intermediate in the metabolism of cholesterol into sex hormones such as testosterone.Recent studies have further demonstrated that neurosteroids enhance memory (Shi J, Schulze S, Lardy H A. The effect of 7-oxo-DHEA acetate on memory in young and old C57BL / 6 mice [J]. Steroids, 2000, 65(3): 124-129), resist anxiety, anticonvulsant (Kokate T G, Svensson B E, Rogawski M A. Anticonvulsant activity of neurosteroids - correlation with gamma-aminobutyric acid-evoked chloride current potentiation [J]. J Pharmacol Exp Ther, 1994, 270(3): 1223-1229), antidepressant, and protect the nervous system, especially from oxidative damage (Bastianetto S, Ramassamy C, Poirier J, et al. Dehydroepiandrosterone (DHEA) protects hippocampal cells from oxidative stress-induced damage [J]. Mol Brain Res, 1999, 66(1-2): 35-41.) and DNA damage caused by exogenous mutations (Shen S, Cooley D M, Glickman L T, et al. Reduction in DNA damage in brain and peripheral blood lymphocytes of elderly dogs after treatment with dehydroepiandrosterone (DHEA) [J]. Mutat Res-Fundam Mol Mech Mutagen, 2001, 480(1): 53-62). In addition to the medicinal functions of DHEA itself, as an important molecule in the steroid industry, DHEA is also an important precursor compound for the synthesis of other steroid drugs. According to the literature, 7a-OH-DHEA has higher activity in preventing hypoxic death of neurons in vitro than DHEA, and its antioxidant activity is greatly enhanced.In addition, 7a-OH-DHEA after hydroxylation has a strong inhibitory effect on tumor proliferation (Li Heping, Liang Dongsong, Dai Guifu, et al. Synthesis and activity determination of 7a-hydroxy-dehydroepiandrosterone [J]. Chinese Pharmaceutical Journal, 2009, 43(20): 1596-1598). Similar to 7a, 15a-OH-DHEA, and 1a-OH-DHEA, and other drugs synthesized by DHEA derivatives have special pharmacological effects and wide application prospects. Therefore, as an important basic raw material in steroid drugs, the industrial synthesis of DHEA has a significant impact on the development of the entire steroid industry.
[0005] The structure of DHEA is as follows:
[0006] In 1956, Rosenkranz et al. successfully synthesized DHEA using tuberous saponin as the starting material, officially opening the industrialization era of DHEA synthesis. The process of synthesizing DHEA from tuberous saponin aglycone is similar, and the principle is almost the same, only the different protective agents or oxidizing agents are selected in each step. Zhou et al. protected phytosterols with dimethoxymethane, and obtained 3-methoxymethyl-DHEA after fermentation, and then obtained DHEA by chemical hydrolysis (Zhou P, Fang Y-K, Yao H-K, et al. Efficient biotransformation of phytosterols to dehydroepiandrosterone by Mycobacterium sp. [J]. Appl Biochem Biotechnol, 2018, 186: 496-506). Fryszkowska and Cui Yunfeng et al. respectively used 5-AD as raw material to realize the reduction of 3-carbonyl group by 3 -hydroxyl sterol dehydrogenase to prepare DHEA (US2016 / 0122382A1, CN109750051A), and 5-AD is obtained by isomerizing 4-AD in a basic n-butanol solution under nitrogen protection, and then adding acetic acid to adjust pH.
[0007] The above technologies either require a tedious protection-deprotection process, or require the use of a large amount of organic solvent, which is not conducive to large-scale green production.
[0008] Many microorganisms can utilize cholesterols, phytosterols, and bile acids as sterols to produce AD, ADD, and 9-OH-AD as carbon and energy sources. Based on the identification of sterol catabolism intermediates and the analysis of catabolic gene clusters in Mycobacterium, Nocardia, and Rhodococcus, a possible sterol degradation pathway was proposed (Bragin EY, Shtratnikova VY, Dovbnya DV, et al. Comparative analysis of genes encoding key steroid core oxidation enzymes in fast-growing Mycobacterium spp. strains [J]. J Steroid Biochem Mol Biol, 2013, 138: 41-53; Van der Geize R, Yam K, Heuser T, et al. A gene cluster encoding cholesterol catabolism in a soil actinomycete provides insight into Mycobacterium tuberculosis survival in macrophages [J]. Proc Natl Acad Sci U S A, 2007, 104(6): 1947-1952.), as shown in Figure 1.Cholesterol oxidase (ChoD) and / or 3β-hydroxysteroid dehydrogenase (3β-HSD) catalyze the conversion of 3β-hydroxy-5-ene structure to 3-ketone-4-ene structure, initiating sterol degradation metabolism (Ivashina TV, Nikolayeva VM, Dovbnya DV, Donova MV. Cholesterol oxidase ChoD is not a critical enzyme accounting for oxidation of sterols to 3-keto-4-ene steroids in fast-growing Mycobacterium sp. VKM Ac-1815D [J]. J Steroid Biochem Mol Biol, 2012, 129(1-2): 47-53; Yang X, Dubnau E, Smith I, Sampson NS. Rv1106c from Mycobacterium tuberculosis is a 3β-hydroxysteroid dehydrogenase [J]. Biochemistry, 2007, 46(31): 9058-9067.). Cholesterol and phytosterols differ in the side chain, while bile acids differ in the number and position of hydroxyl groups on the polycyclic ring.The hydroxyl groups at C3, C7 and C12 of the polycyclic ring of bile acid have little effect on the degradation of the branched chain and are similar to the side chain degradation pathways of cholesterol and phytosterol (Holert J, Kulic Z, Yucel O, et al. Degradation of the acyl side chain of the steroid compound cholate in Pseudomonas sp. strain Chol1 proceeds via an aldehyde intermediate [J]. J Bacteriol, 2013, 195(3): 585-595; Holert J, Jagmann N, Philipp B. The essential function of genes for a hydratase and an aldehyde dehydrogenase for growth of Pseudomonas sp. strain Chol1 with the steroid compound cholate indicates an aldolytic reaction step for deacetylation of the side chain [J]. J Bacteriol, 2013, 195(15): 3371-3380.), mainly affecting the ring-opening process of the steroid ring, and requiring specific enzymes to participate in the reaction.
[0009] SUMMARY
[0010] PROBLEMS TO BE SOLVED BY THE INVENTION
[0011] In the current preparation of DHEA, a tedious protection-deprotection process is required, the reaction process is complex, or a large amount of organic solvent is required, which is not conducive to large-scale green production.
[0012] SOLUTIONS TO THE PROBLEMS
[0013] Based on the current problems, the present disclosure reduces or blocks cholesterol oxidase and / or 3β-hydroxysteroid dehydrogenase and / or other oxidoreductases through genetic engineering, in order to realize microbial conversion of sterols to produce DHEA. The microbial fermentation conversion does not require substrate / product protection-deprotection process, which is conducive to the realization of large-scale green production of DHEA. Through genetic engineering, a new strain capable of directly using phytosterol and / or cholesterol as substrate to produce DHEA through microbial fermentation conversion is obtained.
[0014] [1]. A recombinant strain for producing dehydroepiandrosterone, wherein the recombinant strain has at least one of the following (a1) to (a 11 ) characteristics compared to a wild-type strain or a starting strain:
[0015] (a1) the expression level of a polypeptide as shown in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 13 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0016] (a2) the expression level of a polypeptide as shown in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32%, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 12 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0017] (a3) the expression level of a polypeptide as shown in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 14 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0018] (a4) the expression level of a polypeptide as shown in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as shown in SEQ ID NO: 15 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0019] (a5) the expression level of a polypeptide as shown in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 16 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0020] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0021] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0022] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0023] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0024] (a 10 ) the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0025] (a 11 ) the expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same is reduced or eliminated in the recombinant strain.
[0026] [2]. The recombinant strain according to [1], wherein the recombinant strain has the following (al) property compared to the wild type strain or the starting strain:
[0027] (al) the expression level of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or a gene encoding the same is reduced or lost in the recombinant strain.
[0028] [3]. The recombinant strain according to [2], wherein the recombinant strain further has the following (a2) property compared to the wild type strain or the starting strain:
[0029] (a2) the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32%, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding the same is reduced or lost in the recombinant strain.
[0030] [4]. The recombinant strain according to [2] or [3], wherein the recombinant strain is selected from any one of the following (A) to (I):
[0031] (A) the recombinant strain further has the following property compared to the wild type strain or the starting strain:
[0032] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or lost in the recombinant strain;
[0033] (B) the recombinant strain further has the following property compared to the wild type strain or the starting strain:
[0034] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or lost in the recombinant strain, and
[0035] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0036] (C) the recombinant strain further has the property that:
[0037] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0038] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and
[0039] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0040] (D) the recombinant strain further has the property that:
[0041] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0042] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0043] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and
[0044] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0045] (E) the recombinant strain further has the following property compared to the wild-type strain or the starting strain:
[0046] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0047] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0048] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0049] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain, and
[0050] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain;
[0051] (F) the recombinant strain further has the following properties compared to the wild-type strain or the starting strain:
[0052] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain,
[0053] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain,
[0054] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain
[0055] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0056] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and
[0057] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0058] (G) the recombinant strain further has the following property compared to the wild-type strain or the starting strain:
[0059] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0060] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0061] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain
[0062] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0063] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0064] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, and
[0065] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0066] (H) the recombinant strain further has a property:
[0067] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0068] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0069] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0070] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0071] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0072] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0073] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, and
[0074] (a 10 ) the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0075] (I) the recombinant strain further has the following properties compared to the wild-type strain or the starting strain:
[0076] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0077] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0078] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0079] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0080] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0081] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0082] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0083] (a 10 ) the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, and
[0084] (a 11 ) the expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same is reduced or eliminated in the recombinant strain.
[0085] [5] The recombinant strain according to any one of [1] to [4], wherein the wild-type strain or the starting strain comprises a microorganism of the order of Actinomycetes.
[0086] [6] The recombinant strain according to [5], wherein the wild-type strain or the starting strain comprises a microorganism of the family of Actinomycetaceae, Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae, Brevibacteriaceae, Streptomycetaceae, Pseudomonadaceae, or Micrococcaceae.
[0087] Preferably, the wild-type strain or the starting strain comprises a microorganism of the genus of Rhodococcus, Mycobacterium, Mycolicibacterium, Arthrobacter, Nocardia, Streptomyces, or Pseudomonas.
[0088] [7] A method for constructing a recombinant strain for producing dehydroepiandrosterone, wherein the method comprises at least one step of (b1) to (b 11 ) shown below:
[0089] (b1) reducing or eliminating the expression level of a polypeptide as shown in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 13 and / or a gene encoding the same, compared to a wild-type strain or a starting strain;
[0090] (b2) reducing or eliminating the expression level of a polypeptide as shown in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 12 and / or a gene encoding the same, compared to a wild-type strain or a starting strain.
[0091] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0092] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0093] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0094] (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0095] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0096] (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain;
[0097] (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain;
[0098] (b 10 ) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain;
[0099] (b 11 ) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain.
[0100] [8]. The method for constructing a recombinant strain according to [7], wherein the method comprises the following steps:
[0101] (b1) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain.
[0102] [9]. The method for constructing a recombinant strain according to [8], wherein the method further comprises the following steps:
[0103] (b2) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding thereof, compared to the wild type strain or the starting strain.
[0104]
[0010] . The method for constructing a recombinant strain according to [9], wherein the method further comprises:
[0105] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain; or,
[0106] The method further comprises:
[0107] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain,
[0108] (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof, compared to the wild type strain or the starting strain; or,
[0109] The method further comprises:
[0110] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain,
[0111] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain, and
[0112] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain; or,
[0113] The method further comprises:
[0114] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide that is at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0115] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0116] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain, and
[0117] (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same compared to the wild type strain or the original strain; or,
[0118] The method further comprises:
[0119] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same compared to the wild type strain or the original strain,
[0120] (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same compared to the wild type strain or the original strain,
[0121] (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same compared to the wild type strain or the original strain,
[0122] (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same compared to the wild type strain or the original strain, and
[0123] (b7) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding thereof compared to the wild type strain or the original strain; or,
[0124] The method further comprises:
[0125] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof compared to the wild type strain or the original strain,
[0126] (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof compared to the wild type strain or the original strain,
[0127] (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding thereof compared to the wild type strain or the original strain,
[0128] (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding thereof compared to the wild type strain or the original strain,
[0129] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0130] (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or,
[0131] The method further comprises:
[0132] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0133] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0134] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0135] (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0136] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0137] (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0138] (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or,
[0139] The method further comprises:
[0140] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0141] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0142] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0143] (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0144] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0145] (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0146] (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide that is at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain, and
[0147] (b 10 ) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide that is at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 21 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain; or,
[0148] The method further comprises:
[0149] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide that is at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0150] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0151] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0152] (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0153] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0154] (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0155] (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0156] (b 10 ) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0157] (b 11Compared to the wild-type strain or the originating strain, the activity of the polypeptide as shown in SEQ ID NO:22 or the polypeptide with at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95% or 99% identity with the polypeptide shown in SEQ ID NO:22 and / or the expression level of its encoding gene are reduced or eliminated.
[0158]
[0011] . A method for producing dehydroepiandrosterone, wherein the method comprises: a step of fermenting a recombinant strain obtained by using phytosterols or cholesterol as a substrate, using any one of the recombinant strains described in [1] to [6], or a recombinant strain obtained by any one of the construction methods described in [7] to
[0010] .
[0159]
[0012] . According to the method described in
[0011] , in the step of carrying out the fermentation reaction, the pH is 5.0 to 9.0 and the reaction temperature is 20℃ to 65℃.
[0160]
[0013] . The method according to
[0011] or
[0012] , wherein the method further includes the step of purifying or separating the dehydroepiandrosterone.
[0161]
[0014] . The application of the recombinant strain described in any one of [1] to [6], or the recombinant strain obtained according to the construction method described in any one of [7] to
[0010] , in the production of dehydroepiandrosterone.
[0162] The effects of the invention
[0163] The genetically engineered bacteria disclosed in this disclosure, by knocking out the NAD(P)-dependent oxidase encoding gene in the starting strain, have for the first time achieved the direct production of DHEA from phytosterols and / or cholesterol through a one-step bio-fermentation transformation without substrate protection or product deprotection. Furthermore, knocking out the sterol Δ-isomerase encoding gene based on the aforementioned genetically engineered bacteria significantly increases DHEA yield, allowing DHEA to accumulate as the main product. Moreover, by additionally knocking out the encoding genes for oxidoreductase, dehydrogenase, and ACP-reductase, the proportion of byproducts 4-AD and androstenediol can be reduced, improving both DHEA yield and purity, facilitating subsequent processing and application. Attached Figure Description
[0164] Figure 1 shows the metabolic pathway of cholesterol in microorganisms.
[0165] Figure 2 shows the PCR validation results of the orD1 gene knockout; lanes 1-2 are validation strains, lane 2 is the gene knockout successful strain, and M is the molecular weight marker.
[0166] Figure 3 shows the orD2 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 1 is a successful gene knockout strain, and M is a molecular weight marker.
[0167] Figure 4 shows the orD1 gene knockout PCR verification results; lanes 1-3 are verification strains, lane 3 is a successful gene knockout strain, and M is a molecular weight marker.
[0168] Figure 5 shows the orD3 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0169] Figure 6 shows the orD4 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 1 is a successful gene knockout strain, and M is a molecular weight marker.
[0170] Figure 7 shows the orD5 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0171] Figure 8 shows the orD6 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0172] Figure 9 shows the orD7 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0173] Figure 10 shows the orD8 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0174] Figure 11 shows the orD9 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 1 is a successful gene knockout strain, and M is a molecular weight marker.
[0175] Figure 12 shows the orD10 gene knockout PCR verification results; lanes 1-3 are verification strains, lanes 2 and 3 are successful gene knockout strains, and M is a molecular weight marker.
[0176] Figure 13 shows the orD11 gene knockout PCR verification results; lanes 1-2 are verification strains, lane 2 is a successful gene knockout strain, and M is a molecular weight marker.
[0177] Figure 14 shows M4 and M40 strain product detection; a represents the fermentation broth extraction sample of the starting strain M4; b represents the fermentation broth extraction sample of the NAD(P)-dependent oxidase (ORD2) gene deletion strain M40; and c represents the DHEA standard.
[0178] Figure 15 shows M40 and M63 strain product testing; a represents the fermentation extract sample of ORD2 gene deletion strain M40; b represents the fermentation extract sample of ORD1 and ORD2 gene deletion strain M63.
[0179] Figure 16 shows M63 and M43 strain product testing; a represents the fermentation extract sample of ORD1 and ORD2 gene deletion strain M63; b represents the fermentation extract sample of ORD1, ORD2 and ORD3 gene deletion strain M43.
[0180] Figure 17 shows M43 and M45 strain product testing; a represents the fermentation extract sample of ORD1, ORD2 and ORD3 gene deletion strain M43; b represents the fermentation extract sample of ORD1, ORD2, ORD3 and ORD4 gene deletion strain M45.
[0181] Figure 18 shows M45 and M50 strain product testing; a represents the fermentation extract sample of ORD1, ORD2, ORD3 and ORD4 gene deletion strain M45; b represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4 and ORD5 gene deletion strain M50.
[0182] Figure 19 shows M50 and M86 strain product testing; a represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4 and ORD5 gene deletion strain M50; b represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4, ORD5 and ORD6 gene deletion strain M86.
[0183] Figure 20 shows M86 and M90 strain product testing; a represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4, ORD5 and ORD6 gene deletion strain M86; b represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6 and ORD7 gene deletion strain M90.
[0184] Figure 21 shows M90 and M87 strain product testing; a represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6 and ORD7 gene deletion strain M90; b represents the fermentation extract sample of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7 and ORD8 gene deletion strain M87.
[0185] Figure 22 shows M87 and M92 strain product detection; a indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, and ORD8 gene deletion strain fermentation extract samples; b indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, and ORD9 gene deletion strain fermentation extract samples.
[0186] Figure 23 shows M92 and M93 strain product detection; a indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, and ORD9 gene deletion strain M92 fermentation extract samples; b indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, and ORD10 gene deletion strain M93 fermentation extract samples.
[0187] Figure 24 shows M93 and M95 strain product detection; a indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, and ORD10 gene deletion strain M93 fermentation extract samples; b indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, ORD10, and ORD11 gene deletion strain M95 fermentation extract samples.
[0188] Figure 25 shows DHEA standard and M95 strain product detection; a indicates DHEA standard sample; b indicates ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, ORD10, and ORD11 gene deletion strain M95 fermentation extract samples.
[0189] Figure 26 shows oxidoreductase, isomerase, dehydrogenase, and reductase catalyze DHEA to diol.
[0190] Figure 27 is a product detection diagram for enzyme catalyzed DHEA to diol.
[0191] Figure 28 shows oxidoreductase, isomerase, dehydrogenase, and reductase catalyze DHEA to AD.
[0192] Figure 29 is a product detection diagram for enzyme catalyzed DHEA to AD. DETAILED DESCRIPTION
[0193] Various illustrative embodiments, features and aspects of the present application are described below. The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.
[0194] In addition, for the purpose of better illustrating the present application, numerous specific details are set forth in the following detailed description. One skilled in the art will understand, however, that the application can be practiced without certain of the specific details herein. In other instances, well-known methods, apparatuses, devices and steps have not been described in detail since they can be readily understood by one skilled in the art.
[0195] In the present specification, units used are international standard units, and the numerical values and numerical value ranges appearing in the present application should be understood to include systematic errors that are inevitable in industrial production.
[0196] In the present specification, the meaning of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.
[0197] In the present specification, the expressions "some embodiments / some preferred embodiments", "other embodiments / other preferred embodiments", "embodiments", and the like mean that the specific elements (for example, features, structures, properties, and / or characteristics) described in relation to the embodiments are included in at least one of the embodiments described herein, and can or can not be present in other embodiments. In addition, it should be understood that the described elements can be combined in various embodiments in any suitable manner.
[0198] In the present specification, the numerical value range expressed by "numerical value A to numerical value B" means a range including the end point numerical values A and B.
[0199] In the present specification, the term "converting" means a chemical conversion from one molecule to another molecule mainly catalyzed by one or more polypeptides (enzymes); it can also mean the ratio (in %) between the molar amount of the desired product and the molar amount of the limiting substrate, although other organic or inorganic catalysts can be used.
[0200] In the present specification, the term "dehydroepiandrosterone" is also known as dehydroisoandrosterone, dehydroepiandrosterone, abbreviated as DHEA, and has the chemical formula C 19 H 28 O2, and the chemical name is 3β-hydroxy-5-androsten-17-one, and the CAS number is: 53-43-0.
[0201] In the present specification, the terms "polypeptide", "enzyme", "polypeptide or enzyme", "polypeptide / enzyme", and "protein" have the same meaning and can be used interchangeably in the present disclosure. The aforementioned terms refer to a polymer composed of many amino acids through a peptide bond, which can be formed by amino acids of any length, which can or can not contain modifications such as phosphate groups and formyl groups.
[0202] In the present specification, the term "expression" includes any steps involving RNA production and protein production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0203] In the present specification, the term "microorganism" is a general term for microscopic organisms that are difficult to observe with the naked eye, including bacteria, fungi, and the like. Since the surface area to volume ratio of a microorganism is large, it can rapidly exchange substances with the outside environment, producing metabolites. The microorganism in the present disclosure specifically refers to a fermentation microorganism that can be fermented and cultured to produce metabolites such as proteins, sugars, lipids, amino acids, nucleotides, and the like.
[0204] In the present specification, the term "recombinant strain" is a modified microorganism obtained by genetic engineering. Embodiments include but are not limited to introduction of a recombinant gene, knock-out, knock-down treatment of an endogenous gene of a microorganism, and the like. Among them, the term "recombinant gene" is a gene that does not exist in nature, and the recombinant gene includes a protein coding sequence operably linked to an expression control sequence. Embodiments include but are not limited to introduction of an exogenous gene of a microorganism, an endogenous protein coding sequence operably linked to an exogenous promoter, and a gene having a modified protein coding sequence. The recombinant gene is stored on the genome of the microorganism, a plasmid free in the microorganism, or a bacteriophage in the microorganism.
[0205] In some embodiments, the reduced or lost protein activity, the reduced or lost expression level of a protein-encoding gene, the reduced or lost enzyme activity, the reduced or lost expression level of an enzyme-encoding gene in the recombinant strain are obtained by the following genetic engineering methods: introduction of a weak promoter, a weak ribosome binding site into the cell of a microorganism, gene knock-out or knock-down of a protein- or enzyme-encoding gene, insertion of a random fragment into a protein- or enzyme-encoding gene to lose the activity of the protein or enzyme.
[0206] In the present specification, the term "starting strain" refers to a strain selected as a prior strain for a subsequent genetic engineering modification step. In other words, the "starting strain" refers to a control strain before each modification step.
[0207] In the present specification, the term "wild-type strain" refers to an original microorganism that has not been subjected to any genetic editing.
[0208] In the present specification, the term "endogenous" refers to a polynucleotide, polypeptide, or other compound that is naturally expressed or produced within an organism or cell. That is, an endogenous polynucleotide, polypeptide, or other compound is not exogenous. For example, a "endogenous" polynucleotide or polypeptide is present in a cell when the cell is initially isolated from nature.
[0209] In the present specification, the term "exogenous" refers to any polynucleotide or polypeptide that is not naturally found or expressed in the particular cell or organism in which expression is desired. An exogenous polynucleotide, polypeptide, or other compound is not endogenous.
[0210] In the present specification, the term "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion, or addition of one or more amino acids or nucleotides". In the present disclosure, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".
[0211] In one embodiment, the "mutation" of the present disclosure can be selected from "conservative mutations". In the present disclosure, the term "conservative mutation" refers to a mutation that can normally maintain the function of a protein. A representative example of a conservative mutation is conservative substitution.
[0212] In the present specification, the term "conservative substitution" involves replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include those with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), beta-branched side chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). In the present specification, "conservative substitution" generally exchanges one amino acid at one or more positions of a protein. Such substitution can be conservative. In addition to substitutions that are considered as conservative substitutions, conservative mutations also include naturally occurring mutations due to individual differences, strain, species differences, etc. of a gene source.
[0213] In the present specification, the term "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment, or can be a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence isolated at least once in terms of quantity or concentration, and is capable of being identified, manipulated, and the sequence and its component nucleotide sequence are recovered by standard molecular biology methods (e.g., using a cloning vector). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" is substituted for "T". In other words, "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure or composition, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences. "Recombinant polynucleotide" is one of "polynucleotide".
[0214] In the present specification, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to suitable control sequences for expression of a gene of interest in a suitable host. "Recombinant expression vector" refers to a DNA construct used to express, for example, a polynucleotide encoding a desired polypeptide. The recombinant expression vector can include, for example, a transcription unit comprising i) a set of genetic elements having a regulatory role on gene expression, such as a promoter and an enhancer; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) appropriate transcription and translation initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector can be used, including plasmids, viruses, bacteriophages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, bacteriophage DNA, yeast plasmids, and vectors derived from combinations of plasmids and bacteriophage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.
[0215] In the present specification, the term "transduction" has the meaning commonly understood by those skilled in the art, i.e., the process of introducing foreign DNA into a host. The method of transformation includes any method of introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
[0216] The culture of the recombinant strain of the present disclosure can be performed according to the conventional methods in the art, including but not limited to well plate culture, shake flask culture, fermenter culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to the actual situation.
[0217] Unless otherwise defined or indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.
[0218] The technical solutions of the present disclosure are described in detail as follows:
[0219] The inventors found that the strain originally only capable of producing AD (androstenedione) but not DHEA (dehydroepiandrosterone) could produce a small amount of DHEA after knocking out the orD2 gene, indicating that the recombinant strain with the orD2 gene knocked out could directly ferment and convert plant sterols and / or cholesterol to produce DHEA. Further, knocking out the orD1 gene encoding the sterol Δ-isomerase on the basis of knocking out the orD2 gene could significantly increase the content of DHEA, and DHEA as the main product could greatly reduce the content of AD as the by-product. On this basis, further knocking out the genes orD3, orD4, orD5, orD7, and orD6, orD8, orD9, orD10, orD11 encoding the SDR family oxidases could further increase the yield and / or purity of the product DHEA, and after knocking out the orD6 gene, the by-product androstenediol could be eliminated, making the product more pure, facilitating subsequent processing and application.
[0220] In some embodiments of the present disclosure, the proteins encoded by the genes orD1, orD2, orD3, orD5, orD7, orD8, orD9 also have the function of catalyzing the C3 and C17 positions of DHEA, which are also referred to as "3 / 17β-hydroxysteroid dehydrogenase" in the present disclosure; the proteins encoded by the genes orD4 and orD10 have the function of catalyzing the C3 position of DHEA, which are also referred to as "3β-hydroxysteroid dehydrogenase" in the present disclosure; and the proteins encoded by the genes orD6 and orD11 also have the function of catalyzing the C17 position of DHEA, which are also referred to as "17β-hydroxysteroid dehydrogenase" in the present disclosure.
[0221] In some embodiments of the present disclosure, the nucleotide sequences of the genes orD1-11 are as shown in SEQ ID NO: 1-11, and the amino acid sequences of the ORD1-11 encoded by the genes orD1-11 are as shown in SEQ ID NO: 12-22.
[0222] <Strains for producing dehydroepiandrosterone>
[0223] According to some embodiments of the present disclosure, a recombinant strain for producing dehydroepiandrosterone is provided, wherein the recombinant strain has the following property (a1):
[0224] (a1) Compared with a wild-type strain or a starting strain, the recombinant strain has a polypeptide having an identity of at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% to the polypeptide shown in SEQ ID NO: 13, and / or a decrease or disappearance of the expression level of a gene encoding the polypeptide, and the recombinant strain is used as a fermentation strain to achieve dehydroepiandrosterone in the fermentation product from "none" to "yes" using phytosterol or cholesterol as a substrate.
[0225] Further, the recombinant strain has the following property (a2):
[0226] (a2) The recombinant strain has a polypeptide shown in SEQ ID NO: 12 or a polypeptide having an identity of at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% to the polypeptide shown in SEQ ID NO: 12, and / or a decrease or disappearance of the expression level of a gene encoding the polypeptide.
[0227] Further, the recombinant strain has at least one of the following (a3) to (a 11 ) characteristics compared to the wild-type microorganism or the starting strain:
[0228] (a3) the expression level of a polypeptide as shown in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 14 and / or a gene encoding the same is reduced or disappeared in the recombinant strain;
[0229] (a4) the expression level of a polypeptide as shown in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as shown in SEQ ID NO: 15 and / or a gene encoding the same is reduced or disappeared in the recombinant strain;
[0230] (a5) the expression level of a polypeptide as shown in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 16 and / or a gene encoding the same is reduced or disappeared in the recombinant strain;
[0231] (a6) the expression level of a polypeptide as shown in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 17 and / or a gene encoding the same is reduced or disappeared in the recombinant strain;
[0232] (a7) the expression level of a polypeptide as shown in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as shown in SEQ ID NO: 18 and / or a gene encoding the same is reduced or disappeared in the recombinant strain;
[0233] (a8) the recombinant strain has reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same;
[0234] (a9) the recombinant strain has reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same;
[0235] (a 10 ) the recombinant strain has reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same;
[0236] (a 11 ) the recombinant strain has reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same.
[0237] In some specific embodiments, the recombinant strain has any one of the following (A) to (I) in addition to (a1) and (a2) above:
[0238] (A) the recombinant strain has the following property in addition to the wild-type strain or the starting strain:
[0239] (a3) the recombinant strain has reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same;
[0240] (B) the recombinant strain has the following property in addition to the wild-type strain or the starting strain:
[0241] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and
[0242] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0243] (C) the recombinant strain further has the property that, compared to the wild-type strain or the starting strain:
[0244] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0245] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and
[0246] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0247] (D) the recombinant strain further has the property that, compared to the wild-type strain or the starting strain:
[0248] (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide,
[0249] (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide,
[0250] (a5) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide;
[0251] (a6) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide;
[0252] (E) the recombinant strain further has a property compared to the wild type strain or the starting strain:
[0253] (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide,
[0254] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0255] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0256] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0257] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0258] (F) the recombinant strain further has the following property compared to the wild-type strain or the starting strain:
[0259] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0260] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain,
[0261] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0262] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0263] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0264] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain;
[0265] (G) the recombinant strain further has the following property compared to the wild-type strain or the starting strain:
[0266] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0267] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0268] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0269] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0270] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0271] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain;
[0272] (a9) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same;
[0273] (H) the recombinant strain further has a property:
[0274] (a3) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same,
[0275] (a4) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same,
[0276] (a5) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same;
[0277] (a6) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same;
[0278] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same in the recombinant strain is reduced or eliminated;
[0279] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same in the recombinant strain is reduced or eliminated;
[0280] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; and,
[0281] (a 10 ) the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same in the recombinant strain is reduced or eliminated;
[0282] (I) the recombinant strain further has a property:
[0283] (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same in the recombinant strain is reduced or eliminated,
[0284] (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0285] (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain
[0286] (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0287] (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0288] (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0289] (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain,
[0290] (a 10) a decrease or absence of expression of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or its encoding gene in the recombinant strain, and
[0291] (a 11 ) a decrease or absence of expression of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or its encoding gene.
[0292] In some specific embodiments, the "decrease or absence of a polypeptide activity" described herein means that the expression of the polypeptide is reduced, weakened or even completely eliminated compared to a wild type strain or a starting strain, or means that a gene is produced which does not express, or although expresses, the expression product does not have activity or has reduced activity. In some more specific embodiments, the expression of the encoding gene of the polypeptide is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% compared to a wild type or endogenous polypeptide, or the encoding gene of the wild type or endogenous polypeptide is removed.
[0293] In some embodiments, the decrease or absence of the polypeptide activity can be achieved by one or a combination of the following methods:
[0294] partial or complete knock-out of a gene encoding a polypeptide; mutation of the encoding gene; alteration of the promoter, translational regulatory region, or coding region codons of the encoding gene to weaken transcription or translation; alteration of the sequence of the encoding gene to weaken the stability of the mRNA or the structure of the encoded protein; or any other means of inactivating the gene by modifying the coding region and its adjacent upstream and downstream regions. More specifically, including but not limited to, by deleting part or all of the encoding gene, frame shift mutation of the gene reading frame, weakening the transcription or translation strength, or using a gene or allele encoding a corresponding enzyme or protein with lower activity, or making the corresponding gene or enzyme lose activity, and optionally combining the use of these methods. The reduction of gene expression can be achieved by using appropriate culture methods or genetic modification (mutation) of the signal structure of gene expression, such as repressor genes, active genes, operons, promoters, attenuators, ribosome binding sites, start codons, and terminators. In some preferred embodiments, including frame shift mutation, missense mutation, deletion, start codon change, etc. of the gene coding sequence.
[0295] In some exemplary embodiments,
[0296] The coding gene of the polypeptide shown in SEQ ID NO: 12 is shown in SEQ ID NO: 1;
[0297] The coding gene of the polypeptide shown in SEQ ID NO: 13 is shown in SEQ ID NO: 2;
[0298] The coding gene of the polypeptide shown in SEQ ID NO: 14 is shown in SEQ ID NO: 3;
[0299] The coding gene of the polypeptide shown in SEQ ID NO: 15 is shown in SEQ ID NO: 4;
[0300] The coding gene of the polypeptide shown in SEQ ID NO: 16 is shown in SEQ ID NO: 5;
[0301] The coding gene of the polypeptide shown in SEQ ID NO: 17 is shown in SEQ ID NO: 6;
[0302] The coding gene of the polypeptide shown in SEQ ID NO: 18 is shown in SEQ ID NO: 7;
[0303] The coding gene of the polypeptide shown in SEQ ID NO: 19 is shown in SEQ ID NO: 8;
[0304] The coding gene of the polypeptide shown in SEQ ID NO: 20 is shown in SEQ ID NO: 9;
[0305] The coding gene of the polypeptide represented by SEQ ID NO: 21 is represented by SEQ ID NO: 10.
[0306] The coding gene of the polypeptide represented by SEQ ID NO: 22 is represented by SEQ ID NO: 11.
[0307] In some embodiments, the DHEA production of the dehydroepiandrosterone-producing strain is at least 5%, 15%, 20%, 25%, 30%, 35% higher, or at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold higher than that of a wild-type or endogenous polypeptide-comprising dehydroepiandrosterone-producing strain.
[0308] As used herein, the term "dehydroepiandrosterone-producing strain" refers to a strain that can produce dehydroepiandrosterone and is capable of accumulating dehydroepiandrosterone when the bacteria is cultured in a culture medium, or is capable of secreting dehydroepiandrosterone into the culture medium, i.e., is capable of obtaining extracellular free dehydroepiandrosterone. For example, it can be a naturally occurring dehydroepiandrosterone-producing strain, or an engineered dehydroepiandrosterone-producing strain obtained through genetic modification.
[0309] In some embodiments, the recombinant strain comprises a microorganism of the order Actinomycetes. Further comprising a microorganism of the family Actinomycetaceae, Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae, Brevibacteriaceae, Streptomycetaceae, Pseudomonadaceae, or Micrococcaceae; as preferred, the recombinant strain comprises a microorganism of the genus Rhodococcus, Mycobacterium, Mycolicibacterium, Arthrobacter, Nocardia, Streptomyces, or Pseudomonas. In some exemplary embodiments, the recombinant strain is Mycobacterium neoaurum NRRL B-3805 as the starting strain, which is genetically modified to superimpose knockouts of 3-steroid-Δ 1,2- M4 strain is obtained by dehydrogenase (GenBank: AMO08643.1), 3-steroidone-9a-hydroxylase (GenBank: AMO05156.1 and AMO07671.1) and aldehyde cleavage enzyme (GenBank: AMO05741.1). Alternatively, it is obtained by knocking out or reducing the expression level of the target gene in the way of upstream and downstream homologous arms of dehydrogenase encoding gene, 3-steroidone-9a-hydroxylase encoding gene and aldehyde cleavage enzyme encoding gene. 1,2 - M4 strain is obtained by dehydrogenase (GenBank: AMO08643.1), 3-steroidone-9a-hydroxylase (GenBank: AMO05156.1 and AMO07671.1) and aldehyde cleavage enzyme (GenBank: AMO05741.1). Alternatively, it is obtained by knocking out or reducing the expression level of the target gene in the way of upstream and downstream homologous arms of dehydrogenase encoding gene, 3-steroidone-9a-hydroxylase encoding gene and aldehyde cleavage enzyme encoding gene.
[0310] In some embodiments of the present disclosure, the strains with low activity or no activity of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, ORD10 and / or ORD11 obtained by mutagenesis and screening, or the strains with low activity or no activity of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, ORD10 and / or ORD11 obtained by other methods as long as the activity of ORD1, ORD2, ORD3, ORD4, ORD5, ORD6, ORD7, ORD8, ORD9, ORD10 and / or ORD11 is inhibited at the same time, can all achieve the same purpose of high-efficiency conversion of phytosterols and / or cholesterols to produce DHEA, and are all within the protection scope of the present disclosure.
[0311] In some embodiments of the present disclosure, in the Actinomycetales as described above, or in the Actinomycetaceae, Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae, Brevibacteriaceae, Streptomycetaceae, Pseudomonadaceae, or Micrococcaceae as described above, a polypeptide having, for example, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 70% identity to the polypeptide shown in any one of SEQ ID NOs: 12 to 22, which performs the same or similar function in different microorganisms or in the same organism (for example, the same or similar function of catalyzing the C3 and C17 positions of DHEA possessed by the polypeptide shown in SEQ ID NOs: 12 to 14, 16, 18 to 20; or the same or similar function of catalyzing the C3 position of DHEA possessed by the polypeptide shown in SEQ ID NO: 15 or 21; or the same or similar function of catalyzing the C17 position of DHEA possessed by the polypeptide shown in SEQ ID NO: 17 or 22) is knocked out. Or in the Actinomycetales as described above, or in the Actinomycetaceae, Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae, Brevibacteriaceae, Streptomycetaceae, Pseudomonadaceae, or Micrococcaceae as described above, even if the identity or similarity to the polypeptide shown in any one of SEQ ID NOs: 12 to 22 is low, a polypeptide having the same or similar function (for example, having the function of catalyzing the C3 and C17 positions of DHEA, the function of catalyzing the C3 position of DHEA, or the function of catalyzing the C17 position of DHEA) to the polypeptide shown in any one of SEQ ID NOs: 12 to 22 should also be included in the protection scope of the present disclosure.
[0312] Table 1
[0313] Table 2
[0314] Table 3
[0315] Table 4
[0316] Table 5
[0317] Table 6
[0318] Table 7
[0319] Table 8
[0320] Table 9
[0321] Table 10
[0322] Table 11
[0323] Table 12
[0324] Method for constructing a recombinant strain for producing dehydroepiandrosterone
[0325] According to some embodiments of the present disclosure, there is provided a method for constructing a recombinant strain for producing dehydroepiandrosterone, the method wherein the method comprises the step of (b1):
[0326] (b1) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or a gene encoding thereof, as compared to a wild type strain or a starting strain.
[0327] In some embodiments, the method further comprises the step of (b2):
[0328] (b2) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding thereof, as compared to a wild type strain or a starting strain.
[0329] In some embodiments, the method further comprises at least one of the following steps:
[0330] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, as compared to a wild type strain or a starting strain;
[0331] (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof, as compared to a wild type strain or a starting strain;
[0332] (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding thereof, compared to the wild type strain or the starting strain;
[0333] (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding thereof, compared to the wild type strain or the starting strain;
[0334] (b7) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding thereof, compared to the wild type strain or the starting strain;
[0335] (b8) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding thereof, compared to the wild type strain or the starting strain;
[0336] (b9) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding thereof, compared to the wild type strain or the starting strain;
[0337] (b 10) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the polypeptide, as compared to the wild type strain or the starting strain;
[0338] (b 11 ) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the polypeptide, as compared to the wild type strain or the starting strain.
[0339] In some exemplary embodiments, on the basis of comprising the steps as set forth in (b1) and (b2), the method further comprises:
[0340] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, as compared to the wild type strain or the starting strain; or,
[0341] The method further comprises:
[0342] (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, as compared to the wild type strain or the starting strain, and
[0343] (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, as compared to the wild type strain or the starting strain; or,
[0344] The method further comprises:
[0345] (b3) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof compared to the wild type strain or the starting strain,
[0346] (b4) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof compared to the wild type strain or the starting strain, and
[0347] (b5) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding thereof compared to the wild type strain or the starting strain; or,
[0348] The method further comprises:
[0349] (b3) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof compared to the wild type strain or the starting strain,
[0350] (b4) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof compared to the wild type strain or the starting strain, and
[0351] (b5) a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16, and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, and
[0352] (b6) a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17, and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain; or,
[0353] The method further comprises:
[0354] (b3) a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14, and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain,
[0355] (b4) a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15, and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain,
[0356] (b5) a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16, and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain,
[0357] (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0358] (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or,
[0359] The method further comprises:
[0360] (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0361] (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0362] (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0363] (b6) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0364] (b7) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0365] (b8) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or,
[0366] The method further comprises:
[0367] (b3) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0368] (b4) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0369] (b5) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0370] (b6) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0371] (b7) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0372] (b8) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and
[0373] (b9) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or,
[0374] The method further comprises:
[0375] (b3) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide that is at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0376] (b4) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0377] (b5) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0378] (b6) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide that is at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 17 and / or expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0379] (b7) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide that is at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 18 and / or expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0380] (b8) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or an expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0381] (b9) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or an expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain, and
[0382] (b 10 ) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or an expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain;
[0383] The method further comprises:
[0384] (b3) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or an expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0385] (b4) a reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or an expression level of a gene encoding the polypeptide compared to the wild type strain or the starting strain,
[0386] (b5) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0387] (b6) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0388] (b7) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0389] (b8) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0390] (b9) reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain,
[0391] (b 10) reduce or eliminate the expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the polypeptide as compared to a wild type strain or a starting strain, and
[0392] (b 11 ) reduce or eliminate the expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the polypeptide as compared to a wild type strain or a starting strain.
[0393] In some exemplary embodiments,
[0394] a gene encoding the polypeptide as set forth in SEQ ID NO: 12 is as set forth in SEQ ID NO: 1 ;
[0395] a gene encoding the polypeptide as set forth in SEQ ID NO: 13 is as set forth in SEQ ID NO: 2;
[0396] a gene encoding the polypeptide as set forth in SEQ ID NO: 14 is as set forth in SEQ ID NO: 3;
[0397] a gene encoding the polypeptide as set forth in SEQ ID NO: 15 is as set forth in SEQ ID NO: 4;
[0398] a gene encoding the polypeptide as set forth in SEQ ID NO: 16 is as set forth in SEQ ID NO: 5;
[0399] a gene encoding the polypeptide as set forth in SEQ ID NO: 17 is as set forth in SEQ ID NO: 6;
[0400] a gene encoding the polypeptide as set forth in SEQ ID NO: 18 is as set forth in SEQ ID NO: 7;
[0401] a gene encoding the polypeptide as set forth in SEQ ID NO: 19 is as set forth in SEQ ID NO: 8;
[0402] a gene encoding the polypeptide as set forth in SEQ ID NO: 20 is as set forth in SEQ ID NO: 9;
[0403] a gene encoding the polypeptide as set forth in SEQ ID NO: 21 is as set forth in SEQ ID NO: 10;
[0404] The coding gene of the polypeptide shown in SEQ ID NO: 22 is shown in SEQ ID NO: 11.
[0405] In some embodiments, the reduction or elimination of the expression level of the polypeptide or its coding gene can be achieved by one or a combination of the following methods:
[0406] partial or complete knockout of the coding gene of the polypeptide; mutation of the coding gene; alteration of the promoter, translation regulatory region or coding region codon of the coding gene to weaken its transcription or translation; alteration of the coding gene sequence to weaken the stability of its mRNA or the structure of the encoded protein; or any other way of inactivating the gene by modifying its coding region and its adjacent upstream and downstream regions, etc. In some preferred embodiments, the gene coding sequence is subjected to frame shift mutation, missense mutation, deletion, initiation codon alteration, etc.
[0407] <Method for producing dehydroepiandrosterone>
[0408] According to some embodiments of the present disclosure, a method for producing dehydroepiandrosterone is provided, wherein the method comprises: performing a fermentation reaction using a recombinant strain described in the above <Recombinant strain for producing dehydroepiandrosterone> or obtained by the construction method described in the above <Construction method of recombinant strain for producing dehydroepiandrosterone> with phytosterol or cholesterol as a substrate.
[0409] In some embodiments, the source of phytosterol of the present application is not particularly limited, for example, the phytosterol can be derived from various plant oils, nuts, plant seeds, vegetables and / or fruits. Specific examples of phytosterols include: the phytosterol is selected from a mixture of one or more of stigmasterol, brassicasterol, campesterol, beta-sitosterol, avenasterol and ergosterol. Exemplarily, the phytosterol comprises sitosterol, campesterol, stigmasterol and brassicasterol, and optionally, the mass ratio is 50:20:20:10.
[0410] In some embodiments, in the step of performing a fermentation reaction, the pH is 7.0-8.0, and the reaction temperature is 20-40°C.
[0411] In some embodiments, the method further comprises the step of purifying or isolating the dehydroepiandrosterone.
[0412] <Use of recombinant strain or construction method>
[0413] According to some embodiments of the present disclosure, the use of the recombinant strain described in the above <Recombinant strain for producing dehydroepiandrosterone> or obtained by the construction method described in the above <Construction method of recombinant strain for producing dehydroepiandrosterone> in the production of dehydroepiandrosterone is provided.
[0414] In some specific embodiments, the application is the fermentation conversion of phytosterols or cholesterols to dehydroepiandrosterone using the recombinant strain.
[0415] Examples
[0416] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. The specific conditions not specified in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be obtained by purchase.
[0417] Example 1: Function exploration of ORD1-ORD11 genes
[0418] The primers were designed, the genes were amplified (the nucleotide sequences of ORD1-ORD11 are shown in SEQ ID NO: 1-11), and the 3 / 17β-hydroxysteroid dehydrogenase (ORD1-ORD11) heterologous expression strains were constructed by connecting with the pET28a (enzyme digestion sites NcoI and XhoI) expression vector. The expression host was BL21 strain. Seed liquid culture, transfer, when the OD value reached about 0.8, 0.1 mM IPTG was added, and the expression was induced overnight at 25°C. The bacterial cells were collected, and the reaction system was constructed according to Table 13 and Table 14, respectively. The reaction process is shown in Figure 26 and Figure 28.
[0419] Table 13
[0420] Table 14
[0421] TLC detection results: ORD1, ORD2, ORD3, ORD5, ORD8, ORD9 have C3 / C17 catalytic function; ORD4, ORD10 only have C3 catalytic function; ORD6, ORD11 only have C17 catalytic function.
[0422] Example 2: Construction and screening of knockout strains
[0423] 1) Construction of gene knockout plasmid
[0424] In this embodiment, the gene is knocked out by homologous recombination. For details, refer to the method disclosed in the reference Parish, T.; Stoker, N. G. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology. 2000, 146, 1969-1975.
[0425] The upstream and downstream fragments of orD1, orD2, orD3, orD4, orD5, orD6, orD7, orD8, orD9, orD10, and orD11 were amplified using the upstream and downstream primers (SEQ ID NO: 23-66) with the upstream and downstream of the orD1, orD2, orD3, orD4, orD5, orD6, orD7, orD8, orD9, orD10, and orD11 gene (the nucleotide sequence is shown as SEQ ID NO: 1-11) as templates, respectively.
[0426] The amplified upstream and downstream fragments were simultaneously ligated with the p2NIL vector fragment (linear fragment obtained by enzyme digestion, KpnI and PstI), and the pGOAL19 vector fragment (linear fragment obtained by PacI enzyme digestion) using the ClonExpress MultiS One Step Cloning Kit to obtain the ligation products containing the upstream and downstream fragments of orD1, orD2, orD3, orD4, orD5, orD6, orD7, orD8, orD9, orD10, and orD11, respectively. The ligation products were transformed into DH5α competent cells, respectively, and plated on Kan, Hyg double-antibiotic plates with IPTG and X-Gal, and incubated at 37°C overnight. After culturing the blue single colonies and extracting plasmids for PacI single enzyme digestion verification, sequencing was further performed to confirm that the plasmids containing orD1, orD2, orD3, orD4, orD5, orD6, orD7, orD8, orD9, orD10, and orD11 were successfully constructed, and were named pKH del -orD1, pKH del -orD2, pKH del -orD3, pKH del -orD4, pKH del -orD5, pKH del -orD6, pKH del -orD7, pKH del -orD8, pKH del -orD9, pKH del -orD10, and pKHdel - orD11.
[0427] PCR system:
[0428] PCR program: 94°C 5 min; 30 cycles of 94°C 30 s, 60°C 30 s, 68°C 1 kb / min, 68°C 20 min.
[0429] The primer sequences used in PCR are (the underlined part is the enzyme digestion site):
[0430] orD1
[0431] Up-F: 5'-ACGTTGTTGCCATTGCTGCAGACGAGCCGGACAATCCGGTCTG-3' (SEQ ID NO: 23),
[0432] Up-R: 5'-GTCGTTGATGAAGTAGGCCTGTAGAAGCTGCGCTGCCGGTATTG-3' (SEQ ID NO: 24),
[0433] Down-F: 5'-CAATACCGGCAGCGCAGCTTCTACAGGCCTACTTCATCAACGAC-3' (SEQ ID NO: 25),
[0434] Down-R: 5'-GTACCGCGGCCGCTTAATTAAAAGATCGCCGTTGGTTAGGTAG-3' (SEQ ID NO: 26).
[0435] orD2
[0436] Up-F: 5'-ACGTTGTTGCCATTGCTGCAGGATGAAGTGGATGTTCTGGGTGGG-3' (SEQ ID NO: 27),
[0437] Up-R:
[0438] 5'-TCTTACCGTCGGTGACCCGGTAGTACTGAGAAGCGGGCGCACAGATGTC-3' (SEQ ID NO: 28),
[0439] Down-F:
[0440] 5'-ACATCTGTGCGCCCGCTTCTCAGTACTACCGGGTCACCGACGGTAAGAG-3' (SEQ ID NO: 29),
[0441] Down-R: 5'-GTACCGCGGCCGCTTAATTAACGAGATCGTGGTGGCACACAAC-3' (SEQ ID NO: 30).
[0442] orD3
[0443] Up-F: 5'ACGTTGTTGCCATTGCTGCAGGTGCCAGGTGCGCAGATCCTTG-3' (SEQ ID NO: 31),
[0444] Up-R:
[0445] 5'-ATGTACGTGCCGACCGACTCGAGTACTAGCCGAGGAGATGGCCGAGTTG-3' (SEQ ID NO: 32),
[0446] Down-F:
[0447] 5'-AACTCGGCCATCTCCTCGGCTAGTACTCGAGTCGGTCGGCACGTACATC-3' (SEQ ID NO: 33),
[0448] Down-R: 5'-GTACCGCGGCCGCTTAATTAACAGACAGGGGGCATCGGGATTC-3' (SEQ ID NO: 34).
[0449] orD4
[0450] Up-F: 5'ACGTTGTTGCCATTGCTGCAGACGCGATCAGGGCGTCGACATC-3' (SEQ ID NO: 35),
[0451] Up-R:
[0452] 5'-CATGATCAGATCCCAGTCGAGTACTGTTGCCGAACACCTCGGCCATC-3' (SEQ ID NO: 36),
[0453] Down-F: 5'-GAGGTGTTCGGCAACAGTACTCGACTGGGATCTGATCATGCGG-3' (SEQ ID NO: 37),
[0454] Down-R: 5'-GTACCGCGGCCGCTTAATTAAGTTCCGCTACGACAATGTGCCG-3' (SEQ ID NO: 38).
[0455] orD5
[0456] Up-F: 5' ACGTTGTTGCCATTGCTGCAGGGTGTTCACCGAGGGCGTCATC-3' (SEQ ID NO: 39),
[0457] Up-R:
[0458] 5'-GCTGGAAGAACTGCGTGAGTACTGGTCGACAACGAGACCGGAGTG-3' (SEQ ID NO: 40),
[0459] Down-F: 5'-GTCTCGTTGTCGACCAGTACTCACGCAGTTCTTCCAGCCGATC-3' (SEQ ID NO: 41),
[0460] Down-R: 5'-GTACCGCGGCCGCTTAATTACTTCGGGCTGTTGGTCGGATTG-3' (SEQ ID NO: 42).
[0461] orD6
[0462] Up-F: 5'-ACGTTGTTGCCATTGCTGCAGCACCTCGGTCCCCGGAATATCG-3' (SEQ ID NO: 43),
[0463] Up-R: 5'-AACGAGGGTTTCACATCGGTCACACGACTGCTCCCC-3' (SEQ ID NO: 44),
[0464] Down-F: 5'-TCGTGTGACCGATGTGAAACCCTCGTTGCGCCATC-3' (SEQ ID NO: 45),
[0465] Down-R: 5'-GTACCGCGGCCGCTTAATTAACGCCCACAGCGATCCATGTAAG-3' (SEQ ID NO: 46).
[0466] orD7
[0467] Up-F 5’-ACGTTGTTGCCATTGCTGCAGTGGCTTCCCGCACGGAGTCTAC-3’ (SEQ ID NO: 47),
[0468] Up-R 5’-CGGCCGTCTCTATCAAGTACTATTCGGCGGCTTTGCGATTGG-3’ (SEQ ID NO: 48),
[0469] Down-F: 5’-CGCAAAGCCGCCGAATAGTACTTGATAGAGACGGCCGAGAACGC-3’ (SEQ ID NO: 49),
[0470] Down-R: 5’-GTACCGCGGCCGCTTAATTAACCTCGACGACACCGGGAATCAG-3’ (SEQ ID NO: 50).
[0471] orD8
[0472] Up-F: 5’-ACGTTGTTGCCATTGCTGCAGCTGACGGAACCAGGCCTGAAGC-3’ (SEQ ID NO: 51),
[0473] Up-R: 5’-TTCGGCTCCCTGTAGTACTATCACGGTGGCGCCGAGAAGTC-3’ (SEQ ID NO: 52),
[0474] Down-F: 5’-ACCGTGATAGTACTACAGGGAGCCGAACCGATCGTG-3’ (SEQ ID NO: 53),
[0475] Down-R: 5’-GTACCGCGGCCGCTTAATTAATCGATATCGGCGCAGATGACCTC-3’ (SEQ ID NO: 54).
[0476] orD9
[0477] Up-F: 5’-ACGTTGTTGCCATTGCTGCAGATTCGATCGGCGATGCGCTCAG-3’ (SEQ ID NO: 55),
[0478] Up-R: 5’-TGGACCTGTGCAGTACTGCGCGGACCGGATATGTCCAAC-3’ (SEQ ID NO: 56),
[0479] Down-F: 5'-TTGGACATATCCGGTCCGCGCAGTACTGCACAGGTCCACCGCGATGATG-3' (SEQ ID NO: 57),
[0480] Down-R: 5'-GTACCGCGGCCGCTTAATTAAAATGTCGGCAACCTGGTGGGTG-3' (SEQ ID NO: 58).
[0481] orD10
[0482] Up-F: 5'-ACGTTGTTGCCATTGCTGCAGCCCCTGTATGCGGCTTTATGCC-3' (SEQ ID NO: 59),
[0483] Up-R: 5'-AAGGGCAAGCGTTTCGCAGTACTACGCGGTGGTGTTCCTGTCCAG-3' (SEQ ID NO: 60),
[0484] Down-F: 5'-AACACCACCGCGTAGTACTGCGAAACGCTTGCCCTTGAGTC-3' (SEQ ID NO: 61),
[0485] Down-R: 5'-GTACCGCGGCCGCTTAATTAACTGGACACCGAGGACCTCAACC-3' (SEQ ID NO: 62).
[0486] orD11
[0487] Up-F: 5'-ACGTTGTTGCCATTGCTGCAGCGCTCGATATCGTCCAGCATGG-3' (SEQ ID NO: 63),
[0488] Up-R: 5'-GCGGTCTGTAGTACTTATCGCGGTCTTCCTGGCGAGC-3' (SEQ ID NO: 64),
[0489] Down-F: 5'-AAGACCGCGATAAGTACTACAGACCGCGGGCCATCATCAC-3' (SEQ ID NO: 65),
[0490] Down-R: 5'-GTACCGCGGCCGCTTAATTAACCAGGCCAGCCAGCTGAAGAAG-3' (SEQ ID NO: 66).
[0491] 2) Screening of knockout strains
[0492] The wild strain Mycobacterium neoaurum NRRL B-3805 (which is disclosed in the document Marsheck WJ, Kraychy S, Muir RD. Microbial degradation of sterols. [J]. Applied Microbiology, 1972, 23: 72-77, which is incorporated herein by reference) was used as the starting strain, and 3-sterol-Δ 1,2 The M4 strain was obtained by knocking out 3-sterol-Δ
[0493] The construction process of the M4 strain is as follows:
[0494] According to the construction method of the knockout plasmid pKH del -orD1, the upstream and downstream of the kstD, kshA1, kshA2, and sal genes were used as templates, and the upstream and downstream primers were used to amplify the upstream and downstream fragments of the kstD, kshA1, kshA2, and sal genes, respectively, to construct the knockout plasmid pKH del -kstD, pKH del -kshA1, pKH del -kshA2, pKH del -sal.
[0495] Primers used in PCR (underlined are enzyme digestion sites):
[0496] kstD:
[0497] Up-F: ACGTTGTTGCCATTGCTGCAGTTCGAAAGAAAGACGAACCGAACC (SEQ ID NO: 67)
[0498] Up-R:ACCCTTGGTGCCCAGAGTACTCTTGACCCCGTCACGCTGCAG(SEQ ID NO:68)
[0499] Down-F:CGTGACGGGGTCAAGAGTACTCTGGGCACCAAGGGTGGCATC(SEQ ID NO:69)
[0500] Down-R:GTACCGCGGCCGCTTAATTAAAGCGTTCCGATGAACTTGCCG(SEQ ID NO:70)
[0501] kshA1:
[0502] Up-F:ACGTTGTTGCCATTGCTGCAGAGCCACCTTCTTCACCTACGTC(SEQ ID NO:71)
[0503] Up-R:GTTGCGCGGTGGTACCGCCAGTACTTCGATCTCGCGGATATCGGTC(SEQ ID NO:72)
[0504] Down-F:GACCGATATCCGCGAGATCGAAGTACTGGCGGTACCACCGCGCAAC(SEQ ID NO:73)
[0505] Down-R:GTACCGCGGCCGCTTAATTAAAGGCCATCAGGCGAGAGACG(SEQ ID NO:74)
[0506] kshA2:
[0507] Up-F:ACGTTGTTGCCATTGCTGCAGACGTCGGGCATATCGTGATCG(SEQ ID NO:75)
[0508] Up-R:TGCGCGGACTCTTTTTGCGGCAGTACTGAATGCCGGCTGTCTCGGTAG(SEQ ID NO:76)
[0509] Down-F:GCCGCAAAAAGAGTCCGCGCAG(SEQ ID NO:77)
[0510] Down-R:GTACCGCGGCCGCTTAATTAAGAATCCGAGCCACCTGTTCGC(SEQ ID NO:78)
[0511] sal:
[0512] Up-F: ACGTTGTTGCCATTGCTGCAGGAGACGCCGTCGTATTGGAAG (SEQ ID NO: 79)
[0513] Up-R: CCTGCGGTGTTCATCGGGAAAGTACTAACAGCTGGGACTCCATGACC (SEQ ID NO: 80)
[0514] Down-F: GTCATGGAGTCCCAGCTGTTAGTACTTTCCCGATGAACACCGCAGGC (SEQ ID NO: 81)
[0515] Down-R: GTACCGCGGCCGCTTAATTAATGTTCCGGCAGGTCTGCAATG (SEQ ID NO: 82)
[0516] The gene knockout plasmid pKH del -kstD was electrotransformed into Mycobacterium neoaurum NRRL B-3805 competent cells, plated on Kan plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, agar 1.5% (m / v), kanamycin 50 mg / ml) and IPTG and X-gal were added, and a first selection was performed; a second selection was performed by plating blue single colonies from the first selection on sucrose plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar 1.5% (m / v) and IPTG and X-gal were added) at 30°C for 4 d; white colonies were picked from the sucrose plates into liquid LB medium and after incubation at 30°C for about 36 h, the genome was extracted and PCR verified, and B-3805AkstD was marked.
[0517] The gene knockout plasmid pKH del- kshA1, electroporated into Mycobacterium B-3805 AkstD competent cells, plated on Kan plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, agar 1.5% (m / v), kanamycin 50 mg / ml) and supplemented with IPTG and X-gal, first selection; incubated at 30°C for 4 days, from which blue single colonies were picked onto sucrose plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, sucrose 10 g / 1, agar 1.5% (m / v) and supplemented with IPTG and X-gal), second selection; incubated at 30°C for 4 days, white colonies on sucrose plates were picked into liquid LB medium, after incubation at 30°C for about 36 h, the genome was extracted, PCR verified and named B-3805 AkstD AkshA1.
[0518] The gene knockout plasmid pKH del - kshA2, electroporated into Mycobacterium B-3805 AkstD AkshA1 competent cells, plated on Kan plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, agar 1.5% (m / v), kanamycin 50 mg / ml) and supplemented with IPTG and X-gal, first selection; incubated at 30°C for 4 days, from which blue single colonies were picked onto sucrose plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, sucrose 10 g / 1, agar 1.5% (m / v) and supplemented with IPTG and X-gal), second selection; incubated at 30°C for 4 days, white colonies on sucrose plates were picked into liquid LB medium, after incubation at 30°C for about 36 h, the genome was extracted, PCR verified and named B-3805 AkstD AkshA1 AkshA2.
[0519] The gene knockout plasmid pKH del - sal, electroporated into Mycobacterium B-3805 AkstD AkshA1 AkshA2 competent cells, plated on Kan plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, agar 1.5% (m / v), kanamycin 50 mg / ml) and supplemented with IPTG and X-gal, first selection; incubated at 30°C for 4 days, from which blue single colonies were picked onto sucrose plates (yeast extract 5 g / 1, peptone 10 g / 1, NaCl 10 g / 1, sucrose 10 g / 1, agar 1.5% (m / v) and supplemented with IPTG and X-gal), second selection; incubated at 30°C for 4 days, white colonies on sucrose plates were picked into liquid LB medium, after incubation at 30°C for about 36 h, the genome was extracted, PCR verified and named M4.
[0520] The constructed orD1 gene knockout plasmid pKH del-orD1 was electroporated into Mycobacterium M4 competent cells, coated with Kan plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, agar powder 1.5% (m / v), kanamycin 50 mg / ml) and added IPTG and X-gal, the first screening was carried out; cultured at 30°C for 4d, blue single colonies were picked from the sucrose plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder 1.5% (m / v) and added IPTG and X-gal) for the second screening; cultured at 30°C for 4d, white colonies were picked from the sucrose plate to liquid LB medium, after about 36h culture at 30°C, the genome was extracted, and orD1-F, orD1-R of orD1 gene were used as primers for PCR verification. If the gene knockout is successful, the PCR product should be about 400kbp fragment. The results are shown in Figure 2: lane 2 is the strain successfully knocking out orD1 gene, which is named M61.
[0521] orD1-F: ATGGGTGACCCAACTTTGCGTACTG (SEQ ID NO: 83),
[0522] orD1-R: TCAGCTCTTCGGTGCTGCGGTC (SEQ ID NO: 84).
[0523] The constructed orD2 gene knockout plasmid pKH del -orD2 was electroporated into Mycobacterium M4 competent cells, coated with Kan plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, agar powder (m / v) 1.5%, kanamycin 50 mg / ml) and added IPTG and X-gal, the first screening was carried out; cultured at 30°C for 4d, blue single colonies were picked from the sucrose plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder (m / v) 1.5% and added IPTG and X-gal) for the second screening; cultured at 30°C for 4d, white colonies were picked from the sucrose plate to liquid LB medium, after about 36h culture at 30°C, the genome was extracted, and orD2-F, orD2-R of orD2 gene were used as primers for PCR verification. If the gene knockout is successful, the PCR product should be about 400kbp fragment. The results are shown in Figure 3: lane 1 is the strain successfully knocking out orD2 gene, which is named M40.
[0524] The constructed orD1 gene knockout plasmid pKH del-orD1 electroporated into mycobacterium M40 competent cells, coated Kan plate and added IPTG and X-gal, the first screening; cultured at 30°C for about 96h, blue single colonies were picked from sucrose plate (added IPTG and X-gal) for the second screening; cultured at 30°C for about 96h, white colonies were picked from the sucrose plate to liquid LB medium, after 30°C culture for about 36h, the genome was extracted, and orD1-F, orD1-R of orD1 gene were used as primers for PCR verification. If orD1 gene knockout is successful, the PCR product should be about 400kbp fragment. The results are shown in Figure 4: lane 3 is the strain successfully knocking out orD1 gene, which is named M63.
[0525] orD1-F: ATGGCGGCAGAGAAGGCACTCGAAG (SEQ ID NO: 85),
[0526] orD1-R: CTAGTACTTCATGACGCCACGGTCG (SEQ ID NO: 86).
[0527] The constructed orD3 gene knockout plasmid pKH del -orD3 electroporated into mycobacterium M63 competent cells, coated Kan plate (yeast powder 5g / l, proteose peptone 10g / l, NaCl 10g / l, agar powder 1.5%(m / v), kanamycin 50mg / ml) and added IPTG and X-gal, the first screening; cultured at 30°C for 4d, blue single colonies were picked from sucrose plate (yeast powder 5g / l, proteose peptone 10g / l, NaCl 10g / l, sucrose 10g / l, agar powder 1.5%(m / v) and added IPTG and X-gal) for the second screening; cultured at 30°C for 4d, white colonies were picked from the sucrose plate to liquid LB medium, after 30°C culture for about 36h, the genome was extracted, and orD3-F, orD3-R of orD3 gene were used as primers for PCR verification. If gene knockout is successful, the PCR product should be about 400kbp fragment. The results are shown in Figure 5: lane 2 is the strain successfully knocking out orD3 gene, which is named M43.
[0528] orD3-F: ATGGAAACGGTAGTGGTGATCACGGG (SEQ ID NO: 87),
[0529] orD3-R: TCAGCCGTGGCGCACCCGG (SEQ ID NO: 88).
[0530] The constructed orD4 gene knockout plasmid pKH del-orD4 was electroporated into Mycobacterium M43 competent cells, coated with Kan plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, agar powder 1.5% (m / v), kanamycin 50 mg / ml) and added IPTG and X-gal, the first screening; cultured at 30°C for 4d, from which the blue single colony was picked to sucrose plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder 1.5% (m / v) and added IPTG and X-gal), the second screening; cultured at 30°C for 4d, white colonies on the sucrose plate were picked to liquid LB medium, after 30°C culture for about 36h, the genome was extracted, and PCR verification was performed with Up-F and Down-R of orD4 gene as primers. If the gene knockout is successful, the PCR product should be about 1900kbp fragment. The results are shown in Figure 6: lane 1 is the strain successfully knocking out orD4 gene, which is named M45.
[0531] The constructed orD5 gene knockout plasmid pKH del -orD5 was electroporated into Mycobacterium M45 competent cells, coated with Kan plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, agar powder 1.5% (m / v), kanamycin 50 mg / ml) and added IPTG and X-gal, the first screening; cultured at 30°C for 4d, from which the blue single colony was picked to sucrose plate (yeast powder 5 g / l, proteose peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder 1.5% (m / v) and added IPTG and X-gal), the second screening; cultured at 30°C for 4d, white colonies on the sucrose plate were picked to liquid LB medium, after 30°C culture for about 36h, the genome was extracted, and PCR verification was performed with orD5-F and orD5-R of orD5 gene as primers. If the gene knockout is successful, the PCR product should be about 400kbp fragment. The results are shown in Figure 7: lane 2 is the strain successfully knocking out orD5 gene, which is named M50.
[0532] orD5-F: ATGACCCGCCAGAAGATACTCATCAC (SEQ ID NO: 89),
[0533] orD5-R: TCAGGCAAAGCGTTTGGTGTACTTC (SEQ ID NO: 90).
[0534] The constructed orD6 gene knockout plasmid pKH del-orD6 was electroporated into the competent cells of Mycobacterium M50, and plated on Kan plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, agar powder 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal, and a first screening was performed; blue single colonies were picked from the plates and plated on sucrose plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder 1.5% (m / v) with IPTG and X-gal) for a second screening; white colonies were picked from the sucrose plates and plated in liquid LB medium, and cultured at 30°C for about 36 h, and the genomic DNA was extracted and verified by PCR using Up-F and Down-R of the orD6 gene as primers. If the gene knockout was successful, the PCR product should be a fragment of about 1900 kbp. The results are shown in Figure 8: lane 2 is the strain with successful knockout of the orD6 gene, which was named M86.
[0535] The constructed orD7 gene knockout plasmid pKH del -orD7 was electroporated into the competent cells of Mycobacterium M86, and plated on Kan plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, agar powder 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal, and a first screening was performed; blue single colonies were picked from the plates and plated on sucrose plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar powder 1.5% (m / v) with IPTG and X-gal) for a second screening; white colonies were picked from the sucrose plates and plated in liquid LB medium, and cultured at 30°C for about 36 h, and the genomic DNA was extracted and verified by PCR using orD7-F and orD7-R of the orD7 gene as primers. If the gene knockout was successful, the PCR product should be a fragment of about 400 kbp. The results are shown in Figure 9: lane 2 is the strain with successful knockout of the orD7 gene, which was named M90.
[0536] orD7-F: ATGACCGATACCGTGCTGGTGACCG (SEQ ID NO: 91),
[0537] orD7-R: TCATGCCTGCGCTCCGTCCG (SEQ ID NO: 92).
[0538] The constructed orD8 gene knockout plasmid pKH del-orD8 was electroporated into Mycobacterium M90 competent cells, plated on Kan plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, agar 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal, and a first screening was performed; blue single colonies were picked from the plates and plated on sucrose plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar 1.5% (m / v) with IPTG and X-gal) for a second screening; white colonies were picked from the sucrose plates and plated in liquid LB medium, and after about 36 h of incubation at 30°C, the genome was extracted and PCR was performed with Up-F and Down-R primers of the orD8 gene. If the gene knockout was successful, the PCR product should be a fragment of about 1900 kbp. The results are shown in Figure 10: lane 2 is the strain with a successful orD8 gene knockout, which was named M87.
[0539] The orD9 gene knockout plasmid pKH del -orD9 was electroporated into Mycobacterium M87 competent cells, plated on Kan plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, agar 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal, and a first screening was performed; blue single colonies were picked from the plates and plated on sucrose plates (yeast extract 5 g / l, peptone 10 g / l, NaCl 10 g / l, sucrose 10 g / l, agar 1.5% (m / v) with IPTG and X-gal) for a second screening; white colonies were picked from the sucrose plates and plated in liquid LB medium, and after about 36 h of incubation at 30°C, the genome was extracted and PCR was performed with Up-F and Down-R primers of the orD9 gene. If the gene knockout was successful, the PCR product should be a fragment of about 1900 kbp. The results are shown in Figure 11: lane 1 is the strain with a successful orD9 gene knockout, which was named M92.
[0540] The orD10 gene knockout plasmid pKH del-orD10 was electroporated into the competent cells of Mycobacterium M92, and plated on Kan plates (yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal for the first screening; cultured at 30°C for 4 days, and blue single colonies were picked to sucrose plates (yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, sucrose 10 g / L, agar powder 1.5% (m / v) with IPTG and X-gal) for the second screening; cultured at 30°C for 4 days, and white colonies were picked to liquid LB medium, and cultured at 30°C for about 36 hours, and the genome was extracted, and PCR verification was performed with Up-F and Down-R of the orD10 gene as primers. If the gene knockout was successful, the PCR product should be about a 1900 kbp fragment. The results are shown in Figure 12: lanes 2 and 3 are strains in which the orD10 gene was successfully knocked out, and they are named M93. The orD11 gene knockout plasmid pKH del -orD9 was electroporated into the competent cells of Mycobacterium M93, and plated on Kan plates (yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 1.5% (m / v), kanamycin 50 mg / ml) with IPTG and X-gal for the first screening; cultured at 30°C for 4 days, and blue single colonies were picked to sucrose plates (yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, sucrose 10 g / L, agar powder 1.5% (m / v) with IPTG and X-gal) for the second screening; cultured at 30°C for 4 days, and white colonies were picked to liquid LB medium, and cultured at 30°C for about 36 hours, and the genome was extracted, and PCR verification was performed with Up-F and Down-R of the orD11 gene as primers. If the gene knockout was successful, the PCR product should be about a 1900 kbp fragment. The results are shown in Figure 13: lane 2 is a strain in which the orD11 gene was successfully knocked out, and it is named M95.
[0541] Example 3: Fermentation of knockout strains to produce DHEA
[0542] 1. Seed medium for shake flask fermentation:
[0543] Yeast powder 5 g / L; peptone 10 g / L; NaCl 10 g / L; Tween 80 5 g / L; sterilized at 121°C for 20 minutes.
[0544] 2. Medium 1 for shake flask fermentation, used for plant sterol shake flask fermentation verification experiments:
[0545] Na2HPO4: 2 g / L; corn syrup dry powder: 5 g / L; defatted soybean powder 10 g / L; plant sterols 5 g / L; sterilized at 121°C for 20 minutes.
[0546] 3. Shake flask fermentation medium 2 for cholesterol shake flask fermentation verification experiment:
[0547] Na2HPO4: 2 g / L; corn steep liquor dry powder: 5 g / L; defatted soybean powder 10 g / L; cholesterol 2 g / L; sterilized at 121°C for 20 minutes.
[0548] 4. Seed medium:
[0549] Glucose: 6 g / L; yeast powder: 15 g / L; NaNO3: 5.4 g / L; glycerol: 2 g / L; NH4H2PO4: 0.6 g / L; pH 7.5; sterilized at 115°C for 30 minutes.
[0550] 5. Fermentation medium 3:
[0551] NaNO3: 6.37 g / L; KH2PO4: 1.05 g / L; Na2HPO4: 2.14 g / L; MgSO4: 0.82 g / L; KCl: 0.21 g / L; CaCl2: 0.1 g / L; corn steep liquor dry powder: 14.23 g / L; phytosterol: 10 g / L; soybean oil: 150 g / L; pH 7.5; sterilized at 121°C for 30 minutes.
[0552] (1) Shake flask fermentation culture step:
[0553] 1. 30°C plate activation of seed: the bacterial liquid of a series of strains constructed in Example 2 was streaked on the activation plate for activation;
[0554] 2. Inoculated from the activation plate into the seed medium, 200 rpm, 30°C culture for 2 days;
[0555] 3. The seed liquid was sampled under sterile conditions for microscopic examination, and the sample was inoculated only when no contamination was found;
[0556] 4. Inoculated into 20 ml of shake flask fermentation medium at an inoculation amount of 10% (v / v);
[0557] 5. 200 rpm, 30°C culture for 14 days;
[0558] 6. Ethyl acetate 3 times volume extraction, 1 ml organic phase was evaporated, 1 ml methanol was resuspended, and HPLC detection.
[0559] 7. HPLC detection method: signal (DAD): 210 nm, 230 nm and 254 nm, flow rate: 0.8 ml / min, column temperature box: 30°C, mobile phase: methanol and water = 80:20, retention time: 25 min, column: C18-column (250 mm x 4.6 mm x 0.5 μm).
[0560] The results of the shake flask fermentation are shown in Table 1: the starting strain has no DHEA, and the main product in the fermentation broth is AD (androstenedione); single knockout of ORD1 has no DHEA; single knockout of ORD2 degrades phytosterols to accumulate a small amount of DHEA; double knockout of ORD1 / 2 significantly increases the accumulation of DHEA as the main product; superimposed knockout of ORD3 has no obvious change; superimposed knockout of ORD4 reduces the byproduct AD; superimposed knockout of ORD5 reduces the byproduct AD and increases DHEA; superimposed knockout of ORD6 eliminates the byproduct androstenediol; superimposed knockout of ORD7 reduces the byproduct AD and increases DHEA; superimposed knockout of ORD8 increases DHEA; superimposed knockout of ORD9 significantly reduces AD and increases DHEA; superimposed knockout of ORD10 increases DHEA; superimposed knockout of ORD11 increases DHEA.
[0561] Table 15. Shake flask fermentation verification results of phytosterols
[0562] Table 16. Shake flask fermentation verification results of cholesterols
[0563] (2) Fermentation tank fermentation culture step (3 repeated experiments for each strain):
[0564] 1. 30℃ plate activated strain: the strains M87 and M95 constructed in Example 2 were respectively coated on the activated plate for activation;
[0565] 2. Inoculate from the activated plate to the seed culture medium, 180 rpm, 30℃ culture for 3 days;
[0566] 3. The seed liquid was sampled under sterile conditions for microscopic examination, and the inoculation was allowed only when there was no bacterial contamination;
[0567] 4. Inoculate 10% (v / v) of the inoculum into 3L fermentation medium, at this time OD 600 is 10-11;
[0568] 5. 500 rpm, 30℃ fermentation culture, aeration ratio is 0.5vvm, the whole fermentation process pH is between 7-8, no need to control, fermentation culture for 7-8d;
[0569] 6. The fermentation broth in the whole system after fermentation is extracted with ethyl acetate 1:1 for three times, the whole extraction phase volume is recorded, 1ml of ethyl acetate organic phase is volatilized, an equal volume of methanol is resuspended, and HPLC detection is performed.
[0570] 7. Quantification was performed by making a standard curve to obtain the mass yield (mass percentage of DHEA production to substrate addition) of the whole fermentation.
[0571] Analytical detection method:
[0572] The fermentation was stopped when the reaction conversion rate of the biosynthesis of DHEA from phytosterol reached 95% (conversion rate refers to the ratio of substrate consumption to substrate addition).
[0573] The content of DHEA in the above-mentioned crude extract by ethyl acetate was determined by high performance liquid chromatography (HPLC). The HPLC analysis conditions were: signal (DAD) 210 nm, 230 nm and 254 nm, flow rate 0.8 ml / min, column temperature box 30°C, mobile phase ratio of methanol and water 80:20, retention time 22 min, column C18-column (250 mm x 4.6 mm x 0.5 μm). The content of DHEA in the crude extract was calculated by peak area using the external standard method, and then the total mass of DHEA in the reaction solution was calculated to calculate the mass yield of DHEA.
[0574] The results of the fermenter experiment are shown in Table 17.
[0575] Table 17. Fermenter verification results
[0576] Gene sequence:
[0577] orD1 (Mycobacterium, SEQ ID NO: 1)
[0578] orD2 (Mycobacterium, SEQ ID NO: 2)
[0579] orD3 (Mycobacterium, SEQ ID NO: 3)
[0580] orD4 (Mycobacterium, SEQ ID NO: 4)
[0581] orD5 (Mycobacterium, SEQ ID NO: 5)
[0582] orD6 (Mycobacterium, SEQ ID NO: 6)
[0583] orD7 (Mycobacterium, SEQ ID NO: 7)
[0584] orD8 (Mycobacterium, SEQ ID NO: 8)
[0585] orD9 (Mycobacterium, SEQ ID NO: 9)
[0586] orD10 (Mycobacterium, SEQ ID NO: 10)
[0587] orD11 (Mycobacterium, SEQ ID NO: 11)
[0588] Protein sequence:
[0589] ORD1 (Mycobacterium, SEQ ID NO: 12):
[0590] ORD2 (Mycobacterium, SEQ ID NO: 13):
[0591] ORD3 (Mycobacterium, SEQ ID NO: 14):
[0592] ORD4 (Mycobacterium, SEQ ID NO: 15):
[0593] ORD5 (Mycobacterium, SEQ ID NO: 16):
[0594] ORD6 (Mycobacterium, SEQ ID NO: 17):
[0595] ORD7 (Mycobacterium, SEQ ID NO: 18):
[0596] ORD8 (Mycobacterium, SEQ ID NO: 19):
[0597] ORD9 (Mycobacterium, SEQ ID NO: 20):
[0598] ORD10 (Mycobacterium, SEQ ID NO: 21):
[0599] ORD11 (Mycobacterium, SEQ ID NO: 22):
[0600] It should be noted that, although the technical solutions of the present application are described with specific examples, those skilled in the art can understand that the present application should not be limited thereto.
[0601] The above has described various embodiments of the present application, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes are obvious to those skilled in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements in the technology in the market, or to enable other ordinary skilled persons in the art to understand the embodiments disclosed herein.
Claims
1. A recombinant strain producing dehydroepiandrosterone, wherein, The recombinant strain has at least one of the following (a1) to (a 11 ) characteristics compared to the wild-type strain or the starting strain: (a1) the expression level of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a2) the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32%, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same in the recombinant strain is reduced or eliminated; (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain; (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain; (a 10 ) the polypeptide as set forth in SEQ ID NO: 21 or an identity to the polypeptide as set forth in SEQ ID NO: 21 in the recombinant strain a polypeptide activity and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain; (a 11 ) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same.
2. The recombinant strain of claim 1, wherein, compared to the wild-type strain or the starting strain, the recombinant strain has the following (a1) characteristics: (a1) the expression level of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain.
3. The recombinant strain of claim 2, wherein, compared to the wild-type strain or the starting strain, the recombinant strain also has the following (a2) characteristics: (a2) the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32%, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain.
4. The recombinant strain of claim 2 or 3, wherein, The recombinant strain is selected from any one of the following (A) to (I): (A) compared to the wild-type strain or the starting strain, the recombinant strain also has the following characteristics: (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide is reduced or eliminated in the recombinant strain; (B) compared to the wild-type strain or the starting strain, the recombinant strain also has the following characteristics: (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, (C) the recombinant strain further has the following properties compared to the wild type strain or the starting strain: (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, (a5) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, (D) the recombinant strain further has the following properties compared to the wild type strain or the starting strain: (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain; (E) the recombinant strain further has the following properties compared to the wild type strain or the starting strain: (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain, and (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or the encoding gene thereof is reduced or eliminated in the recombinant strain; (F) the recombinant strain further has the following properties compared to the wild type strain or the starting strain: (a3) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same in the recombinant strain, (a4) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same in the recombinant strain, (a5) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same in the recombinant strain, (a6) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same in the recombinant strain, (a7) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same in the recombinant strain, and (a8) a reduced or absent expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same in the recombinant strain; (G) the recombinant strain further has the following properties compared to the wild type strain or the starting strain: (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same, (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same, (a5) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same, (a6) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same, (a7) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same, (a8) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same, and (a9) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same; (H) the recombinant strain further has a property that: (i) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same, (a3) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same, (a4) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same, (a5) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same, (a6) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same, (a7) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same, (a8) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same, (a9) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same, and (I) the recombinant strain further has a property: (a 10 ) a decrease or loss of expression of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same in the recombinant strain; (i) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same, and (ii) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same, and (iii) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same, and (iv) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same, and (v) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same, and (vi) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same, and (vii) the recombinant strain has a reduced or no expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same, and (a3) the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a4) the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a5) the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a6) the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a7) the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a8) the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a9) the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the same is reduced or eliminated in the recombinant strain, (a 10 ) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same, and (a 11 ) the recombinant strain has a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same.
5. The recombinant strain according to any one of claims 1 to 4, the wild-type strain or the starting strain comprising a microorganism of the order of the Actinomycetes.
6. The recombinant strain according to claim 5, the wild-type strain or the starting strain comprising a microorganism of the family of the Actinomycetaceae, of the Corynebacteriaceae, of the Mycobacteriaceae, of the Nocardiaceae, of the Brevibacteriaceae, of the Streptomycetaceae, of the Pseudomonadaceae or of the Micrococcaceae; Preferably, the wild-type strain or the starting strain comprises a microorganism of the genus Rhodococcus, of the genus Mycobacterium, of the genus Mycolicibacterium, of the genus Arthrobacter, of the genus Nocardia, of the genus Streptomyces or of the genus Pseudomonas.
7. A method for constructing a recombinant strain for producing dehydroepiandrosterone, wherein, The method comprises at least one step as shown in (bl) to (b 11 ) below. (b1 ) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 13 or of a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95% or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or of a gene encoding the polypeptide, compared to the wild-type strain or the starting strain; (b2) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 12 or of a polypeptide having at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95% or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or of a gene encoding the polypeptide, compared to the wild-type strain or the starting strain; (b3) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 14 or of a polypeptide having at least 21 %, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95% or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or of a gene encoding the polypeptide, compared to the wild-type strain or the starting strain; (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b7) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b8) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b9) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; (b 10 ) reduced or eliminated expression of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same, as compared to a wild type strain or a starting strain; (b 11 ) reduced or eliminated expression of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same, as compared to a wild type strain or a starting strain.
8. The method for constructing a recombinant bacterial strain according to claim 7, wherein, The method comprises the following steps: (b1) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 13 or a polypeptide having at least 30%, 32%, 33%, 37%, 45%, 49%, 52%, 60%, 70%, 72%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 13 and / or a gene encoding thereof, compared to the wild type strain or the starting strain.
9. The method for constructing a recombinant bacterial strain according to claim 8, wherein, The method further comprises the following steps: (b2) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 12 or a polypeptide having at least 26%, 28%, 29%, 30%, 32, 40%, 50%, 60%, 70%, 73%, 78%, 80%, 83%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 12 and / or a gene encoding thereof, compared to the wild type strain or the starting strain.
10. The method for constructing a recombinant bacterial strain according to claim 9, wherein, The method further comprises: (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain; or, The method further comprises: (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain, (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof, compared to the wild type strain or the starting strain; or, The method further comprises: (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding thereof, compared to the wild type strain or the starting strain, (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding thereof, compared to the wild type strain or the starting strain, (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or The method further comprises: (b3) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b4) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b6) reducing or eliminating the expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or The method further comprises: (b3) a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b4) a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b5) a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b6) a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, and (b7) a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain; or the method further comprises: (b3) a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide having at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 14 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b4) a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b5) a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, (b6) a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain, and (b7) a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a reduced or eliminated expression level of a gene encoding the polypeptide, as compared to the wild-type strain or the starting strain; or (b4) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b6) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide that is at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b7) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide that is at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b8) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide that is at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 19 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or the method further comprises: (b3) a decrease or elimination of the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide that is at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b4) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b6) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b7) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b8) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b9) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or, the method further comprises: (b4) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide having at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 15 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide having at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 16 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b6) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide having at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 17 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b7) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide having at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 18 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b8) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide having at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 19 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b9) a reduced or eliminated expression level of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or a gene encoding the polypeptide, compared to the wild type strain or the starting strain; or, the method further comprises: (b3) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b4) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b6) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 17 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b7) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 18 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b8) reduced or eliminated activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 19 and / or expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide that is at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, and (b 10 ) reduced or eliminated expression of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same as compared to a wild type strain or a starting strain; or, The method further comprises: (b3) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 14 or a polypeptide that is at least 21%, 25%, 27%, 28%, 30%, 35%, 40%, 50%, 60%, 69%, 70%, 80%, 87%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 14 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b4) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 15 or a polypeptide that is at least 32%, 34%, 35%, 37%, 40%, 50%, 60%, 67%, 70%, 77%, 78%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 15 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b5) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 16 or a polypeptide that is at least 29%, 30%, 31%, 40%, 50%, 52%, 54%, 55%, 60%, 70%, 72%, 80%, 83%, 84%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 16 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b6) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 17 or a polypeptide that is at least 29%, 30%, 32%, 34%, 36%, 37%, 40%, 49%, 51%, 60%, 70%, 85%, 90%, 93%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 17 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b7) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 18 or a polypeptide that is at least 28%, 29%, 31%, 32%, 37%, 38%, 41%, 50%, 60%, 63%, 70%, 80%, 85%, 90%, 95%, or 99% identical to the polypeptide as set forth in SEQ ID NO: 18 and / or the expression level of a gene encoding the polypeptide, compared to the wild type strain or the starting strain, (b8) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 19 or a polypeptide that is at least 29%, 31%, 33%, 36%, 37%, 38%, 40%, 41%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% of the activity of the polypeptide and / or the expression level of the gene encoding the polypeptide, (b9) reducing or eliminating the activity of a polypeptide as set forth in SEQ ID NO: 20 or a polypeptide having at least 29%, 35%, 49%, 51%, 54%, 63%, 66%, 71%, 85%, 90%, 95%, 97%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 20 and / or the expression level of the gene encoding the polypeptide, as compared to the wild type strain or the starting strain, (b 10 ) reduced or eliminated expression of a polypeptide as set forth in SEQ ID NO: 21 or a polypeptide having at least 33%, 34%, 35%, 36%, 38%, 40%, 50%, 60%, 70%, 84%, 85%, 90%, 96%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 21 and / or a gene encoding the same, and (b 11 ) reduced or eliminated expression of a polypeptide as set forth in SEQ ID NO: 22 or a polypeptide having at least 33%, 35%, 36%, 40%, 42%, 45%, 50%, 55%, 60%, 70%, 76%, 78%, 85%, 90%, 95%, or 99% identity to the polypeptide as set forth in SEQ ID NO: 22 and / or a gene encoding the same, as compared to a wild type strain or a starting strain.
11. A method of producing dehydroepiandrosterone, wherein, The method comprises the step of performing a fermentation reaction using the recombinant strain of any one of claims 1-6 or the recombinant strain obtained by the construction method of any one of claims 7-10 as a substrate.
12. The method of claim 11, wherein, In the step of performing a fermentation reaction, the pH is 5.0-9.0 and the reaction temperature is 20°C-65°C.
13. The method of claim 11 or 12, wherein, The method further comprises the step of purifying or isolating the dehydroepiandrosterone.
14. Use of the recombinant strain of any one of claims 1-6 or the recombinant strain obtained by the construction method of any one of claims 7-10 in the production of dehydroepiandrosterone.
Citation Information
Patent Citations
Compositions and methods for making androstenediones
CN101918436A
Method for producing dehydroepiandrosterone through microbial fermentation
CN104232673A
Defective mycobacterium and method for preparation of dehydroepiandrosterone from the same
CN107267418A
17beta-hydroxysteroid dehydrogenase mutant of mycobacterium, engineering bacterium and application of engineering bacterium
CN112813041A
Genetically modified organisms for the production of steroid derivatives
US20240102073A1