Diguanylate cyclase variants and methods of their use
NIR light-responsive DGC variants with targeted mutations provide enhanced enzymatic activity and sensitivity, addressing the limitations of existing tools by achieving rapid and precise control of intracellular c-di-GMP dynamics for biofilm formation and gene expression.
Patent Information
- Application Number
- PCT/SG2025/050380
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-07
- Filing Date
- 2025-06-05
- Publication Date
- 2025-12-11
AI Technical Summary
Existing optogenetic tools for controlling intracellular c-di-GMP dynamics, such as NIR light-responsive DGCs, suffer from limited enzymatic activity and sensitivity, leading to inadequate spatiotemporal control, particularly in applications requiring rapid and dynamic regulation of biofilm formation and gene expression.
Development of NIR light-responsive DGC variants with specific amino acid mutations, such as Q655K, I9F, S89P, L325I, R377C, and G432D, enhancing enzymatic activity and sensitivity, allowing for more dynamic control of intracellular c-di-GMP levels.
The mutated DGC variants exhibit up to 13 times higher enzymatic activity and improved photosensitivity, enabling rapid and precise modulation of c-di-GMP levels for enhanced biofilm formation and gene expression control.
Smart Images

Figure SG2025050380_11122025_PF_FP_ABST
Abstract
Description
DIGUANYLATE CYCLASE VARIANTS AND METHODS OF THEIR USECROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority of Singapore Patent Application No. 10202401634W filed 7 June 2024, the content of which being hereby incorporated by reference in its entirety for all purposes.TECHNICAL FIELD
[0002] Various embodiments relate generally to light-responsive polypeptides having diguanylate cyclase (DGC) activity, nucleic acid molecules encoding such polypeptides, host cells comprising such polypeptides or nucleic acid molecules, compositions comprising such polypeptides or nucleic acid molecules or host cells, and methods of their use. More particularly, various embodiments relate to near-infrared (NIR) light-responsive DGC polypeptide variants with increased enzymatic activity and sensitivity to NIR light compared to its parental polypeptide to allow more dynamic control of intracellular c-di-GMP dynamics with various in vitro and in vivo applications.BACKGROUND
[0003] Nucleotide second messengers are a key component of bacteria’s signal transduction pathway that allows bacteria to link sensory inputs into regulatory responses in the cell.[1] Bis-(3'-5')-cyclic dimeric guanosine monophosphate (c-di-GMP) is a ubiquitous second messenger commonly found in a large number of bacteria.[2] As a signalling molecule, c-di-GMP is responsible for a host of bacteria behaviour ranging from motility, virulence, biofilm formation, and cell cycle progression. [3] Several studies have demonstrated that the signal cascade produced by these intracellular c-di-GMP molecules is instrumental in the switch between the motile (planktonic) and sessile (biofilm) mode of life in bacteria cells. [4] High levels of c-di-GMP increases biofilm formation by increasing adhesin synthesis and secretion of exopolysaccharides while low levels of c-di-GMP leads to increased flagella activity and a more motile mode of life. [4, 5] This regulation and turnover of intracellular c-di-GMP is regulated by two different groups of enzymes. Diguanylate cyclases (DGCs) containing the GGDEF amino acid sequence motif synthesizes c-di-GMP from two molecules of guanosine-5’-triphosphate (GTP). Conversely, phosphodiesterases (PDEs) containing either the EAL or HD-GYP motif will degrade it to form 5’-phosphoguanylyl-(3’-5')-guanosine (pGpG) which subsequently gets broken down into two guanosine monophosphate (GMP) molecules. [6]
[0004] Several studies have shown that c-di-GMP binds to a diverse range of effectors and is involved in numerous complex regulatory networks across many different phyla. [5] Therefore, the c-di-GMP signalling pathway is an attractive target for the control of cellular behaviour in environmental, immunological, and biomedical applications. For example, by increasing intracellular c-di-GMP levels to promote biofilm formation, it is possible to enhance contaminant degradation due to the protection conferred by the extracellular polymeric substances (EPS) of the biofilm. [7] Similarly, upregulation of c-di-GMP in Streptomyces ghanaensis has been shown to increase biosynthesis of moenomycin A, a potential antibiotic that may be able to combat vancomycin- and methicillin-resistant pathogens. [8] Besides regulating intracellular c-di-GMP dynamics, scientists are also looking into developing peptides and molecules that interfere with the bacteria’s c-di-GMP signalling pathway to combat chronic wound infections caused by biofilms. [9] Lastly, c-di-GMP is also an immunosurveillance target of mammalian cells and binds to helicase DDX41 to trigger the expression of type I interferons (IFNs) via the stimulator of interferon genes (STING) pathway.
[0010] Due to the immunostimulatory and anti-tumour effects of this nucleotide messenger, c-di-GMP is also being looked into as a vaccine adjuvant for infectious diseases and anti-cancer agent for cancer therapeutics.
[0011]
[0005] The prevalence of c-di-GMP and its potential applications makes it imperative to develop methods and tools to regulate intracellular c-di-GMP levels. This can be done by incorporating synthetic biology principles to rationally design gene circuits consisting of a c-di-GMP control module which will contain the associated DGCs, PDEs, effectors, and targets of a c-di-GMP molecule.
[0012] The created designer cells can then be controlled and programmed for next generation environmental, biotechnological, and biomedical applications.
[0013] Although it is possible to control intracellular c-di- GMP dynamics by regulating the expression of DGCs and PDEs in the gene circuit, the constitutive expression of relevant DGC and PDE genes prevents fine control of intracellular c-di-GMP levels while the use of chemical inducers is severely limited by a lack of precise spatial and temporal control.
[0014] However, several studies have shown that the catalytic domains of DGCs and PDEs are usually linked to a wide range of N-terminal sensory input domains. These domains allow bacteria to perceive a wide range of external signals which are then integrated into a downstream signalling cascade and converted into an output response by the bacterial cell. [4, 5]
[0006] Light is one such environmental signal that can be used to control DGC and PDE activity and several light-responsive DGCs and PDEs have been reported.
[0015] The optogenetic control of DGCs and PDEs is an attractive synthetic biology tool to regulate intracellular c-di-GMP dynamics as it is tuneable, reversible and provides fine spatiotemporal control.
[0016] For example, by introducing a dichromatic c-di-GMP gene circuit into a quorum quenching biofilm, the optogenetic control of a bacterial biofilm that could mitigate biofouling on water purification membranes was achieved.
[0017] Similarly, by introducing a near-infrared (NIR) light-responsive DGC into Escherichia coli, it is possible to increase E. co / / biofilm formation upon NIR irradiation to enhance biocatalytic transformation of indole to tryptophan.
[0018] Furthermore, despite the absence of genes encoding for DGCs and PDEs in mammalian cells, the optogenetic control of c-di-GMP still has important biomedical applications. This can be achieved by coupling the c-di-GMP response elements of a mammalian cell’s signalling pathway to a c-di-GMP synthase which allows for tight orthogonal control of gene expression in designer mammalian cells. For example, by introducing a NIR light-responsive DGC into mammalian cells, Folcher et al.
[0019] was able to rewire the STING -activated signalling pathway for the expression of a human glycoprotein. Using the same NIR light-responsive DGC, Shao et al.
[0020] demonstrated thefeasibility of using optogenetics to regulate insulin production in designer cells embedded in a hydrogel matrix which can be used as a drug delivery platform in diabetic mice.
[0007] Despite the attractiveness of using optogenetics to control c-di-GMP dynamics for environmental and biomedical applications, there is still room for improvement of these optogenetic tools. In the study by Mukherjee et al.
[0017] , a long exposure time of at least 48 h was required before an increase in biofilm biomass was observed. Even then, the increase in biofilm biomass and biovolume was limited.
[0008] Therefore, there is still a need in the art to provide alternative NIR light-responsive DGC to address the drawbacks of existing approaches. In particular, there is a need in the art for the provision of a NIR light-responsive DGC variant with increased enzymatic activity and sensitivity to NIR light to allow more dynamic control of intracellular c-di-GMP dynamics.SUMMARY
[0009] Various embodiments meet this need by in one aspect providing an isolated polypeptide having diguanylate cyclase activity, comprising or consisting of: (I) an amino acid sequence set forth in SEQ ID NO:1 (WT-BphS); (ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:1 over its entire length; or (iii) a functional fragment of (I), or (II); wherein the polypeptide comprises a GG[D / E]EF motif, and one or more amino acid mutations at a position selected from Q655, A2, G4, L6, I9, G54, S89, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, and E652 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0010] In various embodiments, the one or more amino acid mutations are at a position selected from Q655, G4, I9, S89, L325, R377, G432, and C492 of SEQ ID NO: 1 .
[0011] In various embodiments, the amino acid mutation is an amino acid substitution, and wherein: t e amino acid residue G at position 4 is substituted with an uncharged polar or neutral hydrophilic amino acid residue, preferably C; and / or the amino acid residue I at position 9 is substituted with a nonpolar, or aromatic, or hydrophobic amino acid residue, preferably F; and / or the amino acid residue S at position 89 is substituted with a non-polar or aliphatic amino acid residue, preferably P; and / or the amino acid residue L at position 325 is substituted with a non-polar or hydrophobic or aliphatic amino acid residue, preferably I; and / or the amino acid residue R at position 377 is substituted with an uncharged polar or neutral hydrophilic amino acid residue, preferably C; and / or the amino acid residue G at position 432 is substituted with an acidic or negatively charged amino acid residue, preferably D; and / or the amino acid residue C at position 492 is substituted with a uncharged polar or neutral hydrophilic aminoacid residue, preferably S; and / or the amino acid residue Q at position 655 is substituted with a basic or positively charged amino acid, preferably K.
[0012] In various embodiments, the one or more amino acid mutations are selected from Q655K, G4C, I9F, S89P, L325I, R377C, G432D, C492S, and combinations thereof.
[0013] In various embodiments, the polypeptide comprises the amino acid mutations Q655K, I9F, G4C, S89P, L325I, R377C, G432D, and C492S.
[0014] In various embodiments, the polypeptide comprise or consists of: (i) an amino acid sequence set forth in anyone of SEQ ID NO:2-35; (ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2-35 over its entire length; or (iii) a functional fragment of (I), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises one or more amino acid mutations at a position selected from Q655, A2, G4, L6, I9, G54, S89, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, 1500, V516, E532, L534, L535, R544, K545, Q561 , 1583, E617, N626, V628, and E652 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0015] In various embodiments, the polypeptide comprises or consists of: (i) an amino acid sequence set forth in SEQ ID NO:2 (BphS-7); (ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2 over its entire length: or (iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions Q655, I9, S89, R377, and C492 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0016] In various embodiments, the polypeptide comprises or consists of: (i) an amino acid sequence set forth in SEQ ID NO:3 (BphS-13); (ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as setforth in any one of SEQ ID NO:3 over its entire length; or (iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions Q655, G4, I9, S89, L325, R377, G432, and C492 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0017] In various embodiments, the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 2 or 3 or a functional fragment thereof.
[0018] In various embodiments, the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof.
[0019] In another aspect, there is provided a nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide disclosed herein.
[0020] In various embodiments, the nucleic acid molecule comprises or consists of: (I) a nucleotide sequence as set forth in any one of SEQ ID NO:37-70; or nucleotide variant, or a complement thereof; or (ii) a nucleotide sequence that shares at least 75% sequence identity with a nucleotide sequence of (i) or a complement thereof.
[0021] In various embodiments, the nucleic acid molecule comprises or consists of: (i) a nucleotide sequence as set forth in SEQ ID NO:37 (BphS-7) or 38 (BphS-13); or a nucleotide variant, or a complement thereof; or (II) a nucleotide sequence that shares at least 75% sequence identity with a nucleotide sequence of (i) or a complement thereof.
[0022] In various embodiments, the nucleotide sequence comprises: a silent mutation at a nucleotide position corresponding to nucleotide position 105 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 35 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 141 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 47 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 276 of SEQ ID NO: 36, preferably the codon is changed from CCA to CCG, wherein the silent mutation encodes the amino acid P at position 92 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1056 of SEQ ID NO: 36, preferably the codon is changed from GAT to GAC, wherein the silent mutation encodes the amino acid D at position 352 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1215 of SEQ ID NO: 36, preferably the codon is changed from GTT to GTC, wherein the silent mutation encodes the amino acid V at position 405 of SEQ ID NO:1 .
[0023] In various embodiments, the nucleotide sequence encoding the polypeptide is operably linked to a first promoter, preferably a constitutive promoter, and the nucleic acid molecule further comprises a fluorescent marker gene operably linked to a second promoter, preferably an interferon (IFN)- responsive promoter.
[0024] In another aspect, there is provided a host cell comprising the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein.
[0025] In various embodiments, the host cell is a mammalian cell, preferably a human cell, or a microbialcell, preferably an E.coli cell.
[0026] In another aspect, there is provided a composition comprising the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein.
[0027] In another aspect, there is provided a method for producing a polypeptide disclosed herein, comprising culturing a host cell disclosed herein, and isolating said polypeptide from the host cell or culture medium.
[0028] In another aspect, there is provided the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the composition disclosed herein, for use in modulating intracellular cyclic di-GMP (c-di-GMP) levels in a host cell.
[0029] In another aspect, there is provided a method of modulating intracellular cyclic di-GMP (c-di- GMP) levels in a host cell, comprising: introducing into said host cell the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the composition disclosed herein; and irradiating the host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide and modulating the intracellular c-di-GMP levels.
[0030] In various embodiments, the method is in vitro or in vivo.
[0031] In another aspect, there is provided the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the composition disclosed herein, for use in promoting biofilm formation in a microbial host cell.
[0032] In another aspect, there is provided a method for promoting biofilm formation in a microbial host cell, comprising: introducing into the microbial host cell the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the composition disclosed herein; optionally expressing the polypeptide in the microbial host cell; and irradiating the microbial host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide, wherein activation of the DGC activity of the polypeptide increases intracellular levels of cyclic di-GMP to induce the formation of the biofilm.
[0033] In another aspect, there is provided the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the composition disclosed herein, for use in regulating gene expression in a mammalian host cell via modulation of intracellular cyclic di-GMP levels.
[0034] In another aspect, there is provided a method for regulating gene expression in a mammalian host cell, comprising: introducing into the mammalian host cell the polypeptide disclosed herein, or thenucleic acid molecule disclosed herein, or the composition disclosed herein; irradiating the mammalian host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; wherein expression of a gene of interest operably linked to a c-di-GMP-responsive regulatory element is regulated in response to the increased c-di-GMP levels.
[0035] In various embodiments, the gene of interest encodes a therapeutic agent, regulatory protein, or other bioactive molecule.
[0036] In another aspect, there is provided the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein or the composition disclosed herein, for use in a subdermal drug delivery system.
[0037] In another aspect, there is provided method for subdermal delivery of a therapeutic agent in a subject, comprising: administering into a subdermal tissue site of the subject the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein or the composition disclosed herein; and irradiating the subdermal tissue site with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; wherein expression or release of a therapeutic agent is regulated in response to the increased c-di-GMP levels.
[0038] In various embodiments, the polypeptide, or the nucleic acid molecule, or the host cell or the composition is administered subdermally by injection, implantation, or surgical insertion.
[0039] In another aspect, there is provided the polypeptide, or the nucleic acid molecule, or the host cell or the composition, for use in stimulating an innate immune response in a subject.
[0040] In another aspect, there is provided a method for stimulating an innate immune response in a subject, comprising: administering to a target site in the subject the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein or the composition disclosed herein; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; wherein an innate immune response at the target site is stimulated via activation of the STING signalling pathway in response to the increased intracellular c-di-GMP levels.
[0041] In another aspect, there is provided the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein or the composition disclosed herein, for use in treating a condition or disease associated with aberrant c-di-GMP levels in a subject.
[0042] In another aspect, there is provided a method for treating a condition or disease associated withaberrant c-di-GMP levels in a subject, comprising: administering to a target site in the subject the polypeptide disclosed herein, or the nucleic acid molecule disclosed herein, or the host cell disclosed herein or the composition disclosed herein; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP optionally, administering the therapeutic agent or a gene encoding the therapeutic agent that is expressed under the control of c-di-GMP-responsive regulatory elements, prior to the irradiating step.
[0043] In various embodiments, the condition or disease associated with aberrant c-di-GMP levels is cancer, preferably breast cancer.BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Various embodiments will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings.
[0045] FIG. 1 shows the screening of BphS variants obtained from the first round of error-prone PCR and StEP in vitro homologous recombination. Overnight cultures of selected colonies were dropped in triplicates onto LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye. The colonies were then either exposed to NIR light or kept in the dark for 48 h before being harvested and resuspended in PBS. The fluorescence (AEx = 497 nm, AEm = 613 nm) of the bound Congo red dye was measured using a Tecan Infinite Pro II Spectrophotometer. All fluorescence readings were normalised to the OD600 of the cell suspension. FIG. 1 A Normalised Congo red fluorescence of BphS variants obtained from the first error-prone PCR library. FIG. 1B Normalised Congo red fluorescence of BphS variants obtained from the first StEP recombinant library.
[0046] FIG. 2 shows a schematic of the mutations shown in Table 6 in relation to the domains of the enzyme.
[0047] FIG. 3 shows the screening of BphS variants obtained after introducing recurring beneficial mutations using site-directed mutagenesis. Overnight cultures of the colonies were dropped in triplicates onto LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye. The colonies were then either exposed to NIR light or kept in the dark for 24 or 48 h before being harvested and resuspended in PBS. The fluorescence (AEx = 497 nm, AEm = 613 nm) of the bound Congo red dye was measured using a Tecan Infinite Pro II Spectrophotometer. All fluorescence readings were normalised to the OD600 of the cell suspension. FIG. 3A Comparison of the normalised Congo red fluorescence of BphS-WT, StEP-22, StEP-27, and BphS-7 after 48 h of exposure to NIR light. FIG. 3B Comparison of the normalised Congo red fluorescence of BphS-WT, StEP-22, StEP-27, and BphS-7 after 24 h of exposure to NIR light.
[0048] FIG. 4 shows the screening of BphS variants obtained from the second round of error-prone PCR and StEP in vitro homologous recombination. Overnight cultures of selected colonies were dropped in triplicates onto LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye. The colonies were then either exposed to NIR light or kept in the dark for 24 h before being harvested and resuspended in PBS. The fluorescence (AEx = 497 nm, AEm = 613 nm) of the bound Congo red dye was measured using a Tecan Infinite Pro II Spectrophotometer. All fluorescence readings were normalised to the OD600 of the cell suspension. FIG. 4A Normalised Congo red fluorescence of BphS variants obtained from the M2-25 error-prone PCR library. FIG. 4B Normalised Congo red fluorescence of BphS variants obtained from the M2-50 error-prone PCR library. FIG. 4C Normalised Congo red fluorescence of BphS variants obtained from the second StEP recombinant library.
[0049] FIG. 5 shows a schematic of the mutations shown in Table 7 in relation to the domains of the enzyme.
[0050] FIG. 6 shows a comparison of normalised Congo red fluorescence of BphS-WT, BphS-7, StEP- 2-97, and BphS-13 after 16 h exposure to NIR light. Overnight cultures of the colonies were dropped in triplicates onto LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye. The colonies were then either exposed to NIR light or kept in the dark for 16 h before being harvested and resuspended in PBS. The fluorescence (AEx = 497 nm, AEm = 613 nm) of the bound Congo red dye was measured using a Tecan Infinite Pro II Spectrophotometer. All fluorescence readings were normalised to the OD600 of the cell suspension.
[0051] FIG. 7 shows a comparison of c-di-GMP synthase activity of purified BphS-WT and BphS-13 enzymes. A standard reaction mixture contained 5 nM of enzyme in 50 mM Tris-HCI (pH 7.6), 10 mM MgCl2, 0.5 mM EDTA, and 50 mM NaCI. The reaction was initiated at 25 °C by adding 20 nM of GTP and the proteins were irradiated with NIR light (A = 660 nm, 5.3 mW / cm2). Aliquots were withdrawn at 0, 5, 10, 20, 30, 60, and 90 min and boiled immediately for 5 min to halt all protein activity. The concentration of c-di-GMP present in the aliquots were then quantified using a c-di-GMP ELISA kit (Cayman Chemical, USA).
[0052] FIG. 8 shows the quantification of intracellular c-di-GMP levels in BphS-WT and BphS-13 biofilms at different time points. BL21 / (pYYDT-BphS-WT) and BL21 / (pYYDT-BphS-13) biofilms were grown on M9 minimal media (MP Biomedical, USA) supplemented with 0.5% yeast extract, 0.2% glucose and 1 .5% agar under dark and NIR conditions at 25 °C. At 8, 16 and 24 h, the bacterial mat growing on the agar plates were harvested and extracted using 95% ethanol. All intracellular c-di-GMP levels were normalised against total protein quantified by Qubit protein assay. For the intracellular c-di- GMP levels of BL21 / (pYYDT-BphS-13) biofilms grown under dark condition, the error bars are covered by the border of the bar graph.
[0053] FIG. 9 shows the study of BL21 / (pYYDT-BphS-WT) and BL21 / (pYYDT-BphS-13) biofilms in a flow cell setup. BL21 / (pYYDT-BphS-WT) and BL21 / (pYYDT-BphS-13) biofilms were cultivated in triplicates in three-channel flow cells (channel dimensions, 1 x 4 x 40 mm) in M9 minimal medium supplemented with 0.4% glucose and 50 pg / mL kanamycin at a flow rate of 3 mL h-1 . The biofilm in the flow cells were allowed to grow at room temperature under NIR light (A = 660 nm, 5.3 mW / cm2) or in the dark for 24 h before being imaged with a Carl Zeiss CLSM 780 (Carl Zeiss, Germany). The images obtained using the Carl Zeiss CLSM 780 (Carl Zeiss, Germany) were analysed using the Imaris software (Version 9.0.2, Bitplane, Switzerland). FIG. 9A CLSM images of biofilms grown in the flow cell setup after 24 h. The green, fluorescent colour represent the bacterial cells within the biofilms that were stained by the SYTO 9 nucleic acid stain. The scale bar represents 20 pm. FIG. 9B Thickness of BphS- WT and BphS-13 biofilms in the flow cell setup after 24 h. FIG. 9C Biovolume of BphS-WT and BphS- 13 biofilms in the flow cell setup after 24 h.
[0054] FIG. 10 shows a schematic of a gene construct used in immunotherapy studies of MCF-7. BphS-13 is expressed constitutively in transfected MCF-7 cancer cells. Upon exposure to NIR light, c- di-GMP is synthesized which activates the STING pathway and induction of Type I interferon promoters. This leads to the expression of a GFP which can then be used to monitor c-di-GMP production in MCF- 7 cells.
[0055] FIG. 11 shows confocal images of MCF-7 cells transfected with either pcDNA-BphS-13-hGFP- v2 or pcDNA. Cells were either exposed to NIR light or kept in the dark for up to 72 h before they were fixed and imaged with a CLSM.
[0056] FIG. 12 shows the responses to Cr (VI) of biosensors under near-infrared (NIR) light (red) or in the dark (black) in three sensing cycles with different Cr (VI) exposure patterns: FIG. 12A 1 to 5 to 1 mg / L, FIG. 12B 5 to 1 to 5 mg / L, and FIG. 12C 3 to 3 to 3 mg / L. Blank circles and solid triangles filled with blue represent the duplicates. Various shades of yellow correspond to different concentrations of Cr (VI), with darker hues signifying higher concentrationsDETAILED DESCRIPTION
[0057] The following detailed description refers to, by way of illustration, specific details and embodiments in which the invention may be practiced. These embodiments are described in sufficient detail to enable those skilled in the art to practice the invention. Other embodiments may be utilized and structural and logical changes may be made without departing from the scope of the invention. Embodiments described below in context of the polypeptides are analogously valid for the respective nucleic acid molecules, host cells, compositions, methods of use, and vice versa. The various embodiments are not necessarily mutually exclusive, as some embodiments can be combined with one or more other embodiments to form new embodiments.
[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The term "comprises" means "includes." In case of conflict, the present specification, including explanations of terms, will prevail. ‘‘About’’, as used herein in connection with numerical values refers to the referenced numerical value ±10% or ±5%.
[0059] Nucleotide second messengers are a key component of bacterial signalling pathways. These messengers allow bacterial cells to respond to environmental cues and regulate a large number of biochemical processes. One such messenger, bis-(3’-5’)-cyclic dimeric guanosine monophosphate (c- di-GMP), is ubiquitous in bacteria and regulates the switch between the motile (planktonic) and sessile (biofilm) modes of life. Utilising synthetic biology principles, one can rationally design a c-di-GMP control module to regulate intracellular c-di-GMP dynamics, and thus bacterial behaviour. Furthermore, c-di- GMP has potential biomedical applications due to the absence of this messenger molecule in mammalian cells. By rewiring the STING-activated signalling pathway in designer cells, orthogonal control of gene expression can be achieved for cell therapy and other applications. Therefore, the control of c-di-GMP dynamics provides an attractive means of controlling biological systems for numerous environmental, biotechnological, and biomedical applications.
[0060] Accordingly, the present invention provides a novel near-infrared (NIR) light-activated diguanylate cyclase (DGC) that has been engineered through a 3-step directed evolution process: error- prone PCR, in vitro homologous recombination, and site-directed mutagenesis. In particular, there is provided a polypeptide variant comprising one or more mutations relative the reference polypeptide (i.e. wild-type DCG polypeptide) and has been shown to confer advantageous effects in advantageously improving DGC activity (e.g. by about 13 times higher). The polypeptide disclosed herein may be termed as a variant for use in environmental, biotechnological, and biomedical applications as it allows more effective and efficient control of intracellular c-di-GMP dynamics. Due to the complex interactions between the photosensory module and its effector domains, it has been difficult to engineer and improve proteins that were used in optogenetics applications.
[0061] In various embodiments, the polypeptide disclosed herein may be termed as a NIR light- responsive DGC polypeptide variant. The polypeptide (DGC variant) may also be described as a bacteriophytochrome c-di-GMP synthase herein.
[0062] The term “diguanylate cyclase” (DGCs) as used herein, refers to a class of enzymes that catalyze the formation of the bacterial second messenger cyclic diguanylate monophosphate (cyclic-di- GMP or c-di-GMP) from two molecules of guanosine-5'-triphosphate (GTP). These enzymes arecharacterized by the presence of a GGDEF domain, named after its signature amino acid motif Gly- Gly-Asp-Glu-Phe (GG[D / E]EF), which is critical for catalytic activity. Cyclic-di-GMP-producing enzymes play a central role in bacterial signal transduction systems, regulating a wide array of physiological processes such as motility, biofilm formation, virulence, cell cycle progression, and differentiation. The intracellular concentration of c-di-GMP is dynamically controlled by the antagonistic activities of DGCs, which synthesize c-di-GMP, and phosphodiesterases (PDEs), which degrade it. DGCs may exist as stand-alone GGDEF-domain proteins or be modular, containing additional sensory or regulatory domains (e.g., PAS, GAF, or PHY domains) that modulate enzymatic activity in response to environmental or intracellular signals such as light, oxygen, or redox state. Light-regulated DGCs, such as bacteriophytochrome-derived enzymes, enable precise external control of c-di-GMP production, facilitating applications in synthetic biology and optogenetic systems.
[0063] In various embodiments, the polypeptide disclosed herein may be an isolated polypeptide. The term “isolated”, as used herein, relates to the polypeptide in a form where it has been at least partially separated from other cellular components it may naturally occur or associate with. The polypeptide may be a recombinant polypeptide, i.e. polypeptide produced in a genetically engineered organism that does not naturally produce said polypeptide. Both native and recombinant polypeptides may be post- transiationaliy modified by N-linked glycosylation.
[0064] In various embodiments, the polypeptide disclosed herein may be derived, or originated, from the Rhodobacter sphaeroides BphG1 protein and comprises one or more mutations in its amino acid sequence and encoded nucleotide sequence. In various embodiments, the polypeptide may be a BphS variant and termed a BphS polypeptide variant.
[0065] The term “BphS polypeptide”, as used herein, may refer to bacteriophytochrome-derived diguanylate cyclase, light-activated diguanylate cyclase, or c-di-GMP synthase BphS, and is a photosensory enzyme derived from the Rhodobacter sphaeroides BphG1 protein (UniProt accession number Q3IUZ1 and NCBI Reference Sequence NC_007490.2). The BphG1 polypeptide is characterized by a modular architecture comprising an N-terminal bacteriophytochrome photosensory domain (PAS-GAF-PHY triad) that mediates red-light sensing via a covalently bound biliverdin chromophore, and a C-terminal GGDEF domain responsible for diguanylate cyclase activity. The amino acid sequence of R. sphaeroides wild-type BphS is publicly available (e.g. Ryu, M.-H et al
[0022] ). In various embodiments, the wild-type BphS consists of an amino acid sequence of 687 amino acid residues in length (SEQ ID NO: 1). The PAS-GAF-PHY photosensory region spans approximately residues 1-511 of SEQ ID NO: 1 , enabling light-induced conformational changes, while the GGDEF domain spans residues 512-681 of SEQ ID NO: 1) and contains the conserved GG[D / E]EF motif essential for catalytic conversion of GTP to cyclic-di-GMP (c-di-GMP), a key bacterial second messenger. BphS polypeptides derived from R. sphaeroides BphG1 or functional variants thereof are characterized by light-regulated enzymatic activity, facilitating their application in optogenetic systemsfor the precise control of intracellular signaling pathways. In various embodiments, the polypeptide disclosed herein may be a bacteriophytochrome c-di-GMP synthase (i.e. light-regulated diguanylate cyclases, such as bacteriophytochrome diguanylate cyclase) that may be derived, or originating, from the Rhodobacter sphaeroides BphG1 protein.
[0066] The polypeptide disclosed herein may comprise or consist of a PAS domain (amino acids 19- 124 of SEQ ID NO:1); a GAF domain (amino acids 148-322 of SEQ ID NO:1); a PHY domain (amino acids 328-508 of SEQ ID NO:1); and / or a GGDEF domain (amino acids 512-681 of SEQ ID NO:1). In various embodiments, amino acid positions of the polypeptide disclosed herein that are essential for catalytic activity may include the GG[D / E]EF motif at positions 596-600 of SEQ ID NO:1 , which are conserved and these amino acid residues are invariable and not mutated. In various embodiments, the polypeptide may comprise the GG[D / E]EF motif at positions 596-600 of SEQ ID NO:1. In various embodiments, the polypeptide may comprise one or more of the PAS domain, GAF domain, PHY domain and GGDEF domain, preferably the polypeptide comprises the PAS domain, GAF domain, PHY domain and GGDEF domain.
[0067] In various embodiments, the polypeptide may comprise the PAS domain and amino acids corresponding to positions 19-124 of SEQ ID NO:1. In various embodiments, the polypeptide may comprise the GAF domain and amino acids corresponding to positions 148-322 of SEQ ID NO:1. In various embodiments, the polypeptide may comprise the PHY domain and amino acids corresponding to positions 328-508 of SEQ ID NO:1. In various embodiments, the polypeptide may comprise the GGDEF domain and amino acids corresponding to positions 512-681 of SEQ ID NO:1. In various embodiments, the polypeptide may comprise the GAF domain, whereby amino acids at positions 148- 322 relative to position numbering of SEQ ID NO:1 are conserved and invariable with respect to the WT BphS (i.e. SEQ ID NO:1 ).
[0068] The polypeptide disclosed herein may have, or exhibit, diguanylate cyclase activity. The term “diguanylate cyclase activity” as used herein, may refer to the enzymatic function of catalysing the condensation of two molecules of guanosine-5'-triphosphate (GTP) to generate bis-(3'-5')-cyclic dimeric guanosine monophosphate (c-di-GMP), a bacterial second messenger, with concomitant release of pyrophosphate. The DGC activity may also be photosensitive and modulated by specific wavelengths of light, most notably within the red (~660 nm) to near-infrared (NIR, -700-780 nm) spectral range. Upon irradiation with light, conformational changes in the phytochrome photosensory domain induce structural rearrangements that either activate or inhibit the catalytic GGDEF domain, thereby rendering c-di-GMP synthesis light-dependent. This photoswitchable activity may be characterized and quantified using spectrophotometric assays, c-di-GMP-specific fluorescent biosensors, HPLC or LC-MS-based quantification of c-di-GMP, or functional phenotypic assays in heterologous expression systems. The light-dependent regulatory mechanism enables precise spatiotemporal control of diguanylate cyclase activity for use in optogenetics, synthetic biology, or light-responsive microbial control systems.
[0069] In various embodiments, the polypeptides disclosed herein exhibit improved catalytic activity and / or photosensitivity relative to, and compared to, the reference / parental Wild-Type polypeptide. With its increased enzymatic activity and sensitivity to NIR light, the polypeptide disclosed herein will allow more dynamic control of intracellular c-di-GMP dynamics. Additionally, the irradiation time required to modulate activity will be reduced and the depth at which engineered cells expressing said polypeptide can be transplanted for cell therapeutics in the future can be increased.
[0070] In various embodiments, the polypeptides disclosed herein have DGC activity that is increased by at least 25%, at least 50%, at least 100% (i.e., a two-fold increase) compared to DGC activity of the wild-type BphS having the amino acid sequence of SEQ ID NO:1. The DGC activity may be measured under in vitro or in vivo conditions. In various embodiments, the DGC activity increase may fall within a range of 25% to 1500%, depending on the specific mutation(s), environmental conditions (e.g., light, temperature, or redox state), or host cell expression system.
[0071] In various embodiments, the polypeptides disclosed herein exhibit increased photosensitivity, defined as an enhanced light-dependent modulation of diguanylate cyclase (DGC) activity, relative to the wild-type BphS protein having the amino acid sequence of SEQ ID NO:1 . In various embodiments, the photosensitivity of the polypeptide may be increased by at least 25%, at least 50%, or at least 100% (i.e., a two-fold increase in light-to-dark activity ratio) compared to the wild-type protein. Photosensitivity may be assessed by measuring the fold-change in DGC activity between light-activated and darkinactive state conditions, under either in vitro or in vivo assay formats. In various embodiments, the increase in photosensitivity may fall within a range of 25% to 1500%, depending on the specific mutation(s), wavelength and intensity of light applied, environmental conditions (e.g., temperature), or the host cell expression system. Enhanced photosensitivity allows for more precise and responsive optical control of c-di-GMP signalling dynamics.
[0072] Accordingly, in various embodiments, the polypeptide having diguanylate cyclase activity may comprise an amino acid sequence set forth in SEQ ID NO:1 (WT-BphS) including one or more mutations that improve the DGC activity and / or photosensitivity of the polypeptide compared to the DGC activity and / or photosensitivity of the WT-BphS.
[0073] The term “amino acid mutation’’, as used herein, refers to any mutation such as substitution, deletion and also insertion of an amino acid residue at a position corresponding to the reference Wild- Type BphS, for example, the amino acid sequence set forth in SEQ ID NO:1 . A missense mutation, as used herein, refers specifically to a point mutation in the encoding nucleic acid sequence that results in the substitution of one amino acid for another in the corresponding amino acid sequence set forth in SEQ ID NO:1 . Thus, missense mutations are a subset of amino acid substitutions and may be either conservative or non-conservative in nature. The mutation may be a conservative and / or non-conservative mutation, more particularly a conservative and / or non-conservative substitution. The term "conservative amino acid substitution" means the exchange (substitution) of one amino acid residue for another amino acid residue, where such exchange does not lead to a considerable change in the polarity or charge or size at the position of the exchanged amino acid, e.g. the exchange of a nonpolar amino acid residue for another nonpolar amino acid residue. Conservative amino acid substitutions in the context of the invention encompass, for example, G=A, l=V=L=M, D=E, N=Q, N=Q=S=T, K=R, K=R=H, Y=F=W, S=T, S=T=C, G=A=I=V=L=M=Y=F=W=P=S=T. The amino acid mutation may also be a non-conservative mutation. The amino acid mutation may be an amino acid substitution, or a nonconservative amino acid substitution.
[0074] In various embodiments, the one or more mutations may be missense mutations resulting in amino acid substitutions at positions corresponding to the numbering of SEQ ID NO:1 . These mutations are introduced into the polypeptides of the invention, and do not adversely or detrimentally alter or reverse the activity and sequence domains detailed above, i.e. the cataiytic GG[D / E]EF motif, but rather enhance or improve the activity of the parent / reference polypeptide.
[0075] In various embodiments, the one or more mutations are at a position selected from A2, G4, L6, I9, G54, S89, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, E652 and Q655 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0076] In various embodiments, the one or more mutations are at a position selected from G4, 19, S89, L325, R377, G432, C492, and Q655 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 . In various embodiments, the one or more amino acid mutations comprise amino acid mutations at a position selected from I9, S89, R377, C492, and Q655. In various embodiments, the one or more amino acid mutations comprises amino acid mutations at a position selected from G4, I9, S89, L325, R377, G432, 0492, and Q655.
[0077] In various embodiments, the one or more mutations are at a position selected from G4, 19, S89, L325, R377, G432, C492, and Q655 of SEQ ID NO: 1 , and the polypeptide may optionally comprise one or more additional mutations at a position selected from A2, L6, G54, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, Q328, L325, T333, L334, P413, E414, G449, N491 , I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, and E652 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0078] All amino acid residues are generally referred to herein by reference to their one letter code and, in some instances, their three letter code. This nomenclature is well known to those skilled in the art and used herein as understood in the field. The term ‘‘amino acid”, as used herein refers to naturaland / or unnatural or synthetic amino acids, including both the D and L optical isomers, amino acid analogues (for example norleucine is an analog of leucine) and derivatives known in the art. The term “natural amino acid”, as used herein, relates to the 20 naturally occurring L-amino acids, namely Gly (G), Ala (A), Vai (V), Leu (L), lie (I), Phe (F), Cys (C), Met (M), Pro (P), Thr (T), Ser (S), Glu (E), Gin (Q), Asp (D), Asn (N), His (H), Lys (K), Arg (R), Tyr (Y), and Trp (W). Generally, in the context of the present application, the polypeptides are shown in the N- to C-terminal orientation. All amino acid residues are generally referred to herein by reference to their one letter code and, in some instances, their three letter code. This nomenclature is well known to those skilled in the art and used herein as understood in the field. As a person skilled in the art would appreciate, amino acids can be categorized in different classes depending upon the chemical and physical properties of the amino acid residue. Amino acids may be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1 ) non-polar: Ala, Vai, Leu, lie, Pro, Phe, Trp, Met; (2) uncharged polar: Gly, Ser, Thr, Cys, Tyr, Asn, Gin; (3) acidic: Asp, Glu; and (4) basic: Lys, Arg, His. Alternatively, naturally occurring residues may be divided into groups based on common side-chain properties: (1 ) hydrophobic: Norleucine, Met, Ala, Vai, Leu, lie; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe. As one of skill in the art would appreciate, amino acids can be categorized in different classes depending upon the chemical and physical properties of the amino acid residue. Typically, hydrophobic amino acids can be further classified as having an aliphatic side chain or an aromatic side chain. Aliphatic amino acids and aromatic amino acids are known one of skill in the art. Typically, aliphatic amino acids have a side chain containing hydrogen and carbon atoms. Examples of aliphatic amino acids include alanine, isoleucine, proline, and valine. Typically, aromatic amino acids contain a side chain containing an aromatic ring. Examples of aromatic amino acids include phenylalanine, tyrosine, histidine and tryptophan.
[0079] In various embodiments, the one or more mutations is selected from those listed in the below Table 1 , with amino acid (AA) position numbering relative to WT-BphS (SEQ ID NO:1 ).
[0080] In various embodiments, the one or more mutations comprise: the amino acid residue G at position 4 substituted with an uncharged polar or neutralhydrophilic amino acid residue, preferably C; and / or the amino acid residue I at position 9 substituted with a non-polar, or aromatic, or hydrophobic amino acid residue, preferably F; and / or the amino acid residue S at position 89 substituted with a non-polar or aliphatic amino acid residue, preferably P: and / or the amino acid residue L at position 325 substituted with a non-polar or hydrophobic or aliphatic amino acid residue, preferably I; and / or the amino acid residue R at position 377 substituted with an uncharged polar or neutral hydrophilic amino acid residue, preferably C; and / or the amino acid residue G at position 432 substituted with an acidic or negatively charged amino acid residue, preferably D; and / or the amino acid residue C at position 492 substituted with a uncharged polar or neutral hydrophilic amino acid residue, preferably S; and / or the amino acid residue Q at position 655 substituted with a basic or positively charged amino acid, preferably K.
[0081] In various embodiments, the one or more mutations may be selected from A2V, G4C, L6S, I9F, G54D, S89P, T94A, I95L, F98I, D128N, G129D, A135V, R136C, L162S, A210V, A223S, L315I, A322T, L325I, Q328H, T333S, L334I, R377C, P413S, E414D, G432D, G449A, N491 K, C492S, I500V, V516A, E532D, L534I, L535I, R544H, K545E, Q561 L, I583N, E617G, N626T, V628A, E652G, Q655K and combinations thereof.
[0082] In various embodiments, the one or more amino acid mutations may be selected from G4C, I9F, S89P, L325I, R377C, G432D, C492S, Q655K and combinations thereof.
[0083] In various embodiments, the polypeptide disclosed herein comprises the amino acid mutations I9F, S89P, R377C, C492S, and Q655K. In various embodiments, the polypeptide disclosed herein comprises the amino acid mutations G4C, I9F, S89P, L325I, R377C, G432D, C492S, and Q655K.
[0084] Table 2: Lists amino acid substitutions and BphS variants identified in this invention using the amino acid sequence of wild-type BphS as reference (N- to C-terminal). The mutations are depicted in the amino acid sequences in bold and |bordered| for ease of reference.
[0085] In various embodiments, the polypeptide disclosed herein comprises or consists of the amino acid sequence set forth in any one of SEQ ID NO:2-35 or a functional variant or fragment thereof. In various embodiments, the polypeptide disclosed herein comprises or consists of the amino acid sequence set forth in SEQ ID NO:2 or 3, or a functional variant or fragment thereof. In various embodiments, the polypeptide disclosed herein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant or fragment thereof.
[0086] The term “functional variant”, as used herein in relation to the polypeptide disclosed herein, relates to polypeptides that comprise or consist of an amino acid sequence that is at least 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91 %, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.25%, or 99.5% identical or homologous to the amino acid sequence set forth in any one of SEQ ID NO:1-35 over their entire length comprising the one or more mutations, but retain the functionality of the reference sequence (i.e. DGC activity). In such functional variants, the amino acid residues responsible for catalytic activity, namely the GG[D / E]EF motif, may be invariable. The term “functional variant”, also encompasses variants that comprise the amino acid sequence set forth in any one of SEQ ID NO:1-35 over their entire length comprising the one or more mutations, but also comprise N- and / or C-terminal extensions of 1 or more amino acids.
[0087] The identity of amino acid sequences (or nucleotide sequences) is generally determined by means of a sequence comparison. This sequence comparison is based on the BLAST algorithm that is established in the existing art and commonly used (cf. e.g. Altschul et al. (1990) “Basic local alignment search tool”, J. Mol. Biol. 215:403-410, and Altschul et al. (1997): “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”; Nucleic Acids Res., 25, p. 3389-3402) and is effected in principle by mutually associating similar successions of nucleotides or amino acids in the nucleic acid sequences and amino acid sequences, respectively. A tabular association of the relevant positions is referred to as an "alignment." Sequence comparisons (alignments), in particular multiple sequence comparisons, are commonly prepared using computer programs which are available and known to those skilled in the art.
[0088] A comparison of this kind also allows a statement as to the similarity to one another of the sequences that are being compared. This is usually indicated as a percentage identity, i.e. the proportion of identical nucleotides or amino acid residues at the same positions or at positions corresponding to one another in an alignment. The more broadly construed term "homology", in the context of amino acid sequences, also incorporates consideration of the conserved amino acid exchanges, i.e. amino acids having a similar chemical activity, since these usually perform similar chemical activities within the protein. The similarity of the compared sequences can therefore also be indicated as a "percentage homology" or "percentage similarity." Indications of identity and / or homology can be encountered over entire polypeptides or genes, or only over individual regions. Homologous and identical regions of various nucleic acid sequences or amino acid sequences are therefore defined by way of matches in the sequences. Such regions often exhibit identical functions. They can be small, and can encompass only a few nucleotides or amino acids. Small regions of this kind often perform functions that are essential to the overall activity of the protein. It may therefore be useful to refer sequence matches only to individual, and optionally small, regions. Unless otherwise indicated, however, indications of identity and homology herein refer to the full length of the respectively indicated amino acid sequence (or nucleic acid sequence).
[0089] In various embodiments, the polypeptide comprises or consists of an amino acid sequence that is at least 60%, 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91 %, 91 .5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.25%, or 99.5% identical or homologous to the amino acid sequence set forth in SEQ ID NO:1 over its entire length, and comprises the one or more mutations. In some embodiments, the polypeptide has an amino acid sequence that shares at least 60, preferably at least 70, more preferably at least 80, most preferably at least 90 % sequence identity with the amino acid sequence set forth in SEQ ID NOU over its entire length or has an amino acid sequence that shares at least 80. preferably at least 90, more preferably at least 95% sequence homology with the amino acid sequence set forth in SEQ ID NO:1 over its entire iength, and comprises the one or more mutations.
[0090] In addition to the above-described mutations, polypeptides according to the embodiments disclosed herein can comprise amino acid modifications other than those described above (i.e. amino acid mutations (substitutions) at positions A2, G4, L6, 19, G54, S89, T94, 195, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, E652 and Q655 of SEQ ID NO:1). Such polypeptides are, for example, further developed by targeted genetic modification, i.e. by way of mutagenesis methods, and optimized for specific purposes or with regard to special properties (for example, with regard to their catalytic activity, stability, photosensitivity etc.). If such additional modifications are introduced into the polypeptides of the invention, these preferably do not affect, alter the DGC activity of the reference / parental polypeptide.
[0091] The term “functional fragment” or “fragment”, as used herein in relation to the polypeptides disclosed herein, relates to polypeptides that differ from the amino acid sequence set forth in any one of SEQ ID NO:1-35 by a deletion of one or more amino acids from its C- and / or N-terminus while retaining the DGC activity. Said fragments preferably retain full functionality, or possess improved functionality. In various embodiments, such fragment differs from the reference sequence and they may lack 1 -20 amino acids from their N- and / or C-terminus, for example 1 -15 amino acids or 1 -10 amino acids or 1 -5 amino acids, and encompasses an amino acid sequence that matches the initial molecule as set forth in SEQ ID NOs. 1-35 over a length of at least 250, 300, 350, 400, 450, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, or 650 continuously connected amino acids. In the functional fragment, the one or more amino acids at positions corresponding to positions A2, G4, L6, 19, G54, S89, T94, 195, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , 1583, E617, N626, V628, E652 and Q655 of SEQ ID NO:1 , contained in the initial reference BphS variant are still present.
[0092] Accordingly, in one aspect the present invention relates to a polypeptide having diguanylate cyclase activity, comprising or consisting of:(i) an amino acid sequence set forth in SEQ ID NO:1 (WT-BphS);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2 or 3 over its entire length; or(ill) a functional fragment of (I), or (ii); wherein the polypeptide comprises a GG[D / E]EF motif, and one or more amino acid mutations at a position selected from A2, G4, L6, I9, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325 77, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K54 617, N626, V628, E652 and Q655 G4, I9, S89, L325, R377, G432, C492, and Q655 , wherein position numbering is relative to the amino acid sequence set forth in SEQ I
[0093] In various embodiments, the polypeptide disclosed herein may comprise or consist of:(i) an amino acid sequence set forth in any one of SEQ ID NO:2-35;(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2-35 over its entire length; or(iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at a position selected from A2, G4, L6, 19, G54, S89, T94, 195, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, E652 and Q655 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0094] In various embodiments, the polypeptide disclosed herein may comprise or consist of:(i) an amino acid sequence set forth in SEQ ID NO:2 (BphS-7);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2 over its entire length; or(iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions I9, S89, R377, C492, and Q655 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0095] In various embodiments, the polypeptide disclosed herein may comprise or consist of:(i) an amino acid sequence set forth in SEQ ID NO:3 (BphS-13);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:3 over its entire length; or(iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions G4, I9, S89, L325, R377, G432, C492, and Q655 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
[0096] Nucleic acid molecules encoding the polypeptides disclosed herein are also provided. All embodiments disclosed above in relation to the polypeptide similarly apply to the nucleic acid molecules and vice versa.
[0097] The nucleic acid molecules can be DNA molecules or RNA molecules. They can exist as an individual strand, as an individual strand complementary to said individual strand, or as a double strand.With DNA molecules in particular, the sequences of both complementary strands in all three possible reading frames are to be considered in each case. Also to be considered is the fact that different codons, i.e. base triplets, can code for the same amino acids, so that a specific amino acid sequence can be coded by multiple different nucleic acids. As a result of this degeneracy of the genetic code, all nucleic acid sequences that can encode one of the above-described polypeptides are included in this subject of the invention. The skilled artisan is capable of unequivocally determining these nucleic acid sequences, since despite the degeneracy of the genetic code, defined amino acids are to be associated with individual codons. The skilled artisan can therefore, proceeding from an amino acid sequence, readily ascertain nucleic acids coding for that amino acid sequence. In addition, in the context of nucleic acids according to the present invention one or more codons can be replaced by synonymous codons. This aspect refers in particular to heterologous expression of the enzymes contemplated herein. For example, every organism, e.g. a host cell of a production strain, possesses a specific codon usage. "Codon usage" is understood as the translation of the genetic code into amino acids by the respective organism. Bottlenecks in protein biosynthesis can occur if the codons located on the nucleic acid are confronted, in the organism, with a comparatively small number of loaded tRNA molecules. Also it codes for the same amino acid, the result is that a codon becomes translated in the organism less efficiently than a synonymous codon that codes for the same amino acid. Because of the presence of a larger number of tRNA molecules for the synonymous codon, the latter can be translated more efficiently in the organism.
[0098] By way of methods commonly known today such as, for example, chemical synthesis or the polymerase chain reaction (PCR) in combination with standard methods of molecular biology or protein chemistry, a skilled artisan has the ability to manufacture, on the basis of known DNA sequences and / or amino acid sequences, the corresponding nucleic acids all the way to complete genes. Such methods are known, for example, from Sambrook, J., Fritsch, E. F., and Maniatis, T, 2001 , Molecular cloning: a laboratory manual, 3rd edition, Cold Spring Laboratory Press.
[0099] In various embodiments, the nucleic acid molecule comprises or consists of a nucleotide sequence encoding the polypeptides disclosed herein.
[0100] Table 3: Lists nucleotide sequences (5’-3’) encoding the BphS variants outlined in Table 2 identified in this invention using the nucleotide sequence encoding the wild-type BphS as reference. Nucleotide (nt) position numbering is relative to WT-BphS (SEQ ID NO:36).
[0101] The term "5'" as used herein refers to the directionality, i.e., the end-to-end chemical orientation of a single strand of nucleic acid. The chemical convention of naming carbon atoms in the nucleotide sugar-ring numerically gives rise to a 5-end and a 3-end. The relative positions of structures along a strand of nucleic acid, including genes and various protein binding sites, are usually noted as being either upstream (towards the 5-end) or downstream (towards the 3-end). This naming convention is important because nucleic acids can only be synthesized in vivo in the 5-to-3' direction, as the polymerase that assembles new strands only attaches new nucleotides to the 3-hydroxyl (-OH) group, via a phosphodiester bond.
[0102] In various embodiments, the nucleic acid molecule comprises or consists of a nucleotide sequence as set forth in any one of SEQ ID NO:37-70 or a nucleotide variant, or a complement thereof.
[0103] The term "nucleotide variant" in the context of a nucleic acid (nucleotide) sequence has an altered sequence in which one or more of the nucleotides in the reference sequence is deleted, or substituted, or one or more nucleotides are inserted into the sequence of the reference nucleotide sequence. Due to the degeneracy of the genetic code, a "variant" of a nucleotide sequence can either result in a change in the respective reference amino acid sequence, i.e. in an amino acid "sequence variant" or not. In various embodiments, a nucleotide sequence variant does not result in an amino acid sequence variant ( e.g ., a silent mutation). In various embodiments, a nucleotide sequence variant that results in one or more "non-silent" mutations is contemplated, and also a combination of non-silent and silent mutations is contemplated. In various embodiments, a nucleotide sequence variant shares at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence set forth in SEQ ID Nos. 37-70. In various embodiments, a nucleotide sequence variant encodes an amino acid sequence that is at least80%, 85 %, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference amino acid sequence. Nucleotide and amino sequences as disclosed herein may refer also to codon-optimized versions of a reference or wild-type nucleotide or amino acid sequence. In any of the embodiments described herein, nucleotide sequence disclosed herein may be codon-optimized for a host cell containing the nucleotide sequence (see, e.g , Scholten et al., Clin. Immunol. 119: 135-145 (2006). Codon optimization can be performed using known techniques and tools. Codon-optimized sequences include sequences that are partially codon-optimized (i.e., at least one codon is optimized for expression in the host cell) and those that are fully codon-optimized. In various embodiments, the nucleotide variants are invariable with respect to the nucleotide sequences encoding the GG[D / E]EF motif, or their degenerate variants.
[0104] The term "degenerate variant" refers to a nucleotide sequence encoding a protein (for example, the polypeptide disclosed herein) that includes a nucleotide sequence that is degenerate as a result of the genetic code. There are twenty natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included as long as the resulting polypeptide disclosed herein encoded by the nucleotide sequence has DGC activity.
[0105] The term "silent mutation" refers to a coden change that does not result in an amino acid change in an expressed polypeptide and is based on redundancy of codon usage for amino acid insertion
[0106] The term "complement", as used herein, relates to a nucleic acid molecule which is complementary to another nucleic acid molecule when both nucleic acid molecules are aligned antiparallel to each other in that essentially all nucleotides of either of the nucleic acid molecules form Watson-Crick base pairs with the corresponding nucleotides on the other molecule. In various embodiments, the complements are full complements in that each nucleotide of the respective molecule or sequence forms a Watson-Crick base pair with a corresponding nucleotide on the other strand.
[0107] In various embodiments, the nucleic acid molecule comprises or consists of (i) a nucleotide sequence as set forth in any one of SEQ ID NO:37-70 or nucleotide variant, or a complement thereof; or (ii) a nucleotide sequence that shares at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98.0%, 98.5%, 99.0%, or 99.5% sequence identity with a nucleotide sequence of (i) or a complement thereof.
[0108] In various embodiments, the nucleic acid molecule comprises or consists of (i) a nucleotide sequence as set forth in SEQ ID NO:37 (encoding BphS-7); or nucleotide variant, or a complement thereof; or (II) a nucleotide sequence that shares at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98.0%, 98.5%, 99.0%, or 99.5% sequence identity with a nucleotide sequence of (i) or a complement thereof.
[0109] In various embodiments, the nucleic acid molecule comprises or consists of (i) a nucleotide sequence as set forth in any one of SEQ ID NO:38 (encoding BphS-13); or nucleotide variant, or a complement thereof; or (II) a nucleotide sequence that shares at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98.0%, 98.5%, 99.0%, or 99.5% sequence identity with a nucleotide sequence of (I) or a complement thereof.
[0110] In various embodiments, the nucleotide sequence comprises one or more silent mutations at a nucleotide position corresponding to nucleotide positions of SEQ ID NO: 36 (WT-BphS). In this regard, the position numbering is relative to the nucleotide sequence set forth in SEQ ID NO:36.
[0111] In various embodiments, the one or more silent mutations may be selected from the following: a silent mutation at a nucleotide position corresponding to nucleotide position 105 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 35 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 141 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 47 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 276 of SEQ ID NO: 36, preferably the codon is changed from CCA to CCG, wherein the silent mutation encodes the amino acid P at position 92 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1056 of SEQ ID NO: 36, preferably the codon is changed from GAT to GAC, wherein the silent mutation encodes the amino acid D at position 352 of SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1215 of SEQ ID NO: 36, preferably the codon is changed from GTT to GTC, wherein the silent mutation encodes the amino acid V at position 405 of SEQ ID NO:1 .
[0112] In various embodiments, the nucleotide sequence comprises one or more silent mutations selected from the following: a GCT to GCC silent mutation at a nucleotide position corresponding to nucleotide position 141 of SEQ ID NO: 36 (corresponding to A47 in the amino acid sequence set forth in SEQ ID NO:1 ); and / or a CCA to CCG silent mutation at a nucleotide position corresponding to nucleotide position 276 of SEQ ID NO: 36 (corresponding to P92 in the amino acid sequence set forth in SEQ ID NO:1 ); and / or a GCT to GCC silent mutation at a nucleotide position corresponding to nucleotide position 105 of SEQ ID NO: 36 (corresponding to A35 in the amino acid sequence set forth in SEQ ID NO:1 ); and / or a GAT to GAC silent mutation at a nucleotide position corresponding to nucleotide position 1056 of SEQ ID NO: 36 (corresponding to D352 in the amino acid sequence set forth in SEQ ID NO:1 ); and / ora GTT to GTC silent mutation at a nucleotide position corresponding to nucleotide position 1215 of SEQ ID NO: 36 (corresponding to V405 in the amino acid sequence set forth in SEQ ID NO:1 ).
[0113] In various embodiments, the nucleic acid molecule is an isolated nucleic acid molecule. As used herein the term "isolated nucleic acid molecule” relates to nucleic acid molecules that may appear independent of their natural genetic context and / or background and are preferably separated from other nucleic acids or cellular components. The separation may occur by purification, for which various techniques are known in the art.
[0114] In various embodiments, the nucleic acid molecules may be a circular DNA molecule such as a plasmid, vector, cosmid, bacterial artificial chromosome (BAC), bacteriophage, viral vector or hybrids thereof.
[0115] In various embodiments, the nucleic acid molecules may be comprised in a vector or is a vector. Vectors are understood for purposes herein as elements - made up of nucleic acids - that contain a nucleic acid molecule or nucleic acid sequence contemplated herein as a characterizing nucleic acid region. They enable said nucleic acid to be established as a stable genetic element in a species or a cell line over multiple generations or cell divisions. In particular, when used in bacteria, vectors are special plasmids, i.e. circular genetic elements. Included among the vectors are, for example, those whose origins are bacterial plasmids, viruses, or bacteriophages, or predominantly synthetic vectors or plasmids having elements of widely differing derivations. Using the further genetic elements present in each case, vectors are capable of establishing themselves as stable units in the relevant host cells over multiple generations. They can be present extrachromosomally as separate units, or can be integrated into a chromosome respectively into chromosomal DNA. In various embodiments, the vector may be selected from the group of plasmids (i.e. bacterial plasmids), binary vectors, DNA vectors, mRNA vectors, retroviral vectors, lentiviral vectors, adenoviral vectors, transposon-based vectors, and artificial chromosomes.
[0116] In various embodiments, the vector may be an expression vector. Expression vectors encompass nucleotide sequences which are capable of replicating in the host cells that contain them, and expressing therein a contained nucleotide sequence. In various embodiments, the vectors described herein thus also contain regulatory elements that control the expression of the nucleotide sequence encoding the polypeptide of the invention. Expression is influenced in particular by the promoter or promoters that regulate transcription. Expression can occur in principle by means of the natural promoter originally located in front of the nucleic acid sequence to be expressed, but also by means of a host-cell promoter furnished on the expression vector or also by means of a modified, or entirely different, promoter of another organism or of another host cell. In the present case at least one promoter for expression of the polypeptide as contemplated herein is made available and used for expression thereof. Expression vectors can furthermore be regulated, for example by way of a changein culture conditions or when the host cells containing them reach a specific cell density, or by the addition of specific substances, in particular activators of gene expression.
[0117] In various embodiments, the nucleic acid molecule disclosed herein may comprise an “expression construct” which refers to a functional unit built in the vector for the purpose of recombinantly expressing the polypeptide disclosed herein, when introduced into an appropriate host cell. The term "recombinant", as used herein (e.g. a recombinant protein, a recombinant nucleic acid, or the like), refers to any molecule which is prepared, expressed, created or isolated by recombinant means, and which is not naturally occurring. "Recombinant" can be used synonymously with "engineered" or "non-natural" and can refer to to an organism, microorganism, cell, nucleic acid molecule, or vector that includes at least one genetic alteration or has been modified by introduction of an exogenous nucleic acid molecule, wherein such alterations or modifications are introduced by genetic engineering (i.e., human intervention). Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding proteins, or other nucleic acid molecule additions, deletions, substitutions or other functional disruption of a cell’s genetic material. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a polynucleotide, gene or operon.
[0118] In various embodiments, the nucleic acid molecule may be comprised in a bacterial plasmid or is a bacterial plasmid. The term “bacterial plasmid” as used herein refers to a circular DNA molecule capable of replication in a bacterial host cell. A bacterial plasmid may contain an appropriate origin of replication, which is a sequence of DNA sufficient to enable the replication of the plasmid in a host bacterial cell. A bacterial plasmid may also contain a selectable marker sequence, which encodes a selectable marker conferring cellular resistance to antibiotics such as ampicillin, kanamycin, chloramphenicol, and tetracycline.
[0119] In various embodiments, the nucleic acid molecule may comprise coding sequences of structural genes (e.g., reporter genes, fluorescent marker gene, selection marker genes, oncogenes, drug resistance genes, growth factor genes), and non-coding sequences which do not encode an mRNA or protein product (e.g., promoter sequences, polyadenylation sequences, termination sequences, enhancer sequences, small interfering RNAs, short hairpin RNAs, antisense RNAs, microRNAs, long non-coding RNAs).
[0120] In various embodiments, the nucleic acid molecule may further comprise regulatory elements for controlling expression of the nucleic acid molecule, more particularly for controlling expression of the polypeptide disclosed herein.
[0121] The term "operably linked" as used herein refers to the relationship between two or more nucleotide sequences that interact physically or functionally. For example, a promoter or regulatorynucleotide sequence is said to be operably linked to a nucleotide sequence that codes for an RNA or a protein if the two sequences are situated such that the regulatory nucleotide sequence will affect the expression level of the coding or structural nucleotide sequence. “Regulatory nucleotide sequences” as used herein refer to nucleotide sequences that influence the timing and level / amount of transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters; translation leader sequences; introns; enhancers; stem-loop structures; repressor binding sequences; termination sequences; and polyadenylation recognition sequences. Particular regulatory sequences may be located upstream and / or downstream of a coding sequence operably linked thereto.
[0122] In various embodiments, the nucleotide sequence encoding the polypeptides disclosed herein may be operably linked to a promoter suitable for controlling expression of the polypeptides disclosed herein. In this regard, the nucleic acid molecule may comprise a nucleotide sequence encoding the polypeptides disclosed herein and a promoter.
[0123] In various embodiments, the promoter may be a constitutive promoter. Many constitutive promoters are known in the art and can be used for expression in host cells of genes and particularly reporter genes. Examples of constitutive promoters include, but are not limited to, the promoter of the mouse metallothionein I gene sequence; the thymidine kinase (TK) promoter of Herpes virus; the SV40 early promoter; the yeast GAL1 gene sequence promoter; the cytomegalovirus (CMV) promoter; the elongation factor-1 alpha (EF-1a) promoter; the actin promoter (including, but not limited to, the chicken P-actin promoter); the phosphoglycerate kinase (PGK) promoter; and the ubiquitin promoter. In various embodiments, the constitutive promoter is a CMV promoter, SV40 promoter, EF-1a promoter, or an actin promoter. However, it will be appreciated that inducible, tissue-specific, and stimulus-responsive promoters, may also be used. Examples of inducible promoters include tetracycline-responsive (Tet- On / Tet-Off) promoters, ecdysone-responsive promoters, and heat shock protein (HSP) promoters. Tissue-specific promoters include, for example, the neuron-specific enolase (NSE) promoter, the albumin promoter (liver-specific), and the myosin light chain promoter (muscle-specific). Stimulus- responsive promoters include interferon (IFN)-responsive promoters, such as IFN-a, IFN-p (type I IFN), and IFN-y (type II IFN) inducible promoters, as well as NF-KB-responsive promoters, hypoxia-inducible promoters (e.g., HRE), and retinoic acid-responsive elements. It is understood that any promoter suitable for driving expression in the desired host system — whether viral, synthetic, constitutive, inducible, tissue-specific, or stimulus-responsive — may be used depending on the application.
[0124] In various embodiments, the promoter operably linked to the nucleotide sequence encoding the polypeptides disclosed herein may be a CMV promoter.
[0125] In various embodiments, the nucleic acid molecule may comprise a fluorescent marker gene.The term “fluorescent marker gene” disclosed herein refers to a gene or nucleotide sequence whoseexpression in a host cell can be detected or made visible. In various embodiments, the fluorescent marker gene may be selected from a green fluorescent protein (GFP) gene or enhanced green fluorescent protein (eGFP) gene, yellow fluorescent protein (YFP) gene or enhanced yellow fluorescent protein (eYFP) gene, red fluorescent protein (RFP) gene, mCherry gene, mRaspberry gene, mPlum gene, mTomato gene, dsRed gene, and luciferase gene. In various embodiments, the fluorescent marker gene is a green fluorescent protein (GFP) gene or enhanced green fluorescent protein (eGFP) gene.
[0126] In various embodiments, the fluorescent marker gene may be operably linked to a promoter suitable for controlling expression of the fluorescent marker gene. In various embodiments, the promoter operably linked to the fluorescent marker gene may be a stimulus-responsive promoter, preferably an interferon (IFN)-responsive promoter.
[0127] In various embodiments, the nucleic acid molecule may comprise a nucleotide sequence encoding the polypeptide disclosed herein operably linked to a first promoter, and a fluorescent marker gene operably linked to a second promoter. In various embodiments, the fluorescent marker gene may be positioned downstream of the nucleotide sequence encoding the polypeptide disclosed herein, whereby the respective first and second promoters are positioned upstream of the nucleotide sequences (coding sequence) they are operably linked to. In this regard, upon expression of the polypeptide disclosed herein within a host cell and activation of said polypeptide via near-infrared (NIR) light, cyclic di-GMP (c-di-GMP) may be synthesized, thereby activating the STING pathway in said host cell and inducing the second promoter (e.g., an interferon (IFN) promoter), which in turn drives expression of the fluorescent marker gene for detecting or monitoring c-di-GMP production in the host cell.
[0128] In various embodiments, the nucleic acid molecule may comprise one or more selection marker genes. In various embodiments, the nucleic acid molecule may comprise a promoter-free selection marker gene that is not operably linked to a promoter.
[0129] The term “selection marker gene’’ as used herein refers to a gene that only allows cells carrying the gene to be specifically selected for or against in the presence of a corresponding selection agent. For example, selectable genes commonly used with eukaryotic cells include the genes for aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase, asparagine synthetase, and genes encoding resistance to neomycin (G418), hygromycin, puromycin, histidinol D, bleomycin and phleomycin.
[0130] In various embodiments, the nucleic acid molecule may comprise one or more c-di-GMP- responsive regulatory elements. Such elements may include riboswitches, c-di-GMP-binding proteindomains (e.g., PilZ domains), or transcriptional regulators responsive to c-di-GMP. In various embodiments, the one or more c-di-GMP-responsive regulatory elements may be operably linked to a gene of interest.
[0131] In various embodiments, the nucleic acid molecule may comprise nucleotide sequences for co- expression of biliverdin or its biosynthetic enzymes.
[0132] In various embodiments, the nucleic acid molecule may comprise one or more additional genes (i.e. gene of interest) encoding a protein or gene product that is desirably secreted from a host cell. In various embodiments, the one or more additional genes may include biosimilars and / or therapeutic agent genes that encode molecules that provide some therapeutic benefit, including proteins (e.g., secreted proteins, membrane-associated proteins (e.g., receptors), structural proteins, cytoplasmic proteins, and the like) functional RNAs (antisense, hammerhead ribozymes), and the like. Such genes include genes encoding an antibody and may be referred to herein as “genes of interest” that may be desirably regulated and expressed in the presence of the polypeptide disclosed herein.
[0133] Another aspect of the invention relates to a host cell comprising the polypeptide or nucleic acid molecule disclosed herein. All embodiments disclosed above in relation to the polypeptide and nucleic acid molecule disclosed herein, similarly apply to the host cell, and vice versa.
[0134] All cells are in principle suitable as host cells, i.e. prokaryotic or eukaryotic cells. Those host cells that can be manipulated in genetically advantageous fashion. The term "host cell" as used herein refers to a living cell into which the nucleic acid molecule, or polypeptide is to be or has been introduced. In various embodiments, the step of introducing the polypeptide or nucleic acid molecule into the host cell may be carried out by any method known in the art, including but not limited to: DNA transfection, transformation, or electroporation (for nucleic acid delivery): viral transduction (e.g., lentiviral, retroviral, or AAV vectors); nanoparticle-mediated delivery: bioiistic particle delivery (gene gun); ultrasound- mediated delivery; microinjection; or direct polypeptide delivery methods such as ceil-penetraiing pepirdes (e.g., HIV Tat-mediated delivery), hposome encapsulation, or protean transduction domains.
[0135] The living cell includes both a cultured cell and a cell within a living organism. In various embodiments, host cells can be engineered to incorporate a desired gene or expression construct on its chromosome or in its genome. The host cell may be any cell that is commonly used for expression, i.e. transcription and translation of the nucleic acid molecule for the expression of the polypeptide disclosed herein. In particular, the term “host cell” relates to prokaryotes, eukaryotes, plants, insect cells or mammalian cells, cell lines and cell culture systems. Host cells include, without limitation, bacterial, microbial, plant or animal cells. In various embodiments, the host cell is a microbial cell, preferably a bacterial cell such as an E. Coli cell. In various embodiments, the host cell is a S. oneidensis cell. In various embodiments, the host cell is a mammalian cell, preferably a human cell.
[0136] In various embodiments, the host cell is represented by those host cells whose activity can be regulated on the basis of genetic regulation elements that are made available, for example, on a vector, but can also be present a priori in those cells. They can be stimulated for expression, for example, by controlled addition of chemical compounds that serve as activators, by modifying the culture conditions, or when a specific cell density is reached. This makes possible economical production of the polypeptides contemplated herein. Host cells contemplated herein may comprise other or additional selection markers, or can also express other or additional proteins. They can, in particular, be those host cells that transgen ically express multiple proteins or enzymes.
[0137] A nucleic acid molecule disclosed herein or a vector or plasmid containing said nucleic acid molecule may be transfected, transduced or transformed into the host cell, which all generally refers to the incorporation of the nucleic acid molecule into the host cell. The host cells contemplated herein may be cultured and fermented in vitro in a usual manner, for example in discontinuous or continuous systems. In the former case a suitable nutrient medium is inoculated with the host cells.
[0138] There is also provided a composition comprising the polypeptide, the nucleic acid molecule encoding the polypeptide, or the host cell comprising the nucleic acid molecule disclosed herein. In various embodiments, the composition may comprise one or more additional components or agents that enhance the function, delivery, stability, or therapeutic applicability of the polypeptide, nucleic acid molecule, or host cell for one or more of the uses described below.
[0139] In various embodiments, the composition may comprise a chromophore or chromophore precursor, such as biliverdin, or a biosynthetic enzyme (e.g., heme oxygenase) capable of generating the chromophore in situ. In various embodiments, the nucleic acid molecule may comprise a nucleotide sequence encoding the chromophore biosynthetic pathway components to ensure adequate cofactor availability in non-mammalian systems.
[0140] In various embodiments, the composition may comprise one or more excipients, carriers, or stabilizing agents, including but not limited to: buffering agents (e.g., PBS, HEPES), osmoprotectants (e.g., mannitol, trehalose), cryoprotectants (e.g., glycerol, DMSO), stabilizing proteins (e.g., serum albumin), or surfactants (e.g., polysorbates). The composition may also include nanoparticles, liposomes, hydrogels, or microspheres for formulation into an injectable or implantable drug delivery system. In various embodiments, the composition may be formulated to be administered subdermally into a subject. In various embodiments, the compositions may be pharmaceutically acceptable, meaning they are suitable for administration to a human or animal subject without undue toxicity, irritation, or allergic response, and are capable of delivering a therapeutic effect under the intended conditions of use. Thus, the composition disclosed herein may be a pharmaceutical composition.
[0141] In various embodiments, the composition may comprise a biocompatible matrix for encapsulating the polypeptide, nucleic acid molecule, or host cell, such as alginate, collagen, polyethylene glycol (PEG), poly(lactic-co-glycolic acid) (PLGA), or other polymeric or hydrogel-based materials. Such compositions may be used in implantable or subdermal drug delivery systems and may be configured to support nutrient diffusion, immune protection, and NIR light penetration.
[0142] In various embodiments, the composition may include one or more therapeutic agents or genes encoding therapeutic products(agent) that are expressed under the control of c-di-GMP-responsive regulatory elements. These agents may include cytokines (e.g., IL-2, IL-10), immune effectors (e.g., granzymes, perforin), growth factors (e.g., BDNF, NGF), antibodies or antibody fragments, metabolic enzymes, or anti-inflammatory or cytotoxic proteins. In various embodiments, the therapeutic gene is comprised in the same nucleic acid molecule as the polypeptide or on a separate “second” nucleic acid molecule introduced into the same host cell.
[0143] Accordingly, the compositions disclosed herein may be formulated and adapted for use in a wide range of applications, including optogenetics, gene therapy, synthetic biology, biosensing, microbial control, and programmable drug delivery. The components of the composition may be suitably selected and formulated by those skilled in the art based on the intended application, delivery route, host organism, and light-accessibility of the target tissue or system.
[0144] Host cells disclosed herein may be used to manufacture the polypeptides described herein.
[0145] Accordingly, a further aspect of the invention is therefore a method for manufacturing a polypeptide disclosed herein, comprising culturing a host cell contemplated herein, preferably under conditions that allow expression of the polypeptide in embodiments where the host cell comprises the nucleic acid molecule disclosed herein; and isolating the polypeptide from the culture medium or from the host cell. Culture conditions and mediums can be selected by those skilled in the art based on the host organism used by resorting to general knowledge and techniques known in the art. In such methods for manufacture, the actual expression may be performed by in vitro transcription and translation or, more preferably, recombinantly in a suitable host cell under conditions that allow production of the polypeptide.
[0146] In this regard, the host cell may be readily manipulated in microbiological and biotechnological terms. This refers, for example, to easy culturability, high growth rates, low demands in terms of fermentation media, and good production and secretion rates for the polypeptides. The polypeptides can furthermore be modified, after their manufacture, by the cells producing them, for example by the addition of sugar molecules, formylation, amination, etc. Post-translation modifications of this kind can functionally influence the polypeptide.
[0147] In various embodiments, the method may further comprise purifying the isolated polypeptide, whereby optionally the purified polypeptide may be constitutively active exhibiting DGC activity.
[0148] In various embodiments, the method manufactures a polypeptide having DGC activity that is designed to be recombinantly expressed and purified in a constitutively active form for subsequent use. In the context of the present disclosure, the term “constitutively active” refers to the polypeptide exhibiting DGC activity, without requiring proenzyme activation by cleavage and being independent of activation steps, such as acid activation, following expression and purification.
[0149] As will be appreciated, the host cell disclosed herein may be expanded in a cell culture medium suitable for expansion of the host cell. Accordingly, there is also provided a cell culture comprising a plurality of the host cells disclosed herein.❖ Methods of Use
[0150] In a further aspect, the present invention relates to the use of the polypeptides, or nucleic acid molecule, or host cell, or composition disclosed herein in various applications. All embodiments disclosed above in relation to the polypeptide, nucleic acid molecule, host cell and composition disclosed herein, similarly apply to the methods of use, and vice versa.
[0151] Light-responsive polypeptides having DGC activity, particularly those activated by far-red / NIR light, may enable precise spatiotemporal control of c-di-GMP signalling in living systems. When expressed in microbial or mammalian cells, and exposed to light in the so-called "NIR window", the DGC activity of the polypeptide can be activated, resulting in a rapid increase in intracellular c-di-GMP levels. This feature allows the reversible and non-invasive modulation of cellular behaviours, providing a unique platform for the development of optogenetic systems in both research and applied biotechnology. The polypeptide disclosed herein may be referred to as a “light-activated polypeptide” which refers to a protein that exhibits increased or decreased catalytic activity in response to light. Upon exposure to NIR light, particularly in the range of 650-800 nm, the polypeptide undergoes a conformational shift from an inactive to an active state / form, resulting in enhanced enzymatic conversion of GTP to c-di-GMP. The terms “active" and “inactive” in the foregoing explanation are relative and include complete activity of the polypeptide to complete inactivity of the polypeptide (complete “on / off” modes) as well as relative activity or inactivity of the polypeptide.
[0152] Since the polypeptides disclosed herein are light responsive, particularly responsive to nearinfrared (NIR) light, the polypeptide may serve as a powerful optogenetic tool capable of modulating intracellular levels of c-di-GMP, a ubiquitous second messenger in bacteria known to regulate diverse physiological processes such as biofilm formation, motility, virulence, cell cycle progression, and gene expression. It will be appreciated that the nucleic acid molecule encoding such polypeptides, host cellscomprising such nucleic acid molecules, and compositions disclosed herein may also be used for modulating intracellular levels of c-di-GMP.
[0153] Accordingly, in various embodiments, there is provided a method for modulating intracellular c- di-GMP levels using the polypeptides disclosed herein in response to near-infrared (NIR) light. These methods may be applied to microbial, plant, and mammalian host cells.
[0154] The host cells may be as defined above, and more particularly be prokaryotic, such as Escherichia coli, Pseudomonas spp., or Bacillus subtilis: a eukaryotic microorganism, such as Saccharomyces cerevisiae', or a mammalian cell, such as a human immune or tumour cell. In various embodiments, the host cell may be a cultured ceil or a cell within a living organism. Thus, the use may be in vitro or in vivo.
[0155] In various embodiments, there is provided a method of modulating intraceiiuiar c-di-GMP levels in a host cell, comprising: introducing into said host ceil a polypeptide, or the nucleic acid molecule, or composition disclosed herein; and irradiating the host ceil with NIR light under conditions sufficient to activate the DGC activity of the polypeptide and modulating the intraceiiuiar c-di-GMP levels
[0156] It will be appreciated that a nucleic acid molecule disclosed herein may be introduced into the host cell, whereby the polypeptide is subsequently expressed in the cell. Thus, in various embodiments, the step of introducing the polypeptide into the host cell may comprise introducing the nucleic acid molecule disclosed herein for expressing the polypeptide in the host cell. In various embodiments, the method for modulating intracellular c-di-GMP comprises the steps of: (i) introducing into a host cell a nucleic acid molecule encoding the polypeptide disclosed herein; (ii) expressing the polypeptide in the host cell; and (iii) irradiating the host cell with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP. In various embodiments, the host cell may be an E. co / / cell or a mammalian cell.
[0157] The increased c-di-GMP levels in the host cell may be used to induce or elicit a specific and desirable cellular response that vary depending on the host cell, and may be used in vitro or in vivo for therapeutic, industrial, or synthetic biology applications. In various embodiments, the method may be in vitro or in vivo.
[0158] In view that the polypeptides disclosed herein may be responsive to NIR light, they may also be used as a biosensor in methods for detecting NIR light exposure by generating a c-di-GMP- dependent readout which may be used to monitor the DGC activity of the polypeptide in the host cell.
[0159] The term “Near infrared” (NIR) light is generally considered in the art to have a wavelength of between about 650 and about 3000 nm. “Far-red” light is generally defined as light having a wavelengthat the long-wavelength red end of the visible (red) spectrum, from about 700 to about 750 nm. The visible spectrum is generally defined as having a wavelength of about 390 to about 750 nm. Bacteriophytochromes sense light from about 650 to about 800 nm, within the “NIR window.” Since this “NIR window" contains light variously defined as being in the visible, far-red and NIR categories, the term “near-infrared” (“NIR”) is used herein to describe light in the “NIR window” that activates bacteriophytochromes, switching them from one (dark) conformation to another (lit) conformation and back, regardless of whether the light would be generally defined as being in the NIR range, the far-red range, or in the visible range. The NIR light may be emitted from any external NIR-emitting device, thus the methods disclosed herein and irradiating step may comprise the use of any means for emitting NIR light. In various embodiments, the NIR light may be emitted from any external NIR-emitting device or system suitable for non-invasive or minimally invasive application to a subject. Suitable means for emitting NIR light include, but are not limited to, LED patches (flexible or rigid) that adhere to or strap onto the skin; handheld devices such as therapeutic lamps or diode-based emitters; wearable lightemitting devices including belts, bands, sleeves, headbands, masks, or garments embedded with NIR sources; NIR laser diodes operating in continuous wave or pulsed mode, optionally integrated into handheld or wearable applicators; fiber-optic-based light delivery systems incorporating fiber-coupled NIR diodes for localized subdermal delivery; transdermal illumination pads designed to emit NIR light uniformly across a defined surface area; and photo-biomodulation therapy (PBMT) devices, including medical or consumer-grade systems configured for therapeutic NIR exposure. Other suitable means include subdermal NIR-emitting implants or microneedle patches with integrated emitters, smartphone- controlled or app-enabled home-use NIR devices, flexible films or hydrogels embedded with NIR LEDs for conformal skin application, and helmet- or cap-based light therapy systems configured for cranial or regional subdermal irradiation.
[0160] The term “light activation” (also referred to herein as “photoactivation”) is used herein to refer to control of a protein activity by application of NIR light of selected wavelengths or removal of light from a polypeptide as described herein. The polypeptide may be “activated" when NIR light applied to the photoreceptor causes a change in conformation of the polypeptide such that it changes the activity of the polypeptide. This change is believed to be caused, at least in part, by rotation of the monomeric output modules with respect to each other such that a desired activity of the fusion protein is changed, e.g., stopped, started, enhanced, or decreased. The term “light activated” (also called “photoactive" in reference to polypeptides hereof) means a protein capable of being controlled by NIR light to be active or inactive, or more or less active or inactive. Thus, the terms “photoactive polypeptide” or “photoactivated polypeptide” also include “photoinactive polypeptide” or “photoinactivated polypeptide,” respectively.
[0161] The term “photoactivation ratio” (also referred to as a “light-activation ratio" or “dynamic range”) may refer to the ratio of polypeptide activity upon NIR irradiation to protein activity in the dark. In various embodiments, the polypeptide activity can be achieved by applying light of a selected wavelength tothe polypeptide, or by removal of such light. In various embodiments, the polypeptide can be made active by applying light of a selected wavelength and can be made immediately inactive by applying light of a different selected wavelength, or can be allowed to become gradually inactive by removing light of said different selected wavelength. In various embodiments, the polypeptide can be made inactive by applying light of a selected wavelength and can be made immediately active by applying light of a different selected wavelength, or can be allowed to become gradually active by removing said light of a different selected wavelength. In various embodiments, the polypeptide can be controlled to be substantially completely inactive or substantially completely inactive by the foregoing means (when high light activation ratios are achieved), or can be controlled to be relatively inactive or to be relative active (when low light activation ratios are achieved).
[0162] In various embodiments, light activation occurs at wavelengths between 650 to about 800nm.
[0163] In various embodiments, the polypeptide disclosed herein may be inactivated, or the activity may be reduced by the absence of NIR light or by the application of light of an inactivating wavelength. The “absence of NIR light” can mean the absence of all light (i.e., darkness), or can mean the absence of light in a selected wavelength range.
[0164] In various embodiments, the polypeptide may have an inactive form until NIR light of a first wavelength (i.e. within the NIR window) is applied. Then after NIR light irradiation the polypeptide may have an active form. Optionally, the polypeptide may be inactivated by application of light of a second wavelength or it can be gradually inactivated by not applying NIR light. Thus, in various embodiments, the desired DGC activity is increased by the application of NIR light of a selected wavelength. In various embodiments, the desired activity is gradually decreased by ceasing to apply NIR light.
[0165] Accordingly, the polypeptide disclosed herein may adopt a light-sensitive conformation, shifting from an inactive form to an active form upon illumination with NIR wavelengths. The active conformation may exhibit enhanced DGC activity compared to the inactive form. This photoconversion may be reversible, as irradiation with light outside the NIR window may rapidly revert the protein to its darkinactive form. The temporal control offered by this switchable system makes it highly suitable for use in dynamic cellular environments. In the dark, the polypeptide may spontaneously convert to the inactive form, and the active form may be converted to the inactive (dark) form.
[0166] In various embodiments, the method may further comprise administering or introducing biliverdin (e.g. biliverdin IXa) to the host cell as a chromophore to support photoreceptor activity of the polypeptide. In various embodiments, the nucleic acid molecules disclosed herein may also comprise a nucleotide sequence encoding a biliverdin cofactor or the biliverdin cofactor may be co-administered with a biliverdin precursor for optimal activation of the polypeptide. The use of biliverdin as a chromophore is especially advantageous in mammalian systems, as it is endogenously produced fromheme catabolism, obviating the need for exogenous chromophore administration. Thus, the method used in mammalian host cells, may not require the need for a step of administering a chromophore separately.
[0167] In various embodiments, the polypeptide disclosed herein may be introduced or expressed in microbial host cells for use in methods of optogenetic control of microbial cell behaviours such as biofilm formation, motility, or adhesion. Elevated c-di-GMP levels lead to enhanced biofilm formation, reduced motility, increased cell adhesion, altered secretion, and changes in virulence factor expression. These effects make c-di-GMP an attractive target for synthetic control of microbial behavior in both pathogenic and industrially beneficial organisms. In various embodiments, the microbial host cell may be engineered to form or disperse biofilms in response to NIR light, enabling controlled colonization or production of biofilm-associated products in industrial fermentation, environmental sensing, or plant symbiosis.
[0168] In various embodiments, in microbial host cells, the polypeptides disclosed herein (once introduced or expressed in the cell) may be used to regulate the expression of biofilm-associated products, secondary metabolites, or genes of interest, based on NIR light cues. Specifically, the ability to induce biofilm formation in response to NIR light exposure can be leveraged in the control of microbial adhesion, surface colonization, and biocatalytic processes, especially in bioreactors or biofilm-based biosensors.
[0169] In various embodiments, the polypeptides, or nucleic acid molecules, or composition disclosed herein may be used for forming a biofilm in a microbial host cell in response to NIR light. The polypeptide or encoding nucleic acid molecule, or composition may be introduced into a microbial host cell, to provide inducible or light-activated DGC activity. Upon exposure to near-infrared (NIR) light, the polypeptide may be converted into an active conformation, resulting in the accumulation of c-di-GMP and the activation of downstream pathways in the microbial host cell. These pathways may lead to the initiation of biofilm formation, depending on the application.
[0170] Accordingly, there is also provided a method for promoting biofilm formation in a microbial host cell, comprising the steps of: introducing into the host cell a polypeptide, or a nucleic acid molecule, or composition disclosed herein; optionally expressing the polypeptide in the microbial host cell; and irradiating the host cell with near-infrared light under conditions sufficient to activate the DGC activity of the polypeptide. Upon activation of the DGC activity of the polypeptide, intracellular levels of cyclic di- GMP are increased, which in turn modulates the biofilm phenotype of the microbial cell to induce the formation or dispersion of the biofilm. The method may thus be used to induce biofilm formation, for example in biocatalytic reactors, or to trigger dispersal of biofilms in anti-fouling or antimicrobial applications.
[0171] In various embodiments, the microbial host cell may comprise one or more regulatory elements that are selectively activated or repressed in the presence of c-di-GMP (i.e. c-di-GMP-responsive regulatory elements). Such elements may include riboswitches, c-di-GMP-binding protein domains (e.g., PIIZ domains), or transcriptional regulators responsive to c-di-GMP, operably linked to a gene of interest. In microbial host cells, these regulatory elements may enable the dynamic control of gene expression in response to light-induced c-di-GMP synthesis via the polypeptides disclosed herein, allowing for regulated biofilm formation, motility, or metabolic output. In various embodiments, these regulatory elements may be operably linked to therapeutic genes, reporter constructs, metabolic pathway enzymes, or regulatory proteins, allowing precise, tunable, and reversible control of gene expression in the microbial host cells upon light-induced production of c-di-GMP.
[0172] In various embodiments, the polypeptides disclosed herein, or nucleic acid molecules, may be used in plant-associated or industrial microorganisms to control colonization, persistence, or product yield through light-controlled modulation of biofilm formation.
[0173] In various embodiments, in eukaryotic host cells, the polypeptides disclosed herein (once introduced or expressed in the cell) may be used for production of metabolites or recombinant proteins in response to NIR light, providing an inducible, non-chemical method of controlling gene expression.
[0174] The consequences of increased intracellular c-di-GMP levels differ between microbial and mammalian cells due to the fact that c-di-GMP is a natural signaling molecule in bacteria but not in mammals. This dichotomy makes c-di-GMP a powerful and orthogonal tool in mammalian systems and a central regulatory molecule in microbial systems.
[0175] In various embodiments, in mammalian host cells, the polypeptides disclosed herein (once introduced or expressed in the cell) may be introduced and used for orthogonal gene regulation, exploiting the absence of endogenous c-di-GMP metabolism in such mammalian cells. Due to the orthogonal nature of c-di-GMP signalling in mammalian cells, the light-activated polypeptides disclosed herein may provide a method for the regulation of gene expression in gene therapy and cell engineering applications. When a gene of interest is operably linked to c-di-GMP-responsive elements in the nucleic acid molecule (or a separately introduced “second" nucleic acid molecule), the polypeptides disclosed herein may allow light-controlled gene expression of said gene of interest, enabling the construction of sophisticated genetic circuits in designer mammalian cells. In mammalian cells, increased intracellular c-di-GMP does not interfere with endogenous signalling cascades, allowing the molecule to function as a synthetic second messenger. In various embodiments, synthetic gene circuits may be engineered to respond to c-di-GMP through the use of riboswitches, c-di-GMP binding domains, or c-di-GMP- responsive transcriptional regulators, enabling regulated expression of target genes upon NIR light exposure.
[0176] In various embodiments, the nucleic acid molecule encoding the polypeptide may also comprise one or more c-di-GMP-responsive regulatory elements, such as riboswitches, allosteric binding domains, or transcription factor-regulated promoters, operably linked to a gene of interest (i.e. a gene circuit). In various embodiments, the gene circuit regulated by c-di-GMP may be comprised in a separate nucleic acid molecule (i.e. a second nucleic acid molecule), whereby the nucleic acid molecule encoding the polypeptide disclosed herein may be termed as a first nucleic acid molecule, whereby the first and second nucleic acids may be introduced into the host cell separately, or together. In various embodiments, the mammalian host cell may comprise a stably integrated or pre-existing gene circuit responsive to c-di-GMP, and the polypeptide disclosed herein may be introduced independently.
[0177] In various embodiments, the mammalian host cell may be regulated by c-di-GMP and respond to intracellular levels of c-di-GMP through incorporation of c-di-GMP-responsive regulatory elements that are selectively activated or repressed in the presence of c-di-GMP. These regulatory elements may be operably linked to therapeutic genes, reporter constructs, metabolic pathway enzymes, or regulatory proteins, allowing precise, tunable, and reversible control of gene expression in mammalian cells upon light-induced production of c-di-GMP. In such embodiments, the light-activated polypeptide may function as a biosensor, whereby exposure to near-infrared (NIR) light triggers intracellular c-di-GMP synthesis, which in turn activates or represses expression of target genes of interest through the regulatory elements. Accordingly, the orthogonal control of gene expression by the polypeptides disclosed herein may be used for cell therapy.
[0178] In various embodiments, the nucleic acid molecule encoding the polypeptide may comprise promoters responsive to c-di-GMP levels, enabling fine spatiotemporal control of transgene expression of a target gene (gene of interest) in mammalian cells in vivo or in vitro. This feature is especially advantageous in therapeutic settings, where precise regulation of gene expression may be required.
[0179] Accordingly, the polypeptide, or nucleic acid molecule, or composition disclosed herein may also be used for regulating gene expression in a host cell, preferably a mammalian host cell.
[0180] In various embodiments, there is provided a method for regulating gene expression in a host cell, comprising: introducing into the host cell the polypeptide, or nucleic acid molecule, or composition disclosed herein; irradiating the host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; and regulating expression of a gene of interest operably linked to a c-di-GMP-responsive regulatory element in response to the increased c-di-GMP levels. In various embodiments, the host cell is a mammalian host cell.
[0181] In various embodiments, the method comprises introducing into the host cell a nucleic acid molecule encoding the polypeptide, and expressing the polypeptide in the host cell prior to irradiationwith NIR light. Expression may occur constitutively or be regulated by inducible systems. In various embodiments, expression may be induced by the addition of one or more inducers, or by altering environmental or culture conditions (e.g., temperature shift, nutrient availability, or oxygen tension). In various embodiments, the nucleotide sequence encoding the polypeptide may be operably linked to a promoter that is active in the host cell, such as a constitutive promoter or an inducible promoter.
[0182] In various embodiments, the step of regulating expression or release of a therapeutic agent, may involve activation or repression of a gene of interest operably linked to a c-di-GMP-responsive regulatory element, such as a riboswitch, or c-di-GMP-binding transcription factor. In various embodiments, increased intracellular levels of c-di-GMP initiate transcriptional activation of a gene of interest. In other embodiments, c-di-GMP triggers conformational changes in regulatory RNA structures or protein domains that control translation, secretion, or physical release of a pre-synthesized or encapsulated therapeutic compound.
[0183] In various embodiments, the gene of interest may comprise or consist of a nucleotide sequence encoding a protein or gene product that is desirably secreted in, or secreted from, the host cell. In various embodiments, the gene of interest may encode a therapeutic agent, regulatory protein, or other bioactive molecule for use in diagnostic or therapeutic applications. Exemplary genes of interest include, but are not limited to, genes encoding cytokines such as interleukin-2 (IL-2), interleukin-12 (IL-12), or interferon-p (IFN-p) for immunomodulation; immune checkpoint inhibitors or decoy receptors targeting PD-1 or CTLA-4; cytotoxic effector proteins such as perforin or granzyme B; prodrug-activating enzymes such as herpes simplex virus thymidine kinase (HSV-TK) or bacterial nitroreductase; monoclonal antibodies or fragments thereof, including single-chain variable fragments (scFvs) targeting disease-associated antigens; metabolic or endocrine regulators such as insulin, leptin, or glucagon-like peptide-1 (GLP-1 ); neurotrophic factors such as brain-derived neurotrophic factor (BDNF) or nerve growth factor (NGF); anti-inflammatory proteins such as interleukin-10 (IL-10) or soluble tumor necrosis factor receptors (sTNFR); and RNA-based effectors including small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), or synthetic guide RNAs (sgRNAs) for use in CRISPR-based gene editing systems. Regulation of these genes in response to light-induced intracellular c-di-GMP synthesis enables spatiotemporal, non-invasive, and orthogonal control of gene expression in mammalian host cells, and may be applied in the treatment of cancer, autoimmune disease, metabolic disorders, infectious diseases, or neurological conditions.
[0184] The NIR light used to activate the DGG activity of the polypeptide disclosed herein is non -toxic, deeply penetrant, and thus may be well-suited for in vivo applications. In particular, when present or expressed in mammalian cells (i.e. human cells) in a subject, light exposure through the NIR window enables deep tissue activation of the polypeptide disclosed herein in the cell. This could be used, for example, in localized gene therapy in a subject, where cells either implanted under the skin or withintissues express therapeutic agents only when irradiated with harmless NIR light and the DGC activity of the polypeptide disclosed here is activated.
[0185] The term “subject” as used herein, refers to a warm-blooded animal, preferably a mammal, more preferably a human. Said subject may be awaiting or receiving medical care or is or will become the subject of a medical procedure or is being monitored for the development of a condition or any condition or disease associated with aberrant c-di-GMP levels. Subjects include those already being afflicted by a condition or any condition or disease associated with aberrant c-di-GMP levels.
[0186] As used herein, a “condition or disease associated with aberrant c-di-GMP levels” may include any pathological, infectious, or engineered biological state in which the intracellular concentration of cyclic di-GMP is dysregulated, resulting in an undesirable phenotype. This may include bacterial infections characterized by excessive biofilm formation, altered motility, or increased virulence due to elevated c-di-GMP levels, as well as conditions involving reduced c-di-GMP levels associated with impaired bacterial colonization or persistence. In certain embodiments, the condition may relate to synthetic or engineered systems in which loss of control over c-di-GMP production leads to aberrant gene expression, therapeutic misregulation, or system instability in a microbial or mammalian host cell. Although cancer is not naturally associated with c-di-GMP dysregulation, in various embodiments, intracellular c-di-GMP may be synthetically introduced or modulated to treat cancer, for example by activating the STING pathway, enhancing immune responses, or triggering expression of therapeutic agents under c-di-GMP-responsive control elements.
[0187] In various embodiments, the polypeptide, nucleic acid molecule, host cell or composition disclosed herein may be used in a subdermal drug delivery system. In this regard, the intracellular production of c-di-GMP in response to NIR light may serve as a regulatory signal to initiate or control the expression or release of a therapeutic agent. In various embodiments, engineered host cells, or encapsulated delivery systems may be implanted or injected subdermally beneath the skin of a subject or within tissues of a subject, and are equipped to respond to externally applied NIR light by activating DGC activity and increasing intracellular c-di-GMP levels. The resulting c-di-GMP may act as a trigger, for example via c-di-GMP-responsive regulatory elements, to release or induce the expression of a therapeutic agent.
[0188] In various embodiments, a subdermal tissue site in a subject may refer to the tissue layer located beneath the dermis of the skin. This includes connective tissue, fat (subcutaneous adipose tissue), blood vessels, lymphatic vessels, and sometimes underlying muscle tissue, depending on the depth of administration. In the context of therapeutic delivery or activation, a subdermal site typically provides a localized environment that is accessible via minimally invasive techniques (e.g., injection) and may be suitable for sustained or targeted treatment effects.
[0189] In various embodiments, there is provided a method for subdermal delivery of a therapeutic agent in a subject, comprising: introducing into a subdermal tissue site of the subject the polypeptide, nucleic acid molecule, host cell or composition disclosed herein; irradiating the subdermal tissue site with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; and regulating expression or release of a therapeutic agent in response to the increased c-di-GMP levels.
[0190] In various embodiments, the introducing step may refer to any method or process by which the specified polypeptide, nucleic acid molecule, host cell, or composition is delivered, injected, implanted, inserted, or otherwise administered into a subdermal tissue site of the subject. This may include, but is not limited to, subcutaneous injection, microneedle arrays, implantable depots, hydrogel delivery systems, or other medical devices or formulations suitable for subdermal administration. The introduction may be direct (e.g., administration of the polypeptide or host cell itself) or indirect (e.g., delivery of a nucleic acid that is subsequently expressed in situ).
[0191] In various embodiments, the polypeptide, nucleic acid molecule, host cell or composition disclosed herein is administered subdermally by injection, implantation, or surgical insertion.
[0192] In various embodiments, the therapeutic agent may be co-formulated with the polypeptide, the nucleic acid molecule, the host cell, or the composition disclosed herein. In various embodiments, the therapeutic agent may be encoded by a nucleic acid operably linked to c-di-GMP-responsive regulatory elements, or it may be entrapped in a carrier or matrix that responds to intracellular c-di-GMP to trigger release. In various embodiments, the composition disclosed herein is introduced into the subdermal tissue site, wherein the therapeutic agent is comprised within the composition.
[0193] In various embodiments, the therapeutic agent may be administered separately, either concurrently or sequentially, from the polypeptide, nucleic acid molecule, host cell, or composition. The therapeutic agent may be delivered via systemic or localized routes, including intravenous, intradermal, intramuscular, or subcutaneous injection, or via implantable depots or devices. In various embodiments, the therapeutic agent is designed to be responsive to intracellular c-di-GMP levels, such that its activity, release, or bioavailability is regulated in response to the signalling events triggered by light-activated DGC activity.
[0194] In various embodiments, the therapeutic agent or a gene encoding the therapeutic agent that is expressed under the control of c-di-GMP-responsive regulatory elements, is introduced into the subdermal tissue site prior to the irradiating step.
[0195] Because mammalian tissue is relatively transparent to NIR light in the range of approximately 680-800 nm, external NIR light sources may be applied non-invasively to penetrate the skin andactivate the polypeptide located subdermally. This allows for on-demand, spatially localized, and temporally precise induction of drug release, minimizing systemic exposure and enabling personalized dosing regimens. In various embodiments, the polypeptide may exhibit minimal activity in the absence of light (dark state), ensuring that drug expression is tightly restricted to light-exposed conditions.
[0196] Accordingly, there is also provided an engineered mammalian host cell (e.g., fibroblasts, mesenchymal stem cells, or HEK293 cells) that stably or transiently expresses the light-responsive polypeptides disclosed herein along with c-di-GMP-responsive regulatory element operably linked to a gene of interest, for use in a subdermal drug delivery system. In various embodiments, the engineered mammalian host cell may be contained within a composition disclosed herein or any suitable biocompatible encapsulation device (e.g., alginate capsules, hydrogel matrices, or immunoprotective polymer scaffolds) to allow nutrient and oxygen exchange while preventing immune rejection.
[0197] In various embodiments, there is also provided an encapsulated drug delivery system that may be cell-free and comprises liposomes, nanoparticles, or hydrogel systems incorporating the polypeptides disclosed herein and c-di-GMP-responsive release mechanisms for implantation or injection subdermally into the subject.
[0198] In various embodiments, the therapeutic agent may be produced or released subdermally in the subject in response to NIR light irradiation.
[0199] The use of the polypeptide disclosed herein in a drug delivery system is particularly advantageous due to its responsiveness to NIR light, which is non-damaging to tissue, and its reliance on biliverdin as a chromophore, a molecule endogenously present in mammalian cells, eliminating the need for external cofactors. The reversible nature of the light-activated polypeptide further allows repeated activation and deactivation cycles without cellular exhaustion or permanent genetic switching.
[0200] Accordingly, the present invention provides a novel, non-invasive, light-regulated, and highly adaptable approach to subdermal drug delivery with applications in treating or preventing endocrine disorders, autoimmune disease, chronic pain, neurological disorders, wound healing, and cancer therapy, among others. The platform may be customized to deliver single or multiple therapeutic outputs under the control of a shared or multiplexed c-di-GMP-responsive architecture.
[0201] Increased c-di-GMP levels may serve as a molecular trigger for the activation of innate immune signaling pathways in mammalian cells. Specifically, c-di-GMP is recognized as a exogenous cyclic dinucleotide and may function as a pathogen-associated molecular pattern (PAMP) capable of engaging cytosolic DNA sensors such as STING (stimulator of interferon genes). Upon binding to STING, c-di-GMP induces a conformational change and oligomerization of STING, leading to the recruitment and phosphorylation of TANK-binding kinase 1 (TBK1 ), which in turn phosphorylatesinterferon regulatory factor 3 (IRF3). Activated IRF3 translocates to the nucleus, where it induces transcription of type I interferons, such as IFN-p, as well as pro-inflammatory cytokines and chemokines.
[0202] Accordingly, the polypeptide, or the nucleic acid molecule, or the host cell, or the composition, disclosed herein may be used for stimulating an innate immune response in a subject.
[0203] In various embodiments, there is also provided a method for stimulating an innate immune response in a subject, comprising: administering to a target site in the subject the polypeptide, or the nucleic acid molecule, or the host cell, or the composition disclosed herein; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide at the site of administration, thereby increasing intracellular levels of c-di-GMP; and stimulating an innate immune response at the target site via activation of the STING signalling pathway in response to the increased intracellular c-di-GMP levels. The innate immune response stimulated by this pathway may be localized to the site of NIR irradiation and used to enhance anti-tumor immunity, improve vaccine efficacy, or promote immune clearance of infected or diseased cells.
[0204] In various embodiments, the polypeptide, or the nucleic acid molecule, or the host cell, or the composition, disclosed herein may be administered to the target site that is subsequently irradiated.
[0205] As used herein, the term “target site” refers to the anatomical location or tissue region within the subject where the therapeutic effect is intended to occur, and into which the polypeptide, the nucleic acid molecule, the host cell, or the composition is introduced. In various embodiments, the target site may include subdermal tissue, such as the dermis, hypodermis, or other underlying soft tissue compartments, and may be proximal to or overlapping with a site of disease, inflammation, infection, injury, or pathological remodeling. The target site may also encompass a region of therapeutic interest, such as a tumor microenvironment, fibrotic tissue, wound bed, or an implant site, where controlled expression or release of a therapeutic agent is desired. The term may further refer to a cellular or intracellular compartment within host cells present at or recruited to the subdermal delivery region, especially in embodiments where intracellular signaling (e.g., c-di-GMP accumulation) governs therapeutic action. The term “target site” is intended to be broad and may also include sites accessible by systemic or local diffusion from the initial point of administration.
[0206] In various embodiments, there is provided a method for treating a condition or disease associated with aberrant c-di-GMP levels, preferably cancer, in a subject, comprising: administering to a target site in the subject the polypeptide, or the nucleic acid molecule, or the host cell, or the composition, disclosed herein; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di- GMP.
[0207] In various embodiments, the activation of the STING pathway enhances the maturation and activation of antigen-presenting cells, including dendritic cells and macrophages, and augments cytotoxic and helper T cell responses. Accordingly, the polypeptides disclosed herein, or nucleic acid molecules encoding such polypeptides, or host cells or compositions may be used in methods for modulating the immune microenvironment in a subject, particularly in the context of immuno-oncology, to enhance anti-tumor immunity and improve the efficacy of immune-based therapies.
[0208] Accordingly, in various embodiments, the polypeptide, or the nucleic acid molecule, or the host cell, or the composition, disclosed herein may be used for treating or preventing cancer in a subject.
[0209] In various embodiments, there is provided a method for treating cancer in a subject, comprising: administering to the subject the polypeptide, or the nucleic acid molecule, or the host cell, or the composition disclosed herein; irradiating a target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide at the site of administration, thereby increasing intracellular levels of c-di-GMP; and inducing a therapeutic anti-cancer response in the subject via one or more of: activation of innate immune signaling, stimulation of cytotoxic T cell activity, or release or expression of a therapeutic agent regulated by c-di-GMP levels.
[0210] In various embodiments, the therapeutic agent or a gene encoding the therapeutic agent that is to be released or expressed under the control of c-di-GMP-responsive regulatory elements, may be administered to the subject prior to the irradiating step.
[0211] In various embodiments, the method may comprise introducing into a tumor-targeting cell (e.g., a T cell, CAR-T cell, or engineered stem cell) the polypeptide or nucleic acid encoding the polypeptide or composition disclosed herein. The tumor-targeting cell may be administered to the subject, where upon administration, the polypeptide may be irradiated with NIR light to activate DGC activity. The resulting increase in c-di-GMP may induce expression of one or more therapeutic agents selected from: (i) cytotoxic agents (e.g., perforin, granzyme); (ii) cytokines (e.g., IL-2, IL-12); (iii) checkpoint inhibitors; or (iv) prodrug-converting enzymes. Thus, the polypeptide may be used to control expression of immune-modulatory factors at the tumor site.
[0212] In various embodiments, the cancer may be selected from liver cancer (such as hepatocellular carcinoma), biliary duct cancer, breast cancer, prostate cancer, colorectal cancer, ovarian cancer, endometrial cancer, cervical cancer, lung cancer, gastric cancer, oesophageal cancer, pancreatic, bone cancer, bladder cancer, head and neck cancer, thyroid cancer, skin cancer, renal cancer, and oesophagus cancer and combinations thereof, for example gastric cancer. In various embodiments, the cancer is breast cancer.
[0213] The invention is further illustrated by the following non-limiting examples and the appendedclaims.EXAMPLES
[0214] Materials and Methods
[0215] Bacterial Strains, Plasmids, Media, and Culture Conditions: The strains, plasmids, and primers used are listed in Table 4. E. co / / strain BL21 was used for the screening of the mutant libraries while NEB® 5-alpha competent E. coli (New England Biolabs, USA) was used for site-directed mutagenesis of BphS variants. During screening of the mutant libraries, all potential mutant strains were grown overnight in LB broth (Miller) supplemented with 50 pg / mL of kanamycin at 37 °C. E. co / / strain BL21 expressing either bphS-WT or bphs-13 used for quantification of intracellular c-di-GMP and growth of flow cell biofilms was grown in their respective liquid or agar media at 37 °C when required. All strains were maintained in 25% glycerol stock and stored at -80 °C.
[0216] Table 4. Strains, plasmids, and primers used.Relevant CharacteristicsE. co / / strain used for gene cloning, protein expression, andscreening of mutantsNEB® 5-alpha E. coli strain used for site-directed mutagenesisE. constrain used for c-di-GMP quantification and growth ofE. coli BphS-WT flow cell biofilmsE. co / / strain used for c-di-GMP quantification and growth ofE. coli BphS- 13 flow cell biofilms pYYDT-L KmR, oriV (pBBR1 ), Ptac, bphS, bphO pYYDT-BphS-WT KmR, oriV (pBBR1 ), Ptac, bphS, bphO pYYDT-BphS-13 KmR, oriV (pBBR1 ), Ptac, bphS-13, bphOATAGAGCTCAAGGAGATATACATATGGCTCGTGGTTBphS-F1(SEQ ID NO: 71)GTCATGCATTTAGTGGTGGTGGTGGTGGTGGTATTCABphS-R1GCTAATT (SEQ ID NO: 72)GCGATGCATAAGGAGATATACATATGCCATTATCTCGV-FTG (SEQ ID NO: 73)CTAGAGCTCCATATGCTATGGTCCTTGTTGGTGAAV-R1(SEQ ID NO: 74)
[0217] Introduction of Restriction Sites into pYYDT-L: Using pYYDT-L as template, the primers, BphS-F1 and BphS-R1 , were used to introduce Sacl and Nsil restriction sites, 5’ and 3’ respectively, into bphS for convenience in all subsequent cloning steps. Similarly, the primers, V-F and V-R1 , were used to introduce Sacl and Nsil restriction sites into the plasmid vector backbone. All PCR amplification was carried out using Phusion High-Fidelity DNA Polymerase (New England Biolabs, USA) and thesequence of bphS after ligation was verified by Sanger sequencing. This plasmid with restriction sites added was named pYYDT -WT and used In the generation of the first round of error-prone PCR libraries.
[0218] Generation of Error-prone PCR Library: Error-prone PCR of bphS was carried out using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, USA). The primers, BphS-F1 and BphS-R1 , were used to carry out two independent error-prone PCR reactions at a high mutation frequency using two different amounts of template DNA, 25 and 50 ng. The thermocycler settings used were as follows: 2 min at 95 °C; 30 sec at 95 °C, 30 sec at 66.1 °C, 2 min at 72 °C (30 cycles); and 10 min at 72 °C. To generate the mutant DNA libraries, error-prone PCR products were digested using the restriction enzymes, Sacl-HF and Nsll-HF, and cloned Into Sacl- and Nsll-dlgested plasmid vectors using T4 DNA ligase (Invitrogen, USA). To select for newly synthesised bphS fragments containing novel mutations, error-prone PCR products were also treated with Dpnl to remove any methylated template pYYDT-WT plasmid. All restriction enzymes were supplied by New England Biolabs, USA. Following ligation, the mutant DNA libraries were transformed Into chemically competent BL21 cells via heat shock. A library size of approximately 10,000 colonies from each mutant library was then screened concurrently for protein variants with increased DGC activity.
[0219] In vitro Homologous Recombination of Improved BphS Variants: Using the BphS variants exhibiting a higher DGC activity from the error-prone PCR library, a recombinant library was constructed. This was carried out using the staggered extension process (StEP) with some modifications. The following reagents were added to each 50 μL reaction: 0.15 pmol (total) of PCR- amplified mutant bphS gene, 30 pmol of each primer, 1X Taq buffer, 0.4 mM of dNTP, 3mM MgCb, and 2.5 U of Taq polymerase. The thermocycler settings used for the first round of StEP were: 3 mln at 95 °C; 30 sec at 95 °C, 30 sec at 55 °C (80 cycles); and 10 mln at 72 °C. During the second round of directed evolution, the thermocycler settings for the annealing / extension step was reduced to 15 s to Increase the crossover frequency during the PCR process.[02201 Site-directed Mutagenesis of Key Amino Acids: Site-directed mutagenesis to introduce key recurring mutations into the best performing BphS variant of the recombinant library was carried out using the Q5 Site-directed Mutagenesis Kit (New England Biolabs, USA). All primers used for site- directed mutagenesis were designed using the NEBaseChanger tool ( http: / nebasechanger . neb.com / ) and are listed in Table 5. All sequences were verified by Sanger sequencing after the site-directed mutagenesis step.
[0221] Table 5. Primers used for site-directed mutagenesis in this study. Nucleotide substitutions are highlighted in bold and underlined.76BphS-6-R AATTCTTGACCAGCTAAACG (SEQ ID NO: 76) R377CBphS-7-F TGAACGTAACaGTGCTCGTGA (SEQ ID NO: 77) C492SBphS-7-R GCAGAAGTCCATGGTAAAG (SEQ ID NO: 78) C492SBphS-12-F TGCTGAAACTaTAGCTCGTCAATC (SEQ ID NO: 79) L325IBphS-12-R GCGTTTTCAACTTCACCTAAAC (SEQ ID NO: 80) L325IBphS-13-F TCTGGTGACGaCGATCTCATAG (SEQ ID NO: 81) G432DBphS-13-R AGTTAATGGTAATAATAAGATACC (SEQ ID NO: 82) G432D
[0222] Mutant Screening and Congo Red Fluorescence Assay: A two-step screening process was developed to identify BphS variants with higher DGC activity than wild-type BphS (BphS-WT). Following transformation with library DNA, the E. coli colonies were grown for 48 h under NIR light (A = 660 nm, 5.3 mW / c2) on LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye at 25 °C. Studies have shown that an increase in c-di-GMP levels will lead to the elevated production of curl! fimbriae in E. co / / colonies. Therefore, colonies containing a BphS variant with higher DGC activity will have a redder morphology due to the increased binding of Congo red dye to their curli fimbriae. These colonies were then manually selected by visual inspection for a second round of screening using a quantitative Congo red fluorescence assay. To carry out the quantitative Congo red fluorescence assay, selected colonies were grown overnight in LB (Miller) broth supplemented with 50 pg / mL kanamycin overnight at 37 °C in the dark. 1 pL of overnight culture of each variant was then dropped in triplicates onto two sets of LB (Miller) agar plates supplemented with 50 pg / mL kanamycin and Congo red dye. After growing the colonies in the dark or under NIR light for 16 to 48 h, the colonies were harvested and resuspended in 500 pL of phosphate-buffered saline (PBS). The resuspended colonies were then transferred to a 96-well plate and diluted four times with additional PBS. The fluorescence (AEX = 497 nm, Asm = 613 nm) of the bound Congo red dye was measured using a Tecan Infinite Pro II Spectrophotometer. All fluorescence readings were normalised to the ODeoo of the cell suspension.
[0223] BphS Homology Model: The BphS-WT and BphS-13 homology models were created by submitting their amino acid sequences to the l-TASSER server. The predicted protein structure with the highest C-score value was then selected for the subsequent molecular docking analysis.
[0224] Molecular Docking of Biliverdin and GTP: Using the homology models predicted by I- TASSER, molecular docking computations were carried out. 3D structures of the biliverdin chromophore and guanosine-5’-triphosphate (GTP) substrate were obtained from the Research Collaborator for Structural Bioinformatics (RCSB) Protein Data Bank. The ligands were then converted into the PDBQT format using Open Babel. The protein model and ligand of interest were prepared in the AutoDock 4.2.6 workspace and the dockings were executed as described with some modifications. For the protein model, polar hydrogen atoms were added before Kollman charges were computed forthe protein. The protein model was then saved in PDBQT format and set as the target for subsequent docking steps. For the ligand, the root was determined, and the torsion tree was defined with the default settings. To prepare the AutoGrid Parameter File, key amino acids involved in binding of the ligand to the chromophore binding pocket or active site of the protein model were determined. After ensuring that these key amino acids were encompassed in the grid parameters, the AutoGrid Parameter File was executed. Subsequently, the AutoDock4 Parameter File was prepared, and the genetic algorithm was used with the following settings: I) number of GA runs: 250; ii) population size: 300; ill) number of energy evaluations: 2.5 million; and iv) number of generations: 27000. The Lamarckian genetic algorithm was selected for the final output and the docking was executed. The results were analysed and the cluster with ligands in the correct conformation based on published literature were used in subsequent binding energy comparisons.
[0225] Enzymatic Assay of BphS-WT and BphS-13: Enzymatic assays to compare the DGC activity of BphS-WT and BphS-13 were carried out using purified protein purchased from the Protein Production Platform (NTU, Singapore). A modified protocol by Ryjenkov at al.
[0021] was used. Briefly, a standard reaction mixture contained 5 nM of enzyme in 50 mM Tris-HCI (pH 7.6), 10 mM MgCl2, 0.5 mM EDTA, and 50 mM NaCI. The reaction was initiated at 25 °C by adding 20 nM of GTP and the proteins were then irradiated with NIR light (A = 660 nm, 5.3 mW / cm2). Aliquots were withdrawn at 0. 5, 10, 20, 30, 60, and 90 and boiied immediately for 5 min to halt ali protein activity. After centrifuging the samples at 15 000 g for 5 min the concentration of c-di-GMP present in the aliquots were quantified using a c-di-GMP ELISA kit (Cayman Chemical, USA).
[0226] Extraction and Quantification of C-di-GMP in E. coli: Tre extraction and quantification of intracellular c-di-GMP levels in BL21 / (pYYDT-BphS-WT) and BL21 / (pYYDT-BphS-13) was carried out following the protocol described by Roy et al.63The two strains were first grown overnight in modified M9 minimal medium (MP Biomedical, USA) supplemented with 0.5% yeast extract and 0.2% glucose at 37 °C. 100 pL of overnight culture was then plated onto M9 minimal media (MP Biomedical, USA) supplemented with 0.5% yeast extract, 0.2% glucose and 1 .5% agar under dark and NIR conditions at 25 °C. At 8, 16, and 24 h, the bacterial mat growing on the agar plates were harvested and extracted using 95% ethanol. The samples were sent to the Singapore Phenome Centre for quantification where the concentration of c-di-GMP in the samples were determined. This was carried out using the Xevo TQ-S liquid chromatography system (Waters, Singapore) with a 2.1 mm x 50 mm BEH C18 column (Waters, Singapore). The following buffers were used: mobile phase A (water + 10mM ammonium formate + 0.1 % formic acid) and mobile phase B (methanol + 0.1 % formic acid). All intracellular c-di- GMP levels were normalised against total protein quantified by Qubit protein assay.
[0227] Growth of Flow Cell Biofilms: BL21 / (pYYDT-BphS-WT) and BL21 / (pYYDT-BphS-13) biofilms were cultivated in triplicates in three-channel flow cells (channel dimensions, 1 x 4 x 40 mm). Each channel was inoculated with 0.5 mL of diluted overnight culture (ODeoo = 0.1 ) followed by a 2 hstoppage of flow to allow cells to attach to the cover slip. M9 minimal medium supplemented with 0.4% glucose as a carbon source and 50 pg / mL kanamycin was then fed continuously at a flow rate of 3 mL h1for biofilm growth. The biofilm in the flow cells were allowed to grow at room temperature under NIR light (A = 660 nm, 5.3 mW / cm2) or in the dark for 24 h before they were imaged using a Confocal Laser Scanning Microscope (CLSM).
[0228] Confocal Microscopy and Image Analysis: The biofilms in each channel were stained with 0.3 mL of diluted SYTO 9 (5 pM) which is a fluorescent nucleic acid stain that aids in the visualization of bacterial cells within the biofilm. After a 15 min incubation in the dark, the images of the biofilm were acquired using the Carl Zeiss CLSM 780 (Carl Zeiss, Germany). For each channel, five representative images of the biofilm were collected using the 40x objective lens. The images were then analysed using the Imaris software (Version 9.0.2, Bitplane, Switzerland) to obtain the quantitative biovolume of the biofilm growing on the coverslip.
[0229] Example 1: Screening for BphS Variants with Enhanced DGC Activity
[0230] In the first round of error-prone PCR, approximately 10,000 colonies from each mutant library were screened for increased BphS activity. Out of these 20,000 colonies, 89 colonies had a redder morphology and were selected for the second round of screening using the quantitative Congo red fluorescence assay. Of these 89 colonies, six had a Congo red fluorescence at least 1 .5 times greater than BphS-WT (FIG. 1 A). This indicates that these BphS variants had an increased DGC activity, resulting in higher c-di-GMP production and thus increased curli fimbriae production.
[0231] To further improve the DGC activity of BphS-WT, the gene sequences of these six variants were pooled together, and a recombinant library of approximately 1 ,500 colonies was constructed using the staggered extension process. 78 colonies were selected to be screened using the quantitative Congo red fluorescence assay and four colonies with at least 2.5 times greater Congo red fluorescence than BphS-WT were identified (FIG. 1 B). Out of these colonies, StEP-17 and StEP-27 had the same mutations, which could be attributed to the normal replication of a completed gene template in later rounds of the amplification cycle during the in vitro recombination process.
[0232] To accumulate more beneficial mutations in the best performing variant, a comparison of mutations found in the four variants was carried out. The mutations that were found in more than one variant are summarised in Table 6. Among these mutations, several recurring mutations that appeared to be critical for the increase in DGC activity were identified (FIG. 2). I9F, A47A, S89P, P92P, and Q655K were found in three out of the four variants. R377C and C492S were found in two out of the four variants.
[0233] Table 6. Summary of mutations found in StEP variants.Mutations Location of Mutations Type of Mutation VariantsI9F N-terminal Missense mutationA47A PAS Domain Silent mutationS89P PAS Domain Missense mutationP92P PAS Domain Silent mutationR377C PHY Domain Missense mutationC492S PHY Domain Missense mutationQ655K GGDEF Domain Missense mutation
[0234] Therefore, using StEP-27 as a template, site-directed mutagenesis was carried out to combine these beneficial mutations and the final BphS variant, BphS-7, was obtained. The mutations that were introduced and their relative positions on BphS-7 are also shown in Table 4. The DGC activity of the BphS-7 variant was then compared to that of BphS-WT, StEP-22, and StEP-27 by carrying out a quantitative Congo red fluorescence assay. After an exposure to NIR light for 48 h, the Congo red fluorescence of BphS-7 was approximately 3.7 times greater than BphS-WT (FIG. 3A). Besides increasing the DGC activity of BphS-WT, another aim of this study was to increase the sensitivity of the DGC to NIR light. This sensitivity is the photoactivation ratio of the protein, which is defined in this study as the fold-change in the Congo red fluorescence of colonies exposed to NIR light when compared to colonies that were kept in the dark. This was achieved and the Congo red fluorescence of BphS-7 colonies exposed to NIR light for 48 h was approximately six times greater than those that were kept in the dark. On the other hand, the Congo red fluorescence of BphS-WT colonies exposed to NIR light was only approximately two times greater than those that were kept in the dark (FIG. 3A).
[0235] By increasing the sensitivity of BphS-WT to NIR light, colonies exposed to NIR light for a shorter timespan should still have a significant increase in intracellular c-di-GMP and thus greater Congo red fluorescence. Therefore, the Congo red fluorescence of the colonies was quantified and compared again after reducing the exposure time to NIR light from 48 h to 24 h. Even with this reduction in exposure time, the Congo red fluorescence of BphS-7 was approximately three times greater than BphS-WT. However, the fold-change in Congo red fluorescence between BphS-7 colonies exposed to NIR light and those that were kept in the dark was only approximately 2.5 times (FIG. 3B). Therefore, the mutant sequence, -ibphS-7, was used as the template for the second round of directed evolution to further improve the light-responsive protein’s DGC activity and sensitivity to NIR light.
[0236] In the second round of error-prone PCR, approximately 10,000 colonies from each of the 25 ng(M2-25) and 50 ng (M2-50) mutant library were screened for increased DGC activity. Out of these 20,000 colonies, 409 colonies were selected for the second round of screening using the quantitative Congo red fluorescence assay. In this round of directed evolution, the stringency of the quantitative Congo red fluorescence assay was increased by reducing the exposure time of the colonies from 48 h to 24 h. Both BphS-WT and BphS-7 were used for comparison during the screening of variants with higher DGC activity. Out of these 409 colonies, three colonies from the M2-25 mutant library had a Congo red fluorescence at least 1 .5 times greater than BphS-7 after a 24 h exposure to NIR light (FIG. 4A). Conversely, it is interesting to note that the M2-50 mutant library had a larger proportion of improved colonies, with 14 colonies from the M2-50 mutant library having a Congo red fluorescence at least 1 .5 times greater than BphS-7 after a 24 h exposure to NIR light (FIG. 4B). The increased Congo red fluorescence indicates that these colonies had increased curl! fimbriae production, and thus higher c-di-GMP production which can be attributed to an increase in DGC activity of these variants as compared with BphS-7 and BphS-WT.
[0237] Subsequently, the gene sequences of these 17 variants were pooled together and a recombinant library of approximately 1 ,750 colonies was created using the staggered extension process. In this round of StEP, the annealing / extension time was reduced to increase the crossover frequency and probability of accumulating more mutations in the recombinants. Subsequently, 125 colonies were selected and screened using the quantitative Congo red fluorescence assay and six variants with at least 2.5 times greater Congo red fluorescence, and thus higher DGC activity, than BphS-7 were identified (FIG. 4C). Out of these colonies, StEP-2-57 and StEP-2-65 had the same mutations and only StEP-2-57 was used when studying the improved variants using the Congo red fluorescence assay.
[0238] In this round of directed evolution, StEP-2-97 had a much higher Congo red fluorescence when compared with the other variants. However, DGC activity could be improved further by accumulating the beneficial mutations found in the improved variants. A comparison of the five variants was carried out to identify the recurring mutations that could be found in multiple variants. These mutations are summarised in Table 7. Among these mutations, several recurring mutations that appeared to be critical for the increase in DGC activity were identified. Out of these four recurring mutations, L325I and G432D were not found in StEP-2-97. Therefore, site-directed mutagenesis was carried out to introduce these mutations into StEP-2-97, thus creating the final variant, BphS-13. The mutations that were introduced and their relative positions on BphS-13 are also summarised in Table 7.
[0239] Table 7. Summary of mutations found in StEP-2 variants.Mutations _ Location of Mutations Type of Mutation _ Variants _StEP-2-57G4C N-terminal Missense mutation StEP-2-65StEP-2-97A35A N-terminal Silent mutation StEP-2-57StEP-2-65StEP-2-97Between GAF and PH StEP-2-57L325I YDomains Missense mutation StEP-2-65StEP-2-86D352D PHY Domain Silent mutation StEP-2-97V405V PHY Domain Silent mutation StEP-2-97StEP-2-57G432D PHY Domain Missense mutation StEP-2-65
[0240] The DGC activity and sensitivity of BphS-13 was then compared to that of BphS-WT, BphS-7, and StEP-2-97 and this was carried out after further reducing the exposure time of the colonies to NIR light from 24 h to 16 h. Even with this reduction in exposure time, the Congo red fluorescence of BphS- 13 was approximately 5.3 times greater than that of BphS-7 and 13 times greater than that of BphS- WT (FIG. 6). Additionally, the fold change in Congo red fluorescence between BphS-13 colonies exposed to NIR light and those kept in the dark was approximately 6-fold which was more than the photoactivation ratio of BphS-7 after a 24 h exposure to NIR light (approximately 2.5 times). This large photoactivation ratio of BphS-13 indicated a significant difference in curli fimbriae production, and thus intracellular c-di-GMP, in colonies exposed to NIR light when compared to those kept in the dark.
[0241] Example 2: Binding Energy Computations from Molecular Docking Simulation
[0242] The binding energy computations from the molecular docking of biliverdin and GTP to the chromophore binding pocket and active site of BphS-WT and BphS-13 are summarised in Table 8.
[0243] Table 8. Computed binding energies from the molecular docking of biliverdin and GTP using AutoDock.Protein Variant Binding Energy of Biliverdin Binding Energy of GTPBphS-WT -3.69-2'35BphS-13 -1 1 .3-3-59
[0244] In general, the more negative the binding energy, the greater the binding efficiency of the ligand to the protein of interest.64,65 For biliverdin, the binding energy computed revealed that it should be able to bind to BphS-13 (-1 1 .3 kcal / mol) more efficiently as compared with BphS-WT (-3.69 kcal / mol). Similarly, GTP was able to bind to BphS-13 (-3.59 kcal / mol) with higher efficiency as compared with BphS-WT (-2.35 kcal / mol), although the difference in binding energies for GTP were less significant when compared to that of biliverdin.
[0245] Example 3: Comparison of DGC Activity between BphS-WT and BphS-13
[0246] Although several missense mutations in bphS-13 had altered the protein’s amino acid sequence, some of the mutations in bphS-13 were silent and did not have an effect on the protein’s amino acid sequence (Table 7). However, several studies have shown that silent mutations could stillhave an effect on the protein’s translation rate and thus expression. Therefore, a comparison of the DGC activity of BphS-13 and BphS-WT was carried out using purified protein to validate if the increase in DGC activity of BphS-13 was largely due to the change in its amino acid sequence.
[0247] Within 5 min of NIR light exposure, BphS-13 was already able to synthesise 4.37 pg / mL of c- di-GMP while BphS-WT was unable to produce a quantifiable amount of the compound. After incubating the reaction for 90 min under NIR light, BphS-13 was able to synthesise a significantly greater amount of c-di-GMP than BphS-WT, which did not produce any significant amount of c-di-GMP throughout the whole incubation period (FIG. 7). This could be attributed to the negligible amount of c-di-GMP produced by BphS-WT which may be lower than the limit of detection (LOD = 5.3 pg / mL) of the c-di-GMP ELISA kit used (Cayman Chemical, USA).
[0248] Example 4: Quantification of Intracellular C-di-GMP Levels in E. coli
[0249] To examine the effect of the increased DGC activity and photosensitivity of BphS-13 on intracellular c-di-GMP levels at different time points, E. coli biofilms were grown on agar plates and either exposed to NIR light or kept in the dark. At 8, 16, and 24 h time points, the biofilms were scraped off and intracellular c-di-GMP was extracted before being sent for quantification via LC-MS / MS (FIG. 8).
[0250] In the first 8 h of incubation, the intracellular c-di-GMP levels of the BphS-13 biofilms were very low (12.0 ± 0.631 pmol / mg). However, intracellular c-di-GMP levels of BphS-WT biofilms were negligible and below the limit of detection (LOD = 0.25 pmol / mg) of the LC-MS / MS method. However, after 16 h of incubation, the intracellular c-di-GMP levels of BphS-13 biofilms were much greater than that of BphS-WT biofilms. Furthermore, there was a significant difference between BphS-13 biofilms that were exposed to NIR light (1390 ± 375 pmol / mg) than those that were kept in the dark (50.0 ± 3.94 pmol / mg). After 24 h of incubation, there was a significant increase in the intracellular c-di-GMP levels of BphS- 13 biofilms exposed to NIR light (3070 ± 558 pmol / mg) while BphS-13 biofilms kept in the dark (33.5 ± 3.12 pmol / mg) still had a much lower level of intracellular c-di-GMP. In both time points, the intracellular c-di-GMP levels of BphS-WT biofilms were still below the LOD of the LC-MS / MS method employed (FIG. 8).
[0251] Example 5: Biovolume and Thickness of Flow Cell Biofilms
[0252] To further compare the increase in DGC activity and its effect on biofilm growth, E. coli biofilms containing either pYYDT-BphS-WT or pYYDT-BphS-13 were grown in a flow cell setup for 24 h and studied using confocal imaging with a Confocal Laser Scanning Microscope (CLSM). These biofilms were either exposed to NIR light or kept in the dark to determine the fold-change in the thickness and biovolume of the E. coli biofilms under different conditions (FIG. 9A). After 24 h of biofilm growth, there was no significant difference in the thickness of BphS-WT biofilms exposed to NIR light (0.709 ± 0.1 13 pm) and those kept in the dark (0.587 ± 0.102 pm). However, BphS-13 biofilms exposed to NIR light(2.16 ± 0.271 pm) were significantly thicker than biofilms that were kept in the dark (0.525 ± 0.0334 pm) (FIG. 9B). Similarly, there was no significant difference in biovolume of BphS-WT biofilms exposed to NIR light (8.45 x 104 ± 3.80 x 104 pm3) and those kept in the dark (5.18 x 104 ± 3.80 x 104 pm3). However, the biovolume of BphS-13 biofilms exposed to NIR light (5.92 x 105 ± 4.99 x 104 pm3) were approximately 10 times greater than those kept in the dark (7.58 x 104 ± 2.43 x 104 pm3) (FIG. 9C).
[0253] Example 6: Cancer immunotherapy studies
[0254] Currently, studies are being carried out to determine the efficacy of the engineered near infrared (NIR) light-responsive diguanylate cyclase (DGC), BphS-13, as an immunotherapy tool via the Stimulator of Interferon Genes (STING) pathway.
[0022] A model cancer cell, MCF-7, was used in the study by transfecting it with the following gene construct, pcDNA-BphS-13-hGFP-v2 (FIG. 10).
[0255] Using this gene construct, BphS-13 is constitutively expressed in MCF-7 cells and upon activation by NIR light, bis-(3’-5’)-cyclic dimeric guanosine monophosphate (c-di-GMP) is synthesized. C-di-GMP will then activate the STING pathway which leads to which leads to the translocation of interferon-regulatory factor 3 (IRF3) and subsequent induction of Type I interferon promoters.
[0023] Besides activating the innate immunity of the cells, the c-di-GMP mediated activation of Type I interferon promoters allows the expression of a green fluorescent protein (GFP), which can then be used to monitor c-di-GMP production in MCF-7 cells with a Confocal Laser Scanning Microscope (CLSM).
[0256] In the transfection studies carried out, cells were transfected with pcDNA-BphS-13-hGFP-v2 or the empty plasmid, pcDNA, and exposed to NIR light or kept in the dark for up to 72 h (FIG. 11).
[0257] At 0 h, the MCF-7 cells exposed to NIR light or kept in the dark were generally healthy and were able to attach well to the cover slip. However, MCF-7 cells transfected with pcDNA-BphS-13-hGFP-v2 were slightly less prolific than those transfected with pcDNA. This could be attributed to the burden of expressing the NIR light-sensitive protein, BphS-13. At 24 h, faint fluorescence was observed in cells expressing BphS-13 and exposed to NIR light. However, these cells were less healthy and were less prolific than those kept in the dark. At 48 h, strong green fluorescence was observed in cells transfected with pcDNA-BphS-13-hGFP-v2 and exposed to NIR light. An interesting observation was that the green fluorescence was only observed in wrinkled, round, and unhealthy cells that appears to be undergoing apoptosis. No fluorescence was observed in flat and healthy cells. Negligible fluorescence was observed in MCF-7 cells transfected with pcDNA-BphS-13-hGFP-v2 and kept in the dark. At 72 h, most of the cells expressing BphS-13 and exposed to NIR light have undergone apoptosis and large areas of the coverslip were devoid of cells. For cells expressing BphS-13 and kept in the dark, a larger number of round and wrinkled cells were observed, but this could be attributed to the burden of expressing BphS-13. Throughout the experiment, cells transfected with the empty plasmid, pcDNA, were generally healthier and were able to attach well to the cover slip. No fluorescence was observed in these cells at all timepoints.
[0258] Accordingly, the cancer immunotherapy potential of BphS-13 has been demonstrated. Further, the BphS-13 may modulate expression of some key genes in the STING pathway and may induce cell apoptosis in cancer cells transfected with BphS-13.
[0259] Example 7: Biosensor Studies using engineered NIR light-sensitive protein, BphS-13
[0260] The engineered NIR light-sensitive protein, BphS-13, was also used as a biosensor in a study carried out using Microbial Electrochemical Systems (MES). In this study, the performance of microbial fuel cells (MFCs) was compared using Shewanella oneidensis transformed with the engineered BphS- 13. In the studies conducted, it was observed that MFCs containing S. oneidensis expressing BphS-13 and exposed to NIR light were more robust and were able to recover its power output after exposure to a toxic substance, Cr (VI) (FIG. 12).Discussion
[0261] Increased DGC Activity of NIR-light Responsive Protein: A three-step directed evolution process was carried out twice to increase the DGC activity of wild-type BphS. In the first round of random mutagenesis via error-prone PCR, six variants with higher DGC activity than BphS-WT were identified. However, the increase in Congo red fluorescence was only approximately 1 .5 times, indicating that improvement in DGC activity was modest (FIG. 1A). Therefore, in vitro homologous recombination via StEP was used to accumulate the beneficial mutations and remove the deleterious mutations. From this recombinant library, four variants with much greater Congo red fluorescence, at least 2.5 times, than BphS-WT was obtained (FIG. 1 B). Among these variants, StEP-22 and StEP-27 had the most significant improvement in DGC activity. As both StEP-22 and StEP-27 had a similar increase in Congo red fluorescence, either one would have been a viable option for the second round of error-prone PCR. However, this would have led to the loss of the beneficial mutations that were discovered in either of these variants and the probability of rediscovering these mutations in the second round of error-prone PCR was not guaranteed. To mitigate this issue, a comparison of the mutations found in the top performing variants was carried out. The recurring mutations that were identified in more than one StEP variant were postulated to be vital for the improvement in DGC activity and site- directed mutagenesis was used to introduce them into StEP-27 to obtain the final variant, BphS-7 (Table 6).
[0262] Besides improving the DGC activity of BphS-WT, another aim was to increase the sensitivity of the light-responsive DGC to NIR light. Although BphS-7 had a significantly higher DGC activity than BphS-WT, it still required at least 48 h of exposure to NIR light before a significant increase in Congo red fluorescence was observed (FIG. 3A). When the exposure time to NIR light was reduced to 24 h, the difference in Congo red fluorescence between colonies exposed to NIR light and those kept in the dark was only approximately two times (FIG. 3B). This reduced the sensitivity of temporal control that could be achieved when the light-responsive DGC is introduced into a system as an optogenetictool.
[0016] Therefore, more can be done to navigate the light-responsive DGC’s fitness landscape to further improve its DGC activity and photosensitivity.
[0263] In the second round of directed evolution, bphS-7was used as parent template for error-prone PCR. Interestingly, this round of error-prone PCR yielded a much larger number of positive colonies with at least 1 .5 times greater Congo red fluorescence than the BphS-7 parent which could be due to the accumulation of beneficial mutations in the first round of directed evolution (FIG. 4A and FIG. 4B).
[0264] Furthermore, out of the 17 variants identified, 14 came from the M2-50 error-prone PCR library, while only three came from the M2-25 error-prone PCR library. However, in the first round of error- prone PCR, an equal number of variants were identified from both 25 ng and 50 ng error-prone PCR libraries. This could be attributed to the reduced mutation rate when generating the M2-50 error-prone PCR library. Therefore, lesser destabilizing, albeit beneficial, mutations were introduced and more functional variants with proper protein folding could be discovered. While some of the M2-50 variants (e.g. M2-25-1 7, M2-50-163 etc.) had a large number of mutations, some of the mutations may have had a stabilizing effect that compensated for the destabilization caused by the other mutations. Conversely, the higher mutation rate used during generation of the M2-25 error-prone PCR library may have resulted in the accumulation of too many destabilizing mutations. Therefore, even if some of these mutations were beneficial to the DGC activity, they may have been detrimental to the structural stability of the protein, thus reducing the number of functional variants that could be identified.
[0265] After identifying the 17 variants with an improved DGC activity, in vitro homologous recombination via StEP was used to accumulate the beneficial mutations and remove the deleterious mutations again. In this round of in vitro homologous recombination, six variants with increased DGC activity were discovered (FIG. 4C). Unlike the first round of directed evolution, StEP-2-97 had a much higher Congo red fluorescence, and thus higher DGC activity, than the other variants discovered. Therefore, recurring mutations likely to be critical to the DGC activity of the light-responsive protein were introduced into it using site-directed mutagenesis to create the final variant, BphS-13 (Table 7).
[0266] During the Congo red screening of the improved variants from the recombinant library generated, it was observed that the colonies had a much redder morphology and were smaller and stickier compared to that of the BphS-7 and BphS-WT colonies. This is likely due to the overproduction of EPS by the colonies under NIR light, which indicates a much higher DGC activity. This made it harder to scrape off the colonies and resuspend in PBS. Hence, when comparing the activity of BphS-13 with the other variants, the exposure to NIR light was further reduced to 16 h. Despite this reduction of exposure to NIR light, the Congo red fluorescence of BphS-13 was still approximately five times greater than that of BphS-7, and 13 times greater than that of BphS-WT. Additionally, the Congo red fluorescence of BphS-13 colonies exposed to Nl R light were approximately six times greater than those colonies that were kept in the dark (FIG. 6). Therefore, even with the reduction of exposure time, BphS-13 had a much greater photoactivation ratio than BphS-7 and BphS-WT. Furthermore, the much higher Congo red fluorescence of BphS-13 colonies exposed to NIR light compared to those kept in the dark indicates that the protein’s DGC activity was only activated upon exposure to NIR light and there was minimal leakage of DGC activity in the absence of NIR light. This tight regulation of increased DGC activity by light makes BphS-13 a suitable optogenetic tool for future biomedical and biotechnological applications as the irradiation time required can be reduced significantly.
[0016]
[0267] Mutations Discovered in BphS-13 and its Effect on DGC Activity: The Per-Arnt-Sim (PAS), cyclic GMP phosphodiesterase-adenylate cyclase-FhlA (GAF), and phytochrome specific (PHY) domains make up the photosensory module of BphS. In this photosensory module, the PAS and GAF domains form the chromophore binding pocket which binds to the biliverdin chromophore responsible for the protein’s light sensing properties. However, when studying the missense mutations that were discovered in BphS-13, it is interesting to note that most of them were located in the PHY domain (Table 7). Furthermore, when looking at the binding energies obtained from the l-TASSER simulation, biliverdin had a much lower binding energy to BphS-13 than BphS-WT (Table 8). This meant that the chromophore had greater affinity to BphS-13 and was able to bind more efficiently to it than BphS-WT.
[0268] Therefore, although most of the key amino acid residues interacting with biliverdin are located in the PAS and GAF domains, it is apparent that the PHY domain is still an important domain to study when attempting to improve the DGC activity and photosensitivity of BphS. For example, Fischer et al.
[0024] reported that the PHY domain keeps the chromophore and its binding pocket in a more reactive conformation, thus allowing for more efficient conformational reorganization of the light-sensitive protein to the photoactivated state. Additionally, Bohm et al.
[0025] reported that the PHY domain helps mediate the cross-talk between the photosensory module and effector domain. Hence, small changes in the protein environment surrounding the chromophore will help regulate the effector domain’s enzyme activity. Therefore, the amino acid substitutions discovered in the PHY domain of BphS-13 may have resulted in subtle changes in the protein’s quaternary structure, thus increasing the catalytic activity of its GGDEF domain. Furthermore, these mutations may have also helped stabilize the biliverdin chromophore within the quaternary structure of the protein, increasing the photoconversion efficiency of the protein to the photoactivated state. This allows a greater fraction of BphS-13 to be in the photoactivated state upon irradiation with NIR light, resulting in higher overall DGC activity.
[0269] Additionally, it was observed that only one missense mutation, Q655K, was located in the GGDEF domain responsible for the DGC activity of the light-responsive protein (Table 7). This mutation was not located near any of the key amino acid residues necessary for the light-responsive protein’s DGC activity.[2,4,6] However, when comparing the DGC activity of BphS-13 and BphS-WT in vitro, BphS-13 was able to produce a significantly greater amount of c-di-GMP after just 30 min of exposure to NIR light (FIG. 7). Furthermore, the l-TASSER simulation predicted that the binding energy of a GTP substrate to the GGDEF domain of BphS-13 was approximately 1 .5 times lesser than that of BphS-WT(Table 8). This meant that the GTP substrate had greater affinity to BphS-13 and is likely to bind more efficiently to it than BphS-WT. Taken together, this highlights how amino acid substitutions located away from the active site of an enzyme can still be beneficial when it comes to improving a protein’s catalytic activity. Therefore, the Q655K mutation, along with the other distal amino acid substitutions located elsewhere in BphS-13 may have aided in the stabilization of the protein’s structure. This would have allowed more beneficial, but potentially destabilizing, mutations to be incorporated into the improved variant.
[0270] Another interesting observation was that several of the mutations found in BphS-13 were silent mutations that did not result in any amino acid substitution when the codon was translated (Table 7). However, Kimchi-Sarfaty et al.
[0026] reported that altering a protein’s codons will affect its translation rate which could have altered the protein’s conformation, thus affecting the binding of a cofactor to the protein. Furthermore, these silent mutations may have affected the co-translational folding of BphS-13 as the secondary structural elements of the protein can help stabilize each other during the protein’s translation. This may have affected its final quaternary structure, thus improving its DGC activity and photosensitivity.
[0271] Intracellular c-d-GMP levels and its effect on biofilm growth: By quantifying the intracellular c-di-GMP levels of E. coli, the increased DGC activity of BphS-13 when compared with that of BphS- WT was verified. While intracellular c-di-GMP levels in the BphS-WT biofilms remained below the equipment’s LOD after 24 h, there was a significant increase in c-di-GMP levels in BphS-13 biofilms after just 16 h of NIR light exposure (FIG. 8). Additionally, although BphS-13 exhibited higher DGC activity than BphS-WT, there was only a minimal amount of c-di-GMP production in the absence of NIR light irradiation. This indicates that the DGC activity of BphS-13 was still tightly regulated by NIR light and there was minimal leakage of activity in the absence of NIR irradiation. Furthermore, in a previous study conducted by Mukherjee et al.
[0017] , a significant increase in biofilm biovolume was observed only after at least 48 h of exposure to NIR light. However, in the flow cell setup, the BphS-13 biofilms had a significantly greater biovolume than BphS-WT biofilms after just 24 h of exposure to NIR light (FIG. 9A). This could be attributed to the increase in intracellular c-di-GMP levels, resulting in an increased production of EPS. Furthermore, BphS-13 biofilms that were exposed to NIR light had a significantly greater thickness (FIG. 9B) and biovolume (FIG. 9C) than those that were kept in the dark. Hence, a greater fold change in biofilm thickness and biovolume was achieved, allowing for greater and more rapid control of biofilm dynamics for biotechnological applications.
[0012]
[0272] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. Other embodiments are within the following claims.
[0273] One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. Further, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The polypeptides, nucleic acid molecules, host cells, compositions and uses described herein are presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims. The listing or discussion of a previously published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.
[0274] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0275] The content of all documents and patent documents cited herein is incorporated by reference in their entirety.References:1. Hengge, R., Grundling, A., Jenal, U., Ryan, R. & Yildiz, F. Bacterial Signal Transduction by Cyclic Di-GMP and Other Nucleotide Second Messengers. J. Bacteriol. 198, 15-26 (2015).2. Jenal, U., Reinders, A. & Lori, C. Cyclic di-GMP: second messenger extraordinaire. Nat. Rev. Microbiol. 15, 271-284 (2017).3.Simm, R., Morr, M., Kader, A., Nimtz, M. & Romling, U. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility: Cyclic di-GMP turnover by GGDEF and EAL domains. Mol. Microbiol. 53, 1123-1134 (2004).4. Romling, U . , Galperin, M. Y. & Gomelsky, M. Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger. Microbiol. Mol. Biol. Rev. 77, 1 -52 (2013).5. Jenal, U. & Malone, J. Mechanisms of Cyclic-di-GMP Signaling in Bacteria. Annu. Rev. Genet. 40, 385-407 (2006).6. Schirmer, T. & Jenal, U. Structural and mechanistic determinants of c-di-GMP signalling. Nat. Rev. Microbiol. 7, 724-735 (2009).7.Wu, Y., Ding, Y., Cohen, Y. & Cao, B. Elevated level of the second messenger c-di-GMP in Comamonas testosteroni enhances biofilm formation and biofilm-based biodegradation of 3- chloroaniline. Appl. Microbiol. Biotechnol. 99, 1967-1976 (2015).8.Makitrynskyy, R. et al. Secondary nucleotide messenger c-di-GMP exerts a global control on natural product biosynthesis in streptomycetes. Nucleic Acids Res. 48, 1583-1598 (2020).9. Hee, C.-S. et al. Intercepting second-messenger signaling by rationally designed peptides sequestering c-di-GMP. Proc. Natl. Acad. Sci. 117, 1721 1 -17220 (2020).10. Burdette, D. L. et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515— 518 (2011 ).H .Karaolis, D. K. R. et al. 3',5'-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growth factor- stimulated human colon cancer cell proliferation. Biochem. Biophys. Res. Common. 329, 40-45 (2005).12. Hu, Y., Mukherjee, M. & Cao, B. Biofilm-Biology-Informed Biofilm Engineering for Environmental Biotechnology, in ACS Symposium Series (eds. Rathinam, N. K. & Sani, R. K.) vol. 1323 59-82 (American Chemical Society, Washington, DC, 2019).13. Khalil, A. S. & Collins, J. J. Synthetic biology: applications come of age. Nat. Rev. Genet. 1 1 , 367- 379 (2010).14. Ryu, M.-H., Fomicheva, A., Moskvin, O. V. & Gomelsky, M. Optogenetic Module for Dichromatic Control of c-di-GMP Signaling. J. Bacteriol. 199, (2017).15.Tarutina, M., Ryjenkov, D. A. & Gomelsky, M. An Unorthodox Bacteriophytochrome from Rhodobacter sphaeroides Involved in Turnover of the Second Messenger c-di-GMP. J. Biol. Chem. 281 , 34751-34758 (2006).16. Lindner, F. & Diepold, A. Optogenetics in bacteria - applications and opportunities. FEMS Microbiol. Rev. fuab055 (2021 ) doi:10.1093 / femsre / fuab055.17. Mukherjee, M., Hu, Y., Tan, C. H., Rice, S. A. & Cao, B. Engineering a light-responsive, quorum quenching biofilm to mitigate biofouling on water purification membranes. Sci. Adv. 4, eaau1459 (2018).18Hu, Y., Liu, X., Ren, A. T. M., Gu, J. & Cao, B. Optogenetic Modulation of a Catalytic Biofilm for the Biotransformation of Indole into Tryptophan. ChemSusChem 12, 5142-5148 (2019).19,Folcher, M. et al. Mind-controlled transgene expression by a wireless-powered optogenetic designer cell implant. Nat. Commun. 5, 5392 (2014).20. Shao, J. et al. Smartphone-controlled optogenetically engineered cells enable semiautomatic glucose homeostasis in diabetic mice. Sci. Transl. Med. 9, eaal2298 (2017).21 .Ryjenkov, D. A., Tarutina, M., Moskvin, O. V. & Gomelsky, M. Cyclic Diguanylate Is a Ubiquitous Signaling Molecule in Bacteria: Insights into Biochemistry of the GGDEF Protein Domain. J. Bacteriol. 187, 1792-1798 (2005).22. Ryu, M.-H. & Gomelsky, M. Near-infrared Light Responsive Synthetic c-di-GMP Module for Optogenetic Applications. ACS Synth. Biol. 3, 802-810 (2014).23.Folcher, M. et al. Mind-controlled transgene expression by a wireless-powered optogenetic designer cell implant. Nat. Commun. 5, 5392 (2014).24. Bloom, J. D. & Arnold, F. H. In the light of directed evolution: Pathways of adaptive protein evolution. Proc. Natl. Acad. Sci. 106, 9995-10000 (2009).25. Bohm, C., Todorovic, N., Balasso, M., Gourinchas, G. & Winkler, A. The PHY Domain Dimer Interface of Bacteriophytochromes Mediates Cross-talk between Photosensory Modules and Output Domains. J. Mol. Biol. 433, 167092 (2021 ).26Kimchi-Sarfaty, C. et al. A ‘Silent’ Polymorphism in the MDR 1 Gene Changes Substrate Specificity. Science 315, 525-528 (2007).
Claims
1. CLAIMSWhat is claimed is:1 . A polypeptide having diguanylate cyclase activity, comprising or consisting of:(i) an amino acid sequence set forth in SEQ ID NO:1 (WT-BphS);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:1 over its entire length; or(Hi) a functional fragment of (i), or (ii); wherein the polypeptide comprises a GG[D / E]EF motif, and one or more amino acid mutations at a position selected from Q655, A2, G4, L6, I9, G54, S89, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325, T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, and E652 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
2. The polypeptide of claim 1 , wherein the one or more amino acid mutations are at a position selected from Q655, G4, I9, S89, L325, R377, G432, and C492, of SEQ ID NO:
13. The polypeptide of claim 2, wherein the amino acid mutation is an amino acid substitution, and wherein: the amino acid residue G at position 4 is substituted with an uncharged polar or neutral hydrophilic amino acid residue, preferably C; and / or the amino acid residue I at position 9 is substituted with a non-polar, or aromatic, or hydrophobic amino acid residue, preferably F; and / or the amino acid residue S at position 89 is substituted with a non-polar or aliphatic amino acid residue, preferably P; and / or the amino acid residue L at position 325 is substituted with a non-polar or hydrophobic or aliphatic amino acid residue, preferably I; and / or the amino acid residue R at position 377 is substituted with an uncharged polar or neutral hydrophilic amino acid residue, preferably C; and / or the amino acid residue G at position 432 is substituted with an acidic or negatively charged amino acid residue, preferably D; and / or the amino acid residue C at position 492 is substituted with a uncharged polar or neutral hydrophilic amino acid residue, preferably S; and / or the amino acid residue Q at position 655 is substituted with a basic or positively charged amino acid, preferably K.
4. The polypeptide of claim 1 , 2 or 3, wherein the one or more amino acid mutations are selected from Q655K, G4C, I9F, S89P, L325I, R377C, G432D, C492S, and combinations thereof.
5. The polypeptide of any one of claims 1 -4, wherein the polypeptide comprises the amino acid mutations Q655K, G4C, I9F, S89P, L325I, R377C, G432D, and C492S.
6. The polypeptide of claim 1 , wherein the polypeptide comprises or consists of:(i) an amino acid sequence set forth in any one of SEQ ID NO:2-35;(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2-35 over its entire length; or(iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises one or more amino acid mutations at a position selected from Q655, A2, G4, L6, I9, G54, S89, T94, I95, F98, D128, G129, A135, R136, L162, A210, A223, L315, A322, L325, Q328, L325. T333, L334, R377, P413, E414, G432, G449, N491 , C492, I500, V516, E532, L534, L535, R544, K545, Q561 , I583, E617, N626, V628, and E652 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1.
7. The polypeptide of claim 1 , wherein the polypeptide comprises or consists of:(i) an amino acid sequence set forth in SEQ ID NO:2 (BphS-7);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:2 over its entire length; or(iii) a functional fragment of (i), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions Q655, I9, S89, R377, and C492 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
8. The polypeptide of claim 1 , wherein the polypeptide comprises or consists of:(i) an amino acid sequence set forth in SEQ ID NO:3 (BphS-13);(ii) an amino acid sequence that shares at least 80%, preferably at least 85%, even more preferably at least 90%, most preferably at least 95% sequence identity with the amino acid sequence as set forth in any one of SEQ ID NO:3 over its entire length; or(iii) a functional fragment of (I), or (ii), wherein the polypeptide comprises a GG[D / E]EF motif, and comprises amino acid mutations at positions Q655, G4, I9, S89, L325, R377, G432, and C492 of SEQ ID NO: 1 , wherein position numbering is relative to the amino acid sequence set forth in SEQ ID NO:1 .
9. The polypeptide according to claim 7 or 8, wherein the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 2 or 3 or a functional fragment thereof.
10. The polypeptide according to any one of claims 1 -9, wherein the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof.11 . A nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide according to any one of claims 1 to 10.
12. The nucleic acid molecule of claim 1 1 , wherein the nucleic acid molecule comprises or consists of:(i) a nucleotide sequence as set forth in any one of SEQ ID NO:37-70; or nucleotide variant, or a complement thereof; or(II) a nucleotide sequence that shares at least 75% sequence identity with a nucleotide sequence of (i) or a complement thereof.
13. The nucleic acid molecule of claim 1 1 , wherein the nucleic acid molecule comprises or consists of:(i) a nucleotide sequence as set forth in SEQ ID NO:37 (BphS-7) or 38 (BphS-13); or a nucleotide variant, or a complement thereof; or(II) a nucleotide sequence that shares at least 75% sequence identity with a nucleotide sequence of (i) or a complement thereof.
14. The nucleic acid molecule of claim 13, wherein the nucleotide sequence comprises: a silent mutation at a nucleotide position corresponding to nucleotide position 105 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 35 relative to the amino acid sequence set forth in SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 141 of SEQ ID NO: 36, preferably the codon is changed from GCT to GCC, wherein the silent mutation encodes the amino acid A at position 47 relative to the amino acid sequence set forth in SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 276 of SEQ ID NO: 36, preferably the codon is changed from CCA to CCG, wherein the silent mutation encodes the amino acid P at position 92 relative to the amino acid sequence set forth in SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1056 of SEQ ID NO: 36, preferably the codon is changed from GAT to GAC, wherein the silent mutation encodes the amino acid D at position 352 relative to the amino acid sequence set forth in SEQ ID NO:1 ; and / or a silent mutation at a nucleotide position corresponding to nucleotide position 1215 of SEQ ID NO: 36, preferably the codon is changed from GTT to GTC, wherein the silent mutation encodes the amino acid V at position 405 relative to the amino acid sequence set forth in SEQ ID NO:1 .
15. The nucleic acid molecule of claim 11 , wherein the nucleotide sequence encoding the polypeptide is operably linked to a first promoter, preferably a constitutive promoter, and the nucleic acid moleculefurther comprises a fluorescent marker gene operably linked to a second promoter, preferably an interferon (IFN)-responsive promoter.
16. A host cell comprising the polypeptide according to any one of claims 1 -9, or the nucleic acid molecule according to any one of claims 11 -15.
17. The host cell of claim 16, wherein the host cell is a mammalian cell, preferably a human cell, or a microbial cell, preferably an E.coli cell.
18. A composition comprising the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or the host cell according to claim 16 or 17.
19. A method for producing a polypeptide of any one of claims 1 to 10, comprising culturing a host cell according to claim 16, and isolating said polypeptide from the host cell or culture medium.
20. The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or composition of claim 18, for use in modulating intracellular cyclic di-GMP (c-d I- GMP) levels in a host cell.21 . A method of modulating intracellular cyclic di-GMP (c-di-GMP) levels in a host cell, comprising: introducing into said host cell a polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 1 1 -15, or composition of claim 18; and irradiating the host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide and modulating the intracellular c-di-GMP levels.
22. The method of claim 21 , wherein the method is in vitro or in vivo.
23. The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or composition of claim 18, for use in promoting biofilm formation in a microbial host cell.
24. A method for promoting biofilm formation in a microbial host cell, comprising: introducing into the microbial host cell the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 10-14, or composition of claim 17; optionally expressing the polypeptide in the microbial host cell; and irradiating the microbial host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide, wherein activation of the DGC activity of the polypeptide increases intracellular levels of cyclic di-GMP to induce the formation of the biofilm.
25. The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or composition of claim 18, for use in regulating gene expression in a mammalian host cell via modulation of intracellular cyclic di-GMP levels.
26. A method for regulating gene expression in a mammalian host cell, comprising: introducing into the mammalian host cell the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or composition of claim 18; irradiating the mammalian host cell with near-infrared (NIR) light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; wherein expression of a gene of interest operably linked to a c-di-GMP-responsive regulatory element is regulated in response to the increased c-di-GMP levels.
27. The method of claim 26, wherein the gene of interest encodes a therapeutic agent, regulatory protein, or other bioactive molecule.
28. The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 1 1 -15, or the host cell according to claim 16 or 17, or the composition of claim 18, for use in a subdermal drug delivery system.
29. A method for subdermal delivery of a therapeutic agent in a subject, comprising: administering into a subdermal tissue site of the subject the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or the host cell according to claim 16 or 17, or the composition of claim 18; and irradiating the subdermal tissue site with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; and wherein expression or release of a therapeutic agent is regulated in response to the increased c-di-GMP levels.
30. The method of claim 29, wherein the polypeptide, or the nucleic acid molecule, or the host cell or the composition is administered subdermally by injection, implantation, or surgical insertion.31 . The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 1 1 -15, or the host cell according to claim 16 or 17, or the composition of claim 18, for use in stimulating an innate immune response in a subject.
32. A method for stimulating an innate immune response in a subject, comprising:administering to a target site in the subject the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or the host cell according to claim 16 or 17, or the composition of claim 18; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; wherein an innate immune response at the target site is stimulated via activation of the STING signalling pathway in response to the increased intracellular c-di-GMP levels.
33. The polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 1 1 -15, or the host cell according to claim 16 or 17, or the composition of claim 18, for use in treating a condition or disease associated with aberrant c-di-GMP levels, preferably cancer, in a subject.
34. A method for treating a condition or disease associated with aberrant c-di-GMP levels, preferably cancer, in a subject, comprising: administering to a target site in the subject the polypeptide according to any one of claims 1 -10, or the nucleic acid molecule according to any one of claims 11 -15, or the host cell according to claim 16 or 17, or the composition of claim 18; irradiating the target site in the subject with NIR light under conditions sufficient to activate the DGC activity of the polypeptide, thereby increasing intracellular levels of c-di-GMP; optionally, administering a therapeutic agent or a gene encoding the therapeutic agent that is expressed under the control of c-di-GMP-responsive regulatory elements, prior to the irradiating step.
35. The method of claim 34, wherein the condition or disease associated with aberrant c-di-GMP levels is cancer.
Citation Information
Patent Citations
Ultra-remote intelligent diagnosis and treatment system for diabetes
WO2018192156A1