Method, composition and kit for rapidly detecting cronobacter malonate through body temperature amplification

By designing specific oligonucleotide primers and probes using thermogenic amplification (ERA) technology, and combining them with fluorescence and test strip methods, the problems of long detection time and equipment dependence of existing PCR technologies have been solved, enabling rapid and accurate detection of Cronobacter malonate and ensuring food safety.

CN121320577APending Publication Date: 2026-01-13CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410919441.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-10
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Existing PCR technology for detecting Cronobacter spp. strains requires 2 hours and specialized equipment, which cannot meet the need for rapid and convenient detection. Furthermore, there is a lack of rapid and accurate methods for identifying Cronobacter malonate, which affects food safety monitoring and prevention.

Method used

Specific oligonucleotide primers and probes were designed using thermogenic amplification (ERA) technology, combined with fluorescence and test strip methods, to achieve rapid amplification and visual detection of Cronobacter malondiamide at 37-42℃. Specific recognition was performed using the ompX, recN, and tdh genes.

Benefits of technology

It enables rapid, accurate, and sensitive detection of Cronobacter malonic acid within 10-20 minutes at room temperature, and is suitable for the detection and traceability of Cronobacter malonic acid in infant food, ensuring food safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to two rapid detection methods, namely a fluorescence method and a test strip method, for rapidly detecting cronobacter malonate by adopting a body temperature amplification (ERA) technology. The invention also relates to an oligonucleotide primer probe composition for the method. The invention also relates to a detection kit containing the composition. When the composition is used for detection by an ERA fluorescence method and a test strip method, the cronobacter malonate can be simply, rapidly, specifically, sensitively and visually detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection. Specifically, this invention relates to the rapid detection of Cronobacter malondiamide using fluorescence and test strip methods with thermoacoustic amplification technology, oligonucleotide primer and probe compositions for the methods, and kits containing the compositions. Background Technology

[0002] Kronobacter spp. Cronobacter spp. ), formerly known as Enterobacter sakazakii ( Enterobacter sakazakii Kronobacter is a Gram-negative bacillus widely found in food and the environment, especially in infant formula and its processing. It has also been reported to be detected in cheese, cured meats, and water. Kronobacter infection primarily causes necrotizing enterocolitis, bacteremia, and meningitis, with a mortality rate as high as 40%–80%. Survivors may experience long-term sequelae, including developmental delays, hydrocephalus, permanent neurological damage, and mental disability.

[0003] The genus *Cronobacter* is divided into 7 species and 2 subspecies, namely *Cronobacter sakazakii* (…). C. Enterobacter ), Cronobacter malonate ( sakazakii s), Zurich Cronobacter ( C. C. malonaticu Moginskohlii ( turicensis ), Kronobacterium dublinum ( C. muytjensii (including Kronobacter berberis subspecies in infant formula) C. dublinensis subsp. Lactaridi), Cronobacter dublin subspecies of Dublin ( C. dublinensis subsp. Dublinensis and Cronobacter dublinii subspecies Lausanne ( C. C. dublinensis ), Contimonte Crohn's disease ( dublinensis subsp. Lausannensis ), Univols seronobacterium ( C. condimenti The pathogenicity of different species of *Cronobacter* varies greatly, and species identification is a prerequisite for the study of *Cronobacter* strains. It is crucial for a deeper understanding of the pathogenicity of *Cronobacter* strains. At the same time, the establishment of rapid and accurate identification and species identification methods for *Cronobacter* at the species level is of great significance for the monitoring, prevention and control of foodborne diseases caused by this genus of bacteria.

[0004] *Cronobacter malonate* is a foodborne pathogen commonly found in the intestines of animals and humans. Belonging to the genus *Cronobacter*, it exhibits some tolerance to extreme conditions such as dryness, heat, acid, alkali, and antibiotics. *Cronobacter malonate* primarily parasitizes the intestines of humans and animals. Infection with this bacterium can cause varying degrees of illness in people of all ages, such as meningitis and sepsis; in severe cases, it can even be life-threatening.

[0005] With the rapid development of molecular biology techniques, various molecular biology techniques for tracing biological components by identifying nucleic acids have advantages such as high specificity, high sensitivity, resistance to environmental interference, and stable results, and are increasingly widely used in the detection of foodborne pathogens. However, the currently popular PCR technology usually takes about 2 hours to detect and requires a professional temperature-controlled nucleic acid amplification instrument. In 2019, my country developed an isothermal nucleic acid amplification technology with global independent intellectual property rights—Enzymatic Recombinase Amplification (ERA). This technology can efficiently and rapidly amplify trace amounts of DNA and RNA specific fragments at room temperature of 37–42℃, hence it is also known as body temperature amplification technology, meaning that amplification can be completed in the palm or armpit of a person, without relying on temperature control equipment. Under body temperature, the recombinase and primer bind tightly to each other, forming a polymer of recombinase and primer. When the recombinase and primer polymer finds a perfectly matching complementary sequence on the template DNA, the double-stranded structure of the template DNA is opened with the help of single-stranded DNA-binding proteins. Under the action of DNA polymerase, primers extend along the 5′→3′ direction, forming new complementary DNA strands and completing the exponential growth of amplified products. Significant breakthroughs have been achieved in its low-temperature adaptability and sensitivity, reaching international advanced levels. Compared with traditional PCR and LAMP isothermal amplification techniques, its most significant advantage is that amplification can be completed within 10-20 minutes at body temperature, and the results can be visualized and analyzed through color development, fluorescence, and test strips. This technology is rapid, convenient, and accurate, and has become a research hotspot in recent years. Summary of the Invention

[0006] The purpose of this invention is to rapidly, efficiently, simply, intuitively, accurately, and sensitively detect Cronobacter malonic acid. This method is crucial for the detection and traceability of Cronobacter malonic acid in infant formula and other infant foods, ensuring the safety of newborns and infants.

[0007] The inventors of this invention used the virulence gene outer membrane protein X of *Cronobacter malonate* from the NCBI database. C. universalis) and thethermostable direct hemolysin gene, ompX ), and the recombination and repair protein gene, tdh Meanwhile, gene sequences of six other species in the genus *Cronobacter* were retrieved: *Cronobacter malondiophilus*, *Cronobacter sakazakii*, *Cronobacter moginskoye*, *Cronobacter dublinum*, *Cronobacter zurichensis*, *Cronobacter univoskoye*, and *Cronobacter contimonte*. Based on the primer design principles of thermoacoustic amplification of respiration (ERA) technology, specific ERA primers and probes capable of efficiently detecting *Cronobacter malondiophilus* were designed in the differential regions. Through a series of screening experiments, the appropriate primer was finally selected. recN Gene-specific rapid detection of Cronobacter malonate amplification ERA at body temperature.

[0008] In one aspect of the invention, oligonucleotide primers for rapid detection of Cronobacter malonic acid using ERA fluorescence technique are provided: upstream malondi-F7: 5′-GCGCTGAAAGACACGCCTGCCGCCCTGC-3′ (SEQ ID No. 1), and downstream malondi-R7: 5′-CCATCTGCGCCATGAGCTCACCTTCGCCT-3′ (SEQ ID No. 2). In another aspect of the invention, a probe for rapid detection of Cronobacter malonic acid using ERA fluorescence technique is also provided: malondi-P6: 5′-TCAAATTCACGGTCAGCACGCCCACCAGCTTCTGCTTAAACCTGAAC-3′ (SEQ ID No. 3), wherein the 3′ end of the probe is blocked with a c3-spacer, the T at position 30 is modified with a FAM group, the base at position 31 is replaced with THF, and the T at position 33 is modified with BHQ1. The probe was combined with SEQ ID No. 1 and SEQ ID No. 2 for thermoacoustic amplification (ERA) fluorescence amplification, thereby specifically recognizing *Cronobacter malondiformis*. The reaction program in the qPCR instrument was set as follows: 37 ℃ 1 s; 37 ℃ 14 s, 60 cycles; FAM fluorescence signal was collected during the second reaction stage.

[0009] In another aspect of the invention, oligonucleotide primers and probes for rapid detection of Cronobacter malonic acid using ERA test strips based on thermoacoustic amplification (ERA) technology are provided. The upstream sequence remains malondi-F (SEQ ID No. 1), and the downstream malondi-R-test strip sequence is the same as SEQ ID No. 2, but modified with biotin at its 5′ end (SEQ ID No. 4). The test strip probe malondi-P6-test strip sequence is the same as SEQ ID No. 3, but modified with FAM at its 5′ end, blocked with a c3-spacer at its 3′ end, and the 31st base replaced with THF (SEQ ID No. 5). SEQ ID No. 1, SEQ ID No. 4, and SEQ ID No. 5 are combined for ERA test strip amplification, and Cronobacter malonic acid is rapidly detected based on the color development of the control and detection bands on the test strip. The reaction program is: 37 ℃ for 15 min.

[0010] In another aspect of the invention, a composition comprising the above-described oligonucleotide sequence is provided. The composition comprises the following primer and probe sequences: (1) Rapid detection of oligonucleotide primer pairs SEQ ID No. 1, SEQ ID No. 2 and probe SEQ ID No. 3 sequences of Cronobacter malondiamide using ERA fluorescence technique; (2) Rapid detection of oligonucleotide primer pairs SEQ ID No. 1, SEQ ID No. 4 and probe SEQ ID No. 5 sequences of Cronobacter malondiamide using ERA test strips.

[0011] In one embodiment, the amplification conditions for the Cronobacter malonate thermoacupuncture amplification (ERA) fluorescence method are 37°C for 1 s; 37°C for 14 s, for 60 cycles; FAM fluorescence signal is collected during the second reaction stage. The detection results are analyzed by fluorescence curve analysis. A good amplification curve indicates a positive result, while no amplification indicates a negative result.

[0012] In another embodiment, the amplification conditions for the Cronobacter malonate thermoacupuncture (ERA) test strip method are: a constant temperature reaction at 37 °C for 15 min; after the reaction, 5 μL of the reaction product is transferred to a 1.5 mL centrifuge tube and diluted 50 times with pure water; the test strip is then removed (without touching the NC membrane) and inserted into the centrifuge tube. Once the test strip is completely wetted, the result is interpreted based on the color development of the control and detection bands. If both the control and detection bands show a clear red line, the result is positive; if only the control band shows a red line, the result is negative; if no red line appears in the control band, the result is invalid.

[0013] In another aspect of the invention, rapid detection kits for ERA fluorescence and colorimetric methods for Cronobacter malonate thermodynamic amplification technology are provided, the kits comprising the oligonucleotide sequence or the composition.

[0014] The kit provided by this invention includes a specific primer and probe composition for rapid detection of Cronobacter malonate using ERA fluorescence and colorimetric methods for thermoamplification technology, as well as an instruction manual.

[0015] In one embodiment, the present invention contains malonate-containing Cronobacter. recN The sequence is the basic sequence, and specific primers and probes are respectively located at... recN The design of nucleic acid sequences in conserved regions of the sequence. In one embodiment, the kit contains a Cronobacter malonic acid-specific amplification target sequence as follows: GCGCTGAAAGACACGCCTGCCGCCCTGCGCTGGCTGGAAGAAAACCAGCTTGAAGACGGCAGCGAGTGCCTGCTGCGCCGTGTTATCAGCAGCGATGGCCGCTCGCGCGGCTTTATCAACGGCACCGCCGTGCCGCTCTCGCAGCTGCGCGAACTCGGTCAGTTGCTGATTCAAATTCACGGTCAGCACGCCCACCAGCTTCTGCTTAAACCTGAACATCAGAAACGCCTGCTGGATGGCTATGCAGGCGAAGGTGAGCTCATGGCGCAGATGG. In a specific embodiment, the kit for detecting Cronobacter malonic acid of the present invention also includes controls. Preferably, the controls include a positive control and a negative control. In one embodiment, the negative control is sterile double-distilled water.

[0016] In another embodiment, the sensitivity of the ERA fluorescence method of the thermoacoustic amplification technique for detecting Cronobacter malonate is 1 ng / μL. The sensitivity of the ERA colorimetric method for detecting Cronobacter malonate is 1 ng / μL.

[0017] In another aspect of the invention, the invention provides the application of the composition or the kit in the detection of Cronobacter malonate in milk powder samples.

[0018] The design of amplification primers and probes is crucial for developing sensitive and rapid ERA detection methods, because primers with different sequences exhibit different behaviors in the ERA reaction, which will affect amplification efficiency and amplification speed. Therefore, primer design and screening are essential.

[0019] Because ERA (Enhanced Reproductive Technology) technology requires unique reaction conditions of 37–42°C, primer design is extremely demanding. Regular PCR primers are unsuitable, as ERA primers are longer than typical PCR primers, usually needing to be 28–35 nt. Primers that are too short will reduce recombination rates, affecting amplification speed and detection sensitivity. Primers that are too long may generate primer dimers or hairpin structures during amplification, thus impacting nucleic acid amplification yield. Furthermore, denaturation temperature is no longer a critical factor influencing primer design for ERA.

[0020] Furthermore, to establish an ERA fluorescence method, ERA detection probes need to be designed. The probe design requires placement in the middle of the primer, complete complementarity to the template, and a length of 46–52 nucleotides, with at least 30 nucleotides at the 5′ end and at least 15 nucleotides at the 3′ end of the THF site. The fluorescent and quenching groups can only be labeled on thymine (T), with a spacing of 1–5 nucleotides between them. Larger spacing leads to higher base values ​​and lower signal-to-noise ratios, thus reducing quenching efficiency. One nucleotide in the middle is replaced with tetrahydrofuran (THF), and the spacing between the dT-fluorophore or dT-quencher and the THF bases is 0, 1, or 2. The 3′ end of the probe needs to be modified and blocked with a blocking group, such as a C3-spacer, phosphate, amine, biotin, or tetraethylene glycol. Under the action of exonuclease II, the two groups are separated, and the fluorescence signal accumulates simultaneously with the amplification product growth, allowing for simultaneous detection of the fluorescence curve.

[0021] To establish the ERA test strip method, further screening of primers and probes is required. The test strip method requires biotin modification at the 5′ end of the primer sequence complementary to the probe. A probe of 46–52 nucleotides in length is designed between the upstream and downstream primers, with at least 30 nucleotides at the 5′ end and at least 15 nucleotides at the 3′ end of the THF site. THF is a base that replaces a base located 30 bp downstream of the fluorophore and 15 bp upstream of the blocking group, with a spacing of 1–5 nucleotides. The 5′ end of the probe is labeled with a FAM fluorescent group, and the 3′ end of the probe needs to be modified and blocked with a blocking group, such as a C3-spacer, phosphate, amine, biotin, or tetraethylene glycol. When the probe binds to its target, endonuclease IV recognizes and cleaves THF, and the cleaved probe extends along the template from the 5′ to 3′ end. Primer and probe design for thermogenic ERA technology is not as mature as that for traditional PCR, and there is currently no design software available. Although the requirements for primer and probe design are known, the final selection still requires manual screening and optimization, and the experimental results are not always predictable.

[0022] Based on the characteristics of Cronobacter malonate, the inventors respectively used...recN , ompX , recN For the target gene, ERA fluorescence detection primers and probes were designed respectively: (1) tdhF1 / R1 / P1, (2) tdh F1 / R1 / P1, (3) malondioxygenated F1 / R1 / P1, (4) malondioxygenated F2 / R2 / P2, (5) malondioxygenated F3 / R3 / P3, (6) malondioxygenated F4 / R4 / P4, (7) malondioxygenated F5 / R5 / P4, (8) malondioxygenated F6 / R6 / P5, (9) malondioxygenated F7 / R7 / P3. After screening, the primer-probe combination (9) malondioxygenated F7 / R7 / P3 amplified *Cronobacter malonium* with good amplification efficiency, but also showed weak amplification of *Cronobacter zurichensis*. Further adjustment of the P3 probe, i.e., malondioxygenated P6, showed that malondioxygenated F7 / R7 / P6 only amplified *Cronobacter malonium*, and did not amplify the other 8 species in the *Cronobacter* genus, indicating good amplification effect. Further analysis of the specific amplification effect of this primer-probe combination on 15 other common foodborne pathogens showed that there was no cross-reactivity with common foodborne pathogens. Therefore, the oligonucleotide primer-probe combination F7 / R7 / P6 for rapid detection of Cronobacter malondiamide using thermodynamic amplification ERA provided by this invention was confirmed.

[0023] Table 1. Primer and probe sequence information for the designed Cronobacter malonate-containing ERA fluorescence rapid detection method.

[0024] Note: a This indicates that when using the test strip method, the 5′ end of the downstream primer Propionibacterium R7 is modified with Biotin; b This indicates that when using the test strip method, the 5′ end of the probe is modified with FAM, the T at position 30 is no longer modified with the FAM group, the T at position 33 is no longer modified with the BHQ1 group, and other modifications are the same as for propionyl-P6.

[0025] This invention cleverly utilizes the high efficiency of ERA (Extracorporeal Resonance Amplification) technology for DNA amplification and the specificity of nucleic acid hybridization to establish two rapid, on-site detection methods for Cronobacter malonate: a fluorescence method and a test strip method. These methods offer advantages such as simple operation, time and labor saving, accuracy and reliability, rapid sensitivity, and visual visualization. They can be used for the rapid qualitative detection of Cronobacter malonate in samples such as milk and other food products, providing excellent technical support for the rapid screening of Cronobacter malonate. Attached Figure Description

[0026] Figure 1 shows the results of primer and probe screening for Cronobacter malonate, in which... OmpXThe figures show the amplification results of primer-probe combinations (1) tdhF1 / R1 / P1, (2) OmpX F1 / R1 / P1, (3) malondiamide F1 / R1 / P1, (4) malondiamide F2 / R2 / P2, (5) malondiamide F3 / R3 / P3, (6) malondiamide F4 / R4 / P4, (7) malondiamide F5 / R5 / P4, (8) malondiamide F6 / R6 / P5, (9) malondiamide F7 / R7 / P3, and (10) malondiamide F7 / R7 / P6. The figures numbered 1-9 represent nine different Cronobacter species, with the strain names and strain numbers as follows: 1. Cronobacter malondiamide (15201), 2. Cronobacter moginskoyes (10403.20), 3. 4. *Cronobacter sakazakii* (10403.17), 5. *Cronobacter dublinii* (15203), 6. *Cronobacter univoskensis* (30419), 7. *Cronobacter zurichensis* (15202), 8. *Cronobacter montelli* (LMG26250), 9. *Cronobacter berberine* subsp. *milk powder* (CICC24181), 10. *Cronobacter dublinii* subsp. *lausanne* (LMG 23824), CK represents blank control.

[0027] Fig. 1A-1J This is the result of specific detection of common pathogenic bacteria (non-Cronobacter spp.) in food using the above-mentioned preferred primer-probe combination, malondiamide F7 / R7 / P6. 1 represents *Cronobacter malondiamide*, and 2-16 represent: 2. *Pseudomonas fluorescens* ATCC13525, 3. *Escherichia coli* O157:H7 ATCC43895, 4. *Salmonella typhimurium* ATCC14028, and 5. *Vibrio parahaemolyticus* ATCC. 33847, 6. Staphylococcus aureus ATCC27664, 7. Listeria monocytogenes ATCC13932, 8. Cronobacter sakazakii ATCC29544, 9. Shigella flexneri CMCC51571, 10. Yersinia enterocolitica ATCC27729, 11. Bacillus cereus ATCC10876, 12. Beta-hemolytic streptococcus CMCC32210, 13. Burkholderia gladioli cocovenenans CICC 25108, 14. Escherichia coli CMCC44104, 15. Pseudomonas aeruginosa ATCC25619, 16. Serratia marcescens ATCC8100, CK represents blank control.

[0028] Fig. 2 The results show the sensitivity analysis of the above-mentioned preferred primer-probe combination, malonidate F7 / R7 / P6, against Cronobacter malonidate using the ERA method. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 ng / μL, two replicates per sample, CK represents blank control.

[0029] Fig. 3 The above-mentioned preferred primer-probe sequence combination, Cronobacter malondiamide F7 / R7-test strip / P6-test strip, was further analyzed to determine its specificity for Cronobacter malondiamide using the test strip method. Strains numbered 1-9 are as shown in Figure 1 above, and strains numbered 10-24 are as shown above. Fig. 4 Strains numbered 2-16 are included, with CK representing the blank control.

[0030] Fig. 2 The results show the sensitivity analysis of *Cronobacter malonate* using the strip method with the above-mentioned preferred primer-probe combination, F7 / R7-test strip / P6-test strip. The numbers 1-5 represent template concentrations of 100, 10, 1, and 10, respectively. -1 10 -2 The detection results were obtained in ng / μL, with two replicates for each sample. CK represents the blank control. Detailed Implementation

[0031] The present invention will be further described by way of examples, but the present invention is not limited to the following examples. Example 1: Screening of ERA primers and probes and analysis of fluorescence detection performance for the detection of Cronobacter malonate.

[0032] The primer and probe design (Table 1) was analyzed for amplification efficiency, specificity, and sensitivity, and the primer and probe combination for rapid detection of Cronobacter malonate using the ERA method was finally determined.

[0033] 1) DNA extraction from Cronobacter malonate: using PrepMan TM The Ultra Sample Preparation Reagent kit was used to extract DNA from Cronobacter malondiamide and diluted with sterile water to a concentration of 10 ng / μL for testing.

[0034] 2) Detection System: Prepare the premix for each sample according to the instructions of the Fluorescent Amplification Reagent Kit (ERA method): 20 μL solvent, 2.1 μL forward primer, 2.1 μL reverse primer, 0.6 μL probe, 1 μL template, and 22.2 μL ddH2O. Transfer the premix to a PCR tube containing the fluorescent amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in a mini qPCR instrument.

[0035] 3) Reaction program: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; in the second reaction stage, select FAM for the fluorescence channel and set the threshold to the default. Use sterile water as a blank control.

[0036] 4) Result Interpretation: A blank control showing no amplification curve is considered valid; otherwise, the result is considered invalid. A clear amplification curve indicates a positive result. No fluorescence curve indicates a negative result.

[0037] Figure 1 shows a comparison of the amplification efficiency of 10 combinations of malondialdehyde (Cronobacter malonate) using ERA fluorescence detection of candidate primers and probes. The results show that primer and probe combination (3) malondialdehyde (Cronobacter malonate) F1 / R1 / P1 ( Fig. 5 (4) C-F2 / R2 / P2 ( Fig. 1C (6) C-F4 / R4 / P4 ( Fig. 1D No amplification was observed in *Cronobacter malondiamide*, so the sample was discarded. Primer-probe combination (1) tdhF1 / R1 / P1 ( Fig. 1F (1) and (2) Fig. 1A F1 / R1 / P1 ( OmpX Although it amplified *Cronobacter malonate*, the amplification efficiency was low, and it showed non-specific amplification with other *Cronobacter* species, so it was discarded. Primer-probe combination (5) *Cronobacter malonate* F3 / R3 / P3 ( Fig. 1B (7) C-F5 / R5 / P4 ( Fig. 1E Although it is specific for the amplification of Cronobacter malondiamide, the amplification efficiency is not high. (8) Cronobacter malondiamide F6 / R6 / P5 ( Fig. 1G (9) C6F7 / R7 / P3 ( Fig. 1H (8) showed good amplification efficiency for Cronobacter malonic acid, but (9) showed non-specific amplification for both Cronobacter zurichensis and Cronobacter univoskensis; therefore, the P3 probe was adjusted to be malondialdehyde-P6, and the results showed that malondialdehyde-F7 / R7 / P6 ( Fig. 1I Only Cronobacter malonate was amplified, while no amplification was observed in the other 8 species of Cronobacter. The amplification effect was good.

[0038] like Fig. 1J As shown, specificity analysis of the screened primer-probe combination F7 / R7 / P6 revealed that only *Cronobacter malonic acid* was amplified, while DNA from other foodborne pathogens and the ddH2O blank control showed no amplification. This fully demonstrates that the specific oligonucleotide primers screened in this experiment exhibit excellent specificity for the detection of *Cronobacter malonic acid*.

[0039] like Fig. 2 As shown, the detection sensitivity analysis of the screened primer-probe combination malondiamide F7 / R7 / P6 was further performed. The results showed that this oligonucleotide primer combination had the highest sensitivity and could detect a minimum concentration of Cronobacter malondiamide of 1 ng / μL. Example 2: Detection performance of the preferred malonate-containing Cronobacter eRA primer probe test strip method

[0040] The selected malonate-based Cronobacter ERA primers and probes were further analyzed using the test strip method. Through specificity and sensitivity analysis, the primer and probe combination for rapid detection of Cronobacter ERA using the malonate-based test strip method was finally determined.

[0041] 1) Extraction of DNA from Cronobacter malonate: Same as in Example 1 above.

[0042] 2) Detection System: Prepare the premix for each sample according to the instructions of the test strip-type nucleic acid amplification kit (ERA method): 20 μL of solvent, 2.1 μL of forward primer, 2.1 μL of reverse primer, 0.6 μL of probe, 1 μL of template, and 22.2 μL of ddH2O. Transfer the premix to a PCR tube containing the test strip-type amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in the PCR instrument.

[0043] 3) Reaction procedure: Amplify at 37 ℃ for 15 min. After the reaction, take 5 μL of the reaction product into a 1.5 mL centrifuge tube and dilute it 50 times with pure water. Take out the test strip (do not touch the NC membrane), insert it into the centrifuge tube, and wait for the test strip to be completely wetted by the liquid. Read the results based on the color development of the control band and the detection band. Use sterile water as a blank control.

[0044] 4) Result Interpretation: If both the control band and the test band show obvious red lines, the test result is positive; if only the control band shows a red line, the test result is negative; if the control band does not show a red line, the test result is invalid.

[0045] like Fig. 3 As shown, specificity analysis of the selected primer-probe combination for the Cronobacter malonate ERA test strip method (malonate F7 / R7-test strip / P6-test strip) revealed amplification only in Cronobacter malonate, indicating high specificity. No amplification was observed in other Cronobacter species DNA or the ddH2O blank control, fully demonstrating the excellent specificity of the selected oligonucleotide primers for the detection of Cronobacter malonate.

[0046] like Fig. 4 As shown, further sensitivity analysis was performed on the preferred ERA test strip detection primer-probe combination, malondiamide F7 / R7-test strip / P6-test strip. The results showed that this oligonucleotide primer combination had the highest sensitivity, and could detect a minimum concentration of 1 mmol / L of Cronobacter malondiamide. ng / μL. Example 3: Limit of detection for rapid detection of malonate-containing Cronobacter in artificially contaminated samples.

[0047] 1) Sample pretreatment: Take 25 mL of sterile water and prepare artificially contaminated Cronobacter malonic acid samples according to the method described in SN / T 1632.3—2013 "Test Method for Cronobacter sakazakii (Cronobacter spp.) in Exported Milk Powder". Take 25 mL of homogenized solution from 7 groups and add 10... 8 CFU / mL malonate-enriched Cronobacterium malonate was serially diluted to 10 7 ~10 0 Artificially contaminated samples with CFU / mL were enriched at 37°C for 0, 2, 4, 6, and 8 h.

[0048] 2) The DNA extraction, fluorescence detection system, reaction procedure, and result interpretation steps are the same as in Example 1. The test strip method detection system, reaction procedure, and result interpretation steps are the same as in Example 2. Sterile ddH2O was used as a blank control during the experiment.

[0049] The results of the artificially contaminated samples are shown in Table 2. The results show that the established malonate Cronobacter ERA fluorescence method has a detection limit of 1 CFU / mL after 8 hours of pre-enrichment, and the method has high sensitivity.

[0050] Table 2 Detection results of artificially contaminated samples

[0051] 1) Sample pretreatment: The sample pretreatment steps for commercially available Stage 1 infant formula milk powder are in accordance with GB 4789.40-2024 National Food Safety Standard for Microbiology of Food - Cronobacter test, and the sample is cultured in pre-enrichment broth for 24 h.

[0052] 2) The DNA extraction, fluorescence detection system, reaction procedure, and result interpretation steps are the same as in Example 1. The test strip method detection system, reaction procedure, and result interpretation steps are the same as in Example 2. Sterile ddH2O is used as a blank control, and each sample is tested in duplicate.

[0053] 3) The accuracy and applicability of the test results of the samples were analyzed using the test method of GB 4789.40-2024.

[0054] The actual results from commercially available samples are shown in Table 3. The results show that the ERA fluorescence method and test strip method established in this study were used to detect 25 samples of commercially available stage 1 infant formula milk powder, and the results were compared with those of the national standard GB 4789.40-2024. The results showed that *Cronobacter malonate* was not detected in any of the 25 commercially available milk powder samples. This may be related to the national food safety standard GB 29921—2021, which stipulates that *Cronobacter malonate* must not be detected in stage 1 infant formula milk powder. The detection results of the ERA fluorescence method and test strip method of this invention are consistent with the detection results of the standard method in GB 4789.40-2024 (Table 3). This confirms the accuracy and practicality of the two rapid detection methods for *Cronobacter malonate* ERA established in this study.

[0055] Table 3. Cronobacter malonate in commercially available Stage 1 infant formula samples. Fig. 5 Sample No. Fluorescence method Test strip method GB 4789.40-2024 1 - - - 2 - - - 3 - - - 4 - - - 5 - - - 6 - - - 7 - - - 8 - - - 9 - - - 10 - - - 11 - - - 12 - - - 13 - - - 14 - - - 15 - - - 16 - - - 17 - - - 18 - - - 19 - - - 20 - - - 21 - - - 22 - - - 23 - - - 24 - - - 25 - - - While specific embodiments of the invention have been described, those skilled in the art will recognize that various changes and modifications can be made to the invention without departing from its scope or spirit. Therefore, the invention is intended to cover all such changes and modifications falling within the scope of the claims and their equivalents.

Claims

1. A composition for detecting Cronobacter malonate by ERA fluorescence method, characterized in that, The composition comprises an upstream primer 5′-GCGCTGAAAGACACGCCTGCCGCCCTGC-3′, a downstream primer 5′-CCATCTGCGCCATGAGCTCACCTTCGCCT-3′, and a probe 5′-TCAAATTCACGGTCAGCACGCCCACCAGCTTCTGCTTAAACCTGAAC-3′ for detecting Cronobacter malonate. The 3′ end of the probe is blocked with a c3-spacer, the T at position 30 is modified with a FAM group, the base at position 31 is replaced with THF, and the T at position 33 is modified with BHQ1.

2. A composition for detecting Cronobacter malonate by ERA test strip method, characterized in that, The composition comprises the upstream primer, downstream primer, and probe sequence as described in claim 1, wherein the 5′ end of the downstream primer is modified with biotin; the 5′ end of the probe is modified with FAM, the 3′ end is blocked with c3-spacer, and the 31st base is replaced with THF.

3. A method and kit for detecting Cronobacter malonate by ERA fluorescence assay, said method comprising using the composition of claim 1.

4. A method and kit for detecting Cronobacter malonate by ERA test strip method, said method and kit comprising using the composition of claim 2.

5. The use of the composition of claims 1 and 2, the method and kit of claims 3 and 4, in the detection of Cronobacter malonate.

Citation Information

Patent Citations

  • Primer pair, probe and method for detecting Cronobacter sakazakii

    CN103409535A

  • ERA nucleic acid test strip amplification kit for rapidly detecting feline herpes virus, preparation method and detection method

    CN113604607A

  • ERA method, composition and kit for rapidly detecting cronobacter

    CN118109614A