Rapid nucleic acid amplification method

Abstract

The invention relates to a set of oligonucleotide primers, and kits and in vitro diagnostic devices comprising the set of oligonucleotide primers. The set of oligonucleotide primers, kits and in vitro diagnostic devices can be used in detecting Chlamydia trachomatis nucleic acid and diagnosing Chlamydia trachomatis infection with high sensitivity and specificity. The invention also relates to methods of loop-mediated isothermal amplification, methods of detecting Chlamydia trachomatis nucleic acid, and methods of diagnosing Chlamydia trachomatis infection using the set of oligonucleotide primers or the kits.

Description

[0001] RAPID NUCLEIC ACID AMPLIFICATION METHOD Field of the invention The disclosure relates to a set of oligonucleotide primers and its use in methods comprising loop-mediated isothermal amplification (LAMP) for detecting Chlamydia trachomatis and diagnosing chlamydia infection. Background to the invention Sexually transmitted infections (STIs) are a significant public health concern. Gonorrhoea and chlamydia are amongst the most commonly reported bacterial STIs worldwide, causing an estimated 82 million and 129 million new infections each year, respectively. The causative agents for gonorrhoea and chlamydia infections are the Gram-negative bacteria Neisseria gonorrhoea (GC) and Chlamydia trachomatis (CT), respectively. Both primarily infect the female endocervix and male urethra, but can also infect the rectum, pharynx and conjunctiva. Disseminated GC affects 0.5-3% of infected patients and presents as tenosynovitis, dermatitis, and / or polyarthralgia. GC / CT co-infections are more common than would be expected by chance, with approximately 10-40% of those infected with GC being also positive for CT. Untreated GC infections can have serious health ramifications such as pelvic inflammatory disease, ectopic pregnancy, infertility, chronic pelvic pain, seronegative arthropathy, and neurological and cardiovascular diseases. Infection in pregnancy can also lead to foetal or neonatal death and premature delivery, and both GC and CT can be passed from infected pregnant women to their baby during birth, causing conjunctivitis, visual deficit and pneumonia in the newborn. Notably, newborn eye infections caused by GC can lead to permanent eye damage or blindness. In addition, infection with GC or CT is associated with an increased risk for the transmission and acquisition of other STIs such as HIV. No vaccine has yet been approved for gonorrhoea or chlamydia infection, but infections are currently curable with existing single-dose regimens of antibiotics. The antibiotic resistance in GC is, however, increasing, with verified exceedingly difficult-to-treat and even untreatable cases. In many under-resourced settings, where the burden is the highest, syndromic treatment of STIs is the standard management. This is due in part to a lack of availability of laboratory diagnostics. Since many infections are asymptomatic, this strategy results in missed opportunities for treatment, which can lead to administration of the wrong treatment or over treatment, the latter contributing to the spread of antimicrobial resistance. Even in well- resourced areas, symptomatic patients are often treated empirically because of the delay in the availability of results from laboratory-based testing. Effective control and surveillance of GC and CT infections will require the development of effective diagnostics. Indeed, the WHO’s Triple Billion goals include improved access to diagnostics for primary health care as a means to enable universal health coverage for one billion more individuals. In order for this goal to be achieved, point-of-care (PoC) tests that both professional and non-professional health workers can utilise will be essential. This is recognised in the WHO’s Global Health sector strategies on HIV, viral hepatitis, and sexually transmitted infections (2022-2030) and further detailed in the publication of target product profiles for GC and CT. A significant obstacle to the effective control and surveillance of GC and CT infections is the lack of PoC tests that are affordable, sensitive, specific, user-friendly, rapid, robust, equipment-free and deliverable to end-users (i.e. the WHO’s ASSURED criteria). Diagnostics encompassing these criteria will, therefore, be vital to the effect control and surveillance of GC and CT infections. Historically, several different laboratory methods have been available for detecting GC and CT, such as serology antibody tests, rapid antigen tests, culture tests and nucleic acid amplification tests (NAATs). Serology antibody tests and rapid antigen tests are not recommended for diagnosis of gonococcal and chlamydial infections, as they consistently show insufficient sensitivity and specificity in clinical studies. Whilst culture tests have high specificity, GC and CT are fastidious bacteria, are difficult to grow, and require meticulous sample collection and transport. Moreover, CT is an obligate intracellular pathogen, which can only be isolated from infected mammalian cell lines, further complicating the culture process. NAATs are currently the gold standard for detecting GC and CT. Amongst the various diagnostic methods available, NAATs are the most sensitive and most widely used in well- resourced settings. However, the majority of available NAATs are based on real-time polymerase chain reaction (PCR), which requires highly trained staff and sophisticated, costly equipment, such that many of the available NAAT and near-patient real-time PCT systems are not affordable in low-and middle-income countries, where the burden of GC and CT infections is greatest. Thus, many clinically approved PCR-based NAATs that are commercially available for detecting both GC and CT in a single reaction, such as Cobas® (Roche) and binx io (binx health), cannot be readily applied in resource-limited settings. In addition, most PCR-based NAATs currently have the time-to-result of several hours, necessitating a second visit from patients to the clinic. Studies show that high-risk patients often do not return to the clinic due to fear of a positive result, stigmatisation and discrimination, leading to reduced opportunity for contact tracing. Hence, there is a high demand for alternative low-cost, accessible and rapid tests for sensitive and specific detection of GC and CT that facilitate diagnosis and treatment in one visit. Recent reviews on PoC tests for STI diagnosis indicate the growing interest in isothermal amplification-based methods as prime candidates, since they can be simple, rapid and cost- effective in the absence of a need for costly PCR thermal cyclers. In particular, loop-mediated isothermal amplification (LAMP) has been applied as a simple, rapid, sensitive and low-cost alternative to PCR for the detection of pathogens, such as viruses, bacteria and protozoa. LAMP uses four main primers including two inner primers (FIP and BIP) and two outer primers (F3 and B3) designed to target six specific regions within a target sequence. Whilst not essential for amplification, the addition of two loop primers (LF and LB) accelerates amplification by reducing the reaction time to less than half of the original time and potentially increases sensitivity. LAMP with six primers can be accomplished in ≤30 min at a single temperature of 63-65°C, allowing rapid detection of a nucleic acid of interest without the need for specialised equipment. In addition, the yield of nucleic acid amplification in LAMP is 50-10 times higher than that of PCR, and the high yield allows sensitive detection of amplification products using various read-out mechanisms, such as turbidity, colorimetry and fluorescence. The availability of WarmStart RTx Reverse Transcriptase (New England Biolabs, UK) also makes it possible to combine both reverse transcription and LAMP in one reaction (RT-LAMP) for the detection of RNA. As LAMP assays are rapid, affordable, specific, sensitive and robust, with the possibility of versatile read-out methods and combining with reverse transcription, they have potential for use in detecting pathogens in resource-limited settings and at the PoC. The potential and recent advancement in PoC LAMP has been reviewed recently (Das et al., 2022; Moehling et al., 2021). Despite the potential of LAMP for use in diagnostics, a LAMP-based method has yet to be approved by the FDA or EUA for STI diagnostics. Indeed, many issues remain to be addressed in order to enhance the PoC adaptability of LAMP for use in diagnosing GC and CT infections. One of the main issues with LAMP is the high false positive rate, which can arise due to carryover contamination from clinical samples, the increased likelihood of formation of primer-dimers as a result of using a large number of primers, and self-amplification of primers. The design of primers for use in LAMP-based diagnostic tests is, therefore, particularly important in ensuring accurate and reliable test results. Summary of the invention The present inventors have developed LAMP assays for the simultaneous and rapid detection of GC and CT in clinical samples. In particular, the present inventors have developed a set of oligonucleotide primers that can be used in LAMP assays to detect the presence of target GC or CT nucleic acid sequences in clinical samples, such as first void urine as well as vaginal, cervical, rectal and throat swabs. Data obtained from the LAMP assays were compared with data obtained using the gold-standard, FDA-approved BD ProTec assay, and discrepant samples were further analysed by real-time PCR. It was found that, surprisingly, the LAMP assays resulted in zero false positives and were capable of detecting the presence of GC or CT in clinical samples that could not be detected using even the BD ProbeTec assay. Accordingly, in a first aspect, the invention provides a set of oligonucleotide primers comprising a forward inner primer (FIP), a reverse inner primer (BIP), a forward outer primer (F3) and a reverse outer primer (B3), wherein: (a) the FIP comprises the nucleotide sequence of SEQ ID NO: 15, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (b) the BIP comprises the nucleotide sequence of SEQ ID NO: 16, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (c) the F3 comprises the nucleotide sequence of SEQ ID NO: 17, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; and (d) the B3 comprises the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto. In a further aspect, the invention provides a kit for detecting Chlamydia trachomatis in a sample or for diagnosing Chlamydia trachomatis infection in a subject, wherein the kit comprises the set of oligonucleotide primers of the invention. In a further aspect, the invention provides an in vitro diagnostic device for Chlamydia trachomatis infection, comprising the set of oligonucleotide primers of the invention or the kit of the invention. In a further aspect, the invention provides a method of loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT- LAMP), wherein the method comprises: (a) mixing the set of oligonucleotide primers of the invention with template DNA or RNA, deoxyribonucleotide triphosphates (dNTP), a DNA polymerase and optionally reverse transcriptase in solution; and (b) heating the mixture to the working temperature of the DNA polymerase. In a further aspect, the invention provides use of the set of oligonucleotide primers of the invention, the kit of the invention, or the in vitro diagnostic device of the invention, to detect the presence or absence of Chlamydia trachomatis nucleic acid in a sample, or to diagnose the presence or absence of Chlamydia trachomatis in a subject. In a further aspect, the invention provides a method of detecting the presence or absence of Chlamydia trachomatis in a sample using the set of oligonucleotide primers of the invention, or the kit of the invention, wherein the method comprises: (a) performing loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT-LAMP) using the set of oligonucleotide primers or the kit to amplify Chlamydia trachomatis nucleic acid in the sample, thereby providing, in the presence of Chlamydia trachomatis nucleic acid, an amplification product; (b) detecting the presence or absence of the amplification product; and (c) determining the presence or absence of Chlamydia trachomatis nucleic acid in the sample, wherein the presence of the amplification product indicates the presence of Chlamydia trachomatis in the sample and absence of the amplification product indicates the absence of Chlamydia trachomatis in the sample. In a further aspect, the invention provides a method of diagnosing the presence or absence of Chlamydia trachomatis infection in a subject, comprising detecting the presence or absence of Chlamydia trachomatis in a sample obtained from the subject using the method of the invention, wherein the presence of Chlamydia trachomatis in the sample indicates the presence of a Chlamydia trachomatis infection in the subject and the absence of Chlamydia trachomatis in the sample indicates the absence of a Chlamydia trachomatis infection in the subject. In a further aspect, the invention provides use of the set of oligonucleotide primers of the invention, or the kit of the invention, in the method of the invention. The invention will now be described in more detail, by way of example and not limitation, and by reference to the accompanying drawings. Many equivalent modifications and variations will be apparent, to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the disclosure set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the scope of the invention which is defined by the claims. All documents cited herein, whether supra or infra, are expressly incorporated by reference in their entirety. The present disclosure includes the combination of the aspects and features described except where such a combination is clearly impermissible or is stated to be expressly avoided. Section headings are used herein for convenience only and are not to be construed as limiting in any way. Description of the figures Figure 1 – Analysis of the amplification efficiency of primer sets targeting the porA pseudogene. (a) qLAMP assay using synthesised DNA fragment of the porA pseudogene with two different primer sets, porA_1 and porA_2. For each template concentration, the LAMP reaction was performed in triplicates, and the results are presented as mean ± SEM. (b) The analytical sensitivtity of porA_1 primer set. The porA_1 primer set can detect 36 copies gene fragmemts per reaction within 20 minutes, but only one out of three replicates was detected. Figure 2 – LAMP with porA_2 primer set on a clinical isolate of N. gonorrhoeae (GC). The GC bacterial cells (copy number not known) were diluted in PBS. 5 µl of diluted cells were then added to 20µl of LAMP reagent. For each diluted sample, reactions were performed in duplicate using NEB Colorimetric Warmstart enzyme. The colorimetric (left) and real-time fluorescence (right) data were recorded. The NEB colorimetric LAMP reagent is based on the pH change, which leads to a colour change from pink to yellow, upon amplification of the target gene. Figure 3 – Analysis of the amplification efficiency of primer sets targeting the ftsk gene. (a) qLAMP assay using the ftsk gene fragment with two different primer sets, ftsk_1 and ftsk_2. For each template concentration, the LAMP reaction was performed in triplicates, and the results are presented as mean ± SEM. (b) The analytical sensitivtity of the ftsk_1 primer set. The ftsk_1 primer set can detect 22 copies gene fragmemts per reaction within 20 minutes, but only two out of three replicates were detected. (c) The performance of the ftsk_1 primer set, ftsk_2 primer set, and cds primer set was evaluated using one clinical positive sample and one clinical negative sample. Each detection was performed in triplicate. The average TT value for the ftsk_1 primer set, the cds primer set and the ftsk_2 primer set when detecting the positive sample was 8.1 minutes, 8.8 minutes and 11.9 minutes, respectively. Figure 4 – Charts showing the distribution of different sample types in the total clinical sample (a), in female samples (b), and in male samples (c). Figure 5 – Schematic showing the three different sample pre-treatments that were employed prior to LAMP detection. Figure 6 – Optimisation of LAMP by investigating the effect of different variables. (a) The effect of adding BD UTM to the LAMP reaction using the N. gonorrhoeae (GC) porA_1 primer set. porA DNA fragment were used as the positive control with a concentration of 1500 copies per reaction. (b) The effect of adding PBS to the LAMP reaction using the GC porA_1 primer set. porA DNA fragments were used as the positive control with a concentration of 1500 copies per reaction. (c) Colorimetric GC-LAMP assays using NEB Warmstart enzyme is not compatible with direct detection of samples. Upon adding the samples, an immediate colour change was observed for urine samples, while sample 2 (GC-positive) showed no colour change after the end of amplification. Sample 1: urine / GC-negative; sample 2: throat swab / GC-positive; sample 3: urine / GC-positive. (d) The effect of adding different volumes of urine sample to LAMP reagents spiked with DNA fragments. Description of the sequence listing SEQ ID NO: 1 – DNA sequence of FIP for porA pseudogene (porA_2 primer set) SEQ ID NO: 2 – DNA sequence of BIP for porA pseudogene (porA_2 primer set) SEQ ID NO: 3 – DNA sequence of F3 primer for porA pseudogene (porA_2 primer set) SEQ ID NO: 4 – DNA sequence of B3 primer for porA pseudogene (porA_2 primer set) SEQ ID NO: 5 – DNA sequence of LF prime for porA pseudogene (porA_2 primer set) SEQ ID NO: 6 – DNA sequence of LB primer for porA pseudogene (porA_2 primer set) SEQ ID NO: 7 – DNA sequence of FIP for porA pseudogene (porA_1 primer set) SEQ ID NO: 8 – DNA sequence of BIP for porA pseudogene (porA_1 primer set) SEQ ID NO: 9 – DNA sequence of F3 primer for porA pseudogene (porA_1 primer set) SEQ ID NO: 10 – DNA sequence of B3 primer for porA pseudogene (porA_1 primer set) SEQ ID NO: 11 – DNA sequence of LF primer for porA pseudogene (porA_1 primer set) SEQ ID NO: 12 – DNA sequence of LB primer for porA pseudogene (porA_1 primer set) SEQ ID NO: 13 – DNA sequence of FW primer for porA pseudogene SEQ ID NO: 14 – DNA sequence of RV primer for porA pseudogene SEQ ID NO: 15 – DNA sequence of FIP for ftsk gene (ftsk_1 primer set) SEQ ID NO:16 – DNA sequence of BIP for ftsk gene (ftsk_1 primer set) SEQ ID NO: 17– DNA sequence of F3 primer for ftsk gene (ftsk_1 primer set) SEQ ID NO: 18 – DNA sequence of B3 primer for ftsk gene (ftsk_1 primer set) SEQ ID NO: 19 – DNA sequence of LF prime for ftsk gene (ftsk_1 primer set) SEQ ID NO: 20 – DNA sequence of LB primer for ftsk gene (ftsk_1 primer set) SEQ ID NO: 21 – DNA sequence of FIP for ftsk gene (ftsk_2 primer set) SEQ ID NO: 22 – DNA sequence of BIP for ftsk gene (ftsk_2 primer set) SEQ ID NO: 23 – DNA sequence of F3 primer for ftsk gene (ftsk_2 primer set) SEQ ID NO: 24 – DNA sequence of B3 primer for ftsk gene (ftsk_2 primer set) SEQ ID NO: 25 – DNA sequence of LF primer for ftsk gene (ftsk_2 primer set) SEQ ID NO: 26 – DNA sequence of LB primer for ftsk gene (ftsk_2 primer set) SEQ ID NO: 27 – DNA sequence of FIP for ompA gene SEQ ID NO: 28 – DNA sequence of BIP for ompA gene SEQ ID NO: 29 – DNA sequence of F3 primer for ompA gene SEQ ID NO: 30 – DNA sequence of B3 primer for ompA gene SEQ ID NO: 31 – DNA sequence of LF primer for ompA gene SEQ ID NO: 32 – DNA sequence of LB primer for ompA gene SEQ ID NO: 33 – DNA sequence of FIP for cryptic plasmid (cds primer set) SEQ ID NO: 34 – DNA sequence of BIP for cryptic plasmid (cds primer set) SEQ ID NO: 35 – DNA sequence of F3 primer for cryptic plasmid (cds primer set) SEQ ID NO: 36 – DNA sequence of B3 primer for cryptic plasmid (cds primer set) SEQ ID NO: 37 – DNA sequence of LF primer for cryptic plasmid (cds primer set) SEQ ID NO: 38 – DNA sequence of LB primer for cryptic plasmid (cds primer set) SEQ ID NO: 39 – DNA sequence of FW primer for ftsk gene SEQ ID NO: 40 – DNA sequence of RV primer for ftsk gene SEQ ID NO: 41 – DNA sequence of FW primer for cryptic plasmid SEQ ID NO: 42 – DNA sequence of RV primer for cryptic plasmid Detailed Description of the invention Primers The invention provides a set of oligonucleotide primers. The primers are suitable for use in a method of LAMP and / or RT-LAMP. The primers are short, often chemically synthesised, polynucleotides. The primers typically have a free 3’-hydroxyl moiety on the terminal sugar. Nucleic acid polymerases generally require a free 3’-hydroxyl moiety on the terminal sugar of a stretch of double stranded nucleic acid adjacent to the site of new synthesis. The primer is able to anneal to a template nucleic acid, typically at a site having a complementary sequence, to provide an initiation site for the polymerase synthesis reaction. A 3’ modification, such as a sulfhydryl, may be utilised to prime the synthesis reaction. The primer is targeted to complementary sequences by virtue of its specific base-pairing capacity. Formation of hybrids between the primer and target nucleic acid are typically formed by incubation of the two in solution under conditions of salt, pH, and temperature that allow spontaneous annealing. The primers used are typically DNA. The primers may be PNA or RNA. The primers may comprise any combination of natural or canonical nucleotides (i.e., “naturally occurring” or “natural” nucleotides), which include adenosine, guanosine, cytidine, thymidine and uridine. The primers may also comprise nucleotide analogues. For example, the primers may include one or more peptide nucleotides, in which the phosphate linkage found in DNA and RNA is replaced by a peptide-like N-(2-aminoethyl)glycine. Peptide nucleotides undergo normal Watson-Crick base pairing and hybridize to complementary DNA / RNA with higher affinity and specificity and lower salt-dependency than normal DNA / RNA oligonucleotides and may have increased stability. The primers may include one or more locked nucleotides (LNA), which comprise a 2′- O-4′-C-methylene bridge and are conformationally restricted. LNA form stable hybrid duplexes with DNA and RNA with increased stability and higher hybrid duplex melting temperatures. The primers may include one or more Propynyl dU (also known as pdU-CE Phosphoramidite, or 5'-Dimethoxytrityl-5-(1-Propynyl)-2'-deoxyUridine,3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite). The primers may include one or more unlocked nucleotides (UNA), which are analogues of ribonucleotides in which the C2′-C3' bond has been cleaved. UNA form hybrid duplexes with DNA and RNA, but with decreased stability and lower hybrid duplex melting temperatures. LNA and UNA may therefore be used to finely adjust the thermodynamic properties the primers in which they are incorporated. The primers may include one or more triazole-linked DNA oligonucleotides, in which one or more of the natural phosphate backbone linkages are replaced with triazole linkages, particularly when click chemistry is used for synthesising the primers. The primers may include one or more 2’-O-methoxy-ethyl bases (2’- MOE), such as 2-Methoxyethoxy A, 2-Methoxyethoxy MeC, 2-Methoxyethoxy G and / or 2- Methoxyethoxy T. The primers may include one or more 2'-O-Methyl RNA bases. The primers may include one or more 2’-fluoro bases, such as fluoro C, fluoro U, fluoro A, and / or fluoro G. Other specific examples of nucleotide analogues include 2-Aminopurine, 5-Bromo dU, deoxyUridine, 2,6-Diaminopurine (2-Amino-dA), Dideoxy-C, deoxyInosine, Hydroxymethyl dC, Inverted dT, Iso-dG, Iso-dC, 5-Methyl dC, 5-Nitroindole, 5-hydroxybutynl-2’-deoxyuridine (Super T) and 8-aza-7-deazaguanosine (Super G). The primers may include super T 2,6- Diaminopurine (2-Amino-dA) and / or 5-Methyl dC. The primers may include one or more biotinylated nucleotides. The primers may comprise up to 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40% or more nucleotide analogues and / or biotinylated nucleotides, or any one type of nucleotide analogue as described herein. Use of synthetic oligonucleotides with a non- hydrolysable backbone at the ultimate and / or penultimate link may be beneficial to reduce reaction noise. Alternative backbones could be selected from the considerable range of chemistries available, such as phosphorothioate, morpholino, locked nucleic acid, or peptide nucleic acid. Primers may be synthesised according to standard techniques. Modified bases and / or linker backbone chemistries may be desirable and functional in some cases. The primer may be modified at their ends, either 5’ or 3’, with groups that serve various purposes e.g. fluorescent groups, quenchers, protecting (blocking) groups (reversible or not), magnetic tags, proteins, radioactive labels etc. The primers typically have a high grade of purity, i.e. before being included in a reaction mix. For example, HPLC purified primers, particularly the FIP and BIP as described herein, may be used. LAMP methods typically use at least four primers that are selected or adapted to hybridise / anneal to six different sequences in the template nucleic acid. Two inner primers, referred to herein as the forward inner primer (FIP) and the reverse (backward) inner primer (BIP), each contain two distinct sequences corresponding to the sense and antisense sequence of the template DNA. The 3’ end sequences of the forward inner primers, referred to as “F2” for the FIP and “B2” for the BIP, are adapted to anneal by hybridisation to the template DNA at corresponding complementary sequence regions (referred to as F2c and B2c) and prime the initial polymerase step of LAMP amplification. The annealing sites of F2 and B2 flank and define the ends of the region of the template DNA that is amplified. The amplified region of template DNA is typically up to about 500 bp, 400 bp, 300 bp, 200 bp, or 100 bp including the B2 / B2c and F2 / F2c regions, and most typically up to about 300 bp. The 5’ end of the FIP and BIP, referred to as “F1c” and “B1c”, have high sequence identity to F1c and B1c of the template DNA, respectively. Typically, F1c of the FIP and B1c of the BIP have identical sequences to F1c and B1c of the template DNA, respectively. F1c and B1c of the template DNA are located 5’ to F2c and B2c of the template DNA, respectively, F2c and B2c of the template DNA form the annealing sites of F2 of the FIP and B2 of the BIP, respectively. F2 of the FIP and B2 of the BIP are located at the 3’ end of the FIP and BIP, respectively. F1c of the FIP and B1c of the BIP are used to generate loop structures. To initialise amplification, F2 of the FIP binds to F2c of the template DNA. After initial strand extension from the FIP, the FIP / nascent strand is displaced from the template as described below, and F1c of the FIP and the complementary sequence of the nascent strand, F1, self-anneal to form a loop at one end of the strand. B2 of the BIP then binds to B2c of the nascent strand, which acts as a further template. After initial strand extension from the BIP, the BIP / nascent strand is also displaced from the template as described below, and B1c of the BIP and the complementary sequence of the nascent strand, B1, self-anneal to form a loop at one end of the strand. The resulting product has a dumbbell structure with loop structures on both ends. The resulting product forms a seed for exponential LAMP amplification. The distance between the 3’ end of F1 and the 3’ end of F2, and between the 3’ end of B1 and the 3’ end of B2 in the template DNA is typically about 30 to 70, or more typically about 40 to 60 nucleotides in length, or about 40 nucleotides in length. Between the F2 and F1c in the FIP (and between B2 and B1c in the BIP) is a spacer region. F2 (or B2) and the spacer region (or their reverse complements) together form part of the loops that form at each end of the initial dumbbell-like structure formed during the initial stage of the LAMP reaction, and each loop added during the cyclic amplification stage. This loop is formed when the 5’ end of the primer self-anneals to new complementary strand primed at the 3’ end of the primer, using the template sequence with high sequence identity to the 5’ end of the primer as template. The rest of the loop is complementary to the region between F1 and F2 (or F1c and F2c, or B1 and B2, or B1c and B2c). This additional loop sequence may provide the template for binding by a loop primer, as described below. The spacer / loop region may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides in length. The spacer / loop region may be less than about 10, less than 9, less than 8, less than 7, less than 6, or less than 5 nucleotides in length. The spacer / loop region is typically 4 to 6 nucleotides in length. The spacer / loop region is typically no more than 8 to 10 nucleotides in length. The spacer / loop region typically comprises a polythymidine, such as TTTT. The spacer / loop region may comprise phosphoramidite. The spacer / loop region may have the sequence of the FIP exemplified in the Examples herein. The outer forward (“F3”) and reverse (“B3”) primers are adapted to anneal by hybridisation to a single stretch of template DNA, typically across substantially the whole length of the primer. They prime a polymerase reaction that displaces the FIP or BIP and nascent strand formed at the 3’ end of the inner primers using the template DNA in the initial polymerase reactions of the LAMP method. Hence, the F3 primer anneals to F3c of the template DNA. F3c of the template DNA is located 3’ to F2c of the template DNA. F2c of the template DNA is the sequence hybridised by F2 of the FIP. The B3 primer anneals to B3c of the template DNA. B3c of the template DNA is located 3’ to B2c. B2c of the template DNA is the sequence hybridised by B2 of the BIP. The distance between the sequence hybridised by the forward inner and outer primers or the reverse inner and outer primers is typically about 100 to 300 nucleotides, for example about 200 nucleotides. The primary purpose of the outer primers in displacing the inner primers and nascent strand from the template nucleic acid is to form the dumbbell-like structure that is used as initial template for the cycling amplification step of LAMP. This cycling step uses further inner forward and reverse primers to prime the cyclic amplification, whilst the outer primers typically perform no further role. Hence, in a typical reaction, the inner forward and reverse primers are present in excess of the outer forward and reverse primers, typically by about 2x to 10x, or about 3x to 9x, or about 4x to 8x, or about 8x. In some embodiments, additional forward and / or reverse primers are included. The inclusion of two additional loop primers (the “LF” and “LB” primers) can shorten the time required for the original LAMP and potentially increase sensitivity. The loop primers hybridise to the loop regions of the dumbbell-like structure described above, except for the part corresponding to or hybridising to the sequence of the inner primers. Typically, the LF primer anneals by hybridisation to the region of the loop between the F1 and F2 regions. Typically, the LB primer anneals by hybridisation to the region of the loop between the B1 and B2 regions. The forward and reverse loop primers may be in about the same quantity as the forward and reverse inner primers, for example + / - 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 2%, or 1%. The forward and reverse loop primers may be in a different quantity to the forward and reverse inner primers, for example + / - 500%, 400%, 300%, 200% or 100%. Typically, the forward and reverse inner primers are in excess to the forward and reverse loop primers. For example, the ratio of forward and reverse loop primers to forward and reverse inner primers may be 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 or 1:10. More typically, the ratio of forward and reverse loop primers to forward and reverse inner primers is 1:4. Each of the F1c, F2, F3, B1c, B2 and B3 regions, which anneal by hybridisation to corresponding reverse complement regions of template DNA, is typically at least 10, or at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, such as from about 10 to about 60, about 12 to about 40, or about 15 to about 25 or 30 nucleotides in length. The primer may comprise one or more nucleotide analogues, such as analogues described herein, that form double-stranded hybrids with higher stability than natural nucleotides. In this case, the primer could, in principal, be shorter, such as at least 6, 7, 8 or 9 nucleotides in length, for example. In general, however, shorter regions will have lower specificity and selectivity and may be more prone to off-target amplification. Typically, the inner primers are longer than the outer primers, because they include two separate template- binding regions (F2 and F1c; or B2 and B1c) and the spacer / loop region in-between. Accordingly, the inner primers typically have a length of about 20, or 30, or 35, or 40, or 45, or 50, to about 100, or 90, or 80, or 70, or 60 nucleotides, or about 30 to 70, or about 35 to 60, or about 40 to 55 nucleotides in length. The FIP and / or BIP may have a length of 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55 nucleotides. The FIP and BIP may have the same length. The FIP and BIP may have different lengths. The outer and loop primers typically comprise their template-binding region across substantially their whole length, but may in some cases have additional nucleotides, such as 1 to 5, or 1 to 10, or 1 to 15, or 1 to 20 additional nucleotides at their 5’ end. These primers are typically between about 10 to about 50 nucleotides in length, for example about 10 to about 40, or about 15 to about 25 or 30 nucleotides in length, or longer if they include additional nucleotides at their 5’ end as described above. The F3 primer, B3 primer, LF primer and / or LB primer may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. The F3 primer, B3 primer, LF primer and / or LB primer may have the same length. The F3 primer, B3 primer, LF primer and / or LB primer may have different lengths. The choice of single-stranded regions will depend, in part, on the complexity of the starting nucleic acid so that, for example, a bacterial circular chromosome may require a longer primer while a plasmid may require a much shorter primer. Amplification may in some cases be achieved even if the primers are not completely complementary to the template nucleic acid, as long as the primers are able to anneal to the target region of the template DNA. In general, however, primers are designed to bind to conserved regions of a template DNA. Reaction conditions are also typically selected, to achieve maximum specificity, selectivity and efficiency of the amplification method. The primers are typically selected to have a melting temperature (Tm) that is optimal for use in a particular DNA polymerase. Typical Tm values are about 50 to about 70°C, more typically about 55 to 68°C, more typically about 59 to 66°C. The Tmvalues of the F1c and B1c regions of the inner primers may be set slightly higher than those of the F2 and B2 regions, so that the loop is formed immediately after release of the single stranded DNA from template. The Tmvalues of the outer primers (F3 and B3) regions may be set at the same value as, or lower than those of, the F2 and B2 regions of the inner primers, to promote initial synthesis from the inner primers. The Tm values of the loop primers (LF and LB) may be set at the same value as the F1c and B1c regions of the inner primers. For example, the Tm values of the F1c and B1c regions of the inner primers and the Tm values of the LF and LB primer may be set at about 64 to 66°C, typically about 65°C, whereas the Tm values of the F2, B2, F3 and B3 primers may be set at about 59 to 61°C, typically about 60°C. In these cases, the difference in Tm values may independently be up to or about 5°C, 4°C, 3°C, 2°C, 1.5°C, 1°C, 0.5°C, 0.2°C, or 0.1°C. Primers can be designed using the primer designing support software, referred to as ‘LAMP primer designing software, PrimerExplorer’. Provided herein is a set of primers. The set of primers can be used for detecting the presence or absence of target nucleic acid of a pathogen (i.e. Neisseria gonorrhoea or Chlamydia trachomatis) in a sample, or for diagnosing the presence or absence of infection by the pathogen in a subject. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 1; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 2; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 3, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 3; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 4, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 4; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 5, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 5; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 6, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 6. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 7, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 7; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 8, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 8; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 9, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 9; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 10, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 10; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 11, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 11; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 12, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 12. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 15, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 15; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 16, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 16; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 17, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 17; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 18, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 18; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 19, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 19; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 20, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 20. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 21, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 21; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 22, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 22; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 23, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 23; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 24, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 24; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 25, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 25; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 26, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 26. In some cases, the set of primers comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 1; and / or the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 15, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 15; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 2; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 16, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 16; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 3, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 3; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 17, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 17; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 4, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 4; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 18, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 18; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 5, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 5; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 19, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 19; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 6, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 6; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 20, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 20. In some cases, the set of primers comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 7, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 7; and / or the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 15, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 15; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 8, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 8; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 16, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 16; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 9, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 9; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 17, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 17; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 10, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO:c10; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 18, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 18; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 11, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 11; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 19, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 19; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 12, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 12; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 20, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 20. In some cases, the set of primers comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 1; and / or the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 21, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 21; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 2; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 22, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 22; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 3, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 3; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 23, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 23; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 4, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 4; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 24, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 24; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 5, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 5; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 25, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 25; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 6, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 6; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 26, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 26. In some cases, the set of primers disclosed herein may comprise four further primers having the nucleotide sequences of SEQ ID NOs: 27 to 30, and optionally two further primers having the nucleotide sequences of SEQ ID NOs: 31 and 32; and / or four further primers having the nucleotide sequences of SEQ ID NOs: 33 to 36, and optionally two further primers having the nucleotide sequences of SEQ ID NOs: 37 and 38. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 27, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 27; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 28, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 28; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 29, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 29; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 30, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 30; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 31, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 31; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 32, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 32. In some cases, the set of primers comprises an FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 33, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 33; and / or a BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 34, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 34; and / or an F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 35, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 35; and / or a B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 36, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 36; and / or an LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 37, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 37; and / or an LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 38, or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 38. Target nucleic acids The primers described herein target nucleic acid sequences characteristic of, or are derived from nucleic acid sequences characteristic of, Neisseria gonorrhoea or Chlamydia trachomatis. That is, the target nucleic acid sequences are found in, or derived from nucleic acid sequences found in, Neisseria gonorrhoea or Chlamydia trachomatis, and the target nucleic acid sequences are specific to Neisseria gonorrhoea or Chlamydia trachomatis and no other bacteria, such as commensal Neisseria or Chlamydia strains. The target nucleic acid may be a DNA sequence, or a cDNA sequence derived from an RNA sequence. Where the target nucleic acid sequence is a cDNA sequence, the RNA sequence from which the cDNA sequence is derived may be reverse-transcribed to provide the cDNA sequence as described herein. In some cases, the target nucleic acid is a DNA sequence, or a cDNA sequence derived from an RNA sequence, found in Neisseria gonorrhoea. Neisseria gonorrhoea comprises a chromosome. Therefore, the target nucleic acid may be comprised in, or derived from an RNA sequence transcribed from, the chromosome of Neisseria gonorrhoea. Where the target nucleic acid is comprised in, or derived from the RNA sequence transcribed from, the chromosome of Neisseria gonorrhoea, the target nucleic acid may comprise or consist of the sequence of the porA pseudogene or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto. The porA pseudogene is highly conserved across Neisseria gonorrhoea strains and is absent in commensal Neisseria strains and other bacteria. In cases where the target nucleic acid comprises or consists of the sequence of the porA pseudogene, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 1; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 2; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 3, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 3; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 4, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 4; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 5, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 5; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 6, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 6, may be used. Alternatively, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 7, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 7; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 8, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 8; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 9, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 9; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 10, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 10; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 11, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 11; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 12, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 12, may be used. In some cases, the target nucleic acid is a DNA sequence, or a cDNA sequence derived from an RNA sequence, found in Chlamydia trachomatis. Chlamydia trachomatis comprises a chromosome and optionally a cryptic plasmid. Therefore, the target nucleic acid may be comprised in, or derived from an RNA sequence transcribed from, the chromosome of Chlamydia trachomatis or the cryptic plasmid of Chlamydia trachomatis. Chlamydia trachomatis comprises a chromosome. Therefore, to determine whether Chlamydia trachomatis is present, primers targeting a nucleic acid comprised in, or derived from an RNA sequence transcribed from, the chromosome may be used. Where the target nucleic acid is comprised in, or derived from the RNA sequence transcribed from, the chromosome of Chlamydia trachomatis, the target nucleic acid may comprise or consist of the sequence of the ftsk gene or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. The ftsk gene is a chromosomal gene encoding the FtsK protein and a low polymorphism region of the chromosome. In cases where the target nucleic acid comprises or consists of the sequence of the ftsk gene, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 15, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 15; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 16, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 16; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 17, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 17; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 18, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 18; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 19, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 19; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 20, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 20, may be used. Alternatively, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 21, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 21; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 22, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 22; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 23, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 23; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 24, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 24; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 25, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 25; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 26, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 26, may be used. Where the target nucleic acid is comprised in, or derived from the RNA sequence transcribed from, the chromosome of Chlamydia trachomatis, the target nucleic acid may comprise or consist of the sequence of the ompA gene of Chlamydia trachomatis or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. The ompA gene is a chromosomal gene encoding membrane protein A and is a highly polymorphic gene amongst the 19 known serological variants of Chlamydia trachomatis. Serological variant strains of Chlamydia trachomatis include serovars A, B, Ba, C, D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a and L3. Thus, the target nucleic acid sequence may comprise the sequence of the ompA gene of one or more of the Chlamydia trachomatis serovars A, B, Ba, C, D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a and L3, or a variant having 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In cases where the target nucleic acid comprises or consists of the sequence of the ompA gene, or the variant having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 27, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 27; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 28, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 28; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 29, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 29; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 30, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 30; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 31, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 31; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 32, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 32, may be used. Given that the ompA gene is highly polymorphic, the primers targeting the ompA gene may be degenerate primers. Methods of designing degenerate primers are known in the art. Chlamydia trachomatis may be plasmid-free. Alternatively, Chlamydia trachomatis may comprise a cryptic plasmid. To determine whether Chlamydia trachomatis comprising a cryptic plasmid is present, primers targeting a nucleic acid comprised in, or derived from an RNA sequence transcribed from, the cryptic plasmid may be used. Where the target nucleic acid is comprised in, or transcribed from the RNA sequence transcribed from, the cryptic plasmid of Chlamydia trachomatis, the target nucleic acid may comprise or consist of the sequence of the CDS2 region of the cryptic plasmid or a variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In cases where the target nucleic acid comprises or consists of the CDS2 region of the cryptic plasmid, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, the set of primers that comprises the FIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 33, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 33; and / or the BIP comprising or consisting of the nucleotide sequence of SEQ ID NO: 34, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 34; and / or the F3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 35, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 35; and / or the B3 primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 36, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 36; and / or the LF primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 37, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 37; and / or the LB primer comprising or consisting of the nucleotide sequence of SEQ ID NO: 38, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 38, may be used. Different sets of primers, or combinations thereof, described herein may be used to target one or more of the target nucleic acids described herein simultaneously in the same LAMP reaction or separately in different LAMP reactions. By way of example, the set of primers targeting nucleic acid comprising or consisting of the ftsk gene, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, described herein and the set of primers targeting nucleic acid comprising or consisting of the CDS2 region of the cryptic plasmid, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, described herein may be used simultaneously in the same LAMP reaction or separately in different LAMP reactions in order to determine the presence or absence of Chlamydia trachomatis and / or the presence or absence of plasmid-free Chlamydia trachomatis. As a further example, the set of primers targeting nucleic acid comprising or consisting of the ftsk gene, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, described herein and the set of primers targeting nucleic acid comprising or consisting of the ompA gene, or the variant having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, described herein may be used simultaneously in the same LAMP reaction or separately in different LAMP reactions in order to determine the presence or absence of Chlamydia trachomatis with higher confidence. Reagents DNA polymerase Any suitable DNA polymerase having strand displacement activity may be used in the methods described herein. The DNA polymerase may be a eukaryotic polymerase. Examples of eukaryotic polymerases that may be used include pol-α, pol-β, pol-δ, pol-ε or any functional variant, analogue, homologue or derivative thereof and any combination thereof. The DNA polymerase is typically Bst DNA polymerase, more typically Bst 2.0 DNA polymerase. Bst 2.0 DNA polymerase does not initiate nucleic acid amplification until about 40°C. This property reduces the likelihood of obtaining false-positive results. The DNA polymerase may be a prokaryotic polymerase. Examples of prokaryotic polymerases that may be used include Bacillus stearothermophilus (Bst) DNA polymerase, BcaBEST DNA polymerse (TaKaRa), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, Bacillus stearothennophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase 1 (Sau), or any functional variant, analogue, homologue or derivative thereof or any combination thereof. The DNA polymerase may be a bacteriophage polymerase. Examples of bacteriophage polymerases that may be used in the methods described herein include Phi-29 DNA polymerase, T7 DNA polymerase, bacteriophage T4 gp43 DNA polymerase, or any functional variant, analogue, homologue or derivative thereof or any combination thereof. The DNA polymerase contains strand displacing properties, and typically a high strand displacement activity. DNA polymerases can use the free 3’-hydroxyl of the invading strand to catalyse DNA synthesis by incorporation of new nucleotides. A number of polymerases can use the 3’- hydroxyl of the invading strand to catalyse synthesis and simultaneously displace the other strand as synthesis occurs. For example, E. coli polymerase II or III can be used to extend invaded D-loops. In addition, E. coli polymerase V normally used in SOS-lesion-targeted mutations in E. coli can be used. All of these polymerases can be rendered highly processive through their interactions and co-operation with the β-dimer clamp, as well as single stranded DNA binding protein (SSB) and other components. Other polymerases from prokaryotes, viruses, and eukaryotes can also be used to extend the invading strand. Many DNA polymerases possess 3’-5’ exonuclease activity, and some also possess 5’-3’ exonuclease activity. 3’-5’ exonuclease activity increases the fidelity of the replication reaction. Accordingly, a DNA polymerase with 3’-5’ exonuclease activity may be used. In some cases, using a DNA polymerase with 3’-5’ exonuclease activity and / or 5’-3’ exonuclease activity may be undesirable, because it results in digestion of one DNA strand progressively as the polymerase moves forward, rather than displacement. Free oligonucleotides may also be subject to end-dependant degradation when polymerases possessing 3’-5’ exonuclease are employed. Mis-priming may also result from oligonucleotides that have been shortened by the 3’-5’ exonuclease activity of polymerases, leading to increased reaction noise. Accordingly, the DNA polymerase may not have 3’-5’ exonuclease activity and / or may not have 5’-3’ exonuclease activity. The DNA polymerase may be present at a concentration of between 10,000 units / mL to 500 units / mL, such as between 5000 units / mL to 600 units / mL or between 2000 units / mL to 600 units / mL. If Bst 2.0 DNA polymerase is used, the DNA polymerase is typically present at a concentration of about 1280 units / mL or 1600 units / mL, more typically about 640 units / mL. If the concentration of the DNA polymerase is below about 640 units / mL. the reaction may be slower. Reverse transcriptase In RT-LAMP, the starting template is RNA, e.g. an RNA transcript of a bacterium. A reverse transcriptase may be used to produce cDNA from the RNA template as an initial step. The cDNA provides the template for amplification. Any suitable reverse transcriptase may be used in the kits, devices or methods described herein. In many cases, it will be preferable to use a reverse transcriptase that has a similar working temperature as the DNA polymerase that is used. In this way, the whole method, for example, can be carried out at a single reaction temperature. The difference between the optimal temperature of the DNA polymerase and reverse transcriptase may be up to about + / - 10, 5, 4, 3, 3, 2, or 1°C. The reverse transcriptase may be present at a concentration of between about 10,000 units / mL to 10 units / mL, such as between 5000 units / mL to 500 units / mL. dNTPs dNTPs, such as dATP, dGTP, dCTP and dTTP, and derivatives and analogues thereof, find use in the present invention. In leading and lagging strand synthesis, RPA, ATP, GTP, CTP, and UTP may also be included for synthesis of RNA primers. The dNTPs may be used at a concentration of between 0.1 mM to 200 mM of each NTP species. The dNTPs are typically used at a concentration of between 0.1 mM to 10 mM, more typically between 0.1 mM to 3 mM, more typically between 0.4 mM to 2.8 mM, more typically between 1.0 mM to 1.8 mM or 1.4 mM. A mixture of dNTP and ddNTP (such as ddATP, ddTTP, ddGTP and ddGTP and derivatives and analogues thereof) may be used, with ddNTP concentrations typically at 1 / 100 to 1 / 1000 that of the dNTP (1 µM to 2 mM), for example, to generate fragment ladders. DNA destabilisers Chemicals that destabilise the DNA helix may improve LAMP efficiency. Suitable chemicals may be selected by the skilled person. For example, 0.5 to 1.5 M betaine (N,N,N- trimethylglycine) or L-proline, which reduce base stacking, can stimulate not only the overall rate of the reaction, but also increased target selectivity with a significant reduction in amplification of irrelevant sequences. Buffers The buffer solution in an (RT-)LAMP reaction is typically a Tris-HCl buffer, a Tris- Acetate buffer, or a combination thereof. The buffers are typically present at a concentration of between about 10 mM and about 100 mM. A typical buffer is a Tris-HCl buffer used at a concentration of between about 20 mM to about 30 mM, or more typically about 25 mM. The buffered pH is typically between about pH6.5 and pH9.0, between about pH7.5 and pH8.8, between about pH8 and pH8.5, or about pH 8.3. The buffer may contain potassium acetate between about 5 mM and about 50 mM, or more typically between about 10 mM and about 40 mM. Reducing agents, such as DTT, may be included. The DTT is typically at a concentration of between about 1 mM and 10 mM, or at about 1 mM. Reaction components A non-limiting example set of reaction components is described in the Examples. In embodiments of the invention, different components of the Example reactions may be independently selected + / - 50%, 40%, 30%, 30%, 10% or 5% for use in methods, kits or devices of the present invention. Drying of reaction components A reaction mix comprising the set of primers of the invention and optionally other reagents can be prepared as a dried reaction mix. The dried primers and reagents offer the advantage of not requiring refrigeration to maintain activity. For example, a tube of primers and / or reagents may be stored at room temperature. This is especially useful in field conditions where access to refrigeration is limited. The primers and / or reagents may be dried by any suitable method. They may be vacuum- dried. They may be freeze-dried (lyophilised). Suitable methods for producing vacuum-dried or lyophilised reagents are known in the art. The primers and / or reagents may be dried onto the bottom of a tube, or on a bead or any other suitable type of solid support. Before use, the freeze-dried reagents may be reconstituted in a buffered solution or water, depending on the composition of the dried reagents. Then, a target or template nucleic acid, or a sample suspected of containing a target or template nucleic acid, may be added. Alternatively, the reconstitution liquid may also contain the sample nucleic acid. The reconstituted reaction may be incubated for a suitable time period and at a suitable temperature (as discussed herein). The amplified nucleic acid, if present, may then be detected (as discussed herein). The reagents that can be dried before use may include DNA polymerase, reverse transcriptase, dNTPs, ddNTPs, reducing agent, primers, probe(s), stabilising agent, such as nucleic acid stabilising agent, buffering agents, pH indicator and / or colorimetric indicator, cell lysis reagents, and / or positive or negative control nucleic acid template. The primers may be any of those described herein. Stabilising agents such as dextran, lactose or trehalose sugar may be included in the dried mixture in order to improve drying performance and shelf life. These are typically present in the reconstituted reaction at about 20 mM to 200 mM, or about 30 mM to 150 mM, or about 40 mM to 80 mM and at appropriate concentrations in the dried mix to achieve these concentrations once reconstituted. Bovine serum albumin may be included. If desired, the dried reagents may be stored before use, e.g. for up to 2 weeks, 3 weeks, 1 month, 6 months or 1 year or more before use. The dried mixes may be re-dissolved in water, typically DNase- and / or RNase-free water, or any other suitable buffer as may be determined by the skilled person in the art. The pH of the re-dissolved reagents may be adjusted before use. Kits The invention provides a kit for detecting Chlamydia trachomatis in a sample or for diagnosing Chlamydia trachomatis infection in a subject. The kit may also detect Neisseria gonorrhoeae in a sample or Neisseria gonorrhoeae infection in a subject. The kit comprises the set of oligonucleotide primers as described herein. In some cases, the kit comprises a set of four primers having the nucleotide sequences of SEQ ID NOs: 15 to 18. The kit may further comprise an additional two primers having the nucleotide sequences of SEQ ID NOs: 19 and 20; a set of four primers having the nucleotide sequences of SEQ ID NOs: 1 to 4, and optionally an additional two primers having the nucleotide sequences of SEQ ID NOs: 5 and 6; and / or a set of four primers having the nucleotide sequences of SEQ ID NOs: 33 to 36, and optionally an additional two primers having the nucleotide sequences of SEQ ID NOs: 37 and 38. The kit may further comprise any of the reagents descried herein and in any of the concentrations described herein, in any suitable combination. In some embodiments, the kit further comprises: (i) a DNA polymerase; (ii) reverse transcriptase (if the kit is for use in a method requiring reverse transcription); (iii) a pH indicator, colorimetric indicator and / or fluorescent dye; (iv) deoxyribonucleotide triphosphates (dNTP); (v) buffer components; and / or (vi) instructions for use; or variants or alternatives of (i) to (vi) as described herein. The DNA polymerase may be Bst 2.0 DNA polymerase (New England Biolabs). The reverse transcriptase may be a WarmStart reverse transcriptase (New England Biolabs). The colorimetric indicator may be phenol red. The primers and / or one or more of the additional reagents of the kit may be dried as described herein. The primers and the one or more additional reagents of the kit may be combined as a reagent mix, for example, in or on a same solid support, such as a reaction tube. The kit may comprise a vacuum-dried reagent mix. The primers and / or the one or more additional reagents of the kit may be provided in any suitable amount such that, when reconstituted, the appropriate reagent concentration is achieved. According to the invention, the kit is for detecting Chlamydia trachomatis in a sample or for diagnosing Chlamydia trachomatis infection in a subject. Diagnostic devices The invention provides an in vitro diagnostic device for diagnosing Chlamydia trachomatis infection in a subject. The in vitro diagnostic device may also detect Neisseria gonorrhoeae infection in a subject. The in vitro diagnostic device comprises the set of oligonucleotide primers or the kit as described herein. The device typically comprises the following elements: a solid support, such as a chip (to receive the sample); a heating element / heating means (to heat the sample to suitable temperatures, as describes elsewhere herein); a reading element / signal detection means (to read reaction / product signal, e.g. fluorescent or colorimetric signals), and / or a test array (comprising the oligonucleotide primers). Alternatively, the device may be designed for use with an external heating means (heating element omitted) and / or external reading device / signal detecting means (reading device / signal detecting means omitted). The oligonucleotide primers are typically attached to the support. The attachment means permits appropriate reaction with the sample and reagents. In some embodiments, the chip may be configured to distribute a single sample into different chambers for testing various pathogens, i.e. where different sets of oligonucleotides are associated with the different chambers. In some embodiments, the device may have the features of a lateral flow assay, as described elsewhere herein. Reaction conditions The amplification reactions may be incubated for any suitable length of time. A typical reaction incubation may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 minutes, for example between about 5 minutes and 16 hours or more, between about 15 minutes and 1 or 3 hours, between about 20 minutes and 1 hour or 2 hours, or between about 30 minutes and 1 hour. Typically, the reaction incubation is about 30 minutes. The incubation may be performed until a desired degree of amplification is achieved. Typically, the desired degree of amplification is at least 10-fold, 100-fold, 1000-fold, 10,000- fold, 100,000-fold or 1,000,000-fold amplification or more. LAMP has been reported to achieve DNA amplification up to 109or more copies of the target sequence or 500 µg / ml or more DNA yield. An optimal time can be selected by the skilled person using methods known in the art and may in some cases be dependent on the method of detection used, as described further below, or the purpose of the amplification. An optimal time will often be one that maximises sensitivity for detecting the presence of a target template RNA or DNA in a test sample, whilst minimising false positives, for example due to non-specific or off-target amplification or cross- contamination of samples. The reaction is typically conducted at a constant temperature, for example + / - 5°C, + / - 4°C + / - 3°C, + / - 2°C, + / - 1°C, or + / - 0.5°C. The temperature is selected according to the temperature range at which DNA polymerase and, where appropriate, reverse transcriptase, are active. The skilled person can readily select a suitable temperature according to the specific enzymes being used. The reactions may be performed at between 20°C and 80°C, between 50°C and 75°C between 55°C and 70°C, such as between 60°C and 65°C. Typically, the reaction is performed at about 65°C. Detection of reaction products The products at the end of a LAMP or RT-LAMP reaction are a mixture of DNA concatemers (amplicons) corresponding to the target polynucleotide region. The DNA concatemers are formed from multiple consecutive stem-loops formed by annealing between alternately inverted repeats of the target sequence in the same strand with loops in between. The LAMP amplification products may be detected by any suitable method known in the art, including direct or indirect methods of detecting DNA amplification (and hence the presence of the target nucleic acid sequence) as described herein. A method that gives a read-out visible to the naked eye may be particularly advantageous, as it minimises the equipment required to perform the methods described herein and facilitates use in the field. Detection may be performed by separating the products by electrophoresis, for example on an agarose or PAGE gel. This gives rise to a characteristic “ladder” or banding pattern due to the different sized DNA concatemers. Detection may be by staining of the products, for example with ethidium bromide or other intercalating dye, or by Southern blot hybridisation with appropriate probes. In some cases, it may be beneficial to use a detection method that allows for real-time detection as the reaction proceeds, or for detection immediately after the reaction is completed with minimal additional steps, and / or requiring minimal specialist equipment or materials. Some methods permit analysis using the naked eye. LAMP is a very efficient method of DNA amplification and produces large yields of amplified DNA. Hence, DNA amplification may be determined by observing or measuring white precipitates or the turbidity of white precipitates caused by magnesium pyrophosphate precipitate in solution as a byproduct of amplification in the reaction solution. Alternatively, the turbidity may be measured using photometry / photometric detection approaches. Pyrophosphate ions strongly bind to metal ions and form insoluble salts. Therefore, an alternative method for detecting the magnesium pyrophosphate is by adding a metal ion, such as manganese, and a metal indicator, e.g. a fluorescent metal detector, such as calcein. Colorimetric pH indicator may be used as an indirect indication of the polymerase amplification of the target nucleic acid sequence. Phenol red, for example, will change colour from pink to yellow as a result of DNA amplification in an (RT-)LAMP reaction. The change of colour may be determined by simple observation. Alternatively, the absorbance at one or two different wavelengths may be measured, and optionally the ratio between them may be determined. The wavelength(s) may be chosen to distinguish between the sample colour obtained, for example using control positive and negative samples. Indirect determination of DNA amplification using a pH indicator may not be suitable in some cases, for example when comparing samples that might have different pH for reasons other than DNA amplification, or if using buffers that interfere with monitoring the DNA amplification. This effect may be minimised by using DNase- and / or RNase-free water instead of, or with minimal, buffer where possible. Direct observation measurement of DNA amplification may be achieved using fluorescence. Intercalating / DNA chelating dyes, such as SYTO9, SYBR green 1, EvaGreen, calcein, hydroxynapthol blue or Qubit BR DNA dye may be used to create a visible color change that can be seen with the naked eye or, where appropriate, under UV light / exposure, or may be measured more accurately using a fluorometer. Typically, SYTO9 is used. The fluorescent emission / intensity of a dye that intercalates with or directly labels DNA can be correlated with the number of copies initially present. Hence, this method of detection can also be quantitative. A fluorescent probe or label may be used. For example, one or more of the primers that is incorporated into the DNA product (i.e., the FIP, BIP, LF primer and LB primer) may be conjugated or 5’-end-conjugated with a fluorophore, such as 6-Carboxyfluorescein (FAM). A fluorescent label and a colorimetric indicator as described above may also be combined for increased flexibility and use in different situations. A dark quencher may be included in the reaction to reduce background fluorescence and / or increase sensitivity, as further described herein. Another method for visual detection of LAMP amplicons by the unaided eye uses sequence specific complementary gold-bound ssDNA (AuNP). Hybridisation of the AuNP to the amplified DNA products of (RT-)LAMP salt-induced aggregation of the gold particles and inhibits the normal red to purple-blue color change, thus providing an alternative colorimetric indicator for successful DNA amplification / detection. The method may involve, for example, removing a fraction of the reaction, isolating the unincorporated fraction, and detecting the unincorporated primer. This may be achieved using the large difference in the small size of an unincorporated primer and the much larger size of the amplified product. The isolation of the unincorporated primer may be performed rapidly using size exclusion chromatography such as, for example, a spin column. If a primer is labelled, a monitor procedure comprising a spin column and a measurement. For example, fluorescence or radioactivity can be performed in less than one minute. Another method for separating elongated primers involves the use of immobilised oligonucleotides. For example, oligonucleotides homologous to sequences found uniquely within the amplified DNA sequence can be used to capture nucleic acids produced by primer elongation specifically. These capturing oligonucleotides can be immobilised on a chip, or other substrate. Capture of the elongated oligonucleotides by the capturing oligonucleotides can be performed by RecA protein mediated methods, or by traditional solution hybridisations if necessary. Detection of amplification products may also be performed using a lateral flow assay. In particular, amplification products of LAMP using labelled primers can be visualised on a lateral flow strip. For example, fluorescein (FAM) and biotin groups may be linked to the FIP and BIP primers, respectively, such that after LAMP, the amplification products are dual-labelled with both FAM and biotin. When the amplification products are added to the lateral flow strip along with, for example, phosphate buffer, the FAM-labelled portion of the amplification products would bind to anti-FITC antibodies conjugated with gold nanoparticles (Au-NP) that are previously adsorbed on the lateral flow strip. Capillary action drives the Au-NP-labelled amplification products across the lateral flow strip until they are captured by streptavidin at the test line via biotin-streptavidin interaction. The results can be visually interpreted without the need for specialised equipment. Methods of detecting amplification products of LAMP using lateral flow assays are known to the skilled person. The lateral flow assay may also be an aptamer-based lateral flow assay. An aptamer- based lateral flow strip may visualise the amplification products of LAMP that use unlabelled primers. In this case, when the amplification products are added to the aptamer-based lateral flow strip, the amplification products would bind to aptamers specific to the amplification products. Binding may be shown by a colour indicator. Aptamer-based lateral flow assays are known to the skilled person. Methods of the invention Method of LAMP or RT-LAMP The invention provides a method of loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT-LAMP), wherein the method comprises: (a) mixing the set of primers described herein with template DNA or RNA (or a sample suspected of comprising a target template DNA or RNA), deoxyribonucleotide triphosphates (dNTP), a DNA polymerase, and optionally a reverse transcriptase in solution; and (b) heating the mixture to the working temperature of the DNA polymerase. Provided that the target template DNA or RNA is in fact present, then the method results in amplification of the target DNA, or cDNA corresponding to the target RNA, as described herein. Accordingly, the method is for amplifying DNA. If the initial template nucleic acid is RNA, or if the method is for detecting / determining the presence or absence of an RNA, then a reverse transcriptase is also included. The method then further comprises reverse transcription of the template RNA to produce cDNA. The cDNA subsequently provides the initial template for DNA amplification by the DNA polymerase. The method may also include a DNA purification step between the reverse transcription and cDNA amplification steps, but this step may be omitted. In many cases, the DNA polymerase and the reverse transcriptase will be selected to be active in a similar temperature range. This has the advantage that the whole reaction can be conducted isothermally, essentially at a single temperature. However, in cases where the active temperate range, or the optimal temperature, for activity of the reverse transcriptase is different to the active temperate range, or the optimal temperature for activity of the DNA polymerase, then the reaction may be incubated at a first temperature for reverse transcription of template RNA to generate cDNA, and then at a second temperature for DNA amplification using the cDNA as initial template. The duration of incubation at the first temperature may be at least or about 10, 20, 30 seconds or 45 seconds, or at least or about 1, 2, 3, 4, 5, 7 or 10 minutes, for example between 10 or 20 seconds and, 1, 5 or 10 minutes. The duration of incubation at the second temperature may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 minutes, for example between about 5 minutes and 1 hour, between about 15 minutes and 1 hour, between about 20 minutes and 1 hour, or between about 30 minutes and 1 hour. The duration of incubation at the second temperature is typically about 30 minutes or under 1 hour. Longer incubation periods at the second temperature, e.g. above 1 hour, are more prone to false-positive results. The first and second temperatures will be determined by the working temperatures and / or optimal temperatures for the reverse transcriptase and DNA polymerase, respectively. Before the reaction is started, all samples are typically kept on ice. The method may be capable of detecting less than 100, or less than 80 or less than 50, or less than 40, less than 30, or less than 20 copies of the target bacterial RNA, for example an RNA transcript of the porA pseudogene of GC or the ftsk gene of CT. If the DNA or RNA is present in the sample, then the target DNA, or the cDNA corresponding to the target RNA, is amplified. Amplification of the target DNA or cDNA may be detected to confirm the presence of the target DNA or RNA in a sample used to provide the initial template DNA or RNA for the reaction. Conversely, if the reaction does not result in the amplification of DNA, this can indicate the absence of the target DNA or RNA in a sample used as initial template for the reaction. In some cases, false positives can result from sample (cross-) contamination of non-specific or off-target amplification, although this is reduced using the present invention as described herein. The occurrence of false positives can also be reduced by additional methods, such as calibrating the length of the incubation / reaction and / or minimising sample handling. The presence or absence of the target DNA or RNA in the sample may be determined by the detection of a pre-determined threshold quantity, or indication thereof as discussed herein, of amplification. For example, a positive sample could be defined as having values at least 2x, or at least 3x, 4x, 5x, 7x or 10x the standard deviation of a negative control, and / or a negative control could be defined as having less than 2x, or less than 3x, 4x, 5x, 7x or 10x the quantity as a negative control. Detection of DNA amplification below the threshold may be the result of contamination or off-target / non-specific amplification, and so may in suitable cases be determined as a negative result or inconclusive. The method may further comprise detecting the presence of the target DNA or RNA in the sample. Any suitable detection method described herein or otherwise known in the art may be used. The method may comprise a detecting step, but if amplification is not detected or is detected below a pre-determined threshold as described above, then a negative result (i.e. the absence of the target DNA or RNA in the sample intended to provide the template) may be determined. Method of detecting the presence or absence of Chlamydia trachomatis The invention also provides a method for detecting the presence or absence of a DNA or RNA associated with a particular pathogen. In particular, the invention provides a method of detecting the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample using the set of oligonucleotide primers described herein or the kit described herein, wherein the method comprises: (a) performing loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT- LAMP) using the set of oligonucleotide primers or the kit to amplify Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample, thereby providing, in the presence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, an amplification product; (b) detecting the presence or absence of the amplification product; and (c) determining the presence or absence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample, wherein the presence of the amplification product indicates the presence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample and absence of the amplification product indicates the absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample. Typically, the target DNA (or DNA from which the target RNA is derived) is comprised in the genome of the pathogen (i.e. Neisseria gonorrhoeae or Chlamydia trachomatis). If the target DNA or RNA is determined to be present (optionally above a pre-determined threshold as described above), then the sample is identified as comprising Neisseria gonorrhoeae and / or Chlamydia trachomatis, and if the target DNA or RNA is determined to be absent (optionally below a pre-determined threshold as described above), then the sample is identified as not comprising Neisseria gonorrhoeae and / or Chlamydia trachomatis. Where primers that target Neisseria gonorrhoeae nucleic acid (e.g. the nucleic acid sequences of SEQ ID NOs: 1 to 4, and optionally the nucleic acid sequences of SEQ ID NO: 5 and 6) and primers that target Chlamydia trachomatis nucleic acid (e.g. the nucleic acid sequences of SEQ ID NOs: 15 to 18, and optionally the nucleic acid sequences of SEQ ID NOs: 19 and 20) are used together in the method, the sample may be identified as comprising both Neisseria gonorrhoeae and Chlamydia trachomatis. The method detects the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample. Any suitable biological sample may be used. The sample may be one in which the target DNA or RNA is present. The sample may be a sample obtained from a subject. For instance, the sample may be an ex vivo sample. Thus, the method maybe performed ex vivo or in vitro. The sample may be a clinical sample or research sample obtained from a subject. The subject may be any subject capable of harbouring Neisseria gonorrhoeae and / or Chlamydia trachomatis. For example, the subject may be a human or a non-human animal. The non-human animal is typically a mammal. The non-human mammal may, for example, be a chimpanzee, mouse, pig, pigeon and Eurasian coot. The sample may be a body fluid sample. The sample may be from a body fluid sample. The body fluid sample may comprise a urine, saliva, sputum, blood, semen, vaginal fluid and / or cerebrospinal fluid sample. The sample may be a tissue sample. The sample may be from a tissue sample. The tissue sample may be taken from the site at which the presence of Neisseria gonorrhoeae and / or Chlamydia trachomatis is suspected. The tissue sample may be a tissue swab or a biopsy. The tissue swab may comprise vaginal, cervical, vaginocervical, rectal, anorectal, throat, pharyngeal, urethral and / or lesion swab. A sample that is “from” a particular type of sample may refer to a sample that has been processed in some way after collection and prior to step (a) of the method. Any sample may be processed prior to being used in the LAMP reaction. In the case of tissue samples, processing may comprise maceration of the tissue sample and / or suspension of tissue particles in a suitable fluid, such as saline. In the case of body fluid samples, tissue samples and environmental samples, processing may comprise pre-treating an unprocessed sample. Pre-treating the sample may comprise at least partially purifying and / or concentrating the Neisseria gonorrhoeae and / or Chlamydia trachomatis cells or nucleic acid, if present in the sample. The sample may comprise eukaryotic cells, such as epithelial cells. As Neisseria gonorrhoeae are facultatively intracellular and Chlamydia trachomatis are obligately intracellular, the eukaryotic cells may be infected by Neisseria gonorrhoeae and / or Chlamydia trachomatis. In such cases, pre-treating the sample may comprise lysing the eukaryotic cells in the sample such that the Neisseria gonorrhoeae and / or Chlamydia trachomatis are released. Methods of lysing eukaryotic cells are known in the art. For example, the eukaryotic cells may be lysed by contacting the sample with H2O (e.g., ddH2O), a composition comprising guanidinium thiocyanate, a composition comprising saponin, a composition comprising sodium cholate and / or phosphate buffered saline (PBS). The sample may be contacted ddH2O at a 1:1 ratio. In some embodiments, pre-treating the sample comprises centrifuging the sample, such that the target DNA or RNA may be partially purified and concentrated prior to use as the template for the LAMP reaction. In this case, centrifugation may be carried out according to any suitable method known in the art. For example, centrifugation may comprise centrifuging the sample for at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 minutes. The sample may be centrifuged under at least 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000 or 15,000×g. After centrifugation, the supernatant may be discarded and the pellet may be centrifuged again. Typically, the sample may be centrifuged for 5 minutes at 10,000×g, the supernatant may be discarded and the pellet may be centrifuged again for 5 minutes at 10,000×g. The sample may be centrifuged in accordance with the Examples. In some embodiments, pre-treating the sample comprises extracting the target DNA or RNA, such that the extracted DNA or RNA may be used as the template for the LAMP reaction. The target nucleic acid may be extracted from the sample after lysing the sample as described herein. The nucleic acid may be extracted using any suitable method known in the art. Typically, the nucleic acid is extracted using a QIAamp DNA Mini Kit (Qiagen, 51304) in accordance with the Examples. PoC applicability is enhanced by using pre-treatment methods that are simple, affordable and rapid. Thus, the nucleic acid may alternatively be extracted using a cellulose-based dipstick (i.e. a dipstick comprising cellulose) in a cellulose-based dipstick DNA extraction method. The cellulose-based dipstick DNA extraction method is an equipment-free, affordable and ultra-rapid method for DNA extraction. The cellulose-based dipstick DNA extraction method involves the use of a cellulose-based dipstick, that is, a dipstick comprising a cellulose membrane. The dipstick may comprise a handle, optionally wherein the handle is water-repellant. The water- repellant handle may comprise wax, such as a paraffin wax coating on the cellulose membrane. The cellulose membrane comprises a nucleic acid-binding zone, such as a zone of the cellulose membrane which is uncoated with wax, such that the zone is capable of binding nucleic acid in a sample. The dipstick may allow the capture, purification and release of nucleic acid to be performed in less than 30 seconds by sequentially dipping the dipstick into a sample, a wash solution, and a LAMP reaction solution or an elution buffer solution. In particular, the dipstick may be dipped into a sample, such a sample which has been lysed as described herein, such that the nucleic acid-binding zone, in particular the cellulose membrane, of the dipstick binds and captures nucleic acid from the sample. The dipstick may be dipped into the sample at least once, twice, three times, four times, five times, six times, seven times, eight times, nine times, or ten times. The dipstick may subsequently be dipped into a wash solution such that the captured nucleic acid is retained but impurities (e.g. molecules smaller than the nucleic acid) are released into the wash solution. The dipstick may be dipped into the wash solution at least once, twice, three times, four times, five times, six times, seven times, eight times, nine times, or ten times. Suitable wash solutions are known in the art. A suitable wash solution may be a wash buffer. A list of recommended wash buffers for different specimens is provided in Mason, M. G. & Botella, J. R. Rapid (30-second), equipment-free purification of nucleic acids using easy-to-make dipsticks. Nat. Protoc.15, 3663–3677 (2020). For example, the dipstick may be dipped into a wash buffer comprising 10 mM Tris-HCl (pH 8.0). The dipstick may subsequently be dipped into a LAMP reaction solution such that the captured nucleic acid is released into the LAMP reaction solution. The dipstick may be dipped into the LAMP reaction solution at least once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, thirteen times, fourteen times, fifteen times, sixteen times, seventeen times, eighteen times, nineteen times, or twenty times. In some cases, instead of dipping the dipstick into a LAMP reaction solution, the nucleic acid bound to the nucleic acid-binding zone of the dipstick may be eluted, for example by dipping the dipstick in an elution buffer solution. The dipstick may be dipped into the elution buffer solution at least once, twice, three times, four times, five times, six times, seven times, eight times, nine times or ten times. After dipping the dipstick in the elution buffer solution, the elution buffer solution may be added to the LAMP reaction solution, thereby adding the nucleic acid eluted from the dipstick into the LAMP reaction solution. The elution buffer solution may be any elution buffer solution which allows nucleic acid bound to the nucleic acid-binding zone of the dipstick to be released. Suitable elution buffer solutions are known in the art. The elution buffer solution may be a dNTP solution, which may comprise the same concentration of dNTP as the LAMP reaction solution. The elution buffer solution may be a solution comprising hydrogen phosphate, optionally a solution comprising about 7 mM of hydrogen phosphate. For example, the elution buffer solution may be K2HPO4, optionally wherein the concentration of K2HPO4is about 14 mM. By eluting the nucleic acid from the nucleic-acid binding zone of the dipstick, the elution buffer solution comprising the eluted nucleic acid may be frozen for long-term storage and analysed using LAMP at a later date. The elution buffer solution comprising the eluted nucleic acid may also be used for multi-pathogen detection using a single dipstick. In some embodiments, pre-treating the sample comprises heat-inactivating the sample. In this case, heat-inactivation can be carried out according to any suitable method known in the art. For example, the sample may be heat-inactivated at 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C. The sample may be heat-inactivated for at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 minutes. Typically, the sample is heat-inactivated at 95°C for 5 minutes in accordance with the Examples. As demonstrated in the Examples, certain pre-treatment methods can improve the sensitivity of LAMP assays carried out on different clinical sample types. Sample pre-treatment may also not be necessary in some cases. Thus, in some embodiments, if the sample is urine or vaginocervical swab, pre-treating the sample comprises centrifuging the sample. In some embodiments, if the sample is urine, vaginocervical swab, rectal swab or throat swab, pre- treating the sample comprises extracting the Neisseria gonorrhoeae and / or Chlamydia trachomatis nucleic acid. In some embodiments, if the sample is vaginocervical swab, pre- treating the sample comprises heat-inactivating the sample. If the sample is vaginocervical swab, the method may not comprise pre-treating the sample. The method of detecting Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, may comprise the use of any sets of primers described herein, any kit described herein and / or any reagent described herein. The amplification product may also be detected using any method described herein. Detection of the presence of the amplification product may indicate one or more characteristics of Neisseria gonorrhoeae and / or Chlamydia trachomatis present in a sample. Such characteristics may include strain, lineage and / or virulence of the Neisseria gonorrhoeae and / or Chlamydia trachomatis. Whether or not such characteristics are indicated by presence of the amplification product will determined by the choice of primers used for isothermal amplification. Primers leading to amplification of a strain- or lineage-specific nucleic acid sequence will allow the presence of the amplification product to indicate the strain or lineage of Neisseria gonorrhoeae and / or Chlamydia trachomatis present in the sample. Primers leading to amplification of a nucleic acid sequence providing a marker of virulence (e.g. the cds region of the cryptic plasmid in Chlamydia trachomatis) will allow the presence of the amplification product to indicate virulence of the Chlamydia trachomatis present in the sample compared with plasmid-free Chlamydia trachomatis. Method of diagnosing Chlamydia trachomatis infection The method described herein for detecting the presence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample may be used to diagnose the presence or absence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject. Thus, the invention also provides a method of diagnosing the presence or absence of Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject, comprising detecting the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample obtained from the subject using the method of detecting the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, described herein, wherein the presence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample indicates the presence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in the subject and the absence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample indicates the absence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in the subject. That is, the invention provides a method of diagnosing the presence or absence of Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject, comprising detecting the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample obtained from the subject, wherein the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample is detected by: (a) performing loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT-LAMP) using the set of oligonucleotide primers described herein or the kit described herein to amplify Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample, thereby providing, in the presence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, an amplification product; (b) detecting the presence or absence of the amplification product; and (c) determining the presence or absence of Chlamydia trachomatis nucleic acid, and optionally Neisseria gonorrhoeae nucleic acid, in the sample, wherein the presence of the amplification product indicates the presence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample and absence of the amplification product indicates the absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample; and wherein the presence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample indicates the presence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in the subject and the absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in the sample indicates the absence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in the subject. Typically, the target DNA (or DNA from which the target RNA is derived) is comprised in the genome of the pathogen (i.e. Neisseria gonorrhoeae or Chlamydia trachomatis). If the target DNA or RNA is determined to be present (optionally above a pre-determined threshold as described above), then the subject is identified as having a Neisseria gonorrhoeae and / or Chlamydia trachomatis infection, and if the target DNA or RNA is determined to be absent (optionally below a pre-determined threshold as described above), then the subject is identified as not having a Neisseria gonorrhoeae and / or Chlamydia trachomatis infection. Where primers that target Neisseria gonorrhoeae nucleic acid (e.g. primers comprising the nucleic acid sequences of SEQ ID NOs: 1 to 4, and optionally primers comprising the nucleic acid sequences of SEQ ID NO: 5 and 6) and primers that target Chlamydia trachomatis nucleic acid (e.g. primers comprising the nucleic acid sequences of SEQ ID NOs: 15 to 18, and optionally primers comprising the nucleic acid sequences of SEQ ID NOs: 19 and 20) are used together in the method, Neisseria gonorrhoeae and Chlamydia trachomatis co-infection in the subject may be identified. Any of the features described above in connection with the method for detecting the presence or absence of Chlamydia trachomatis, and optionally Neisseria gonorrhoeae, in a sample may also apply to the method for diagnosing the presence or absence of Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject. The Neisseria gonorrhoeae and Chlamydia trachomatis infection may cause, or be suspected of causing, a disease or condition in the subject. The disease or condition may be any disease or condition in which Neisseria gonorrhoeae or Chlamydia trachomatis contribute to the aetiopathogenesis. Numerous such diseases are known in the art. For example, in humans, Neisseria gonorrhoeae are implicated in tenosynovitis, dermatitis, polyarthralgia, pelvic inflammatory disease, ectopic pregnancy, infertility, chronic pelvic pain, seronegative arthropathy, neonatal conjunctivitis, neonatal visual deficit, neonatal pneumonia, neurological diseases, cardiovascular diseases, scrotal swelling and urethral stricture. In humans, Chlamydia trachomatis are implicated in pelvic inflammatory disease, infertility, neonatal conjunctivitis, neonatal visual deficit, neonatal pneumonia, cervicitis, urethritis, epididymitis, prostatitis, proctitis, lymphogranuloma venereum. The subject may have, or be suspected of having, any of these diseases or conditions. Thus, the method for diagnosing the presence or absence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject may be a method for diagnosing tenosynovitis, dermatitis, polyarthralgia, pelvic inflammatory disease, ectopic pregnancy, infertility, chronic pelvic pain, seronegative arthropathy, neonatal conjunctivitis, neonatal visual deficit, neonatal pneumonia, neurological diseases, cardiovascular diseases, scrotal swelling and urethral stricture, cervicitis, urethritis, epididymitis, prostatitis, proctitis and / or lymphogranuloma venereum. If the subject is identified as having a Neisseria gonorrhoeae and / or Chlamydia trachomatis infection, the method may further comprise implementing any appropriate action, such as selecting and / or administrating a suitable treatment to the subject for the infection. The treatment may be a prophylactic or therapeutic treatment. Such treatments for Neisseria gonorrhoeae and Chlamydia trachomatis infection are known in the art. The treatment of Neisseria gonorrhoeae infection may, for example, comprise an antibiotic, such as azithromycin, ceftriaxone, cefixime, ciprofloxacin and / or gentamycin. The treatment of Chlamydia trachomatis infection may, for example, comprise an antibiotic, such as amoxicillin, azithromycin, doxycycline, erythromycin, ofloxacin and / or levofloxacin. If the method indicates the presence of infection in an animal subject, the subject may be isolated or culled, for instance as part of a programme for controlling the spread of the infection. It is known that Neisseria gonorrhoeae and Chlamydia trachomatis infection can be present in a subject in the absence of clinical signs. That is, Neisseria gonorrhoeae and / or Chlamydia trachomatis infection may be present without causing active disease. Neisseria gonorrhoeae or Chlamydia trachomatis infection may, for instance, be a sub-clinical infection. The method for diagnosing the presence or absence of a Neisseria gonorrhoeae and / or Chlamydia trachomatis infection in a subject may be used to diagnose the presence or absence of a Neisseria gonorrhoeae and / or Chlamydia trachomatis infection in the absence of clinical disease. Subjects determined to have Neisseria gonorrhoeae and / or Chlamydia trachomatis infection in the absence of clinical disease may be treated pre-emptively to guard against the onset of clinical disease and / or monitored for the onset of clinical signs. Implementation of early treatment in this way may improve the outcome of infection. The method for diagnosing the presence or absence of a Chlamydia trachomatis infection, and optionally Neisseria gonorrhoeae infection, in a subject may be used to monitor the course of the infection in the subject. For instance, the method may be used to monitor the response of the infection to treatment, for example by repeating the method before and after treatment. Additional Definitions As used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a primer” includes two or more such entities (primers). The term "and / or" as used in this application includes any and all combinations of one or more related listed items. The term “comprising” (means including but not limited to) specifically discloses / includes equivalent embodiments “consisting of” (means limited to). The term “consisting essentially of” should be understood to mean that the sequence comprises no additional sequence units or elements that materially affect the function of the sequence element. Numeric ranges are inclusive of the numbers defining the range. Thus, every numerical range disclosed herein is intended to encompass every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein. It is also intended that every maximum (or minimum) numerical limitation disclosed herein includes every lower (or higher) numerical limitation, as if such lower (or higher) numerical limitations were expressly written herein. The term "about" as used herein means in quantitative terms plus or minus 5%, or in another embodiment plus or minus 10%, or in another embodiment plus or minus 15%, or in another embodiment plus or minus 20%. For the purpose of this invention, in order to determine the percent identity or similarity of two sequences (such as two nucleic acid sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in a first sequence for optimal alignment with a second sequence). The residues at each position are then compared. When a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, then the amino acids are identical at that position. The percent identity or similarity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions in the reference sequence x 100. Typically, the sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence has a certain percentage identity to SEQ ID NO: X, SEQ ID NO: X would be the reference sequence. For example, to assess whether a sequence is at least 80% identical to SEQ ID NO: X (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: X, and identify how many positions in the test sequence were identical to those of SEQ ID NO: X. If at least 80% of the positions are identical, the test sequence is at least 80% identical to SEQ ID NO: X. If the sequence is shorter than the reference sequence, the gaps or missing positions should be considered to be non-identical positions. The skilled person is aware of different computer programmes that are available to determine the homology or identity between two sequences using a mathematical algorithm. The percent identity between two amino acid or nucleic acid sequences may be determined using the Needleman and Wunsch (1970) algorithm, which has been incorporated into the GAP programme in the Accelrys GCG software package, using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. Other examples of suitable programmes are the BESTFIT programme provided by the UWGCG Package (for example used on its default settings) and the PILEUP and BLAST algorithms c (for example used on its default settings). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by those skilled in the technical field of this application. The terminology used in the description of this application is only for the purpose of describing specific embodiments, and is not used to limit this application. The experimental methods without specific conditions in the following examples generally follow conventional conditions or the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products. Examples The following Examples are provided to illustrate the invention but are not intended to limit the invention. Example 1 – Optimisation of primer design without false positives Primer design for GC The porA pseudogene was selected as the primer target because the porA pseudogene is highly conserved across a diverse range of Neisseria gonorrhoeae strains but is absent in commensal Neisseria strains and other bacteria. The phylogenetic and experimental analysis of gonococcal strains from various geographic locations confirmed that porA pseudogene is a unique reliable biomarker for GC detection, which can avoid false-positive results attributed to cross-reactions with similar genes in commensal strains. Two sets of LAMP primers targeting porA pseudogene were designed. The primer sequences are set out in Table 1. Table 1. DNA sequence of newly designed LAMP primers targeting porA pseudogene. The spacer region is underlined. The F1c and B1c sequences are shown in italics. Primer Sequence (5’-3’) SEQ ID NO Neisseria gonorrhea - porA pseudogene (porA_2 primer set) FIP GTAACGCACGGAAACCGGCATTTTGTGGCTTCGCAATTGGGTA 1 BIP TTCCCCCGGATTTTCCGGTTTTTTTGGCGTATAGGCGGACTTG 2 F3 TTGATCCTTGGGACAGCAAT 3 B3 TTTCCAGCGTGAAAGTAGCA 4 LF TACCGTCGTGGCGTTTGAA 5 LB CAGCATTCAATTTGTTCCGAGTC 6 Neisseria gonorrhea - porA pseudogene (porA_1 primer set) FIP GCATACCGTCGTGGCGTTTGAATTTTCCAGCAAAGCCATTGATCCT 7 BIP CGATTCCCCCGGATTTTCCGGTTTTGGCGTATAGGCGGACTTG 8 F3 GCGAATCCGTTTGGCGAT 9 B3 TTTCCAGCGTGAAAGTAGCA 10 LF GCCACATTATTATTGCTGTCCCA 11 LB CAGCATTCAATTTGTTCCGAGTC 12 The amplification efficiency of the two sets of LAMP primers was experimentally verified using a synthesised DNA fragment of porA pseudogene. The time point at which the fluorescent signal surpassed the threshold was denoted as the Time to Threshold (TT) values. The TT value is inversely proportional to the template concentration and can be used as criterion for assessing the binding efficiency of different primer sets (Figure 1a). The porA_2 primer set, showing a faster response time, was used in subsequent LAMP assays. Analysis of the sensitivity of the porA_2 primer set showed that the set was capable of detecting 36 DNA copies per reaction within 20 minutes. However, only one out of three replicates was detected at this concentration. All three replicates of 72 copies per reaction yielded positive detection results (Figure 1b). Analysing a GC clinical isolate further confirmed the suitability of the porA_2 primer set for subsequent clinical studies (Figure 2). Primer design for CT The ompA gene (encoding membrane protein A) is a standard gene which has been targeted for CT NAAT detection in molecular laboratories and commercial tests (Adamson et al., 2022). The CT ompA gene is, however, a highly polymorphic gene among 19 known CT serological variants (serovars: A–K, and Ba, Da, Ia, Ja, L1, L2, L2a and L3). Some studies have designed degenerate LAMP primers to cover all CT serovars (Choopara et al., 2017; Somboonna et al., 2018; Chen et al., 2022). However, degenerate primers can reduce the efficiency of amplification, particularly for assays such as LAMP, which can consist of six primers targeting eight separate regions. Therefore, for primary selection, the ftsk gene, which is a single-copy chromosomal gene encoding the FtsK protein, was additionally selected as a target. BLASTing the CT ftsk gene with NCBI GenBank confirmed high specificity in a wide spectrum of CT isolates and low polymorphism region. One primer set targeting the ompA gene and two sets of primers targeting the ftsk gene were designed. The primer sequences are set out in Table 2. Degenerate ompA primers designed by Somboonna et al. (2018) were also tested. Table 2. DNA sequence of newly designed LAMP primers targeting ftsk gene and ompA gene. The spacer region is underlined. The F1c and B1c sequences are shown in italics. Primer Sequence (5’-3’) SEQ ID NO Chlamydia trachomatis - ftsk gene (ftsk_1 primer set) FIP TGTTCGAGAAATGGAACTACGTTATTTTTCGAGTTCGAGAATTAAAGGA 15 TT BIP CAAATTAAAGCGCTATGGGCTTCTTTTTTAACAGGATACTCGCAACT 16 F3 GAAGCTTCGATATCCACATTG 17 B3 AGACATAAAACTCGTAATCGTG 18 LF TCTTCGATTTTTAGGGCTACGAAAC 19 LB AGATTCTGTGATAACAGGAGTTAGC 20 Chlamydia trachomatis - ftsk gene (ftsk_2 primer set) GGAAAAAAGCTAATGGCGATAACTTTTTTCCTGCAATAATTAAATGGGG 21 FIP C BIP GAAGAGGAACTTGGAGTCGTTGTTTTTCAATCCAGATCCTCAGCC 22 F3 TCGTGTTAATGCAGACAGAT 23 B3 GCGGTAGGAATTGAAATCC 24 LF TTGGACAGATTTGGCAACCAT 25 LB GGTAATCTTCTAATAAATCTCG 26 Chlamydia trachomatis - ompA gene AGGGAGTGAACATATTCAGTCTGTATTTTGGATGCCTCTATTGATTACC 27 FIP A BIP TGATGCCGATACGATTCGTATAGCTTTTGTTGGGTTAAGCGTGGTA 28 F3 GAACAGATGCTGCGACAG29B3 CAGTTTTCACATCGCCAG 30 LF GAGAGCTAAACTTGCTTGCCATTC 31 LB CCAGCCAAAATCAGCTACAGC 32 The amplification efficiency of the primers on a confirmed CT-positive clinical sample was compared. Primers targeting gene showed the best performance with time to threshold value (TT) of less than 12 min. The ompA primer (non-degenerate) had a TT of 22 min. The higher TT value for ompA primer compared to ftsk primer sets could be explained by the high variability of ompA gene and the longer time that primers need to anneal to their template. In comparison, the degenerate ompA primers designed by Somboonna et al. (2018) gave positive results only after 54 min. Therefore, ftsk primers, having the best clinical response time, were selected for the LAMP assay (Figure 3c). The analytical performance of ftsk primer sets was evaluated by qLAMP assay (Yu et al., 2022) using a synthesised DNA fragment of the ftsk gene (Figure 3a). With the same template concentration, the ftsk_1 primer set showed a slightly lower TT value of 8.1 min, and higher sensitivity compared to the ftsk_2 primer set. As illustrated in Figure 3b, the ftsk_1 primer set was capable of detecting as few as 22 copies per reaction, with 2 out of 3 replicates yielding positive results within 20 minutes. The cryptic plasmid is an extrachromosomal DNA element and exists in multiple copies per CT cell. It is a widely used amplification target in commercial assays (Adamson and Klausner, 2022). Although chlamydial isolates, carrying cryptic plasmid, are reported to have higher virulence, pathogenic plasmid-free C. trachomatis variant have also been isolated, leading to false-negative in NAATs (Magbanua et al., 2007). To check the prevalence of plasmid-free C. trachomatis variant in the UK cohort, a primer set targeting the CDS2 region of the cryptic plasmid was additionally designed (cds primer set). The primer sequences are set out in Table 3. Table 3. DNA sequence of newly designed LAMP primers targeting the CDS2 region of the cryptic plasmid. The spacer region is underlined. The F1c and B1c sequences are shown in italics. Primer Sequence (5’-3’) SEQ ID NO Chlamydia trachomatis – cryptic plasmid FIP CGCTGTGACGGAGTACAAACTTTTCCTGTGACCTTCATTATGTCG 33 BIP GAAGCACGTGCGGGGTTATTTTTTGCACGTTCTCTCAAGCAG 34 F3 ATCATCTTTGCGGTTGCG 35 B3 AATGGTGGGGTTAAGGCA 36 LF GCCTAGGGTGCTCAGACTC 37 LB AAAGGGATTGCAGCTTGTAGTC 38 The cds primer set was selectively used only for samples that were detected as positive by the ftsk_1 primer set. The amplification efficiency of the cds primer set was found to be comparable to that of the ftsk_1 primer set, having the similar TT values for the same clinical positive sample (Figure 3c). The TT values of each of the primer sets are summarised in Table 4. Table 4. Validating the performance of newly designed primers for variant genes (ftsk, cryptic plasmid and ompA) and the ompA degenerate primers (designed by Somboonna et al., (2018)) on a pre-confirmed CT-positive sample.

[0002] Example 2 – Clinical samples and pre-treatment 208 discrete clinical specimens (120 male, 88 female) including first void urine (n=42), vaginal swabs (n=67), cervical swabs (n=4), rectal swabs (n=29), throat swabs (n=62) and unidentified swabs (n=4) were analysed. All clinical samples were previously analysed by the Becton‐Dickinson ProbeTec ET (BD) test, an FDA-approved assay based on strand- displacement isothermal amplification (SDA), with run-through automatic DNA extraction. Table 5 shows the number of GC- or CT-positive specimens (based on the results of the BD test) in females and males by specimen type. Among the female participants, the predominant sample type was vaginocervical swab (over 80%), whereas among the male participants, throat swabs (46.3%) and urine (34.7%) were the prevalent sample types (Figure 4). Table 5. The number of GC- or CT-positive specimens (based on BD ProbeTec ET test) in female (F) and male (M) by specimen type. F M CT+ GC+ CT+ CT+ GC+ GC+ in F in M in F in M Urine (n=42) 1 40 31 12 1 30 0 12 Vaginal swab (n=67) 67 0 44 12 44 0 12 0 Cervix swab (n=4) 4 0 4 0 4 0 0 0 Rectal swab (n=29) 7 22 3 22 0 3 6 16 Throat swab (n=62) 6 56 1 25 1 0 5 20 Unidentified swab (n=4) 3 1 3 2 2 1 1 1 Total (n=208) 90 118 86 73 52 34 24 49 Each sample was analysed using LAMP following three different pre-treatment steps including heating (95°C, 5 min), centrifugation and DNA extraction by a commercial kit (Figure 5). The swabs were preserved in the BD UTM (universal transport media). The addition of UTM was observed to have inhibitory effect on the LAMP reactions (Figure 6a). However, due to the necessity for sensitivity, 5 µl sample volume was added to each 20µl LAMP reaction. Moreover, centrifugation was used as a simple and rapid (~15 min) method to partially purify and concentrate the samples and exchange buffer with PBS. PBS was found not to affect LAMP reactions (25 µl), unless more than 7.5 μl was added (Figure 6b). In this study, colorimetric detection (based on pH change) was not used, as immediate colour changes were observed upon direct addition of some of the samples to the colorimetric LAMP reagent. In addition, several samples, which were identified by fluorescence reading to be GC- or CT-positive, displayed no colour change after the amplification (Figure 6c). Therefore, fluorescent readings were used for detecting LAMP results. Example 3 – Clinical evaluation of LAMP assay GC Of 208 clinical samples, 73 were classified as GC-positive by the BD test. In case of direct LAMP, where samples added to the LAMP reagents after a short heating step, only 41% of (30 / 73) of pre-confirmed GC positive samples could be detected. The low sensitivity can be caused by the inhibitory effect of impurities in the samples. All BD-negative samples were also negative in direct LAMP (Table 6). Table 6. The clinical sensitivity, specificity, and Kappa agreement of LAMP assays for detecting N. gonorrhoea in comparison with the BD ProbeTec ET assay. N. gonorrohoea Reference BD Test Total Sensitivity Specificity Kappa Results + - Direct + 30 0 30 41.1% 100% 0.48 LAMP - 43 135 178 LAMP after + 59 1 60 80.8% 99.3% 0.83 centrifugation - 14 134 148 LAMP after + 69 1 70 94.5% 99.3% 0.95 Extraction - 4 134 138 Total 73 135 208 Implementing centrifugation as a sample pre-treatment led to the detection of 81% (59 / 73) of pre-confirmed GC-positive samples including those which were detected in direct LAMP. Centrifugation significantly improved the detection rate across all sample types, with notable enhancements observed for urine specimens (100%, 12 / 12) and vaginocervical swabs (92%, 11 / 12) (Table 7). Using DNA extraction for sample pre-treatment, the LAMP sensitivity further increased from 81% (59 / 73) to 93% (68 / 73) by allowing detection of additional eleven pre-confirmed positive samples. These eleven samples (n=11) comprised six throat swabs (n=6), four rectal swabs (n=4) and one vaginal swab (n=1). All BD-negative samples were also negative in LAMP (after centrifugation or DNA extraction), except one sample, which was later found by real-time PCR to be true positive. Table 7. Comparing LAMP assays using different sample pre-treatment methods for detecting pre-confirmed (by BD test) N. gonorrhoea-positive samples. Urine Vaginocervical Rectal swab Throat swab Total (n=42) Swaba(n=71) (n=29) (n=62) BD ProbeTec 12 12 22b Et27 734 8 6 10 Direct LAMP 28 (33%) (67%) (27%) (37%) LAMP after 12 11 17 17 57 centrifugation (100%) (92%) (77%) (63%) LAMP after 12 12 21 23 67 extraction (100%) (100% (95%) (85%)aVaginocervical swabs comprise of 4 cervix swabs (all GC negative) and 56 vaginal swabs.bTwo positive samples were of unknown sample type and were excluded from this analysis. CT Within 208 clinical samples, 86 were identified as CT-positive based on the BD test. The majority of CT-positive samples were either urine (n=31) or vaginocervical swabs (n=48), with only three positive rectal swabs and one throat swab. Three different pre-treatment methods were employed for CT-LAMP. A consistent trend was observed, with direct LAMP exhibiting the lowest sensitivity (65.1%, 56 / 86) and Kappa agreement (0.67) among the three pre-treatment methods (Table 8). Vaginocervical swabs (81%, 39 / 48) were the most suited for direct detection (Table 9). Table 8. The clinical sensitivity, specificity, and Kappa agreement of LAMP assays for detecting C. trachomatis in comparison with the BD ProbeTec ET assay. C. trachomatis Total Sensitivity Specificity Kappa Reference BD Test Results + - + 56 2 58 Direct LAMP 65.1% 98.4% 0.67 - 30 120 150 LAMP after + 78 2 80 90.7% 98.4% 0.90 centrifugation - 8 120 128 LAMP after + 82 2 84 95.3% 98.4% 0.94 Extraction - 4 120 124 Total 86 122 208 Table 9. Comparing LAMP assays using different sample pre-treatment methods for detecting pre-confirmed (by BD test) C. trachomatis positive samples. Urine Vaginocervical Rectal swab Throat swab Total (n=42) Swaba(n=71) (n=29) (n=62) BD 31 48b ProbeTec Et3 1 8313 39 Direct LAMP 0 1 53 (42%) (81%) LAMP after 28 43 3 1 75 centrifugation (90%) (90%) LAMP after 28 47 3 1 79 extraction (90%) (98%)aVaginocervical swabs comprise of 4 cervix swabs (all CT positive in all LAMP assays) and 56 vaginal swabs.bTwo positive samples were non-specific swab samples and were excluded from this analysis. LAMP following centrifugation led to the detection of 91% (78 / 86) of BD-positive CT samples, including all those that were detected in direct LAMP. While the sensitivity for direct CT detection in urine was low (42%, 13 / 31), centrifugation pre-treatment has significantly increased the detection rate to 90% (28 / 31) of pre-confirmed positive urine specimens. Compared to centrifugation, DNA extraction slightly improved the sensitivity from 91% (78 / 86) to 95% (82 / 86) by detecting four extra BD-positive samples of CT vaginal swabs. All LAMP assays, irrespective of applied pre-treatment method, showed excellent clinical specificity, with 98% (120 / 122) of BD-negative samples were also LAMP-negative. Two BD-negative samples were positive in all LAMP assays with primers targeting ftsk gene and cryptic plasmid, and later confirmed by real-time PCR to be true positive. All CT-ftsk positive samples were also positive in LAMP with primers targeting cryptic plasmid. As the virulence of plasmid-carrying isolates is reported to be significantly higher compared to plasmid-free strains, the positivity of all CT samples for cryptic plasmid indicates the high infectiousness of circulating chlamydial infections in this cohort in the UK. Example 4 – Resolving discrepant samples by real-time PCR GC Compared to the BD testing results, GC-LAMP had six discrepant samples including one false-positive (FP) and five false-negative (FN) samples. The FP (a vaginal swab) was confirmed by PCR targeting the porA pseudogene (Hjelmevoll et al., 2006) to be true-positive. All three FN samples, which were positive in the BD assay but negative in LAMP, were also negative in porA-PCR (Table 10). These negative samples were additionally tested by PCR for ß-actin gene of Homo sapiens as an internal positive control, which were also negative, indicative of negligible concentration of cells and a poor sample. Table 10. Analysis of discrepant GC samples using real-time PCR assay as an alternative molecular test. Analyte No. of LAMP after LAMP Real-time BD specimens centrifugation after PCR after ProbTec ET extraction extraction GC 5 Negative Negative Negative Positive 1 Positive Positive Positive Negative CT Compared to the BD testing results, CT-LAMP had six discrepant samples including two FP and four FN samples (Table 11). The two FP samples (both throat swabs) were positive in LAMP assays targeting ftsk and cryptic plasmid. They were further found be true positive as confirmed in PCR by directing primers against two separate genes; ftsk and cryptic plasmid. All the four FN samples were also negative in both ftsk-PCR and ß-actin PCR. Table 11. Analysis of discrepant CT samples using real-time PCR assay as an alternative molecular test. Analyte No. of LAMP after LAMP Real-time BD specimens centrifugation after PCR after ProbTec ET extraction extraction CT 4 Negative Negative Negative Positive 2 Positive Positive Positive Negative Example 5 – Co-infection Of the 208 samples, BD tests confirmed GC and CT co-infection in 11 samples. Direct LAMP could detect only four of these co-infections, further identified single infection in three samples and missed four samples. LAMP after DNA extraction and centrifugation led to detection of ten and nine of these co-infections, respectively, and identified single infection in all these samples. Discussion In the present study, LAMP assays for GC and CT detection in a range of different clinical sample types were designed and evaluated. Initially, specimens were added to the LAMP reaction following a brief heating step (termed direct LAMP), which could detect only 41% (30 / 73) of pre-confirmed GC-positive samples and 65% (56 / 86) of pre-confirmed CT- positive samples. Within samples, which were confirmed by the BD ProbeTec ET assay to be either GC- or CT-positive, direct GC / CT LAMP assays detected 78% (39 / 48) of positive vaginocervical swabs, 40% (17 / 43) of positive first void urine, 39% (11 / 28) of positive rectal swabs and 24% (6 / 25) of positive throat swabs. While the clinical data suggest the feasibility of using direct LAMP for vaginocervical swabs, they also suggest that sample purification for urine specimens, throat and rectal swabs is preferable. In direct LAMP, the better sensitivity for CT detection compared to GC detection (65% vs 41%) can be attributed to the incidence of significantly more CT-positive vaginocervical swabs (48 CT vs 12 GC), rather than the performance of the designed primers and LAMP assays. While nucleic acid extraction with commercial kits allows a thorough purification process for efficient removal of inhibitors, they are tedious, time-consuming and costly. Centrifugation was therefore used for partial purification of specimens as well as increasing the pathogen load through concentration. LAMP after centrifugation had a very good agreement with the BD test with kappa values of 0.83 and 0.90 for GC and CT detection, respectively. The positive detection rates were 81% and 91% for GC and CT, respectively. The significant increase in the sensitivity of LAMP after centrifugation compared to heating, can be attributed to the (partial) removal of inhibitors as well as the higher pathogen loads as a result of concentrating specimens. After centrifugation, over 90% of pre-confirmed GC- or CT-positive urine specimens and vaginocervical swabs could be detected, while the overall positive detection rates for rectal and throat swabs were 80% (20 / 25) and 64% (18 / 24), respectively. After DNA extraction by the commercial kit, LAMP reached the positive detection rates of ≥94% and kappa values of ≥0.93 for both infections, showing surprising and excellent agreement with the BD test. The better positive detection rate after DNA extraction compared to centrifugation can be explained by the better removal of inhibitors rather than the pathogen load, as for both methods the same concentration factor was applied. While the performance of LAMP assays for GC and CT detection are comparable if using DNA extraction, the clinical sensitivity of CT-LAMP was significantly better than the GC-LAMP if using centrifugation (91% vs 81%). This discrepancy is not due to the difference in performance of designed primers but rather can be attributed to the fact that 95% of CT positive samples are either vaginocervical swabs (n=48) or urine (n=31), while only 67% of GC positive samples are either rectal (n=22) or throat swabs (n=27). Resolving the discrepant samples (after DNA extraction) by real-time PCR using published primers, showed complete agreement with LAMP. A total of 9 samples (5 GC and 4 CT) were positive in the BD assay but negative in both LAMP and PCR. These samples were also negative in PCR with primers targeting the ß-actin gene, further confirming the poor quality of these samples. The samples may have undergone degradation during storage. In addition, the difference in the efficiency of the DNA extraction method carried out and the one used in the BD assay may also cause the discrepancy. Irrespective of pre-treatment method, the LAMP assays showed very high and surprising specificity with >98% of negative GC (134 / 135) or CT (120 / 122) specimens in BD assay also being negative in LAMP. The three LAMP- positive samples (one GC and two CT) were confirmed by PCR to be true positive. As anorectal and pharyngeal swabs usually contain numerous commensal Neisseria species, the very high clinical specificity of the present LAMP assays confirms the suitability of the chosen target genes (porA pesudogene for GC and ftsk gene for CT) and the good design of primers with no primer-dimer associated false-positive results. A few other studies developed LAMP assays for detecting CT (Choopara et al., 2017; Somboonna et al.2018; Dean et al., 2021), GC (Liu et al., 2017; Chen et al., 2021) or antibiotic-resistant GC (Shimuta et al., 2019; Shimuta et al. 2022). Two studies by Xu et al. (2016) and Chen et al. (2023) further developed multiplex LAMP assays for detecting both CT and GC. These studies, however, analysed mainly vaginocervical or urethral swabs and did not validate their assays for throat swabs and urine specimens. The present inventors have, for the first time, analysed a range of different specimens including vaginocervical, rectal and throat swabs, as well as urine. As urine is the main specimen for detecting STIs in men and with the increase in the occurrence of rectal and throat infection, verifying LAMP assays on all types of specimens is essential. LAMP has a high potential to be used for the PoC diagnosis of STIs. CT and GC are particularly interesting because there is no suitable rapid antigen test available and because of the significant morbidity associated with these two infections. The bottleneck for many nucleic acid amplification assays is the need for nucleic acid extraction prior to amplification. Here, centrifugation was used, which showed efficiency and reliability for purification of different types of clinical specimens. Centrifugation serves as a low-cost, simple and rapid technique that could be readily implemented in resource-limited labs. In summary, the present inventors have developed highly sensitive and specific LAMP assays for rapid (under 30 min) diagnosis of GC and CT infection in a variety of clinical specimens. The present inventors have shown that these LAMP assays have a clinical sensitivity of 95% and 93% for GC and CT respectively and a specificity of >98%. These results are within the optimal target product profiles for sensitivity and specificity, published by WHO for GC / CT PoC tests. The results further highlight the suitability of LAMP as an affordable, accurate and rapid alternative to PCR. This approach can be harnessed to address the problem of STIs in areas of the world where the burden of disease is highest. Materials and methods LAMP primer design LAMP primers were designed as described above. For N. gonorrhoeae detection, the porA pseudogene (GenBank: AJ223448.1) was targeted. For C. trachomatis, primers against multiple genes including ompA (Locus: NC_000117.1:c780060-778879), ftsK (Locus: NC_000117.1:851469-852172) and the CSD2 region of cryptic plasmid (GenBank: CP015295.1) were designed. For each gene, LAMP primers (FIP, BIP, F3, B3, LF, LB) were designed using PrimerExplorer V5. The best primer sets were selected by checking the parameters of the primers (GC content, stability at 3´ for F3 / B3 primers, F2 / B2, LF / LB and stability at 5’ for F1c / B1c). The specificity of F3 / B3 and F2 / B2 primers was further evaluated using “Basic Local Alignment Search Tool (BLAST)” tool of NCBI against the GenBank database in “Refseq representive genomes” or “nr” in relevant organisms including bacteria (taxid:2), virus (taxid:10239), Trichomonas (taxid:5721) and Homo sapien (taxid:9606). The primers were ordered from Intergraded DNA Technologies (IDT) in salt desalted purity. LAMP reaction The LAMP stock primers (10x) consisted of the following primers: 16 µM FIP, 16 µM BIP, 2 µM F3, 2 µM B3, 4 µM LF and 4 µM LB. LAMP was performed in a final volume of 25µl including 12.5 µl NEB WarmStart LAMP Kit (2x), 2.5 µl stock primers (10x), 0.5 µl SYTO9 fluorescent dye (25 µM), 4.5 µl DNase- and RNase-free water and 5 µl of sample or positive / negative control. Water was used as the negative control and the 10 ng / µL DNA (extracted whole genome or synthetic gene fragment obtained from IDT as a positive control). The reactions were carried out in PCR strip tubes (Invitrogen) or 96-well plates (Bio-Rad) in a real-time PCR machine (BioRad) or mini-PCR machines (MEStar, UK). The reactions were carried out at 65°C for 30 min and were monitored real-time via fluorescence in FAM channel. Each sample was analysed in triplicate by LAMP. Clinical samples and pre-treatment methods 208 samples were pre-tested with the ProbeTec ET assay (Becton‐Dickinson) in the microbiology laboratory before analysis. LAMP assay, all clinical samples were subjected to three distinct pre-treatment procedures: heating at 95°C for 5 min, centrifugation and DNA extraction. Centrifugation was used as a simple method to partially purify and concentrate the specimen. To achieve this, 200 µl of specimen was centrifuged for 5 min at 10,000×g, then the supernatant was discarded and 100 µl PBS was added to the pellet, followed by a second centrifugation at 10,000×g for 5 min. The final pellet was re-suspended in 20 µl PBS and heated at 95°C for 5 min. The pellet contained the bacterial cells or human cells encapsulating the bacteria. For DNA extraction, QIAamp DNA Mini Kit (Qiagen, 51304) was used following the supplier protocol, and the samples were eluted in the nuclease free water with the concentration factor of 10 (similar to the concentration factor used in centrifugation method). 5 µl of the sample after heating, centrifugation or extraction, per LAMP reaction, was used. Real-time PCR for discrepant samples After DNA extraction using QIAamp DNA mini kit, discrepant samples were analysed by real-time PCR assay using published primers. For GC, PCR primers targeting porA pseudogene designed by Hjelmevoll et al (2006) were selected. For CT, primers against ftsk gene designed by Eszik et al. (2019) and primers designed by Venter et al. (2019) targeting the cryptic plasmid were selected. The sequences of the PCR primers are listed in Tables 12 and 13. Blasting these primers showed high specificity. Moreover, PCR was performed using primers targeting the ß-actin sequence of Homo sapien (gene code: ACTB), purchased from ThermoFisher (Assay ID: Hs00368836) as an internal positive control. Table 12. DNA sequences of PCR primers for GC samples. Primer Sequence (5’-3’) SEQ ID NO Neisseria gonorrhea - porA pseudogene (primers reported by Hjelmevoll et al., 2006) FW CCGGAACTGGTTTCATCTGATT 13 RV GTTTCAGCGGCAGCATTCA 14 Table 13. DNA sequences of PCR primers for CT samples. Primer Sequence (5’-3’) SEQ ID NO Chlamydia trachomatis - ftsk gene (primers reported by Eszik et al., 2016) FW AACTTGCAAGCTTCTAGCATCCGC 39 RV ATCACATCTCGAGAAGGGCGTTGT 40 Chlamydia trachomatis - cryptic plasmid (primers reported by Venter et al., 2019) FW GGATTGACTCCGACAACGTATTC 41 RV ATCATTGCCATTAGAAAGGGCATT 42 The real-time PCR reactions were performed in a final volume of 20 µl including 10 µl of GoTaq qPCR master mix 2X (Promega), 2 µl forward / reverse Primer (5 µM), 0.5 µl SYTO9 (25µM), 2.5 µl PCR water and 5 µL of sample or positive / negative control. The PCR cycle conditions were set according to the manufacturer’s instructions, as follows: 2 min at 95 °C followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C. The reactions were monitored real- time via fluorescence in FAM channel. Each sample was repeated three times by PCR. Statistical analysis An agreement between the BD ProbeTec ET assay and the LAMP assay was evaluated by Cohen’s Kappa coefficient. Kappa values ranging from 0.0 to 0.20 are generally regarded as poor agreement, from 0.21 to 0.40 as fair agreement, from 0.41 to 0.60 as moderate agreement, from 0.61 to 0.80 as good agreement and from 0.81 to 1.00 as very good agreement. Exemplary Oligonucleotide Primer Sequences SEQ ID NO: 1 = GTAACGCACGGAAACCGGCATTTTGTGGCTTCGCAATTGGGTA SEQ ID NO: 2 = TTCCCCCGGATTTTCCGGTTTTTTTGGCGTATAGGCGGACTTG SEQ ID NO: 3 = TTGATCCTTGGGACAGCAAT SEQ ID NO: 4 = TTTCCAGCGTGAAAGTAGCA SEQ ID NO: 5 = TACCGTCGTGGCGTTTGAA SEQ ID NO: 6 = CAGCATTCAATTTGTTCCGAGTC SEQ ID NO: 7 = GCATACCGTCGTGGCGTTTGAATTTTCCAGCAAAGCCATTGATCCT SEQ ID NO: 8 = CGATTCCCCCGGATTTTCCGGTTTTGGCGTATAGGCGGACTTG SEQ ID NO: 9 = GCGAATCCGTTTGGCGAT SEQ ID NO: 10 = TTTCCAGCGTGAAAGTAGCA SEQ ID NO: 11 = GCCACATTATTATTGCTGTCCCA SEQ ID NO: 12 = CAGCATTCAATTTGTTCCGAGTC SEQ ID NO: 13 = CCGGAACTGGTTTCATCTGATT SEQ ID NO: 14 = GTTTCAGCGGCAGCATTCA SEQ ID NO: 15 = TGTTCGAGAAATGGAACTACGTTATTTTTCGAGTTCGAGAATTAAAGGATT SEQ ID NO:16 = CAAATTAAAGCGCTATGGGCTTCTTTTTTAACAGGATACTCGCAACT SEQ ID NO: 17 = GAAGCTTCGATATCCACATTG SEQ ID NO: 18 = AGACATAAAACTCGTAATCGTG SEQ ID NO: 19 = TCTTCGATTTTTAGGGCTACGAAAC SEQ ID NO: 20 = AGATTCTGTGATAACAGGAGTTAGC SEQ ID NO: 21 = GGAAAAAAGCTAATGGCGATAACTTTTTTCCTGCAATAATTAAATGGGGC SEQ ID NO: 22 = GAAGAGGAACTTGGAGTCGTTGTTTTTCAATCCAGATCCTCAGCC SEQ ID NO: 23 = TCGTGTTAATGCAGACAGAT SEQ ID NO: 24 = GCGGTAGGAATTGAAATCC SEQ ID NO: 25 = TTGGACAGATTTGGCAACCAT SEQ ID NO: 26 = GGTAATCTTCTAATAAATCTCG SEQ ID NO: 27 = AGGGAGTGAACATATTCAGTCTGTATTTTGGATGCCTCTATTGATTACCA SEQ ID NO: 28 = TGATGCCGATACGATTCGTATAGCTTTTGTTGGGTTAAGCGTGGTA SEQ ID NO: 29 = GAACAGATGCTGCGACAG SEQ ID NO: 30 = CAGTTTTCACATCGCCAG SEQ ID NO: 31 = GAGAGCTAAACTTGCTTGCCATTC SEQ ID NO: 32 = CCAGCCAAAATCAGCTACAGC SEQ ID NO: 33 = CGCTGTGACGGAGTACAAACTTTTCCTGTGACCTTCATTATGTCG SEQ ID NO: 34 = GAAGCACGTGCGGGGTTATTTTTTGCACGTTCTCTCAAGCAG SEQ ID NO: 35 = ATCATCTTTGCGGTTGCG SEQ ID NO: 36 = AATGGTGGGGTTAAGGCA SEQ ID NO: 37 = GCCTAGGGTGCTCAGACTC SEQ ID NO: 38 = AAAGGGATTGCAGCTTGTAGTC SEQ ID NO: 39 = AACTTGCAAGCTTCTAGCATCCGC SEQ ID NO: 40 = ATCACATCTCGAGAAGGGCGTTGT SEQ ID NO: 41 = GGATTGACTCCGACAACGTATTC SEQ ID NO: 42 = ATCATTGCCATTAGAAAGGGCATT References Adamson, P. C. & Klausner, J. D. Diagnostic Tests for Detecting Chlamydia trachomatis and Neisseria gonorrhoeae in Rectal and Pharyngeal Specimens. J. Clin. Microbiol.60, e0021121 (2022). Chen, X. et al. Visual and Rapid Diagnosis of Neisseria gonorrhoeae Using Loop- Mediated Isothermal Amplification Combined With a Polymer Nanoparticle–Based Biosensor in Clinical Application. Front. Mol. Biosci. 8, 1–11 (2021). Chen, X. et al. Nanoparticle-Based Lateral Flow Biosensor Integrated With Loop- Mediated Isothermal Amplification for Rapid and Visual Identification of Chlamydia trachomatis for Point-of-Care Use. Front. Microbiol.13, 1–13 (2022). Chen, X., Zhou, Q., Yuan, W. & Shi, Y. Visual and rapid identification of Chlamydia trachomatis and Neisseria gonorrhoeae using multiplex loop-mediated isothermal amplification and a gold nanoparticle-based lateral flow biosensor. 1–12 (2023) doi:10.3389 / fcimb.2023.1067554. Choopara, I., Arunrut, N., Kiatpathomchai, W., Dean, D. & Somboonna, N. Rapid and visual Chlamydia trachomatis detection using loop-mediated isothermal amplification and hydroxynaphthol blue. Lett. Appl. Microbiol.64, 51–56 (2017). Das, D., Lin, C.-W. & Chuang, H.-S. LAMP-Based Point-of-Care Biosensors for Rapid Pathogen Detection. Biosensors 12, (2022). Dean, D. et al. Development and evaluation of a point-of-care test in a low-resource setting with high rates of chlamydia trachomatis urogenital infections in fiji. J. Clin. Microbiol. 59, (2021). Eszik, I. et al. High dynamic range detection of Chlamydia trachomatis growth by direct quantitative PCR of the infected cells. J. Microbiol. Methods 120, 15–22 (2016). Hjelmevoll, S. O. et al. A fast real-time polymerase chain reaction method for sensitive and specific detection of the Neisseria gonorrhoeae porA pseudogene. J. Mol. Diagnostics 8, 574–581 (2006). Liu, M. L., Xia, Y., Wu, X. Z., Huang, J. Q. & Guo, X. G. Loop-mediated isothermal amplification of Neisseria gonorrhoeae porA pseudogene: a rapid and reliable method to detect gonorrhea. AMB Express 7, (2017). Magbanua, J. P. V et al. Chlamydia trachomatis variant not detected by plasmid based nucleic acid amplification tests: molecular characterisation and failure of single dose azithromycin. Sex. Transm. Infect.83, 339–343 (2007). Mason, M. G. & Botella, J. R. Rapid (30-second), equipment-free purification of nucleic acids using easy-to-make dipsticks. Nat. Protoc.15, 3663–3677 (2020). Moehling, T. J., Choi, G., Dugan, L. C., Salit, M. & Meagher, R. J. LAMP Diagnostics at the Point-of-Care: Emerging Trends and Perspectives for the Developer Community. Expert Rev. Mol. Diagn.21, 43–61 (2021). Shimuta, K., Nakayama, S., Takahashi, H., Ohnishi, M. A Loop-Mediated Isothermal Amplification Assay Targeting Neisseria gonorrhoeae penA-60.001. Antimicrob. Agents Chemother.1–5 (2019). Shimuta, K., Takahashi, H., Akeda, Y., Nakayama, S. & Ohnishi, M. Loop-Mediated Isothermal Amplification Assay for Identifying Neisseria gonorrhoeae Nonmosaic penA- Targeting Strains Potentially Eradicable by Cefixime. Microbiol. Spectr. (2022) doi:10.1128 / spectrum.02335-22. Somboonna, N. et al. Rapid and sensitive detection of Chlamydia trachomatis sexually transmitted infections in resource-constrained settings in Thailand at the point-of-care. PLoS Negl. Trop. Dis. 12, 1–9 (2018). Venter, J. M. E. et al. Comparison of an in-house real-time duplex PCR assay with commercial HOLOGIC® APTIMA assays for the detection of Neisseria gonorrhoeae and Chlamydia trachomatis in urine and extra-genital specimens. BMC Infect. Dis.19, 1–7 (2019). Xu, G., Zhao, H., Cooper, J. M. & Reboud, J. A capillary-based multiplexed isothermal nucleic acid-based test for sexually transmitted diseases in patients. Chem. Commun. 52, 12187– 12190 (2016). Yu, Y. et al. A quantitative RT-qLAMP for the detection of SARS-CoV-2 and human gene in clinical application. Microb. Biotechnol. (2022) doi:10.1111 / 1751-7915.14112.

Claims

CLAIMS 1. A set of oligonucleotide primers comprising a forward inner primer (FIP), a reverse inner primer (BIP), a forward outer primer (F3) and a reverse outer primer (B3), wherein: (a) the FIP comprises the nucleotide sequence of SEQ ID NO: 15, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (b) the BIP comprises the nucleotide sequence of SEQ ID NO: 16, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (c) the F3 comprises the nucleotide sequence of SEQ ID NO: 17, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; and (d) the B3 comprises the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto.

2. The set of oligonucleotide primers according to claim 1, wherein the set of oligonucleotide primers further comprises a forward loop primer (LF) and / or a reverse loop primer (LB), wherein: (e) the LF comprises the nucleotide sequence of SEQ ID NO: 19, or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% sequence identity thereto; and / or (f) the LB comprises the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% sequence identity thereto.

3. The set of oligonucleotide primers according to claim 1 or 2, wherein the oligonucleotide primers are DNA primers.

4. A kit for detecting Chlamydia trachomatis in a sample or for diagnosing Chlamydia trachomatis infection in a subject, wherein the kit comprises the set of oligonucleotide primers according to any one of claims 1 to 3.

5. The kit according to claim 4, wherein the kit further comprises: (i) DNA polymerase; (ii) reverse transcriptase; (iii) a pH indicator, colorimetric indicator and / or fluorescent dye;(iv) deoxynucleotide triphosphates (dNTP); (v) buffer components; and / or (vi) instructions for use.

6. The kit according to claim 4 or 5, wherein the primers and optionally one or more of the additional components of the kit are dried, optionally freeze-dried, and optionally further combined as a reagent mix.

7. An in vitro diagnostic device for Chlamydia trachomatis infection, comprising the set of oligonucleotide primers according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 6.

8. A method of loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT-LAMP), wherein the method comprises: (a) mixing the set of oligonucleotide primers according to any one of claims 1 to 3 with template DNA or RNA, deoxyribonucleotide triphosphates (dNTP), a DNA polymerase and optionally reverse transcriptase in solution; and (b) heating the mixture to the working temperature of the DNA polymerase.

9. Use of the set of oligonucleotide primers according to any one of claims 1 to 3, the kit according to any one of claims 4 to 6, or the in vitro diagnostic device according to claim 7, to detect the presence or absence of Chlamydia trachomatis in a sample, or to diagnose the presence or absence of Chlamydia trachomatis infection in a subject.

10. A method of detecting the presence or absence of Chlamydia trachomatis in a sample using the set of oligonucleotide primers according to any one of claims 1 to 3, or the kit according to any one of claims 4 to 6, wherein the method comprises: (a) performing loop-mediated isothermal amplification (LAMP) or reverse transcription loop-mediated isothermal amplification (RT-LAMP) using the set of oligonucleotide primers or the kit to amplify Chlamydia trachomatis nucleic acid in the sample,thereby providing, in the presence of Chlamydia trachomatis nucleic acid, an amplification product; (b) detecting the presence or absence of the amplification product; and (c) determining the presence or absence of Chlamydia trachomatis nucleic acid in a sample, wherein the presence of the amplification product indicates the presence of Chlamydia trachomatis in the sample and absence of the amplification product indicates the absence of Chlamydia trachomatis in the sample.

11. A method of diagnosing the presence or absence of Chlamydia trachomatis infection in a subject, comprising detecting the presence or absence of Chlamydia trachomatis in a sample obtained from the subject using the method according to claim 10, wherein the presence of Chlamydia trachomatis in the sample indicates the presence of a Chlamydia trachomatis infection in the subject and the absence of Chlamydia trachomatis in the sample indicates the absence of a Chlamydia trachomatis infection in the subject.

12. The method according to claim 10 or 11, wherein detecting the presence or absence of the amplification product comprises using a nucleic acid stain producing a colorimetric reaction.

13. The method according to claim 11, wherein the nucleic acid stain comprises SYTO9, SYBR green 1, EvaGreen, calcein and / or hydroxynapthol blue.

14. The method according to any one of claims 10 to 13, wherein the method comprises pre- treating the sample prior to performing LAMP or RT-LAMP, thereby at least partially purifying and / or concentrating the Chlamydia trachomatis nucleic acid.

15. The method according to claim 14, wherein pre-treating the sample comprises: (i) centrifuging the sample; (ii) extracting the Chlamydia trachomatis nucleic acid from the sample; and / or (iii) heat-inactivating the sample.

16. The method according to any one of claims 10 to 15, wherein the sample is a body fluid.

17. The method according to claim 16, wherein the body fluid is urine, saliva, sputum, blood, semen, vaginal fluid or cerebrospinal fluid.

18. The method according to any one of claims 10 to 17, wherein the sample is a tissue sample.

19. The method according to claim 20, wherein the tissue sample is a tissue swab or a biopsy.

20. The method according to claim 19, wherein the tissue swab is a vaginal, cervical, vaginocervical, rectal, anorectal, throat, pharyngeal, urethral or lesion swab.

21. The method according to claim 17 or 20, wherein: (i) pre-treating the sample comprises centrifuging the sample, and the sample is urine or vaginocervical swab; (ii) pre-treating the sample comprises extracting the Chlamydia trachomatis nucleic acid from the sample, and the sample is urine, vaginocervical swab, rectal swab or throat swab; or (iii) pre-treating the sample comprises heat-inactivating the sample, and the sample is vaginocervical swab.

22. The method according to any one of claims 10 to 21, wherein the method further comprises, prior to or after carrying out steps (a) to (c), detecting the presence or absence of Chlamydia trachomatis cryptic plasmid in the sample, optionally wherein detecting the presence or absence of Chlamydia trachomatis cryptic plasmid in the sample comprises: (A) performing LAMP or RT-LAMP using a set of oligonucleotide primers to amplify the nucleic acid sequence of the CDS2 region of Chlamydia trachomatis cryptic plasmid, thereby providing, in the presence of Chlamydia trachomatis cryptic plasmid, an amplification product; (B) detecting the presence or absence of the amplification product; and (C) determining the presence or absence of Chlamydia trachomatis cryptic plasmid in the sample, wherein the presence of the amplification product indicates the presence ofChlamydia trachomatis cryptic plasmid in the sample and absence of the amplification product indicates the absence of Chlamydia trachomatis cryptic plasmid in the sample.

23. The method according to claim 22, wherein the second set of oligonucleotide primers comprise a forward inner primer (FIP), a reverse inner primer (BIP), a forward outer primer (F3) and a reverse outer primer (B3), and optionally a forward loop primer (LF) and / or a reverse loop primer (LB), wherein: (i) the FIP comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (ii) the BIP comprises the nucleotide sequence of SEQ ID NO: 34, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (iii) the F3 comprises the nucleotide sequence of SEQ ID NO: 35, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (iv) the B3 comprises the nucleotide sequence of SEQ ID NO: 36, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity thereto; (v) the LF comprises the nucleotide sequence of SEQ ID NO: 37, or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% sequence identity thereto; and (vi) the LB comprises the nucleotide sequence of SEQ ID NO: 38, or a nucleotide sequence having at least 80%, 90%, 95%, 98% or 99% sequence identity thereto.

24. The method according to claim 22 or 23, wherein the presence or absence of Chlamydia trachomatis cryptic plasmid indicates one or more additional characteristics of Chlamydia trachomatis present in the sample.

25. Use of the set of oligonucleotide primers according to any one of claims 1 to 3, or the kit according to any one of claims 4 to 6, in the method according to any one of claims 10 to 24.

Images