Prevention of cognitive-decline disorders derived from radiotherapy

FLT3L-based interventions address neurocognitive side effects of radiotherapy by promoting dendritic cell proliferation and recruitment, effectively preventing cognitive decline and enhancing neurological function.

WO2025262249A1PCT designated stage Publication Date: 2025-12-26UNIV DE NAVARRA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/067331
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-21
Filing Date
2025-06-20
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current radiotherapy treatments for brain tumors, while effective in limiting tumor progression, often result in neurocognitive side effects such as learning, memory, and mood disorders due to the activation of neurotoxic microglia and other immune cells, with the role of non-CNS resident immune cells in cognitive decline being unclear.

Method used

The use of FMS-like tyrosine kinase 3 ligand (FLT3L) or functionally equivalent variants to promote the proliferation and recruitment of dendritic cells, which counteract the neurotoxic effects of radiotherapy by modulating the immune response and reducing neuroinflammation.

Benefits of technology

FLT3L-based interventions effectively prevent and treat cognitive decline associated with radiotherapy by enhancing dendritic cell populations, thereby mitigating neuronal damage and improving neurological function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000018_0001
    Figure IMGF000018_0001
  • Figure IMGF000018_0002
    Figure IMGF000018_0002
  • Figure 00000054_0000
    Figure 00000054_0000
Patent Text Reader

Abstract

The invention relates to the field of radiotherapy and, more particularly, to the use of a compound based on FMS-like tyrosine kinase 3 ligand (FLT3L) and adoptive cell therapy using dendritic cells in the prevention of cognitive damage associated with radiotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PREVENTION OF COGNITIVE-DECLINE DISORDERS DERIVED FROM RADIOTHERAPY

[0002] FIELD OF THE INVENTION

[0003] The invention relates to the field of radiotherapy and, more particularly, to the use of a compound or a cell population in the prevention and / or treatment of radiotherapy neurological side effects.

[0004] BACKGROUND ART

[0005] Radiotherapy (RT) is currently the most effective treatment to limit tumor progression, either in the brain or in other central nervous system (CNS) locations. Advancements in clinical protocols have enabled personalized RT treatment by accurately delivering the dose to the tumor although the maximum irradiation dose that can be administered remains subjected to the toxicity induced in the surrounding healthy tissues. This problem is critical for brain tumors, especially in pediatric patients, where RT is frequently associated with adverse events at the neurocognitive level that include learning, memory, and attention deficits, as well as a variation of mood disorders.

[0006] The main causes of cognitive impairment are the loss of hippocampal neurons and dendritic spines, changes in myelin plasticity, and neuroinflammation. Several preclinical studies highlight the role of microglia (the CNS resident macrophages) as the main mediator of cognitive decline after cancer therapies such as RT. In a physiological state, microglia maintain cerebral homeostasis through synaptic pruning. However, upon pathological or inflammatory states instigated by antitumoral therapies, microglia transition to a neurotrophic state that results neurotoxic. It has been demonstrated that the blockade of microglia through colony stimulation receptor (CSF1 R) inhibitors prevents side effects of whole-brain irradiation in preclinical models. In addition to microglia, there is growing evidence pointing to the role of other immune system components in neurological diseases, either playing a detrimental or protective function. Peripheral T lymphocytes and conventional dendritic cells (eDC), for instance, have been shown to contribute to neurodegeneration and neuroprotection in ischemia models, respectively. However, it remains unclear to what extent the non-CNS resident immune cells contribute to neurocognitive decline upon brain inflammation caused by radiotherapy.

[0007] Advances in brain cancer treatments have increased survival in recent decades.

[0008] However, this survival is usually accompanied by side effects associated with the treatment that limit the quality of life of patients and their family environment. Today, the vast majority of strategies against brain tumors are based on radiotherapy, which, despite improvements in protocols, induces adverse effects at the neurocognitive level that include deficiencies in learning, memory, attention, and mood disorders.

[0009] Therefore, there is still a need in the state of the art to develop new strategies to minimize radiotherapy associated neurocognitive side effects and improve the quality of life of patients who have survived brain cancer.

[0010] SUMMARY OF THE INVENTION

[0011] The object of the present invention relates to a compound or cell population for use in the prevention and / or treatment of cognitive-decline disorders derived from radiotherapy.

[0012] Thus, in a first aspect, the present invention relates to a compound selected from the group consisting of:

[0013] (a) the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof,

[0014] (b) a polynucleotide encoding the polypeptide defined in a),

[0015] (c) a vector comprising the polynucleotide as defined in b),

[0016] (d) a host cell comprising the sequence as defined in a), the polynucleotide as defined in b) or the vector as defined in c), and

[0017] (e) a pharmaceutical composition comprising the sequence as defined in a), the polynucleotide as defined in b), the vector according to c) or the host cell as defined in d) and a pharmaceutically acceptable carrier, diluent or solute, for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0018] In a second aspect, the invention relates to the dendritic cell population for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0019] DESCRIPTION OF THE FIGURES

[0020] Figure 1. cDC1 deficiency increases brain irradiation-induced neurocognitive decline. (A) Schematic illustration of cranial irradiation and neurological evaluation experiments performed in 3-week-old mice. The NOR and MWM behavioral tests were performed to evaluate cognition 30 and 90 days after irradiation. (B) The Discrimination index differences (% DI Differences; NOR test) and amount of time spent in the target quadrant (in seconds; MWM test) of C57BI / 6J (n=10) and Batf3ko mice (n=10). Student's t-test was used to study the data. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

[0021] Figure 2. cDC1 deficiency increases neuronal dysfunction and the induction of reactive microglia and A1-like astrocytes in brain-irradiated mice. (A and B) Representative immunofluorescence (up) and quantification (down of NeuN, doublecortin (DOX), and synaptophysin (Synap) of brain collected from C57BI / 6J (n=4) and Batf3ko mice (n=4) at the indicated time points (15 and 120 days) after irradiation and quantification of the images. (C) Spine density analysis using the Golgi-Cox assay in brain slides from C57BI / 6J (n=4) and Batf3ko mice (n=4). (D) Representative images and quantification of Iba1+CD68+; (E) Iba1+MAP2+ and (F) GFAP+C3+ co-location assessed by double immunofluorescence in brain slides from C57BI / 6J (n=4) and Batf3ko mice (n=4) upon sham or 10Gy-brain irradiation. All images were taken in the hippocampal dentate gyrus at days 15 and 120 post-radiotherapy. Scale bar represents 33 pm. Student's t-test (panel C) or Two-way ANOVA (panel A-B, D-F) was used to study the data followed by a Turkey post-hoc test in case it reached significant values. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01 ; ***p<0.001 ; ****p<0.0001).

[0022] Figure 3. DNGR-1 blockade augments irradiation-associated cognitive decline. (A) Discrimination index change (%DI Loss / gain) and time on target quadrant (in seconds) of IgG (n=10), IgG+RT (n=10) and aClec9a+RT (n=10) treated wild-type mice. (B) Quantification of immunofluorescence of NeuN, (C) doublecortin (DCX) and (D) Synaptophysin (Synap.). (E) Spine density analysis using Golgi-Cox. (F) Representative images and quantification of Iba1+CD68+; and (G) GFAP+C3+ co-location assessed by double immunofluorescence in brain slides from of IgG (n=4), IgG+RT (n=4) and aClec9a+RT (n=4) treated wild-type mice. All images were taken in the hippocampal dentate gyrus at days 15 and 120 post-radiotherapy. Scale bar represents 33pm. (H) Heat map of proinflammatory cytokines and (I) the differentially expressed neurotrophic factors from mouse brains 120 days after the indicated treatment (n=4 per group). Two- way ANOVA (panel A-E and F-G) or One-way ANOVA (E, H, and I) was used to study the data, followed by a Turkey posthoc test in case it reached significant values. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01 ; ***p<0.001 ; ****p<0.0001). Figure 4. DC-ACT reverse radiation neuronal damage. (A) Schematic illustration of the DC-ACT workflow. eDC were obtained from bone marrow precursors during two weeks of differentiation and expansion. At day 0, 1x106of cDC1 and 0.5x106of cDC2 were administered intravenously followed by 10Gy brain irradiation. On day 15, mice were sacrificed to evaluate neurological and glial status. (B) Quantification of NeuN and doublecortin (DCX), and (C) Synaptophysin (Synap.) markers assessed by immunofluorescence from mice in the indicated groups of treatment. (D) Fold loss / gain of Iba1 / CD68 co-location and (E) microglia phenotype analysis from Iba1+ cells assessed by immunofluorescence. (F) Quantification of Iba1+MAP2+; and (G) GFAP+C3+ colocation assessed by double immunofluorescence in the hippocampal dentate gyrus at days 15. n=4. One-way ANOVA was used to study the data followed by a Turkey posthoc test in case it reached significant values. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

[0023] Figure 5. Dendritic cell expansion restores neurological brain functions. (A) Schematic illustration of the experiment workflow. Dendritic cells were expanded by hydrodynamic injection of FLT3L-coding plasmid (100pg / mouse) one week before brain irradiation (10Gy). (B) cDC1 percentage present in brains and meninges 15 days after being injected with saline or the FLT3L-coding plasmid. (C and D) ELISA quantification of the FLT3L levels present in serum and brain seven days after the hydrodynamic injection. (E) Discrimination index change (%DI Loss / gain) and time in the target quadrant in saline (n=10), saline+RT (n=11), FLT3L (n=10), and FLT3L+RT (n=11) treated mice at the indicated time points after brain irradiation. (F) Quantification of NeuN, doublecortin (DCX) and Synaptophysin (Synap.) neuronal markers in the hippocampal dentate gyrus assessed by immunofluorescence. (G) Analysis and representative images of the spine density assed by Golgi-Cox. (H) Quantification of Iba1+CD68+; and (E) GFAP+C3+ co-location assessed by double immunofluorescence in the hippocampal dentate gyrus at days 15 and 180. (I) Heat map of the differentially expressed proinflammatory cytokines and (J) neurotrophic factors at day 180 (n=4mice / group). Student's t-test (B), One-way ANOVA (C, D, G, I and J), and Two-way ANOVA (E, F, H) were used to study the data followed of a Turkey post-hoc test in case it reached significant values. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

[0024] Figure 6. eDC expansion prevents neurocognitive decline in brain-tumor survivor mice treated with local radiotherapy. (A) Schematic illustration of the experiment workflow. One week prior to locoregional radiotherapy (6,8Gy two consecutive days), mice received a hydrodynamic injection of saline or FLT3L-coding plasmid. At day 100, survivor mice received a second irradiation following the same hypofractionated schedule. Behavioral tests were performed one- and three-months post-treatment and three months post-reirradiation. (B) Discrimination index change (%DI Loss / gain) and time in the target quadrant in sham (n=10), RT (n=15), and FLT3L+RT (n=15). (C) Correlation analyses of the serum FLT3L levels (7 days post-hydrodynamic injection) and behavioral test results. (D) %DI Loss / gain ten days pre- and 30 days post- reirradiation in the RT and FLT3L-RT groups (left). Correlation analysis of serum FLT3L levels and %DI Loss / gain (right). Two-way ANOVA (B, D left) and Pearson correlation (C and D right) analysis were used to study the data, followed by a Turkey posthoc test in case it reached significant values. Bar graphs indicate the mean ± SEM. (ns, p>0.05; *p<0.05; **p<0.01 ; ***p<0.001 ; ****p<0.0001).

[0025] DETAILED DESCRIPTION OF THE INVENTION

[0026] FLT3L-based compositions for use as protective agents for the cognitive damage that results from radiotherapy

[0027] The authors of the present invention have found that the polypeptide known as the FMS- like tyrosine kinase 3 ligand (FLT3L) shows a protective effect on the cognitive damage that results from radiotherapy. Without wishing to be bound by any theory, this effect seems to be caused by the effect that this molecule shows on the proliferation of dendritic cells in the periphery and their recruitment to the brain. Accordingly, the invention relates to compound for use in the prevention of the cognitive damage associated with radiotherapy in a subject suffering from cancer.

[0028] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the first aspect, the invention relates a compound selected from the group consisting of:

[0029] (a) FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof,

[0030] (b) a polynucleotide encoding the polypeptide defined in a),

[0031] (c) a vector comprising the polynucleotide as defined in b),

[0032] (d) a host cell comprising the sequence as defined in a), the polynucleotide as defined in b) or the vector as defined in c), and

[0033] (e) a pharmaceutical composition comprising the sequence as defined in a), the polynucleotide as defined in b), the vector according to c) or the host cell as defined in d) and a pharmaceutically acceptable carrier, diluent or solute, for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0034] The present invention relates to a method for preventing and / or treating the cognitive damage associated with a radiotherapy treatment in a subject comprising the steps of administering a compound selected from the group consisting of:

[0035] (a) the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof,

[0036] (b) a polynucleotide encoding the polypeptide defined in a),

[0037] (c) a vector comprising the polynucleotide as defined in b),

[0038] (d) a host cell comprising the sequence as defined in a), the polynucleotide as defined in b) or the vector as defined in c), and

[0039] (e) a pharmaceutical composition comprising the sequence as defined in a), the polynucleotide as defined in b), the vector according to c) or the host cell as defined in d) and a pharmaceutically acceptable carrier, diluent or solute.

[0040] The present invention also relates to the use of a compound selected from the group consisting of:

[0041] (a) the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof,

[0042] (b) a polynucleotide encoding the polypeptide defined in a),

[0043] (c) a vector comprising the polynucleotide as defined in b),

[0044] (d) a host cell comprising the sequence as defined in a), the polynucleotide as defined in b) or the vector as defined in c), and

[0045] (e) a pharmaceutical composition comprising the sequence as defined in a), the polynucleotide as defined in b), the vector according to c) or the host cell as defined in d) and a pharmaceutically acceptable carrier, diluent or solute, for the manufacture of a medicament for the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0046] In one embodiment, the compound for use according to the invention is an FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof. The term “Feline McDonough Sarcoma (FMS)-like tyrosine kinase 3 ligand” or “FMS-like tyrosine kinase 3 ligand”, “Flt3lg”, “Ly72L” or “FLT3L” is used herein to refer to a polypeptide which is a hematopoietic cytokine that binds to FMS-like tyrosine kinase 3 receptor (FLT3) receptor. In a particular embodiment, the compound for use according to the invention is human FLT3L. In some embodiments, the compound for use according to the present invention is the soluble isoform of FLT3L or the membrane-bound FLT3L as defined in the UniProtID database under accession numbers P49771-1 (entry version 27-Mar-2024) or P49771-2 (entry version 27-Mar-2024). In one embodiment, the FLT3L for use according to the present invention is the mature form of the human FLT3L isoform 1 (Accesion number NP_001191431 in the GenPept database having a release date of 6 April 2024). In another embodiment, the FLT3L for use according to the present invention is the mature form of the human FLT3L isoform 1 (Accession number NP_001191432 in the GenPept database having a release date of 6 April 2024). In another embodiment, the FLT3L for use according to the present invention is the mature form of the human FLT3L isoform 2 (Accession number NP_001265566 in the GenPept database having a release date of 6 April 2024). In another embodiment, the FLT3L for use according to the present invention is the mature form of the human FLT3L isoform 2 (Accession number NP_001450 in the GenPept database having a release date of 4 April 2024).

[0047] In a more preferred embodiment, the compound for use according to the invention comprises, consists, or essentially consists of the soluble isoform of FLT3L as defined in the UniProtID database under accession numbers P49771-2 (entry version 27-Mar- 2024).

[0048] In some embodiments, the FLT3L comprises, consists, or essentially consists of the amino acid sequence as defined in SEQ ID NO: 1 , which corresponds to the full-length FLT3L) which is:

[0049] 1 MTVLAPAWSP TTYLLLLLLL SSGLSGTQDC SFQHSPI SSD FAVKIRELSD YLLQDYPVTV 61 ASNLQDEELC GGLWRLVLAQ RWMERLKTVA GSKMQGLLER VNTEIHFVTK CAFQPPPSCL 121 RFVQTNI SRL LQETSEQLVA LKPWITRQNF SRCLELQCQP DSSTLPPPWS PRPLEATAPT 181 APQPPLLLLL LLPVGLLLLA MWCLHWQRTR RRTPRPGEQV PPVPSPQDLL LVEH where Bold = leader sequence, Underlined: extracellular region not part of receptor binding domain, Italic =transmembrane and intracellular domain. In some embodiments, the FLT3L comprises, consists or essentially consists of the amino acid sequence as defined in SEQ ID NO: 1 as defined above but wherein the signal sequence has been cleaved.

[0050] In some embodiments, the FLT3L comprises, consists or essentially consists of the amino acid sequence as defined in SEQ ID NO: 2, which corresponds to the mature FLT3L extracellular domain and which is:

[0051] 1 TQDCSFQHSP I SSDFAVKIR ELSDYLLQDY PVTVASNLQD EELCGGLWRL VLAQRWMERL 61 KTVAGSKMQG LLERVNTEIH FVTKCAFQPP PSCLRFVQTN I SRLLQETSE QLVALKPWIT 121 RQNFSRCLEL QCQPDSSTLP PPWSPRPLEA TAPTAPQP

[0052] In some embodiments, the FLT3L comprises, consists, or essentially consists of the amino acid sequence as defined in SEQ ID NO: 3, which corresponds to the shorter version of the mature FLT3L extracellular domain and which is:

[0053] 1 TQDCSFQHSP I SSDFAVKIR ELSDYLLQDY PVTVASNLQD EELCGGLWRL VLAQRWMERL

[0054] 61 KTVAGSKMQG LLERVNTEIH FVTKCAFQPP PSCLRFVQTN I SRLLQETSE QLVALKPWIT

[0055] 121 RQNFSRCLEL QCQPDSSTLP PPWSPRPLE

[0056] In some embodiments, the FLT3L comprises, consists, or essentially consists of the amino acid sequence as defined in SEQ ID NO: 4 which corresponds to the FLT3L extracellular domain minimal functional domain (Savvides et al., 2000, Nature Structural Biology, 7:486-91) which is

[0057] 1 TQDCSFQHSP I SSDFAVKIR ELSDYLLQDY PVTVASNLQD EELCGGLWRL VLAQRWMERL 61 KTVAGSKMQG LLERVNTEIH FVTKCAFQPP PSCLRFVQTN I SRLLQETSE QLVALKPWIT 121 RQNFSRCLEL QCQP

[0058] In some embodiments, the FLT3L comprises, consists or essentially consists of the amino acid sequence as defined in SEQ ID NO: 5 which corresponds to the FLT3L extracellular domain minimal functional domain (Savvides et al., 2000, Nature Structural Biology, 7:486-91) and which is characterized in that it starts at the first cysteine and ends at the last cysteine and which is

[0059] 1 CSFQHSPI SS DFAVKIRELS DYLLQDYPVT VASNLQDEEL CGGLWRLVLA QRWMERLKTV 61 AGSKMQGLLE RVNTEIHFVT KCAFQPPPSC LRFVQTNI SR LLQETSEQLV ALKPWITRQN 121 FSRCLELQC

[0060] The term “functionally equivalent variant”, refers to any polypeptide which results from the insertion or addition of one or more amino acids and / or from the deletion of one or more amino acids and / or from the conservative substitution of one or more amino acids with respect to the polypeptide of any one of SEQ ID NO: 1-5 and / or which results from the chemical modification of the polypeptide of any one of SEQ ID NO: 1-5 and which substantially preserves the activity of the FLT3L polypeptide. Functionally equivalent variants of the FLT3L according to the invention will preferably show at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 105%, at least 1 10%, at least 1 15%, at least 120%, at least 125%, at least 130%, at least 135%, at least 140%, at least 145%, at least 150%, at least 200% or more of the capacity of the native FLT3L to promote the expansion of eDC, wherein the proliferation-promoting effect is measured, for instance, using the assay disclosed in Laouar Y. et al. (Immunity. 2003; 19:903-912. doi: 10.1016 / S1074- 7613(03)00332-7 ) in which the phosphorylation of STAT3 during the generation of pDCs from bone marrow HSCs is detected, the assay disclosed in Maraskovsky E., et al- (J. Exp. Med. 1996;184:1953-1962) in which expansion of granulocyte-macrophage colony-forming units (CFLI-GM) and granulocyte, erythrocyte, monocyte, megakaryocyte colony-forming units (CFU-GEMM) is measured or the assay disclosed by Brasel K., et al., (Blood. 2000;96:3029-3039). In which the generation of murine dendritic cells from FLT3-ligand-supplemented bone marrow cultures is measured.

[0061] Preferably, the functionally equivalent variant refers to any polypeptide that results from the insertion or addition of one or more amino acids and / or from the deletion of one or more amino acids and / or from the conservative substitution of one or more amino acids with respect to the polypeptide of SEQ ID NO: 1 to 5 and which substantially preserves the capability of promoting the expansion of eDC of FTL3L; more preferably results from the insertion or addition of one or more amino acids with respect to the polypeptide of SEQ ID NO: 1 to 5.

[0062] Suitable functionally equivalent variants include polypeptides consisting essentially of the polypeptide of SEQ ID NO: 1 to 5. In this context, "consisting essentially of" means that the specified molecule would not contain any additional sequences that would alter the activity of the SEQ ID NO: 1 to 5.

[0063] In a preferred embodiment, the functionally equivalent variant of SEQ ID NO: 1 to 5 is a polypeptide which results from the insertion or addition of one or more amino acids with respect to the polypeptide of SEQ ID NO: 1 to 5. In an embodiment, the functionally equivalent variant results from the insertion of less than 10 amino acids, more preferably less than 5 amino acids, more preferably results from the insertion of one amino acid.

[0064] In another embodiment, the functionally equivalent variant of any one of SEQ ID NO: 1 to 5 is a polypeptide which results from the deletion of one or more amino acids with respect to the polypeptide of any one of SEQ ID NO: 1 to 5. In an embodiment, the functionally equivalent variant results from the deletion of less than 10 amino acids, more preferably less than 5 amino acids, more preferably results from the deletion of one amino acid.

[0065] Functionally equivalent variants of the polypeptide are those showing a degree of identity with respect to the peptide of any one of SEQ ID NO:1 to 5 of about greater than 25% amino acid sequence identity, such as 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. The degree of identity between two polypeptides is determined using computer algorithms and methods that are widely known for the persons skilled in the art. The identity between two amino acid sequences is preferably determined by using the BLASTP algorithm as described previously (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 1990; 215: 403-410). In a preferred embodiment, the sequence identity is determined throughout the whole length of the polypeptide of SEQ ID NO: 1 or throughout the whole length of the variant or of both.

[0066] The functionally equivalent variants of the FLT3L for use according to the invention may also include post-translational modifications, such as glycosylation, acetylation, isoprenylation, myristoylation, proteolytic processing, etc.

[0067] In another embodiment, suitable functional variants of the targeting peptide are those wherein one or more positions within the polypeptide for use according to the invention contain an amino acid which is a conservative substitution of the amino acid present in the protein mentioned above. "Conservative amino acid substitutions" result from replacing one amino acid with another having similar structural and / or chemical properties. For example, the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). Selection of such conservative amino acid substitutions is within the skill of one of ordinary skill in the art and is described, for example, by Dordo et al., (J. Mol. Biol, 1999, 217; 721-739) and Taylor et al., (J. Theor. Biol., 1986, 119:205-218).

[0068] The terms "polypeptide" and "peptide" are used interchangeably herein to refer to polymers of amino acids of any length. The FLT3L or variant thereof for use according to the invention can comprise modified amino acids, and it can be interrupted by non- amino acids. In a preferred embodiment the polypeptide is exclusively formed by amino acids.

[0069] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Furthermore, the term "amino acid" includes both D- and L-amino acids (stereoisomers).

[0070] The term "natural amino acids" or “naturally occurring amino acids” comprises the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.

[0071] As used herein, the term "non-natural amino acid" or “synthetic amino acid” refers to a carboxylic acid, or a derivative thereof, substituted at position “a” with an amine group and being structurally related to a natural amino acid. Illustrative non- limiting examples of modified or uncommon amino acids include 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2- aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3- diaminopropionic acid, N-ethylglycine, N-ethylasparagine, hydroxy lysine, alio hydroxy lysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N- methylglycine, N-methylisoleucine, 6-N-methyl-lysine, N-methylvaline, norvaline, norleucine, ornithine, etc.

[0072] The polypeptide for use according to the present invention may also comprise non-amino acid moieties, such as for example, hydrophobic moieties (various linear, branched, cyclic, polycyclic or heterocyclic hydrocarbons and hydrocarbon derivatives) attached to the peptides; various protecting groups which are attached to the compound’s terminals to decrease degradation. Suitable protecting functional groups are described in Green and Wuts, "Protecting Groups in Organic Synthesis", John Wiley and Sons, Chapters 5 and 7, 1991.

[0073] Chemical (non-amino acid) groups present in the polypeptide may be included in order to improve various physiological properties such as decreased degradation or clearance; decreased repulsion by various cellular pumps, improve various modes of administration, increased specificity, increased affinity, increased stability, bioavailability, solubility, decreased toxicity and the like.

[0074] "Mimetic" includes molecules that mimic the chemical structure of a peptidic structure and retain the functional properties of the peptidic structure. Approaches to designing peptide analogous, derivatives and mimetics are known in the art.

[0075] In another embodiment, the compound for use according to the invention is a polynucleotide encoding the FLT3L polypeptide according to part (a), this part is from the first and second aspects of the invention.

[0076] The terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably to refer to polymeric forms of nucleotides of any length. The polynucleotides may contain deoxyribonucleotides, ribonucleotides, and / or their analogs. Nucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The term "polynucleotide" includes, for example, singlestranded, double-stranded and triple helical molecules, a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. In addition to a native nucleic acid molecule, a nucleic acid molecule of the present invention may also comprise modified nucleic acid molecules. As used herein, mRNA refers to an RNA that can be translated in a cell.

[0077] In a preferred embodiment, the polynucleotide for use according to the invention is a DNA molecule. DNA can be chemically synthesized or can be obtained by means of in vitro amplification of a template AND or synthesized in vivo in a target cell. The nucleotide sequences that form the polynucleotide for use according to the invention are in the same correct reading frame for expression thereof.

[0078] In a preferred embodiment, the compound for use according to the invention is a DNA encoding for a polypeptide consisting of the sequence SEQ ID NO: 1 to 5 as defined above or a polypeptide consisting of a functionally equivalent variant of SEQ ID NO: 1 to 5.

[0079] In another embodiment, the compound for use according to the invention is a vector comprising the polynucleotide of the invention, as defined in part (b) of the present invention. The term “vector”, as used herein, refers to a nucleic acid sequence comprising the necessary sequences so that after transcribing and translating said sequences in a cell, a polypeptide encoded by the polynucleotide of the invention is generated. Said sequence is operably linked to additional segments that provide for its autonomous replication in a host cell of interest. Preferably, the vector is an expression vector, which is defined as a vector which, in addition to the regions of the autonomous replication in a host cell, contains regions operably linked to the nucleic acid of the invention and which are capable of enhancing the expression of the products of the nucleic acid according to the invention. The vectors for use according to the invention can be obtained by means of techniques widely known in the art.

[0080] Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. Suitable vectors comprising a polynucleotide of the invention are vectors derived from expression vectors in prokaryotes such as pUC18, pUC19, pBluescript and their derivatives, mp18, mp19, pBR322, pMB9, ColE1 , pCRI, RP4, phages and “shuttle” vectors such as pSA3 and pAT28, expression vectors in yeasts such as vectors of the 2-micron plasmid type, integration plasmids, YEP vectors, centromeric plasmids and similar, expression vectors in insect cells such as the vectors of the pAC series and of the pVL series, expression vectors in plants such as vectors of the series pl Bl, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE and similar and expression vectors in superior eukaryote cells based on viral vectors (adenovirus, virus associated to adenovirus as well as retrovirus and, in particular, lentivirus) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg, pHCMV / Zeo, pCR3.1 , pEFI / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXI, pZeoSV2, pCI, pSVL, pKSV-10, pBPV-1 , pML2d and pTDT1. In a preferred embodiment, the polynucleotide for use according to the present invention is comprised in a plasmid. The vector preferably comprises the polynucleotide for use according to the invention operationally bound to sequences that regulate the expression of the polynucleotide. The regulatory sequences of use in the present invention may be nuclear promoters or, alternatively, enhancer sequences and / or other regulatory sequences that increase expression of the heterologous nucleic acid sequence. In principle, any promoter can be used in the present invention provided said promoter is compatible with the cells wherein the polynucleotide is to be expressed. Thus, promoters suitable for realizing the present invention include, but are not necessarily limited to, constitutive promoters such as derivatives of eukaryotic virus genomes such as polyoma virus, adenovirus, SV40, CMV, avian sarcoma virus, hepatitis B virus, the metallothionein gene promoter, the herpes simplex virus thymidine kinase gene promoter, LTR regions of retroviruses, the immunoglobulin gene promoter, the actin gene promoter, the EF-1 alpha gene promoter as well as inducible promoters wherein protein expression depends on the addition of a molecule or exogenous signal, such as tetracycline systems, the NFKB / UV light system, the Cre / Lox system and the heat shock genes promoter, the regulable RNA polymerase II promoters described in WO / 2006 / 135436 and tissue-specific promoters.

[0081] In another embodiment, the compound for use according to the invention is a host cell comprising the FLT3L polypeptide as defined in part (a), the polynucleotide as defined in part (b), the vector as defined in part (c), all parts are from the invention. The term “host cell” means any cell of any organism that is modified, transformed, or manipulated by the addition of the FLT3L polypeptide as defined in part (a), the polynucleotide as defined in part (b), the vector as defined in part (c), all parts are from the invention. It will be understood that the host cells, according to the invention, are capable of expressing and secreting to the extracellular medium the FLT3L polypeptide or the variant thereof.

[0082] Host cells for use according to the invention include without limitation, cardiomyocytes, adipocytes, endothelial cells, epithelial cells, lymphocytes (B and T cells), mastocytes, eosinophils, vascular intima cells, primary cultures of isolated cells of different organs, preferably of cells isolated from Langerhans islets, hepatocytes, leukocytes, including mononuclear leukocytes, mesenchymal, umbilical cord or adult (of skin, lung, kidney and liver), osteoclasts, chondrocytes and other connective tissue cells. Cells of established lines such as Jurkat T cells, NIH-3T3, CHO, Cos, VERO, BHK, HeLa, COS, MDCK, 293, 3T3 cells, C2C12 myoblasts and W138 cells are also suitable. Persons skilled in the art will appreciate that the cells capable of secreting into the medium the FTL3L or variant thereof for use according to the present invention may be found forming microparticles or microcapsules so that the cells have a greater useful life in patients. Materials suitable for the formation of microparticles object of the invention include any biocompatible polymeric material which permits continuous secretion of the therapeutic products and which acts as support for the cells. Thus, said biocompatible polymeric material may be, for example, thermoplastic polymers or hydrogen polymers. Examples of thermoplastic polymers are acrylic acid, acrylamide, 2-aminoethyl methacrylate, poly(tetrafluoroethylene-cohexafluorpropylene), methacrylic-(7-cumaroxy) ethyl ester acid, N-isopropyl acrylamide, polyacrylic acid, polyacrylamide, polyamidoamine, poly(amino)-p-xylylene, poly(chloroethylvinylether), polycaprolactone, poly(caprolactone-co-trimethylene carbonate), polycarbonate urea) urethane, poly(carbonate) urethane, polyethylene, polyethylene and acrylamide copolymer, polyethylene glycol, polyethylene glycol methacrylate, poly(ethylene terephthalate), poly(4-hydroxybutyl acrylate), poly(hydroxyethyl methacrylate), poly(N-2-hydroxypropyl methacrylate), poly(lactic glycolic acid), poly(L-lactic acid), poly(gamma-methyl, L- glutamate), poly(methylmethacrylate), polypropylene fumarate), polypropylene oxide), polypyrrole, polystyrene, poly(tetrafluoroethylene), polyurethane, polyvinyl alcohol, polyethylene of ultra-high molecular weight, 6-p-vinylbenzamide)-hexanoic acid N-p- vinylbenzyl-D-maltonamide and copolymers containing more than one of said polymers. Examples of polymers of hydrogel type are natural materials of alginate, agarose, collagen, starch, hyaluronic acid, bovine serum albumin, cellulose and their derivatives, pectin, chondroitin sulphate, fibrin and fibroin, as well as synthetic hydrogels such as Sepharose® and Sephadex®.

[0083] In another embodiment, the compound for use according to the invention is a pharmaceutical composition comprising the sequence as defined in part (a), the polynucleotide as defined in part (b), the vector as defined in part (c) or the host cell as defined in part (d) of the invention, and a pharmaceutically acceptable carrier, diluent or solute.

[0084] The term “pharmaceutical composition” refers to a form that allows the biological activity of the active ingredient contained therein to be effective and has an acceptable toxicity for the subject to which the composition is administered.

[0085] The term “pharmaceutically acceptable carrier” means any substance that serves to improve the delivery and the effectiveness of the active principle within the pharmaceutical composition. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, as well as combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives, or buffers, which enhance the shelf life or effectiveness of components forming part of the compositions for use of the invention. Examples of proper carriers are well known in the literature (see, for example Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995). Examples of carriers without limitation are a series of saccharides such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, and maltitol; a series of starch such as corn starch, wheat starch, rice starch, and potato starch; a series of cellulose such as cellulose, methyl cellulose, sodium carboxy methyl cellulose, and hydroxyl propylmethyl cellulose; and a series of filler such as gelatin and polyvinyl pyrrolidone. In some cases, a disintegrant such as cross-linked polyvinyl pyrrolidone, agar, alginic acid, or sodium alginate may be added.

[0086] The number and the nature of the pharmaceutically acceptable excipients depend on the desired dosage form. The pharmaceutically acceptable excipients are known by the person skilled in the art (Fault y Trillo C. (1993) “Tratado de Farmacia Galenica”, Luzan 5, S.A. Ediciones, Madrid). Said compositions can be prepared by means of the conventional methods known in the state of the art (“Remington: The Science and Practice of Pharmacy”, 20th edition (2003) Genaro A.R., ed., Lippincott Williams & Wilkins, Philadelphia, US).

[0087] As used herein, the term “diluent” refers to saline, aqueous buffer solutions, solvents, and / or dispersion media. The use of such carriers and diluents is well known in the art. The pharmaceutical composition comprising the compound for use according to the present invention comprises the compound in a therapeutically effective amount.

[0088] The expression “therapeutically effective amount”, as used herein, is understood as an amount capable of providing a therapeutic effect, and which can be determined by the person skilled in the art by commonly used means. The amount of the FLT3L polypeptide, of the functionally equivalent variant thereof, polynucleotide, vector, host cell or pharmaceutical composition vary depending upon the subject and the particular mode of administration. Those skilled in the art will appreciate that dosages may also be determined with guidance from Goodman and Goldman's The Pharmacological Basis of Therapeutics, Ninth Edition (1996), Appendix II, pp. 1707-1711 and from Goodman and Goldman's The Pharmacological Basis of Therapeutics, Tenth Edition (2001), Appendix II, pp. 475-493.

[0089] The appropriate dosage of the active principle within the pharmaceutical composition will depend on the type of disease to be treated, the severity and course of the cognitive damage associated with radiotherapy treatment, whether the composition is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the peptide or polypeptide, and the discretion of the attending physician. Doses of the compound for use according to the invention may be expressed either in mg of compound per kg of body weight or in mg of compound per square meter of body surface. The article from Reagan-Shaw S. et al. (Reagan-Shaw S. et al. “Dose translation from animal to human studies revisited’’. FASEB J 2008, 22(3):659-661) provides the standard conversion factors used to convert mg / kg to mg / m2.

[0090] Dose (mg / kg) x Km = Dose (mg / m2)

[0091] The article also explains that this conversion is the basis for converting dose in a first animal species to dose in a second animal species (allometric dose translation). Thus, animal dose (AD) in mg / kg can be converted to human equivalent dose (HED) in mg / kg using the following formula:

[0092] Animal

[0093] HED (mg / kg) = AD (mg / kg) X

[0094] Human wherein the Kmfor each species is shown in Table 1 (data extracted from Reagan-Shaw S. et al. “Dose translation from animal to human studies revisited’’. FASEB J 2008, 22(3):659-661).

[0095] Table 1. Kmfactor for conversion of AD to HED

[0096] The present invention relates to the use of a compound as defined above in the prevention and / or treatment of the cognitive damage associated with radiotherapy treatment in a subject.

[0097] The term “prevention” is understood as the administration of the compound for use according to the invention in an initial or early stage of the cognitive damage associated with a radiotherapy treatment or to also prevent its onset. In a particular embodiment, the term “prevention” refers to the administration of the compound prior to the radiotherapy treatment. In another particular embodiment, the term “prevention” refers to the administration of the compound prior to the manifestation of cognitive damage associated with a radiotherapy treatment, i.e. before symptoms manifest.

[0098] The term “treatment” is used to designate the administration of the compound for use according to the invention to control the progression of the cognitive damage associated with a radiotherapy treatment before or after the clinical signs have appeared. Control of the progression of the cognitive damage associated with a radiotherapy treatment is understood as the beneficial or desired clinical results, which include but are not limited to: reduction of the symptoms, reduction of the duration of the disease, stabilization of pathological conditions (specifically avoiding additional impairment), delaying the progression of the cognitive damage, improving the pathological condition and remission (both partial and complete). The control of the progression of the disease also involves a prolongation of survival in comparison to the expected survival if the treatment was not applied. In a preferred embodiment, the control of the progression of the disease is measured as reduction in cognitive damage.

[0099] The term “cognitive damage associated with radiotherapy”, is used in the present invention to refer to the reduction of the cognitive function due to the irradiation treatment by about 5%, about 10%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more, compared to the cognitive function measured in an age- matched normal subject.

[0100] The term "cognitive function" refers to the mental processes of a subject relating to information gathering and / or processing; the understanding, reasoning, and / or application of information and / or ideas; the abstraction or specification of ideas and / or information; acts of creativity, problem-solving, and possibly intuition; and mental processes such as learning, perception, and / or awareness of ideas and / or information. The mental processes are distinct from those of beliefs, desires, and the like. In some embodiments, the cognitive damage is characterized by one or more of the following symptoms: hippocampal-related learning and memory dysfunction, focal neurological deficits, increased intracranial pressure, secondary epilepsy and / or progressive dementia or impaired learning, processing speed, memory, executive function or attention.

[0101] In some embodiments, the subject which is treated according to the present invention has developed the cognitive damage as a result of the radiotherapy administered for the treatment of a neoplastic disease and a non-neoplastic disease that benefits from radiotherapy.

[0102] The term “radiotherapy” or "radiation therapy" refers to a therapy using ionizing radiation to control or kill malignant cells. Common side effects of radiotherapy include, but are not limited to, acute side effects (such as nausea, vomiting, damage to the epithelial surfaces, mouth, throat and stomach sores, intestinal discomfort, swelling, infertility, etc.), late side effects (such as fibrosis, epilation, dryness, lymphedema, cardiovascular disorder, cognitive decline, radiation enteropathy, radiation-induced polyneuropathy), and cumulative side effects. Also, radiotherapy refers to a single administration of radiation to a subject or a regimen of two or more radiation treatments administered to a subject to treat the subject’s cancer. It will be understood that the term "regimen" as used means one or a plurality of radiation treatments prescribed to a subject to treat a disease in the subject. For example, upon a diagnosis of a cancer in a subject, a healthcare professional may prescribe a regimen of one or more radiation administrations to treat the cancer in the subject.

[0103] In an embodiment, the subject has acquired cognitive damage as a result of radiotherapy administered to treat cancer, more typically brain cancer.

[0104] The term “cancer” or “tumor” or “tumor disease” as used herein, refers to a disease characterized by uncontrolled cell division (or by an increase of survival or apoptosis resistance) and by the ability of said cells to invade other neighboring tissues (invasion) and spread to other areas of the body where the cells are not normally located (metastasis) through the lymphatic and blood vessels, circulate through the bloodstream, and then invade normal tissues elsewhere in the body. Depending on whether or not they can spread by invasion and metastasis, tumors are classified as being either benign or malignant: benign tumors are tumors that cannot spread by invasion or metastasis, i.e., they only grow locally; whereas malignant tumors are tumors that are capable of spreading by invasion and metastasis. As used herein, the term cancer includes, but is not limited to, the following types of cancer: primary brain cancer, secondary brain cancer, metastasis from any type of cancer, head and neck cancer, chordoma, spinal cord cancer and microcytic lung carcinoma.

[0105] In a particular embodiment, the neoplastic disease is selected from: primary brain cancer, secondary brain cancer, metastasis, head and neck cancer, bone marrow cancer, spinal cord cancer, microcytic lung carcinoma, chordoma, Ewing’s Sarcoma, leukemia or malignant vascular tumors.

[0106] As used herein, the term “primary brain cancer” refers to a tumor that arises in the brain and includes but is not limited to: gliomas, medulloblastomas, glioneuronal and neuronal tumors, choroid plexus tumors, embryonal tumors, ependymomas, pineal tumors, cranial nerve and paraspinal nerve tumors (including schwannomas and acoustic neurofibromas, among others), meningiomas, non-meningothelial mesenchymal tumors, melanocytic tumors, hematological tumors infiltrating the central nervous system, lymphomas, histiocytic tumors, germ cell tumors and selar region tumors.

[0107] As used herein, "secondary brain cancer" or "metastatic brain cancer" or "metastatic brain tumor" or "secondary brain tumor" occurs when cancer cells spread to the brain from a primary cancer elsewhere in the body, forming a tumor or tumors in the brain. Such brain cancers are about ten times more common than a cancer that starts or originates in the brain, which is known as "primary brain cancer." Cancer cells can break away from the primary tumor site and travel through blood and lymphatic vessels. Metastases most often appear in the brain at the junction of two types of brain tissue, referred to as gray matter and white matter. This junction is rich with blood vessels of very narrow diameter, and metastatic cells often lodge there.

[0108] Metastatic brain tumors are often multifocal in nature and are also referred to herein as "multifocal brain metastases." Although multifocal brain metastases can develop from almost any kind of cancer, those originating in the breast, lung, colon, and kidney, along with malignant melanoma, are the most likely to metastasize to the brain. About half of patients with brain metastases have more than one tumor in the brain.

[0109] In most patients with brain metastases, tumors appear in the cerebral cortex, the two large hemispheres of the brain where most high-level functions (such as consciousness, memory, language, and sensory perception) are governed. Fifteen percent of brain metastases develop in the cerebellum, where complex voluntary muscle movements are regulated and coordinated. Five percent of metastatic tumors develop in the brain stem, where functions such as visual coordination, swallowing, and balance are directed. In a small number of patients, brain metastases appear before the primary cancer is discovered in another part of the body. This is called a "metastasis of unknown origin." These tumors can develop when a patient's primary cancer, while still undetected or undetectable at its original site, sends out metastatic cells that travel to the brain and establish themselves there. In these patients, physicians can sometimes biopsy the tumor (depending on its location in the brain), identify the type of cells it is composed of, and determine its site of origin.

[0110] Symptoms of brain metastases are quite varied and depend on the location and size of the tumor or tumors. These symptoms can include, for example, headaches, seizures, speech problems, comprehension problems, impaired vision, weakness or numbness in parts of the body, and motor problems.

[0111] The term “head and neck cancer”, as used herein, refers to any of the cancers of the oral cavity, throat (pharynx, including the nasopharynx, oropharynx, and hypopharynx), larynx, paranasal sinuses, nasal cavity, and salivary glands. Head and neck cancers include hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, metastatic squamous neck cancer, nasopharyngeal cancer, oropharyngeal cancer, paranasal sinus and nasal cavity cancer, and salivary gland cancer. This term includes, but is not limited to for example: clivus tumors or parotid tumors. The clivus adjacent to the bilateral medial temporal lobe -hippocampus- is radiated and therefore these patients have a Korsakoff's syndrome: they are not able to register anything and they cannot retain any information.

[0112] As used herein, the term “bone marrow cancer” refers to cancers that originate in the soft, sponge-like tissue inside the bones called the bone marrow. This vital tissue is responsible for producing various blood cells. Including red blood cells, white blood cells and platelets. The “bone marrow cancer” may include, but it is not limited, multiple myeloma, leukemia and lymphoma.

[0113] As used herein, the term “spinal cord cancer” refers to a tumor in the spinal cord that can be caused by tumors from other parts of the body that spread to the vertebrae, the supporting network around the spinal cord or, in rare cases, the spinal cord itself.

[0114] As used herein, the term “chordoma” refers to a rare slow-growing neoplasm thought to arise from cellular remnants of the notochord. It most often forms where the skull sits atop the spine (skull base) or at the bottom of the spine (sacrum). Radiation therapy is often recommended after surgery for skull base chordoma to kill any cancer cells that might remain. If surgery isn't an option, radiation therapy may be recommended instead. The term “Ewing’s Sarcoma”, as used herein, refers to a type of cancer that begins as a growth of cells in the bones and the soft tissue around the bones. Radiotherapy has been used for localized disease. The tumor has a unique property of being highly sensitive to radiation, but the main drawback is that it recurs dramatically after some time.

[0115] As used herein, the term “leukemia” refers to a collective term for diseases that appear in blood where neoplastic hemopoietic cells multiply unlimitedly. Leukemia, in which the cancer cells have lost differentiation ability, is called acute leukemia, while leukemia in which the cancer cells retain differentiation ability, is called chronic leukemia. In addition, when the origin of the cancer is a myeloid cell, the leukemia is grouped into myelocytic leukemia. Meanwhile, when the origin of the cancer is a lymphoid cell, the leukemia is grouped into lymphocytic leukemia. Thus, leukemia is roughly classified into four groups: acute myelogenous leukemia (AML), chronic myelogenous leukemia (CML), acute lymphoid leukemia (ALL), and chronic lymphoid leukemia (CLL). The classification also includes acute promyelocytic leukemia (APL), atypical leukemia (AUL), myelomonocytic leukemia (AMMoL), and juvenile chronic myelogenous leukemia (JCML). Furthermore, types of leukemia include acute monocytic leukemia (AMoL), chronic monocytic leukemia (CMoL), erythroleukemia, eosinophilic leukemia, basophilic leukemia, megakaryoblastic leukemia, plasma cell leukemia, chloroma, chronic neutrophilic leukemia, adult T-cell leukemia, lymphosarcoma cell leukemia, hairy cell leukemia, and prolymphocytic leukemia. There is no limitation on the type of leukemia in the present invention; however, preferred leukemia includes leukemia with expression of the MLL (Mixed Lineage Leukemia) fusion gene (MLL leukemia) and leukemia with expression of the MOZ (Monocytic Leukemia Zinc-finger) fusion gene (MOZ leukemia), which are intractable acute leukemia.

[0116] In some embodiments, the subject suffers from malignant vascular tumors. The term includes several forms of malignant tumors, such as hemangioendothelioma, angiosarcoma, and Kasabach-Merritt syndrome.

[0117] In an embodiment, the subject suffers from microcytic lung cancer and receives prophylactic whole-cranial radiotherapy to reduce the risk of the appearance of brain metastasis.

[0118] As used herein, the term “microcytic lung carcinoma” refers to a type of lung cancer characterized by small cells that multiply quickly and are prone to early spread. The disease can be treated with radiotherapy. Concretely, the radiotherapy treatment is prophylactic holocranial radiotherapy. These patients with a small-cell lung carcinoma without metastasis undergo a preventive prophylactic holocranial radiotherapy to kill possible cells so that they do not develop metastasis. The consequences of this preventive prophylactic holocranial radiotherapy leave the patient with severe cognitive neurological sequelae, such as dementia in a few years in many cases.

[0119] In some embodiments, the subject has acquired cognitive damage as a result of radiotherapy administered in order to treat a non-neoplastic disease that benefits from radiotherapy. Examples of these types of diseases include, without limitation, is selected from the group consisting of vascular malformations, hypersalivation, a tauopathy, essential tremor, Parkinson disease, refractory focal epilepsy, acoustic neuroma and arteriovenous malformations (AVMs).

[0120] The term “vascular malformations”, as used herein, refers to abnormal blood vessel changes. The term vascular malformations include, but it is not limited, these types: capillary malformations, venous malformations, arteriovenous malformations (AVMs), lymphatic malformations, and combined malformations (such as venous-lymphatic malformations). There are syndromes that involve vascular malformations such as: Klippel Trenaunay (KT) syndrome, Parkes Weber syndrome, generalized lymphatic anomaly, Gorham’s (or Gorham-Stout) syndrome or Cowden Syndrome.

[0121] As used herein, the term “hypersalivation” refers to excess saliva in patients with neurodegenerative diseases that lead to swallowing problems and, therefore, accumulation of saliva in the mouth. The radiotherapy treatment consist of irradiation of the glands so that they do not produce saliva.

[0122] As used herein, the term “tauopathy” is used to refer to a class of neurodegenerative diseases characterized by the aggregation of abnormal tau protein. The term includes, without limitation, Pick Disease (PiD), Progressive Supranuclear Palsy (PSP), and Corticobasal Degeneration (CBD)

[0123] The term “essential tremor”, as used herein, refers to one of the most common neurological disorders, affecting less than 0.9 percent of the general population. Essential tremor is characterized by an action tremor of the upper limbs and, less commonly, the head, voice, and trunk. A family history of essential tremor can be identified in approximately half of patients, suggesting a genetic component.

[0124] “Parkinson's disease” also referred to herein as Parkinson’s disease or PD is a degenerative disorder of the central nervous system that often impairs the sufferer's motor skills, speech, and other functions (Jankovic J et al., April 2008, J. Neurol.

[0125] Neurosurg. Psychiatr. 79 (4): 368-76).

[0126] The term “refractory focal epilepsy”, also known as uncontrolled, intractable, or drugresistant epilepsy, occurs when medications fail to bring seizures under control.

[0127] As used herein, the term “acoustic neuroma”, also known as a vestibular schwannoma refers to a noncancerous tumor that develops on the main nerve leading from the inner ear to the brain.

[0128] The term “arteriovenous malformations (AVMs)”, as used herein, refers to a defect in the blood vessels, often, but not exclusively, associated with the brain or spinal cord. An arteriovenous malformation or AVM is an abnormal grouping of blood vessels connecting arteries and veins that can disrupt normal blood flow and, hence, oxygen circulation. The presence of an AVM can lead to inadequate oxygenation of tissues as well as weakening and rupture of the arteries and / or veins. In one aspect, the compositions disclosed herein can be used to treat an AVM such as, for example, by strengthening weakened blood vessel walls or by embolizing improperly formed vessels. The term includes congenital vascular anomalies of veins, lymph vessels, or arteries. Lesions may remain stable through life of patient but can cause significant morbidity and mortality through brain involvement, limb overgrowth, and lymphatic malformations.

[0129] The term “subject”, as used herein, refers to an individual, such as a human, a nonhuman primate (e.g., chimpanzees and other apes and monkey species); farm animals, such as birds, fish, cattle, sheep, pigs, goats and horses; domestic mammals, such as dogs and cats; laboratory animals including rodents, such as mice, rats and guinea pigs. The term does not denote a particular age or sex. In a preferred embodiment of the invention, the subject is a mammal.

[0130] The term “mammal” includes, but is not restricted to, domestic and farm mammals, primates and humans, e.g., human beings, non-human primates, cows, horses, pigs, sheep, goats, dogs, cats or rodents.

[0131] In another particular embodiment, the subject is human.

[0132] In a more particular embodiment, the subject is a pediatric patient or an adolescent or young adult (aya). The terms "pediatric" and "pediatric individual" are used interchangeably herein to refer to individuals from the age of greater than 0 year to 14 years or less. The term “aya” are used to individuals from the age of 15 to 39 or less.

[0133] In another embodiment, the radiotherapy is administered to the whole brain. In another particular embodiment, the radiotherapy is administered locally to the brain. In a more particular embodiment, the radiotherapy is administered regionally to the brain.

[0134] In whole body radiotherapy, the radiation treatment is mainly aimed at the treatment of metastatic cancer that has spread throughout the body.

[0135] In local radiotherapy, radiation is applied to a small area, such as a tumor.

[0136] In regional radiotherapy, radiation is applied to large areas of tissue, such as a body cavity organ, or limb.

[0137] The total dose of radiations delivered can be given following different schedules such as single dose, fractionated doses, hypofractionated doses, hyperfractionated doses, etc. In a preferred embodiment, the radiotherapy is administered as single dose or as fractionated doses.

[0138] As used herein, the term “single dose radiotherapy” refers to a radiotherapy treatment comprising only one radiation administration.

[0139] The term “fractionated dose radiotherapy” refers to a treatment schedule in which the total dose of radiation is divided in more than one dose.

[0140] In a more preferred embodiment, the subject has received more than one dose.

[0141] In another embodiment, the single dose is from about 1 .8 to about 161.5 Gy. In another embodiment, the single dose is from about 10 to about 150 Gy. In another embodiment, the single dose is from about 20 to about 130 Gy. In another embodiment, the single dose is from about 30 to about 120 Gy. In another embodiment, the single dose is from about 40 to about 110 Gy. In another embodiment, the single dose is from about 50 to about 100 Gy. In another embodiment, the single dose is from about 60 to about 90 Gy. In another embodiment, the single dose is from about 70 to about 80 Gy. Preferably, the single dose is from about 54 to about 80 Gy. More preferably, the single dose is from about 54 to about 60 Gy.

[0142] In another embodiment, the fractionated total dose is from about 1.8 to about 161.5 Gy. In another embodiment, the fractionated total dose is from about 10 to about 150 Gy. In another embodiment, the fractionated total dose is from about 20 to about 130 Gy. In another embodiment, the fractionated total dose is from about 30 to about 120 Gy. In another embodiment, the fractionated total dose is from about 40 to about 110 Gy. In another embodiment, the fractionated total dose is from about 50 to about 100 Gy. In another embodiment, the fractionated total dose is from about 60 to about 90 Gy. In another embodiment, the fractionated total dose is from about 70 to about 80 Gy. Preferably, the fractionated total dose is from about 54 to about 70 Gy. More preferably, the fractionated total dose is from about 54 to about 64 Gy.

[0143] In some embodiments, the compound for use according to the present invention is administered by following a schedule selected from the group consisting of: about 30 Gy of holocraneal radiotherapy in 10 fractions, between 45 to 70 Gy in fractions of between 1 .8 and 2 Gy each, about 40 Gy in 15 fractions or between 25 to 39 Gy in a single fraction or in between 3 and 5 fractions.

[0144] In another embodiment, the dose per fraction is from about 1 to about 10 Gy. In another embodiment, the dose per fraction is from about 2 to about 9 Gy. In another embodiment, the dose per fraction is from about 3 to about 8 Gy. In another embodiment, the dose per fraction is from about 4 to about 7 Gy. In another embodiment, the dose per fraction is from about 5 to about 6 Gy. Preferably, the dose per fraction is from about 8 to about 10 Gy. More preferably, the dose per fraction is from about 5 to about 6 Gy. More preferably, the dose per fraction is from about 1 .8 to about 2 Gy. More preferably, the dose per fraction is about 3 Gy.

[0145] In a preferred embodiment, the compound is administered prior to the beginning of the radiotherapy treatment. In a more preferred embodiment, the compound is administered from about 1 week to about 4 weeks prior to the beginning of the radiotherapy treatment. In a more preferred embodiment, the compound is administered from about 1 week to about 3 weeks prior to the beginning of the radiotherapy treatment. In a more preferred embodiment, the compound is administered from about 1 week to about 2 weeks prior to the beginning of the radiotherapy treatment. In a more preferred embodiment, the compound is administered in a single administration or multiple administrations at a therapeutic effective dose.

[0146] In a particular embodiment, the dose is from about 25 pg / kg to about 520 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 500 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 450 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 400 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 350 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 300 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 250 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 200 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 150 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 100 pg / kg. In a particular embodiment, the dose is from about 25 pg / kg to about 50 pg / kg. In a more particular embodiment, the dose is from about 32 pg / kg to about 130 pg / kg.

[0147] The compound of the invention may be administered locally or systemically. For example, without limitation, the compound according to the disclosure can be administered orally, nasally, ocularly or parenterally. In one embodiment, the compound is administered locoregionally. In another embodiment the compound is administered parenterally.

[0148] The term “parenterally”, as used herein, refers to modes of administration which include intravascular (intraarterial or intravenous), intramuscular, intradermal, intracranial, intraperitoneal, intracisternal, subcutaneous and intraarticular injection and infusion. Preferably, the compound for use according to the invention is administered intratumorally, locoregionally, subcutaneously, intravenously, intramuscularly or intranasally.

[0149] In an embodiment, wherein the compound for use according to the present invention is a polynucleotide or a vector comprising said polynucleotide wherein the polynucleotide encodes the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 , 2, 3 or 4 or a functionally equivalent variant thereof, then the compound is administered parenterally, preferably intravenously.

[0150] In another embodiment, wherein the compound for use according to the present invention is a polynucleotide or a vector comprising said polynucleotide wherein the polynucleotide encodes the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 , 2, 3 or 4 or a functionally equivalent variant thereof, then the compound is administered intravenously by a hydrodynamic injection.

[0151] In another embodiment, wherein the compound for use according to the present invention is the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 , 2, 3 or 4 or a functionally equivalent variant thereof, then the compound is administered subcutaneously.

[0152] In another embodiment, in those cases in which the compound is used on patients suffering from a neoplastic disease and in which the neoplastic disease is to be treated by radiotherapy, the compounds is administered intratumorally.

[0153] In a still more preferred embodiment, wherein the compound for use according to the present invention is a polypeptide, then the compound is administered:

[0154] (a) at a dose of 25 pg / kg subcutaneously for several consecutive days,

[0155] (b) at a single dose of 25 mg,

[0156] (c) at a dose of between 32 to 130 pg / kg subcutaneously.

[0157] In another embodiment, wherein the compound for use in the present invention is a polynucleotide or a vector encoding said polynucleotide, then the compound is administered intravenously and, more preferably, by a hydrodynamic injection.

[0158] As used herein, the term "hydrodynamic injection" refers to an in vivo gene delivery method where an engineered plasmid (e.g., a viral plasmid) containing a nucleic acid molecule encoding a protein of interest (e.g., the FLT3L or variant thereof for use according to the invention) in a large fluid volume is rapidly injected intravenously into a subject. Hydrodynamic injection uses controlled hydrodynamic pressure in veins to enhance cell permeability such that the elevated pressure from the rapid injection of the large fluid volume results in fluid and plasmid extravasation from the vein. Generally, the nucleic acid molecule is put under the control of a strong promoter in the engineered plasmid. The expression of the nucleic acid molecule is driven primarily by the liver. In mice, hydrodynamic injection is often performed by injection of the plasmid into the tail vein.

[0159] In a particular embodiment, the polynucleotide encoding FLT3L having the sequence SEQ ID NO: 1 or a functionally equivalent variant according to the invention is administered subcutaneously, intravenously, intramuscularly, intranasally or intravenously by a hydrodynamic injection.

[0160] Adoptive cell therapy using dendritic cells in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject

[0161] The authors of the present invention have found that a dendritic cell population shows a protective effect on the cognitive damage that results from radiotherapy. Accordingly, in a second aspect, the invention relates to a dendritic cell population for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0162] In one embodiment, the dendritic cell population for use according to the present invention is selected from the group consisting of:

[0163] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+,

[0164] (b) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+,

[0165] (c) A dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1)+,

[0166] (d) A m dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN)high and

[0167] (e) A combination of two or more of the above.

[0168] The invention also relates to a method for the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject in need thereof wherein the method comprises the administration to the patient of a dendritic cell population, wherein the dendritic cell population is selected from the group consisting of:

[0169] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+,

[0170] (b) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+,

[0171] (c) A dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1)+,

[0172] (d) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN)high and

[0173] (e) A combination of two or more of the above.

[0174] The invention also relates to the use a dendritic cell population, wherein the dendritic cell population is selected from the group consisting of:

[0175] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+, (b) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+,

[0176] (c) A dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1)+,

[0177] (d) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN)high and

[0178] (e) A combination of two or more of the above. for the preparation of a medicament for the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

[0179] All definitions of terms used in the context of the present aspect of the invention are equally applicable are equally applicable to the second aspect of the present invention to dendritic cells.

[0180] The term “dendritic cell”, as used herein, refers to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. Dendritic cells are a class of “professional” antigen presenting cells, and have a high capacity for sensitizing H LA-restricted T cells. Specifically, the dendritic cells include, for example, conventional dendritic cells (previously called myeloid dendritic cells that include two clusters, cDC1 and cDC2), bone marrow dendritic cells (generally used dendritic cells, including immature and mature dendritic cells), Langerhans cells (dendritic cells important as antigen-presenting cells in the skin), interdigitating cells (distributed in the lymph nodes and spleen T cell region, and believed to function in antigen presentation to T cells), follicular dendritic cells (important as antigen-presenting cells for B cells), plasmacytoid dendritic cell (a rare type of immune cell known to secrete large quantities of type 1 interferon (IFNs) in response to a viral infection) and monocyte-derived dendritic cell (develop from monocytes play a key role in innate inflammatory responses as well as T-cell priming). Dendritic cells may be recognized by function, or by phenotype, particularly by cell surface phenotype. These cells are characterized by their distinctive morphology (having veil-like projections on the cell surface), intermediate to high levels of surface H LA-class II expression and ability to present antigen to T cells, particularly to naive T cells. See Steinman R, et al., Ann. Rev. Immunol. 1991 ; 9:271-196. The cell surface of dendritic cells is characterized by the expression of the HLA-DR cell surface marker and others like CD141+, Clec9a+, XCR1+, CD1c+, CD123+.CD11b+ and CD303.

[0181] In an embodiment, the dendritic cell population for use according to the second aspect of the invention wherein: (a) the dendritic cell population which is CD141+, Clec9a+, XCR1 + and CD11c+ is also positive for one or more of the HLA-DR, CD13 and CD33 markers.

[0182] (b) The dendritic cell population which is CD1c+, CD11c+, CD123+ and CD11 b+ is also positive for one or more of the HLA-DR, CD13, CD33, CD32, CD64, FCERI, CD2, CD45RO, HLA-DR and CD172 (SIRP-a) marker,

[0183] (c) the dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA- 4 / Neuropilin-1)+ is also positive for one or more of HLA-DR, CD123, CD4, CD45RA and CD11 c low or

[0184] (d) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC- SIGN) high is also negative for CD83.

[0185] The dendritic cell population which is CD141+, Clec9a+, XCR1+ and CD11c+ were generated as described in the Examples in the section “Generation of conventional dendritic cells (eDCs)”.

[0186] The dendritic cell population which is CD1c+, CD11c+, CD123+ and CD11 b+ were generated as described in the Examples in the section “Generation of conventional dendritic cells (eDCs)”.

[0187] The dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA- 4 / Neuropilin-1)+ were generated as described in Ngo, C. et al. (Cellular & Molecular Immunology, 2024).

[0188] The dendritic cell population which is HLA-DR+ CD14- CD11b+ and CD209 (DC-SIGN) high were generated as described in Quiroga Chometon, T et al. (Pios One, 2020).

[0189] Various techniques for determining if a cell is positive or negative for a specific marker are known.

[0190] The presence / absence of a marker in a cell can be determined, for example, by means of flow cytometry using conventional method and apparatus. For example, a BD LSR II flow cytometer (BD Biosciences Corp., Franklin Lakes, NJ, USA) with commercially available antibodies and following protocols known in the art can be used. Therefore, cells emitting a signal for a specific cell surface marker that is stronger than the background noise can be selected. The background signal is defined as the signal strength produced by a non-specific antibody of the same isotype as the specific antibody used for detecting each surface marker in the conventional FACS analysis. To consider a marker positive, the specific signal observed must be 20%, preferably, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 500%, 1000%, 5000%, 10000%, or higher, stronger than the background signal using conventional methods and apparatus (for example using a FACSCalibur flow cytometer (BD Biosciences Corp., Franklin Lakes, NJ, USA) and commercially available antibodies). Otherwise, the cell is considered negative for said marker.

[0191] The level of a biomarker is considered “increased” or “high” when the level of said biomarker in a sample is higher than a reference value. The levels of a biomarker are considered to be higher than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more higher than its reference value.

[0192] On the other hand, the level of a biomarker is considered “decreased” or “low” when the level of said biomarker in a sample is lower than a reference value. The levels of a biomarker are considered to be lower than its reference value when it is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more lower than its reference value.

[0193] In an embodiment, the dendritic cell population for use according to the present invention is a population which is CD141+, Clec9a+, XCR1+and CD11c+and is also positive for one or more of the HLA-DR, CD13 and CD33 markers.

[0194] In an embodiment, the dendritic cell population for use according to the present invention is a population which is CD1c+, CD11c+, CD123+and CD11b+and is also positive for one or more of the HLA-DR, CD13, CD33, CD32, CD64, FCERI, CD2, CD45RO, HLA-DR and CD172 (SIRP-a) marker.

[0195] In an embodiment, the dendritic cell population for use according to the present invention is a dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA- 4 / Neuropilin-1)+ and is also positive for one or more of HLA-DR, CD123, CD4, CD45RA and CD11c low.

[0196] In some embodiment, the dendritic cell population for use according to the present invention is a dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN) high is also negative for CD83.

[0197] In another embodiment, the dendritic cell population for use according to the present invention comprise at least:

[0198] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+and,

[0199] (b) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+,

[0200] In another embodiment, the dendritic cell population for use according to the present invention comprise at least:

[0201] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+, and

[0202] (b) A dendritic cell population which is CD303 (BDCA-2) + and CD304 (BDCA-4 / Neuropilin-1) +.

[0203] In another embodiment, the dendritic cell population for use according to the present invention comprise at least:

[0204] (a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+, and

[0205] (b) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN) high.

[0206] In another embodiment, the dendritic cell population for use according to the present invention comprise at least:

[0207] (a) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+, and

[0208] (b) A dendritic cell population which is CD303 (BDCA-2) + and CD304 (BDCA-4 / Neuropilin-1) +.

[0209] In another embodiment, the dendritic cell population for use according to the present invention comprise at least: (a) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+, and

[0210] (b) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN) high.

[0211] In another embodiment, the dendritic cell population for use according to the present invention comprise at least:

[0212] (a) A dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1) + and,

[0213] (b) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN) high.

[0214] In a preferred embodiment, the dendritic cell population for use according to the present invention is a combination of a dendritic cell population which is CD141+, Clec9a+, XCR1+ and CD11c+ and a dendritic cell population which is CD1c+, CD11c+, CD123+ and CD11b+. In a more preferred embodiment, the two populations forming the mixture contains the CD141+, Clec9a+, XCR1+ and CD11c+ cells and the CD1c+, CD11c+, CD123+ and CD11b+ cells is typically within the range from approximately 0.01:1 to 100:1. Suitable ratios include without limitation for example, 0.05:1, 0.1:1, 0.5:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 100:1, 95:1, 90:1, 85:1, 80:1, 75:1, 70:1, 65:1, 60:1, 55:1, 50, 45:1, 40:1, 35:1, 30:1, 25:1, 20:1, 15:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:0.5, 1:0.1 and 1:0.05.

[0215] In a still preferred embodiment, the ratio of the two populations forming the mixture contains the CD141+, Clec9a+, XCR1+ and CD11c+ cells and the CD1c+, CD11c+, CD123+ and CD11b+ cells at a 2:1 ratio.

[0216] In an embodiment, the dendritic cell population for use according to the present invention is a bone marrow-derived dendritic cell population. In another embodiment, the dendritic cell population for use according to the present invention is a cell population obtained from dendritic cell precursors present in peripheral blood. In a more preferred embodiment, the bone marrow-derived or the peripheral blood-derived dendritic cell population is obtained by treating bone marrow precursors with granulocyte / macrophage colony stimulating factor (GM-CSF) and FLT3L. In a particular embodiment, the dendritic cell population for use according to the present invention is administered subcutaneously, intramuscularly, intranasally or intravenously. In a preferred embodiment, the dendritic cell population for use according to the present invention is administered intravenously.

[0217] In another embodiment, the cognitive damage is characterized by one or more of the following symptoms: hippocampal-related learning and memory dysfunction, focal neurological deficits, increased intracranial pressure, secondary epilepsy and / or progressive dementia or impaired learning, processing speed, memory, executive function or attention.

[0218] In some embodiments, the subject which is treated according to the present invention has developed the cognitive damage as a result of the radiotherapy administered for the treatment of a neoplastic disease and a non-neoplastic disease that benefits from radiotherapy.

[0219] All previous definitions and embodiments related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0220] In a particular embodiment, the neoplastic disease is selected from: primary brain cancer, secondary brain cancer, metastasis, head and neck cancer, bone marrow cancer, spinal cord cancer, microcytic lung carcinoma, chordoma, Ewing’s Sarcoma, leukemia or malignant vascular tumors.

[0221] Regarding this particular embodiment, all previous definitions and embodiments related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0222] In an embodiment, the subject suffers from microcytic lung cancer and receives prophylactic whole-cranial radiotherapy to reduce the risk of the appearance of brain metastasis.

[0223] The “microcytic lung carcinoma” definition related to the corresponding embodiment of the first aspect of the invention is also applicable to the corresponding embodiment of the second aspect of the invention. In some embodiments, the subject has acquired cognitive damage as a result of radiotherapy administered in order to treat a non-neoplastic disease that benefits from radiotherapy. Examples of these types of diseases include, without limitation, is selected from the group consisting of vascular malformations, hypersalivation, a tauopathy, essential tremor, Parkinson disease, refractory focal epilepsy, acoustic neuroma and arteriovenous malformations (AVMs).

[0224] All previous definitions related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0225] In another particular embodiment, the subject is human. In a more particular embodiment, the subject is a pediatric patient or an adolescent or young adult (aya).

[0226] All definitions related to the corresponding embodiment of the first aspect of the invention are also applicable to the corresponding embodiment of the second aspect of the invention.

[0227] In another embodiment, the radiotherapy is administered to the whole brain. In another particular embodiment, the radiotherapy is administered locally to the brain. In a more particular embodiment, the radiotherapy is administered regionally to the brain.

[0228] All previous definitions related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0229] In another embodiment, the radiotherapy is administered as a single dose or fractionated doses.

[0230] All previous definitions and embodiments related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0231] In another embodiment, the single dose is from about 1.8 to about 161.5 Gy. Suitable single radiation dose ranges from the current embodiment of the second aspect of the invention are as defined in the corresponding embodiment of the first aspect of the invention. In another embodiment, the fractionated total dose is from about 1.8 to about 161.5 Gy. Suitable fractionated total radiation dose ranges from the current embodiment of the second aspect of the invention are as defined in the corresponding embodiment of the first aspect of the invention.

[0232] In some embodiments, the dendritic cell population for use according to the present invention is administered by following a schedule selected from the group consisting of: about 30 Gy of holocraneal radiotherapy in 10 fractions, between 45 to 70 Gy in fractions of between 1.8 and 2 Gy each, about 40 Gy in 15 fractions or between 25 to 39 Gy in a single fraction or in between 3 and 5 fractions.

[0233] All previous definitions and embodiments related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0234] In a preferred embodiment, the compound is administered prior to the beginning of the radiotherapy treatment. Suitable administration time ranges from the current embodiment of the second aspect of the invention are as defined in the corresponding embodiment of the first aspect of the invention.

[0235] All previous definitions and embodiments related to the corresponding embodiment of the first aspect of the invention are also applicable to the current embodiment of the second aspect of the invention.

[0236] ***

[0237] The invention will be described by way of the following examples which are to be considered as merely illustrative and not limitative of the scope of the invention.

[0238] EXAMPLES

[0239] Materials and Methods

[0240] Cell lines and culture conditions

[0241] The murine diffuse intrinsic pontine glioma cell line NP53 was provided by Dr. Becher (Mount Sinai, NY, USA). NP53 was maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with inactivated 10% fetal bovine serum (FBS) and 1% streptomycin / penicillin in a humidified atmosphere of 37°C and 5% CO2. This cell line was authenticated at the CIMA Genomic Core Facility (Pamplona, Spain) using DNA profiling and it was routinely tested for mycoplasma (Mycoalert mycoplasma detection kit; Lonza).

[0242] Animal studies

[0243] Animal experimental procedures were reviewed and approved by the Animal Ethical Committee of the University of Navarra (CEEA) and the Committee of Bioethics of the Government of Navarra under protocol number CEEA / 073-21 E4. Three to four weeks old C57BI / 6J (Envigo Laboratories) and B6.129S(C)-Batf3tmKmm / J (breeding protocol CEEA / 105c-22) were used in this study with equal numbers of each sex included. The mice were maintained in the veterinary facilities of the Center for Applied Medical Research (CIMA) in specific pathogen-free conditions and fed standard laboratory chow. All animal studies were performed at the veterinary facilities of the center in accordance with institutional, regional, and national ethical laws and guidelines of animal experimentation.

[0244] Clec9a blockade’. One day prior to irradiation, mice were treated with 100 pg of DNGR- 1 blocking antibody (clone 7H11 , BioXCell) or isotype-matched control for six consecutive days.

[0245] FLT3L treatment. One week prior to irradiation, in vivo eDC expansion by hydrodynamic injection of mouse FLT3L-coding plasmid was performed. Briefly, 10 pg of pUMVC3- mFLex plasmid (Biomedical Research Core Facilities, Michigan) was diluted in 1 ,5 ml of sterilized saline and injected through the tail vein in 3-week-old C57BI / 6J mice. The levels of FLT3L were assessed on days 7 and 15 using the mouse / rat FLT3L Quantikine ELISA kit (R&D systems) following manufacturer instructions. Additionally, conventional DC levels were assessed in the spleen and blood of mice at days 7, 15, and 30 upon hydrodynamic injection.

[0246] Brain tumor model: For the generation of brain tumor-bearing mice the inventors used a guidedscrew system previously described. Briefly, 3-week-old mice were anesthetized by intraperitoneal injection with ketamine Imalgene / xylazine solution (200 mg ketamine and 20 mg xylazine in 17 ml saline) at a dosage of 0.1 mg / 10g body weight. Briefly, the procedure consists of the implantation of a 2.6 mm guide-screw at the skull of mice (1 mm lateral and 0.8 mm posterior to the lambda) and the injection of 10.000 NP53-X1- DTR cells (a diffuse intrinsic pontine glioma cell line derived from the NP53 cell line) in a final volume of 3 pl of DMEM at a 4 mm depth using a Hamilton syringe (Fisher Scientific, Waltham, MA). The cell infusion was performed with an infusion pump (Harvard Apparatus, Holliston, MA) at a ratio of 15 pl per hour. After that, the wound was sutured, and the animals were awakened with an antipamezol (Antisedan; 50ng / g body weight) solution. To alleviate the pain caused by the surgery, a buprenorphine solution (Buprex 0,3 mg; 1 ,2 pg / 20g body weight) was administered subcutaneously every 12 hours. Additionally, protein gels were added to accelerate the recovery of mice. Mice were sacrificed with C02 when they showed symptoms of tumor burden: weight loss, hemiparesis, hunched posturing, and unresponsiveness to stimuli.

[0247] X-ray irradiation

[0248] Brain irradiation was performed with the Small Animal Radiation Research Platform Xray irradiator (SARRP, Xstrahl Ince., Suwanee, GA). Anesthetized mice were placed in a prone position in the X-ray irradiator platform. A 3D image was taken using computed tomography (CT), moving on to whole brain (10Gy dose with 10 x 10 mm collimator) or tumor-focused (6,8Gy / day on two consecutive days with 3 x 3 mm collimator) irradiation. Matched-age and sex sham-irradiated mice were used as control animals.

[0249] Behavioral tests

[0250] Neurocognitive function was assessed 30, 90, 130 and 180 days post-irradiation. Spatial and memory learning were evaluated by first measuring the discrimination capacity for novel objects in the novel object recognition (NOR) task and then assessing the escape latency in the Morris water maze (MWM) task. All tests were carried out in a sound- attenuated room with low-intensity light and scored by the same rater in a blind mode.

[0251] Novel Object Recognition (NOR) test: On the first two days animals were habituated to the square chamber (40 cm x 40 cm x 40 cm) for ten minutes. On training day (day three), two identical objects were placed at both sides of the chamber, letting five minutes of exploration. The objects and the chamber were cleaned with 70% ethanol between each animal pass to eliminate organic remains and odors. On the test day (day four), the right object was replaced by a novel one located in the lower corner of the box. Trials from the third and fourth days were recorded by an overhead camera and analyzed manually by the same person in blind mode. Animals with insufficient exploration (less than 5 seconds of interaction with both objects) during the training or test day were excluded from the analysis. The same set of objects was used in the NOR test conducted 30, 90, 130, and 180 days upon irradiation. The discrimination index percentage (%DI) was calculated as the quotient of the exploration time in the new object over the total. The discrimination index loss (%DI Loss) was calculated by subtracting the %DI after radiotherapy from the one before the irradiation.

[0252] Morris water maze (MWM) test. A grey circular pool (1.2 m in diameter and 55 cm high) filled with 20°C water and non-toxic white paint was used for all phases of the experiment as described previously. The first day, mice underwent a visible-platform train using a white platform raised 2,5 mm above the surface of the opaque water with a familiar object used in the NOR test. The following day, the platform was submerged 1 cm beneath the water surface and 4 cues (flower, star, moon and rectangle) were located in the pools wall, starting the acquisition phase for one week. In both visible- and hidden-platform training, mice were placed four times in random locations of the pool. Each trial was terminated when the animal reaches the platform or after 60 seconds. Mice failing to reach the platform, were manually guided onto it. After each trial, mice remained on the platform for 20 seconds to facilitate memory location acquisition. Twenty-four hours after the 16th and 24th trials, mice underwent a one-minute test in which they swam in the pool with no platform. The trial was recorded by an overhead camera and analyzed manually by the same person in a blind mode. The escape latency was calculated as the amount of time the mice need to reach the platform in the acquisition phase. In the test day, total amount of time in the right quadrant was assessed. Those mice that showed difficulty swimming were removed from the test.

[0253] Histological techniques

[0254] For immunohistochemistry on paraffin-embedded sections, animals were sacrificed with an increased concentration of CO2. The mice's brains were removed from the meninges and fixed for 48 hours in a 4% solution. Coronal and sagittal sections of 4 pm-thick obtained with an HM 340E microtome (Thermo Fisher Scientific, Waltham, MA) were deparaffinized, rehydrated, and stained with hematoxylin and eosin for tumor analysis. For Golgi-Cox staining, mice were sacrificed by C02, and brains were removed from the meninges. After a quick wash in MilliQ water, the brain was divided into its two hemispheres by a sagittal cut. Both parts were immersed in freshly prepared Golgi-Cox impregnation buffer for 3 weeks. Each brain hemisphere was cut into 200-um sections with a VT1200S vibratome (Leica, Wetzlar, Germany), dehydrated, mounted on glass slides (Epredia, Michigan, USA), dried, and covered with a coverslip with DPX (Deltalab, Spain).

[0255] For immunofluorescence on free-floating sections, animals were anesthetized and transcardially perfused with phosphate buffer saline (PBS, pH 7,4) at a rate of 9,5ml / min, followed by 4%PFA in 0,125M PBS for 10 minutes at the same rate. The brain was removed from the meninges and post-fixed overnight in 4% PFA at 4°C. Brains were stored in 30% sucrose / PBS until sink. Coronal 40 pm thick sections were obtained by a Leica SM2000R sliding microtome (Leica, Wetzlar, Germany) and stored in a preserved solution (30% glycerol / 30% ethylene glycol in PBS) at -20°C. Briefly, the free-floating section were washed three times with PBS, and endogenous peroxidase activity was inactivated by incubation in 0,03% H202 (Sigma-Aldrich) / 0,03% methanol for 15 min in darkness. After that, the tissue was washed with PBS and permeabilized by incubation in 0,2% Triton X-100 (Thermo Fisher Scientific, Waltham, MA) for 10 min. Then, the tissue was blocked for unspecific bindings with the blocking solution (4% normal goat / donkey serum, 0,05% Triton X-100, and 4% BSA [Merck, Darmstadt, Germany]) for 1 hour, followed by primary antibody (Table 1) overnight incubation diluted in blocking solution at 4°C. After three washing steps, sections were incubated with the appropriate secondary antibodies (Table 1) conjugated with fluorophores for 1 hour at room temperature and finally stained with DAPI (1 :50.000; Thermo Fisher Scientific, Waltham, MA). Sections were mounted on glass slides (Epredia, Michigan, USA), dried and covered with a coverslip in an anti-fade medium containing DAPI (Abeam, France). Images were acquired in a LSM 800 confocal microscope (Zeiss, Jena, Germany). Three intercalated hippocampal sections of each hemisphere for each animal were taken for the analysis.

[0256] Table 1. List of primary and secondary antibodies used.

[0257] Antibody Cat. Number, Dilution manufacturer

[0258] NeuN 24307, Cell Signalling 1 :200

[0259] Synaptophysin 17785-1 -AP Proteintech 1 :200

[0260] Doublecortin ab18723, Abeam 1 :200

[0261] MAP2 M1406-2ML, Thermofisher 1 :1.000 lba-1 018-28523, Wako 1 :250 lba-1 234004, Synaptic Systems 1 :500

[0262] GFAP 80788, Cell Signalling 1 :200

[0263] CD68 ab53444 Abeam 1 :200

[0264] C3 ab11862, Abeam 1 :50

[0265] AF594 Invitrogen 1 :500

[0266] AF594 A11075, Invitrogen 1 :500

[0267] AF488 4416S, Cell Signalling 1 :200

[0268] AF647 A31573, Invitrogen 1 :500

[0269] AF647 A31571 , Invitrogen 1 :500

[0270] Image For dendritic spines density evaluation, three hippocampal intercalated slices were analyzed for each mouse. Three secondary neuronal branches of the same size of three isolated and independent neurons were selected. Imaged software (National Institutes of Health, MD) was used for dendritic spine quantification. The number of dendritic spines were normalized by the length of the branch.

[0271] For immunofluorescence analysis, a projection stack with the same number of images per section was taken to calculate the fluorescence intensity of NeuN, Synaptophysin, and MAP-2, the co-location percentage of lba-1+ / CD68+ and GFAP+ / C3+ cells. Three sections per animal were used for the analysis. Both hemispheres were studied. Classification of microglia (Iba1+ cells) was performed as described previously by using four types of morphologies: ramified, hypertrophic, bushy, and amoeboid. Ramified microglia are characterized by long and thin branches with a small cell body while the hypertrophic one has a shorter and thicker process with a big cell body. Bushy microglia have few or no branches with thickened cell bodies. Amoeboid microglia have a macrophage-like morphology with no processes and a round cell body. This classification was made manually from six stacks obtained from three hippocampal sections of each hemisphere for each animal. Imaged software was used for obtaining fluorescence intensity, colocation, and percentage cell values.

[0272] RNA Extraction

[0273] Animals were anesthetized and sacrificed with CO2. The brain was removed from the meninges, collecting the hippocampus and prefrontal cortex. The tissues were immediately submerged in liquid nitrogen and stored at -80°C until processing. RNA was extracted from tissues by adding 500 pl Trizol (Life Technologies, Carlsbad, CA). The aqueous phase was collected and placed on columns for further processing with the RNA Extraction kit (Qiagen, Netherlands). The amount and purity of RNA was evaluated with nanodrop (Thermo Fisher Scientific, Waltham, MA).

[0274] Quantitative real-time PCR (qRT-PCR) cDNA was synthesized from 1 pg total RNA by using MMLV reverse transcriptase (Promega, Madison, Wl, USA). Reverse transcription consisted of two incubations, one at 25°C 10 min and 2h at 37°C in the thermal cycler GeneAmp PCR System 2700 (Applied Biosystems, Waltham, MA). Quantitative Real-Time Polymerase Chain Reaction (qRTPCR) was performed using 20 ng of cDNA amplified using the SYBR- Green Master Mix (Applied Biosystems, Watham, MA). Sequences of the primers are list in Table 2. Real time PCR was monitored using ABI 7700 detection system (Applied Biosystems, Foster City, CA) and samples were subjected to the following steps: 95°C for 20 sec followed of 40 cycles of 95°C 1 sec and 60°C 20 sec. Hypoxanthine-guanine phosphoribosyl transferase (HPRT) primers were used as housekeeping gene for endogenous control and all the samples were run in triplicates. Fold-changes of the genes of interest were determined using the 2'AACtmethod and normalized against HPRT.

[0275] Table 2. List of oligonucleotides used.

[0276] Oligonucleotides Sequences

[0277] HPRT FW: TGACACTGGCAAAACAATGC

[0278] RV: GG I CC I I I I CACCAGCAAGC

[0279] BDNF FW: GCCTTGGAGCCTCCTCTAC

[0280] RV: GCGGCA I CCAGG I AA I I I I

[0281] DCX FW: CCCTTGATGGAAAGCAGGTCA

[0282] RV: GCGGAA I I I I I CAGGACCACA

[0283] C1qa FW: TGTCCCACCATCAGCAAAGG

[0284] RV: GTCTCCATGGTGTCCCTGC

[0285] TN Fa FW: GGTGCCTATGTCTCAGCCTCTT

[0286] RV: GCCATAGAACTGATGAGAGGGAG

[0287] I L1 b FW: TGGACCTTCCAGGATGAGGACA

[0288] RV: GTTCATCTCGGAGCCTGTAGTG

[0289] Ccl2 FW: CACTCACCTGCTGCTACTCA

[0290] RV: GCTTGGTGACAAAAACTACAGC

[0291] Ccl7 FW:TGGGAAGCTGTTATCTTCAAGACA

[0292] RV: CTCGACCCACTTCTGATGGG

[0293] Ccl8 FW: ATGGAAGCTu I UU I I I I CCAG

[0294] RV: CCATGTACTCACTGACCCACT

[0295] CxCI2 FW:CCAAAAGATACTGAACAAAGGCAA

[0296] RV: TCTCTTTGGTTCTTCCGTTGAG

[0297] Cx3CI1 FW: GCGACAAGATGACCTCACGA

[0298] RV: TGTCGTCTCCAGGACAATGG

[0299] IL6 FW: CTCATTCTGCTCTGGAGCCC

[0300] RV: CAACTGGATGGAAGTCTCTTGC

[0301] IL18 FW: TTACAAGCATCCAGGCACAGC

[0302] RV: AAGGTTTGAGGCGGCTTTCT

[0303] NLRP3 FW: GGACCAGCCAGAGTGGAATGAC

[0304] RV: CCATCCACTCTTCTTCAAGGCT

[0305] Generation of conventional dendritic cells (eDCs)

[0306] Conventional dendritic cells 1 and 2 from 3-week-old C57BI / 6J mice were generated from bone marrow (BM) precursors. Briefly, tibiae and femur of mice were collected and placed on ice cold PBS. All the following procedures were performed in a laminar flow cabinet under sterile conditions. BM precursors were extracted by flushing with ice-cold PBS using a 5 ml syringe and filtered in a 70 pm-cell strainer (Thermo Fisher Scientific, Waltham, MA). The solution was centrifuged at 1800 rpm 5 min at 4°C and lysed by adding 3ml of the ACK lysing solution (Gibco, A1049-01 , Carlsbad, CA) for 1 ,5 min. Cells were suspended in complete DC medium (RPMI 1640 media supplemented with 10% FBS, 1 % Penicillin / Streptomycin, 0,05mM 2-mercaptoethanol, 1X Glutamax [Thermo Fisher Scientific, Waltham, MA], 1X MEEM [Thermo Fisher Scientific, Waltham, MA], 1X HEPES [Thermo Fisher Scientific, Waltham, MA], 1X Sodium pyruvate [Thermo Fisher Scientific, Waltham, MA], 200 ng / ml FLT3L [BioXCell] and 3.33 ng / ml mGM-CSF [Thermo Fisher Scientific, Waltham, MA]). Cells were seeded at a density of 1 ,5x106 in a T-75 flask and cultured at 37°C in a 5% CO2 humidified atmosphere. At day 3 and 6, half of the total DC medium was added. At day 8, non-adherent cells were collected and centrifuged at 1800 rpm 5 min at room temperature. Cells were resuspended in DC medium and seed at density of 6x105in T-75 flasks. At day 14, DCs subsets were analyzed by flow cytometry using specific antibodies (Table 3). cDC1 are classified as CD11c+MHC-II high XCR1+and cDC2 as CD11c+MHC-II high SIRP1a+. eDC expansion was considered satisfactory when the percentage of cDC1 and cDC2 were 60% and 30% respectively.

[0307] Table 3. List of antibodies used.

[0308] Antibody Cat. Number, manufacturer Dilution

[0309] CD16 / 32 101319, BioLegend 1 :100

[0310] CD45 103128, BioLegend 1 :200

[0311] CD11 b 563553, BioLegend 1 :200

[0312] F4 / 80 123116, BioLegend 1 :200

[0313] CD19 115538, BioLegend 1 :400

[0314] TCRb 109249, BioLegend 1 :100

[0315] CD11c 117318, BioLegend 1 :100

[0316] IA / IE 107641 , BioLegend 1 :300

[0317] SIRPIa 144005, BioLegend 1 :100

[0318] XCR1 148210, BioLegend 1 :100

[0319] Ly6C 130-111-919, Miltenyi Biotec 1 :200

[0320] Adoptive cell transfer (ACT) of eDC

[0321] 1x106cDC1 and 0.5 x106cDC2 were diluted in 100 l of PBS and injected into the tail vein of 3-week-old C57BI / 6J mice. Control mice were injected with 100 pl of PBS.

[0322] Results

[0323] Example 1 - The role of cDC in radiotherapy-induced neurocognitive decline

[0324] It is known that brain radiation causes neural hippocampal death, a reduction in neurogenesis, and an increase in neuro-inflammation in which microglia are the most studied immune component. As there is evidence that microglia and dendritic cells share common features in brain pathologies, the inventors aimed to study the role of eDC in radiotherapy-induced neurocognitive decline. To do so, the inventors subjected wild type and Batf3ko mice that are deficient for such cDC1 to 10Gy-whole brain irradiation (WBI) (Figure 1A) followed by a study of the cognitive function with the behavioral tests Nobel Object Recognition (NOR) and the Morris Water Maze (MWM) one and three months afterward (Figure 1A). Thirty days post-WBI, the object discrimination index difference (i.e. , the DI obtained in irradiated mice versus non-irradiated) significantly decreased in Batf3ko mice compared to their wild-type counterparts. This was maintained over time and the same results were obtained 90 days upon irradiation (Figure 1 B). Similarly to the NOR results, mice that underwent WBI spent less time in the target quadrant of the MWM test than the non-irradiated mice when they lacked cDC1 , showing a higher time on target quadrant differences than their wild-type counterparts at both time points (Figure 1 B).

[0325] These results indicate that cDC1 cells are crucial in regulating neurocognitive decline following irradiation.

[0326] Example 2 - Neurocognitive hippocampal markers such as NeuN and doublecortin (PCX) Next, the inventors studied neurocognitive hippocampal markers such as NeuN and doublecortin (DOX), which stain mature and immature neurons, respectively, and Synaptophysin and Golgi-Cox staining for the evaluation of synaptic plasticity alterations and dendritic spine density. Both wild-type and Batf3ko irradiated mice showed a significant reduction in the NeuN marker in the dentate gyrus of the hippocampus as compared to their respective sham-irradiated controls, reflecting a reduction in the number of mature neurons due to irradiation (Figure 2A). However, such reduction was higher in mice lacking cDC1 as compared to wild-type brains. Neurogenesis was also compromised as the reduction in the number of immature neurons (DCX positive cells) was more significant in the Batf3ko as compared to the wild-type animals (Figure 2B). In the same vein, the fluorescence intensity of synaptophysin (Figure 20), as well as the number of dendritic spines (Figure 2D), which indicate loss of neuronal connectivity, were significantly reduced in Batf3ko mice upon WBI as compared to irradiated wild-type counterparts. These data suggest that the absence of cDC1 affects the viability of mature and immature neurons, leading to early hippocampal synaptic impairments.

[0327] Example 3 - Status of brain-resident populations in the absence of cDCI. To study the status of other brain-resident populations in the absence of cDC1 , the inventors first focused on the phenotype of microglia. The inventors conducted double immunostaining to measure the expression of CD68, which is a well-known receptor for reactive microglia on Iba1 -positive cells. The inventors observed that in steady-state conditions in both wild-type and Batf3ko mice, the co-location area of CD68 / lba1 had similar levels. After WBI, more than half of microglia expressing CD68 were found in Batf3ko mice, which was significantly higher than in the irradiated wild-type mice (Figure 2D). In addition, microglia from irradiated mice contained more MAP2+phagocytic vesicles in their cytoplasm. Indeed, the percentage of the percentage of active phagocytosis (MAP2+microglia) is higher in the Batf3ko mice upon irradiation compared to wild-type mice. (Figure 2E). The inventors’ results show that I ba1+cells from Batf3ko irradiated brains have a phagocytic phenotype, suggesting their contribution to removing hippocampal dying neurons and synaptic pruning.

[0328] Astrocytes are the most abundant glial cells in the central nervous system, which regulate brain functions and can be involved in the pathology of neurodegenerative diseases. Thus, the inventors explored astrocyte status by measuring C3 levels (a neurotoxic astrocyte marker) in the GFAP-positive population. Similarly to what happened with microglia, the co-location percentage of GFAP+C3+ cells was significantly increased in irradiated animals, and within both strains, it was higher in cDC1 -lacking mice, indicating that the absence of dendritic cells causes major recruitment of reactive A1 -astrocytes in the hippocampus (Figure 2F).

[0329] To discard any conditioning related to strain phenotype in the inventors’ observations, the inventors performed an in vivo inhibition of the cDC1 receptor DNGR-1 , a cDC1- specific C-type lectin receptor that senses dying cells and mediates cross-priming. Therefore, C57BI / 6J wild-type mice received brain irradiation in combination with intraperitoneal injections of a blocking antibody against DNGR-1 (anti-Clec9a). Neuronal cognition was assessed before and after the treatment to determine neurocognitive changes. Thirty days upon irradiation, the DI decreased in WBI animals as compared to IgG-control mice, independently of receiving the blockade of Clec9a, although the reduction was significantly higher in anti-Clec9a irradiated mice as compared to IgG- irradiated mice (Figure 3A). In addition, the blocking of Clec9a progressively exacerbated the loss of memory as mice obtained a significant reduction in the NOR test results at later time points (3 months afterward), something that was not observed in the IgG-RT group (Figure 3A). Additionally, spatial memory was assessed by the MWM test, pointing out a working memory loss in anti-Clec9a-treated animals upon radiation, which resulted in a reduction of time in the target quadrant as compared to irradiated mice receiving the IgG (Figure 3A). Similar to the inventors’ observations in Batf3ko mice, the targeting cDC1 through Clec9a upon WBI caused a significant reduction of NeuN fluorescence intensity in the DG compared to the rest of the groups, including radiotherapy with the IgG control antibody (Figure 3B). Likewise, neurogenesis was also more compromised upon the blocking of Clec9a (Figure 30). In addition, it induced a major reduction of Synaptophysin fluorescence intensity (Figure 3D). Of note, these neuronal markers decreased slightly in advanced stages after cranial radiation (day 146); the inventors also reported a decrease in synaptic connections by diminishing the number of dendritic spines (Figure 3E). Regarding the glial cell status, the inventors observed that the Clec9a blockade in irradiated animals significantly augments the presence of CD68-positive microglia and 03-positive astrocytes in the acute phase of inflammation as compared to IgG-sham-irradiated and IgG-irradiated groups, reaching higher values in a more advanced phase of neuroinflammation (Figure 3F and G).

[0330] To better understand the brain microenvironment originated by radiotherapy, the inventors performed a cytokines and chemokine study in the hippocampus. C1Qa, TNFa, IL1b, Ccl2, Ccl7, Ccl8, Cxcl2, 0x3011 , and IL6 expression levels showed a significant increase in the anti-0lec9a group (Figure 3H), with TFN alpha, Ccl8, and IL6 the most significantly upregulated. At the same time, neuronal markers such as BFNF and Doublecortin experienced a significant decrease (Figure 3I).

[0331] Altogether, these data indicate that cDC1 prevents the RT-associated neurocognitive decline through the Clec9a receptor, which is necessary to avoid the generation of a proinflammatory scenario in the brain that may contribute to neurotoxicity.

[0332] Example 4 - The efficacy of neural damage prevention of an adoptive cell transfer (ACT) consisting of conventional dendritic cells

[0333] The inventors evaluated the efficacy of neural damage prevention of an adoptive cell transfer (ACT) consisting of conventional dendritic cells. Thus, 3-week-old mice were intravenously inoculated with a mix of cDC1 and cDC2 (2:1) before WBI. The inventors next evaluated the cognitive damage through the study of neuronal markers and glial cell status (Figure 4A). The DC-ACT managed to completely revert the loss of NeuN fluorescence intensity and synaptic connections assessed by synaptophysin staining and reduced the harmful effect of radiation in DCX-positive immature neurons (Figures 4B and C). Analyses of glial cells showed a reduction in microglia reactivity assessed by a decreased in the presence of CD68-positive cells (Figure 4D). In addition, the percentage of microglia with MAP2 expression and a hypertrophic morphology is lower, suggesting that transferred eDC play a role in controlling an exacerbated microglia phagocytic activity promoted by irradiation (Figures 4E and F). The inventors also observed a significant reduction in astrocyte reactivity in mice receiving ACT-RT compared to only RT. However, the presence of C3-positive astrocytes did not reach the levels observed in saline and ACT non-irradiated mice (Figure 4G).

[0334] The inventors’ data suggested that eDC, in particular type- 1 eDC, could be a therapeutic target to limit neurocognitive decline. Therefore, one week before animals underwent WBI, the inventors performed an in vivo expansion of the dendritic cell populations by overexpressing Flt3L systemically (Figure 5A). Eight days later, the inventors could confirm that the overexpression of Flt3L significantly increased the percentage of cDC1 in the whole brain and the meninges as compared to saline (Figure 5B). Levels of FLT3L were upregulated in the serum of FLT3L-overexpressing mice regardless of RT (Figure 5C). However, its presence in the brain was only detected in mice that have been subjected to radiotherapy (Figure 5D). Results of the NOR and MWM behavioral tests showed that systemic FLT3L completely reverted the cognitive damage caused by radiotherapy an effect that was maintained over time (Figure 5E). In addition, the administration of FLT3L was able to prevent the radiotherapy-related neurotoxic effects on neuronal integrity and plasticity in the hippocampus. Irradiated mice that have received the FLT3L preserved the levels of NeuN, Synaptophysin, and dendritic spines as mice that did not receive RT at early and late time points (Figures 5F-G). FLT3L also avoided the reduction of immature neurons (DCXpositive) as compared to irradiated mice, it recovered similar levels to sham-irradiated saline and FLT3L controls at a later stage. FLT3L treatment suppressed radiotherapy induced microglia and astrocyte reactivity (Figure 5H). Finally, in brains from FLT3LRT mice, the inventors observed a reduction (similar to non-irradiated controls) in the expression of the cytokines and chemokines previously studied, except for Ccl8 although at lower levels than Saline-RT mice it is still significantly augmented compared to the controls (Figure 5I). The BFNF and Double cortin neuronal markers resembled the expression obtained in non-irradiated controls (Figure 5J).

[0335] These data show that FLT3L avoids the neurocognitive decline associated with brain radiation by suppressing glial cell inflammation and thereby preserving neuronal integrity and functionality. Example 5 - The protective effect of systemic FLT3L on brain tumor model sensitive to RT.

[0336] The inventors evaluated the protective effect of systemic FLT3L on brain tumor model sensitive to RT. Two days after the FLT3L-coding plasmid injection, and once the tumor was established in the cerebellum, the inventors treated mice locally with two consecutive doses of 6,8Gy (Figure 6A). Even though in this setting, mice were only irradiated in the cerebellar region, in the absence of FLT3L treatment, there is a loss in the learning (NOR test) and spatial (MWM) memory that is completely reverted with the systemic FLT3L therapy at early and late stages (Figure 6B). Of note, the inventors have found that the concentration of FLT3L in the serum positively correlates with the best results in both, the NOR and the MWM tests (Figure 6C). In addition, at day 100 posttumor inoculation, the inventors performed a second irradiation in the cerebellum. The inventors observed that, unlike mice that have received saline injection, the originally FLT3L-treated mice were still able to prevent a second drop in the learning capacity due to re-irradiation (Figure 6D upper panel). FLT3L-treated animals with better scores in the NOR test following the re-irradiation corresponded to those that previously had higher levels of FLT3L in the sera (Figure 6D lower panel).

[0337] In summary, the in vivo expansion of eDC via FLT3L prevents neurocognitive decline in brain-tumor survivor mice treated with local radiotherapy and can also avoid the cognitive damage exacerbation of a second irradiation schedule.

Claims

CLAIMS1 . A compound selected from the group consisting of:(a) the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof,(b) a polynucleotide encoding the polypeptide defined in a),(c) a vector comprising the polynucleotide as defined in b),(d) a host cell comprising the sequence as defined in a), the polynucleotide as defined in b) or the vector as defined in c), and(e) a pharmaceutical composition comprising the sequence as defined in a), the polynucleotide as defined in b), the vector according to c) or the host cell as defined in d) and a pharmaceutically acceptable carrier, diluent or solute, for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

2. The compound for use according to claim 1 , wherein the functionally equivalent variant of the FLT3L is the polypeptide according to SEQ ID NO: 2.

3. The compound for use according to claims 1 or 2, wherein the compound is administered in a single administration or in multiple administrations at a therapeutic effective dose.

4. The compound for use according to any of claims 1 to 3, wherein the compound is a polynucleotide or a vector comprising said polynucleotide wherein the polynucleotide encodes the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 , 2, 3 or 4 or a functionally equivalent variant thereof and wherein the compound is administered parenterally, preferably intravenously.

5. The compound for use according to claim 4, wherein the compound is administered intravenously by a hydrodynamic injection.

6. The compound for use according to any of claims 1 to 3 wherein the compound is the FMS-like tyrosine kinase 3 ligand (FLT3L) having the sequence SEQ ID NO: 1 or a functionally equivalent variant thereof, and wherein the compound is administered subcutaneously.

7. The compound for use according to claim 6, wherein the compound is administered:(a) at a dose of 25 pg / kg for several consecutive days,(b) at a single dose of 25 mg,(c) at a dose of between 32 to 130 pg / kg.

8. A dendritic cell population for use in the prevention and / or treatment of the cognitive damage associated with a radiotherapy treatment in a subject.

9. The dendritic cell population for use according to claim 8, wherein the dendritic cell population is selected from the group consisting of:(a) A dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+,(b) A dendritic cell population which is CD1c+, CD11c+, CD123+and CD11b+,(c) A dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1)+,(d) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN)high and(e) A combination of two or more of the above.

10. The dendritic cell population for use according to claim 9, wherein:(a) the dendritic cell population which is CD141+, Clec9a+, XCR1+and CD11c+is also positive for one or more of the HLA-DR, CD13 and CD33 markers.(b) The dendritic cell population which is CD1c+, CD11c+, CD123+and CD11 b+is also positive for one or more of the HLA-DR, CD13, CD33, CD32, CD64, FCERI, CD2, CD45RO, HLA-DR and CD172 (SIRP-a) marker,(c) the dendritic cell population which is CD303 (BDCA-2)+ and CD304 (BDCA-4 / Neuropilin-1)+ is also positive for one or more of HLA-DR, CD123, CD4, CD45RA and CD11c low or(d) A dendritic cell population which is HLA-DR+ CD14- CD11 b+ and CD209 (DC-SIGN)high is also negative for CD8311. The dendritic cell population for use according to claims 9 or 10, wherein the dendritic cell population is a combination of the dendritic cell population defined in (a) and the dendritic cell population defined in (b).

12. The dendritic cell population for use according to claim 11 , wherein the mixture of the dendritic cell populations comprises the cells defined in (a) and (b) at a 2:1 ratio.

13. The dendritic cell population for use according to any of claims 8 to 12, wherein the dendritic cell population is a bone marrow derived dendritic cell population.

14. The dendritic cell population for use according to claim 13, wherein the dendritic cell population is obtained by treating bone marrow precursors or peripheral blood precursors with granulocyte / macrophage colony stimulating factor (GM- CSF) and FLT3L.

15. The dendritic cell population for use according to any of claims 8 to 14, wherein the dendritic cell population is administered intravenously.

16. The compound for use according to any of claims 1 to 7 or the dendritic cell population for use according to any of claims 8 to 15, wherein the cognitive damage is characterized by hippocampal-related learning and memory dysfunction, focal neurological deficits, increased intracranial pressure, secondary epilepsy and / or progressive dementia or impaired learning, processing speed, memory, executive function or attention.

17. The compound for use according to any of claims 1 to 7 or the dendritic cell population for use according to any of claims 8 to 15, wherein the subject suffers from a disease selected from a neoplastic disease and a non-neoplastic disease that benefits from radiotherapy.

18. The compound or dendritic cell population for use according to claim 17, wherein the neoplastic disease is selected from the group consisting of a primary brain tumor, a secondary brain tumor, metastasis, a head and neck cancer, a bone marrow cancer, a spinal cord cancer, a microcytic lung carcinoma, a chordoma, an Ewing’s Sarcoma, a leukemia and a malignant vascular tumor.

19. The compound or dendritic cell population for use according to claim 18, wherein the subject suffers from microcytic lung cancer and receives prophylactic whole cranial radiotherapy to reduce the risk of the appearance of brain metastasis.

20. The compound or dendritic cell population for use according to claim 17, wherein the non-neoplastic disease that benefits from radiotherapy is selected from the group consisting of a vascular malformation, a tauopathy, hypersalivation, essential tremor, tremor associated with Parkinson’s disease, refractory focal epilepsy, acoustic neuroma and arteriovenous malformations (AVMs).21 . The compound or dendritic cell population for use according to any one of claims 1 to 20, wherein the subject is a human.

22. The compound or dendritic cell population for use according to claim 21 , wherein the subject is a pediatric patient or an adolescent or young adult.

23. The compound or dendritic cell population for use according to any one of claims 1 to 22, wherein the radiotherapy is administered to the whole brain, local or regional to the brain.

24. The compound or dendritic cell population for use according to any one of claims 1 to 23, wherein the radiotherapy is administered as a single dose or fractionated doses.

25. The compound or dendritic cell population for use according to claim 24, wherein the single dose is from about 1.8 to about 161.5 Gy or wherein the fractionated dose results in a total dose of from about 1 .8 to about 161 .5 Gy.

26. The compound or dendritic cell population for use according to claim 25, wherein the subject has received: about 30 Gy of holocraneal radiotherapy in 10 fractions, between 45 to 70 Gy in fractions of between 1 .8 and 2 Gy each, about 40 Gy in 15 fractions or between 25 to 39 Gy in a single fraction or in between 3 and 5 fractions.

27. The compound or dendritic cell population for use according to any one of claims 1 to 26, wherein the compound or the dendritic cell population is administered prior to the beginning of the radiotherapy treatment.

Citation Information

Patent Citations

  • Inhibition of gene expression and therapeutic uses thereof

    WO2006135436A2

  • Methods of treating cognitive impairment

    US20210106654A1