Anti-taq DNA polymerase antibody or antigen binding fragment thereof, and use thereof

Abstract

The present disclosure relates to the technical field of biology. Disclosed are an anti-Taq DNA polymerase antibody or an antigen binding fragment thereof, and a use thereof. The antibody or the antigen binding fragment thereof can specifically bind to a Taq DNA polymerase and block the polymerization activity and / or exonucleolytic activity of the Taq DNA polymerase, thereby improving the stability of the Taq DNA polymerase.

Description

Antibodies or antigen-binding fragments thereof against Taq DNA polymerase and uses thereof

[0001] Cross-reference to Related Applications

[0002] The present disclosure claims priority to the Chinese patent application No. 2024108436559, filed on June 26, 2024, entitled “Antibodies or antigen-binding fragments thereof against Taq DNA polymerase and uses thereof”, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure claims priority to the Chinese patent application No. 2025103656716, filed on March 25, 2025, entitled “Antibodies or antigen-binding fragments thereof against Taq DNA polymerase and uses thereof”, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0004] The present disclosure relates to the field of biotechnology, and in particular to antibodies or antigen-binding fragments thereof against Taq DNA polymerase and uses thereof. BACKGROUND

[0005] The following discussion of the background of the present disclosure is merely provided to aid in understanding the present disclosure and is not admitted to be prior art.

[0006] Taq DNA polymerase is isolated from a kind of aquatic thermophilic bacteria Thermus aquaticus in Yellowstone National Park, USA, which grows in a high-temperature environment of 70-75℃ and is rich in minerals. Taq DNA polymerase is one of the recognized DNA polymerases with thermal stability for PCR amplification. The application of DNA polymerase in PCR reaction makes PCR technology very simple, greatly reduces the cost, and enables PCR technology to be widely used and gradually applied in clinical practice.

[0007] Taq DNA polymerase includes three domains: 1-291 amino acids encoding 5'-3' exonuclease activity domain, 292-423 amino acids encoding 3'-5' exonuclease domain, and 424-832 amino acids encoding polymerase domain. The 3'-5' exonuclease domain of Taq DNA polymerase does not play an active role in routine applications, but the 5'-3' exonuclease activity domain has activity and plays an important function in probe-based qPCR reactions.

[0008] With the gradual improvement of clinical detection requirements, researchers found that the heat-resistant Taq DNA polymerase also has certain defects in the use process, that is, it also has certain enzymatic properties at room temperature, which in turn leads to the problem of non-specific and primer dimer amplification in the PCR amplification process. In addition, Taq DNA polymerase also has certain problems in long-term stability. Therefore, the hot start technology emerges as the times require, and the method of using antibody modified hot start enzyme is also more common.

[0009] The antibody modified hot start enzyme needs to use specific anti-Taq DNA polymerase monoclonal antibody. After the specific anti-Taq DNA polymerase monoclonal antibody binds with the Taq DNA polymerase, an antigen-antibody complex is formed, which can effectively block the activity of the Taq DNA polymerase at room temperature or even 50℃, so that it does not exert the polymerase activity at room temperature or below 50℃; at high temperature (> 90℃ denaturation), the complex will dissociate, releasing the active Taq DNA polymerase, and the PCR amplification reaction is carried out again, which can effectively avoid the formation of primer dimer and reduce the formation of non-specific products, and at the same time can prolong the long-term stability of Taq DNA polymerase and improve the stability of the whole mixed system. Therefore, designing and cloning the specific anti-Taq DNA polymerase monoclonal antibody with good blocking effect and stable properties is of great significance for today's qPCR detection. The present disclosure discloses an antibody capable of specifically recognizing Taq DNA polymerase, which can be used for antibody modification of hot start TAQ enzyme.

[0010] In view of this, the present disclosure is proposed.

[0011] Application content

[0012] One of the purposes of the present disclosure is to provide an antibody or antigen-binding fragment thereof capable of specifically binding to Taq DNA polymerase and application thereof.

[0013] To solve the above technical problems, the present disclosure adopts the following technical solutions:

[0014] In a first aspect, an antibody or antigen-binding fragment thereof against Taq DNA polymerase is provided.

[0015] In an optional embodiment, the Taq DNA polymerase antibody or antigen-binding fragment thereof contains the complementarity determining regions HCDR1, HCDR2 and HCDR3 of the heavy chain variable region, and / or the complementarity determining regions LCDR1, LCDR2 and LCDR3 of the light chain variable region;

[0016] the HCDR1 comprises amino acid residues GY, SN, NY, SH, SY, TF, KY or an amino acid sequence as set forth in SEQ ID NO. 80;

[0017] the HCDR2 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115 and 117;

[0018] the HCDR3 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146 and 148;

[0019] the LCDR1 comprises amino acid residues YSY, SSR, GSY, SSY, FNA, GSN, NNL, GSD, SNL, GDL, YSL, an amino acid sequence as set forth in any one of SEQ ID NO. 158, 162 and 167;

[0020] the LCDR2 comprises amino acid residues DA, SA, RA, KA, FE, YA, GA, EA or DS;

[0021] the LCDR3 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213 and 215.

[0022] In an optional embodiment, the Taq DNA polymerase antibody or antigen-binding fragment thereof comprises a complementarity determining region HCDR1, HCDR2 and HCDR3 of a heavy chain variable region, and / or a complementarity determining region LCDR1, LCDR2 and LCDR3 of a light chain variable region;

[0023] the HCDR1, HCDR2 and HCDR3 comprise an amino acid sequence identical to the HCDR1, HCDR2 and HCDR3 of a heavy chain variable region as set forth in any one of SEQ ID NO. 1-17;

[0024] the LCDR1, LCDR2 and LCDR3 of the light chain variable region of any one of SEQ ID NO. 18-34;

[0025] Optionally, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 or LCDR3 of the variable region is defined by any one of Kabat, Chothia, IMGT, ABM or Contact, or a combination of multiple definition systems.

[0026] In a second aspect, there is further provided an antibody composition comprising at least two antibodies or antigen-binding fragments thereof against Taq DNA polymerase according to the first aspect.

[0027] In a third aspect, there is further provided a biological material selected from (i) a nucleic acid molecule, (ii) a vector, or (iii) a recombinant cell;

[0028] The (i) nucleic acid molecule encodes the antibody or antigen-binding fragment thereof against Taq DNA polymerase according to the first aspect;

[0029] The (ii) vector carries the (i) nucleic acid molecule;

[0030] The (iii) recombinant cell expresses the antibody or antigen-binding fragment thereof against Taq DNA polymerase according to the first aspect, or contains the (i) nucleic acid molecule, or contains the (ii) vector.

[0031] In a fourth aspect, there is further provided use of the antibody or antigen-binding fragment thereof against Taq DNA polymerase according to the first aspect, or the antibody composition according to the second aspect, or the biological material according to the third aspect, in any one of (i)-(v) below:

[0032] (i) preparing an antibody-modified Taq DNA polymerase.

[0033] (ii) preparing a hot-start Taq DNA polymerase.

[0034] (iii) blocking the polymerization activity of Taq DNA polymerase below 75°C.

[0035] (iv) preparing a product for blocking the polymerization activity of Taq DNA polymerase below 75°C.

[0036] (v) blocking the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C.

[0037] (vi) preparing a product for blocking the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C.

[0038] (vi) reducing non-specific amplification by Taq DNA polymerase.

[0039] (vii) producing a product that reduces non-specific amplification by Taq DNA polymerase.

[0040] (viii) increasing thermal stability of Taq DNA polymerase.

[0041] (ix) producing a product that increases thermal stability of Taq DNA polymerase.

[0042] In a fifth aspect, there is also provided an antibody-modified Taq DNA polymerase, which is an antigen-antibody complex formed by binding of the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect to Taq DNA polymerase, or is an antigen-antibody complex formed by binding of the antibody composition of the second aspect to Taq DNA polymerase.

[0043] In a sixth aspect, there is also provided a composition for nucleotide amplification, comprising (A) and (B):

[0044] (A) the antibody-modified Taq DNA polymerase of the fifth aspect;

[0045] (B) one or more of 4 deoxynucleotide triphosphates, a primer, a probe, a metal ion, a template, and a buffer component.

[0046] In a seventh aspect, there is also provided a nucleotide amplification kit, which comprises the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect, or the antibody composition of the second aspect, or the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleotide amplification of the sixth aspect.

[0047] In an eighth aspect, there is also provided use of the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect, or the antibody composition of the second aspect, or the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleotide amplification of the sixth aspect, or the nucleotide amplification kit of the seventh aspect, in any one of (I) to (IV):

[0048] (I) nucleic acid amplification.

[0049] (II) producing a product for nucleic acid amplification.

[0050] (III) nucleic acid detection.

[0051] (IV) producing a product for nucleic acid detection.

[0052] In a ninth aspect, there is also provided a nucleic acid amplification method comprising using the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleotide amplification of the sixth aspect, or the nucleotide amplification kit of the seventh aspect for hot start PCR. BRIEF DESCRIPTION OF DRAWINGS

[0053] In order to more clearly illustrate the technical solutions in the specific embodiments of the present disclosure or the prior art, the drawings required to be used in the specific embodiments or prior art description will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present disclosure, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0054] FIG. 1 is the blocking polymerization efficiency of antibodies E1-E10 binding to Taq DNA polymerase in Example 2;

[0055] FIG. 2 is the blocking exonuclease efficiency of antibodies E1-E10 binding to Taq DNA polymerase in Example 2;

[0056] FIG. 3 is the amplification curve of double-antibody-modified Taq DNA polymerase and control Taq DNA polymerase in qPCR full-mix system for 100 copies and 10000 copies of target in Example 2, wherein arrow A is the amplification of 10000 copies of target by control Taq DNA polymerase, arrow B is the amplification of 10000 copies of target by double-antibody-modified Taq DNA polymerase, wherein arrow C is the amplification of 100 copies of target by control Taq DNA polymerase, and arrow D is the amplification of 100 copies of target by double-antibody-modified Taq DNA polymerase;

[0057] FIG. 4 is the amplification curve of double-antibody-modified Taq DNA polymerase and control Anstart Taq DNA polymerase for target after incubation at 37 degrees Celsius for 7 days in Example 2, curve 1 is double-antibody-modified Taq DNA polymerase, and curve 2 is Anstart Taq DNA polymerase;

[0058] FIG. 5 is the blocking polymerization efficiency of antibodies 13D8, 6J12, 10C13 and 7M9 binding to Taq DNA polymerase in Example 4;

[0059] FIG. 6 is the blocking exonuclease efficiency of antibodies 13D8, 6J12, 10C13 and 7M9 binding to Taq DNA polymerase in Example 4;

[0060] FIG. 7 is the blocking polymerization efficiency of Fab antibody 17M12 binding to Taq DNA polymerase in Example 6;

[0061] Figure 8 is the blocked exonuclease efficiency of Fab antibodies 7M17 and 10D12 binding to Taq DNA polymerase in Example 6. DETAILED DESCRIPTION

[0062] The technical solutions of the present disclosure will be described clearly and completely in connection with the embodiments below. Obviously, the described embodiments are part of the embodiments of the present disclosure, rather than all the embodiments. Based on the embodiments in the present disclosure, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present disclosure.

[0063] The articles "a", "an", and "the" in the present disclosure include plural referents, unless the context clearly dictates otherwise. For example, "an antibody" refers to one antibody or more than one antibody.

[0064] In the present disclosure, the terms "first", "second" or any other ordinal number, such as (a1), (a2)…, (b1), (b2)…, (c1), (c2)…, (d1), (d2)…, (f1), (f2)…, (e1), (e2)…, (g1), (g2)…, (E1), (E2)…, (i), (ii)…, (A), (B), (I), (II)…, etc. are used only for descriptive purposes and are not to be construed as indicating or implying relative importance or a specific number of the technical features indicated. Thus, the features defined with "first", "second" or distinguished by ordinal numbers can explicitly or implicitly include at least one of the features. In the description of the present disclosure, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise specifically limited.

[0065] In the present disclosure, the Taq DNA polymerase bound by the antibody or antigen-binding fragment thereof against Taq DNA polymerase includes natural Taq DNA polymerase, and also includes artificially modified Taq DNA polymerase; the artificial modification includes but is not limited to polypeptide or protein after mutation, truncation or fusion with other domains, and retains the necessary antigenic epitopes for binding to the antibody.

[0066] In the present disclosure, the term "antibody" includes any immunoglobulin that can bind to a certain antigen. The term "antibody" is used in the broadest sense and encompasses various antibody structures including, but not limited to, monoclonal antibodies, polyclonal antibodies, monospecific antibodies, multispecific antibodies, full-length antibodies, antigen-binding fragments, as long as they exhibit the desired antigen-binding activity. Typically, a natural, intact antibody comprises two heavy (H) chains and two light (L) chains. Depending on whether it contains alpha, delta, epsilon, gamma, and mu heavy chains, an antibody can be assigned to five major classes or isotypes: IgA, IgD, IgE, IgG, and IgM. Several of the major antibody classes can be further divided into subclasses, such as IgGl (gamma 1 heavy chain), IgG2 (gamma 2 heavy chain), IgG3 (gamma 3 heavy chain), IgG4 (gamma 4 heavy chain), IgAl (alpha 1 heavy chain), or IgA2 (alpha 2 heavy chain), etc. Each heavy chain is comprised of one variable region (VH) and one, two, three, and four (optionally) constant regions (CH1, CH2, CH3, CH4). Mammalian light chains can be classified as lambda or kappa, and each light chain is comprised of one variable region (VL) and one constant region (CL). The variable regions of the light and heavy chains determine antigen binding. Each variable region typically contains three hypervariable regions, referred to as "complementarity determining regions (CDRs)", wherein the light chain CDRs include LCDR1, LCDR2, LCDR3, and the heavy chain CDRs include HCDR1, HCDR2, HCDR3. Each variable region (VH and VL) is composed of three complementarity determining regions connected by four framework regions. Typically, the variable regions of the heavy and light chains VL / VH can be arranged and connected by the following numbered CDRs and FRs in the following combinations: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0067] In the present disclosure, the term "antigen-binding fragment" is a substance comprising the CDRs of an antibody, which lacks some of the amino acids present in the full-length chain, but is still capable of specifically binding to an antigen. Such fragments are biologically active in that they bind to a target antigen and can compete with other antigen-binding molecules, including intact antibodies, for binding to a given epitope. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, disulfide stabilized Fv fragments (dsFv), (dsFv)2, bispecific dsFv (dsFv-dsFv'), disulfide stabilized diabodies, single-chain antibody molecules (scFv), scFv dimers (bivalent diabodies), and minimal recognition units of an antibody. The above antigen-binding fragments are capable of binding to the same antigens as the parent antibody.

[0068] In the present disclosure, the term "Fab" of an antibody refers to a portion of an antibody consisting of a single light chain (including variable and constant regions) and the variable region and first constant region of a single heavy chain, joined by disulfide bonds. "Fab' fragment" refers to a Fab fragment that includes a portion of the hinge region. "F(ab')2" refers to a dimer of Fab'. "Fv fragment" consists of the variable region of a single light chain and / or the variable region of a single heavy chain. "Single-chain Fv antibody" or "scFv" refers to an antibody fragment consisting of a light chain variable region and a heavy chain variable region directly linked to one another or linked by a peptide linker sequence. "Minimal recognition unit of an antibody" refers to a single CDR structure within the variable region alone, which has the ability to bind to an antigen, although the minimal recognition unit is small in molecular weight and low in affinity.

[0069] The CDR boundaries of the antibodies or antigen binding fragments thereof in the present disclosure can be defined or identified according to IMGT, Kabat, Chothia, AbM, Contact definition, or CDR defined in other ways acceptable in the art, CDR defined in other ways acceptable in the art also belong to the protection scope of the present disclosure (Kaas, Q et al. IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig super family C-like domains. Dev. Comp. Immunol. 29, 185-203, (2005); R. M. MacCallum et al.. Antibody-antigen interactions: contact analysis and binding site topography J. Mol. Biol. (1996); Martin, A. C. R. Protein sequence and structure analysis of antibody variable domains (Book chapter). In Antibody engineering lab manual Eds. Duebel, S. and Kontermann, R. (2001); Marie-Paule Lefranc et al. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains, Developmental and Comparative Immunology 27 (2003) 55-77).

[0070] In the present disclosure, the term "amino acid" refers to naturally occurring amino acids and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids include those encoded by the genetic code and modified amino acids thereof, such as hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. Common naturally occurring amino acids are, for example: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C); glutamic acid (Glu; E), glutamine (Gin; Q), glycine (Gly; G); histidine (His; H), isoleucine (lie; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V). An amino acid analog refers to a compound that has the same basic chemical structure as a naturally occurring amino acid (i.e., an alpha carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group), such as homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. An amino acid analog typically has a modified R group (e.g., norleucine) or a modified peptide backbone, but retains the same basic chemical structure as a naturally occurring amino acid. An amino acid mimetic refers to a chemical compound that has a structure different from the general chemical structure of an amino acid, but functions in a manner similar to a naturally occurring amino acid. In the present disclosure, the term "percent identity" refers to the extent to which the amino acids of two polypeptides are the same at equivalent positions when the two sequences are optimally aligned. Alignment for percent amino acid sequence identity can be performed using a variety of ways in the art, such as software well known in the art, such as BLAST, BLAST-2, ALIGN, MEGALIGN (DNASTAR), CLUSTALW, or CLUSTAL OMEGA, etc. One of skill in the art can determine appropriate parameters for aligning sequences, including any algorithm needed to achieve maximum alignment of the full length of the compared sequences.

[0071] In the present disclosure, the term "specifically binds" or "binds specifically" refers to a non-random binding reaction between two molecules, such as, for example, the reaction between an antibody and an antigen. In some embodiments, for example, according to an ELISA screening assay.

[0072] In the present disclosure, the term "affinity" or "avidity" refers to the strength of the noncovalent interaction between an immunoglobulin molecule (i.e., an antibody) or fragment thereof and an antigen. The strength or affinity of an immunological binding interaction can be expressed in terms of the equilibrium dissociation constant (KD) of the interaction, where a smaller value for KD indicates a higher affinity. KD can be determined by using any conventional method known in the art, including but not limited to Biacore assay, Octet method, microcalorimetry, HPLC MS method, and flow cytometric fluorescence sorting technique.

[0073] In the present disclosure, the term "epitope" refers to any antigenic determinant on an antigen that is bound by the paratope of an antibody. Antigenic determinants are typically special chemical groups with certain constituent and conformational features. Epitopes can be linear (i.e., contiguous) or conformational (i.e., comprising spaced apart amino acid residues, non-contiguous). Epitopes define the minimum binding site for an antibody, and thus are the specific targets of an antibody or antigen-binding fragment thereof. Epitopes can be determined by any method well known in the art, such as conventional immunoassays, antibody competitive binding assays, or X-ray crystallography or related structural determination methods (e.g., nuclear magnetic resonance spectroscopy).

[0074] In the present disclosure, the term "nucleic acid molecule" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Examples of nucleic acid molecules include, but are not limited to, single-, double-, or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. When the nucleic acid molecule encodes a protein or polypeptide, the coding is optionally for the sense or antisense strand. The nucleic acid molecule can be naturally occurring, synthetic, recombinant, or any combination thereof. "Nucleic acid molecule", "nucleic acid", and "polynucleotide" are used interchangeably.

[0075] In alternative embodiments, the nucleic acid molecule is RNA or DNA, which can be single- or double-stranded, preferably double-stranded DNA. A nucleic acid molecule is "operably linked" when it is functionally connected to another nucleic acid sequence, such as a promoter or enhancer, in a manner that allows for expression of the coding sequence. DNA is preferred when it is incorporated into a vector.

[0076] In the present disclosure, the term "vector" refers to a vehicle into which a genetic element (e.g., the aforementioned nucleic acid molecule) can be operatively inserted and which allows the genetic element to be expressed, e.g., to produce a protein, RNA or DNA encoded by the genetic element, or to replicate the genetic element. The vector can be used to transform, transduce or transfect a host cell, so that the genetic element carried by the host cell is expressed in the host cell. For example, the vector includes a plasmid, a phagemid, a cosmid, an artificial chromosome such as a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC) or a P1 -derived artificial chromosome (PAC), a bacteriophage such as a lambda phage or a M13 phage, and an animal virus, etc. The vector can contain various elements for controlling expression, including a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection element, and a reporter gene. In addition, the vector can also contain a replication initiation site. The vector can also include components that assist its entry into a cell, including but not limited to a viral particle, a liposome, or a protein coat. The vector can be an expression vector or a cloning vector. In some embodiments, the vector (e.g., expression vector) provided in the present disclosure contains a nucleic acid sequence encoding an antibody or antigen-binding fragment thereof described in the present disclosure, at least one promoter (e.g., SV40, CMV, EF 1 a) operably linked to the nucleic acid sequence, and at least one selection marker.

[0077] In the present disclosure, the term "purified" or "isolated" in association with a polypeptide or a nucleic acid means that the polypeptide or nucleic acid is not in its natural medium or in its natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid removed from its original environment, e.g., if it is naturally occurring, from the natural environment. In association with a nucleic acid, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

[0078] In the present disclosure, the term "recombinant cell" refers to a cell into which a foreign polynucleotide and / or a vector can be or has been introduced. The foreign polynucleotide can or can not be integrated into the genome of the "recombinant cell". When the vector is contained in the recombinant cell, the vector can be introduced into a mammalian cell to construct a recombinant cell, and then the recombinant cell is used to express the antibody or antigen-binding fragment provided in the present disclosure. The corresponding antibody can be obtained by culturing the recombinant cell. The available mammalian cell can be a HEK293 cell, etc.

[0079] In the present disclosure, the term "hot start PCR" refers to a PCR that allows Taq DNA polymerase to act only when the temperature of the sample exceeds a certain temperature, thereby improving the specificity of the reaction and avoiding non-specific amplification of nucleic acids.

[0080] In a first aspect, there is provided an antibody or antigen-binding fragment thereof against Taq DNA polymerase.

[0081] In an optional embodiment, the antibody or antigen-binding fragment thereof comprises a complementarity determining region HCDR1, HCDR2 and HCDR3 of a heavy chain variable region, and / or, a complementarity determining region LCDR1, LCDR2 and LCDR3 of a light chain variable region.

[0082] The HCDR1 comprises amino acid residues GY, SN, NY, SH, SY, TF, KY or an amino acid sequence as set forth in SEQ ID NO. 80.

[0083] In an optional embodiment, the HCDR1 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 75-79, 81-88, according to the Kabat definition.

[0084] The HCDR2 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115 and 117.

[0085] In an optional embodiment, the HCDR2 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116 and 118, according to the Kabat definition.

[0086] The HCDR3 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146 and 148.

[0087] In an optional embodiment, the HCDR3 comprises an amino acid sequence as set forth in any one of SEQ ID NO. 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145 and 147, according to the Kabat definition.

[0088] the LCDR1 includes amino acid residues YSY, amino acid residues SSR, amino acid residues GSY, amino acid residues SSY, amino acid residues FNA, amino acid residues GSN, amino acid residues NNL, amino acid residues GSD, amino acid residues SNL, amino acid residues GDL, amino acid residues YSL, an amino acid sequence as shown in any one of SEQ ID NO. 158, 162, and 167.

[0089] In an optional embodiment, the LCDR1 includes an amino acid sequence as shown in any one of SEQ ID NO. 149-157, 159-161, 163-166, and 168, according to the Kabat definition.

[0090] the LCDR2 includes amino acid residues DA, amino acid residues SA, amino acid residues RA, amino acid residues KA, amino acid residues FE, amino acid residues YA, amino acid residues GA, amino acid residues EA, or amino acid residues DS.

[0091] In an optional embodiment, the LCDR2 includes an amino acid sequence as shown in any one of SEQ ID NO. 169-181, according to the Kabat definition.

[0092] the LCDR3 includes an amino acid sequence as shown in any one of SEQ ID NO. 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, and 215.

[0093] In an optional embodiment, the LCDR3 includes an amino acid sequence as shown in any one of SEQ ID NO. 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, and 214, according to the Kabat definition.

[0094] In an optional embodiment, the complementarity-determining region of the antibody or antigen-binding fragment thereof against Taq DNA polymerase includes any one of (al)-(al7) below:

[0095] (al) the HCDR1 includes amino acid residues GY, the HCDR2 includes an amino acid sequence as shown in SEQ ID NO. 89, the HCDR3 includes an amino acid sequence as shown in SEQ ID NO. 120, the LCDR1 includes amino acid residues YSY, the LCDR2 includes amino acid residues DA, and the LCDR3 includes an amino acid sequence as shown in SEQ ID NO. 183;

[0096] (a2) HCDR1 comprises amino acid residues SN, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 91, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 122, LCDR1 comprises amino acid residues SSR, LCDR2 comprises amino acid residues SA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 185;

[0097] (a3) HCDR1 comprises amino acid residues GY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 89, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 120, LCDR1 comprises amino acid residues YSY, LCDR2 comprises amino acid residues RA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 187;

[0098] (a4) HCDR1 comprises amino acid residues GY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 89, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 120, LCDR1 comprises amino acid residues YSY, LCDR2 comprises amino acid residues KA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 189;

[0099] (a5) HCDR1 comprises amino acid residues NY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 93, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 124, LCDR1 comprises amino acid residues GSY, LCDR2 comprises amino acid residues FE, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 191;

[0100] (a6) HCDR1 comprises amino acid residues NY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 95, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 126, LCDR1 comprises amino acid residues SSY, LCDR2 comprises amino acid residues YA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 193;

[0101] (a7) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 80, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 97, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 128, LCDR1 comprises amino acid residues FNA, LCDR2 comprises amino acid residues GA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 195;

[0102] (a8) HCDR1 comprises amino acid residue SH, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 99, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 130, LCDR1 comprises amino acid residues GSN, LCDR2 comprises amino acid residues GA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 197;

[0103] (a9) HCDR1 comprises amino acid residue SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 101, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 132, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 158, LCDR2 comprises amino acid residues KA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 199;

[0104] (a10) HCDR1 comprises amino acid residue SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 103, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 134, LCDR1 comprises amino acid residues NNL, LCDR2 comprises amino acid residues RA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 201;

[0105] (a11) HCDR1 comprises amino acid residue SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 105, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 136, LCDR1 comprises amino acid residues SSY, LCDR2 comprises amino acid residues EA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 203;

[0106] (a12) HCDR1 comprises amino acid residue TF, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 107, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 138, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 162, LCDR2 comprises amino acid residues YA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 205;

[0107] (a13) HCDR1 comprises amino acid residue SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 109, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 140, LCDR1 comprises amino acid residues GSD, LCDR2 comprises amino acid residues RA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 207;

[0108] (a14) HCDR1 comprises amino acid residues KY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 111, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 142, LCDR1 comprises amino acid residues SNL, LCDR2 comprises amino acid residues DA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 209;

[0109] (a15) HCDR1 comprises amino acid residues SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 113, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 144, LCDR1 comprises amino acid residues GDL, LCDR2 comprises amino acid residues GA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 211;

[0110] (a16) HCDR1 comprises amino acid residues SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 115, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 146, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 167, LCDR2 comprises amino acid residues DS, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 213;

[0111] (a17) HCDR1 comprises amino acid residues SY, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 117, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 148, LCDR1 comprises amino acid residues YSL, LCDR2 comprises amino acid residues RA, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 215.

[0112] In an optional embodiment, the complementarity determining regions of the anti-Taq DNA polymerase antibody or antigen-binding fragment thereof comprise any of (b1) to (b17) according to the Kabat definition:

[0113] (b1) HCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 75, HCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 90, HCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 119, LCDR1 comprises the amino acid sequence set forth in SEQ ID NO. 149, LCDR2 comprises the amino acid sequence set forth in SEQ ID NO. 169, and LCDR3 comprises the amino acid sequence set forth in SEQ ID NO. 182;

[0114] (b2) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 76, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 92, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 121, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 150, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 170, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 184;

[0115] (b3) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 75, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 90, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 119, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 151, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 171, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 186;

[0116] (b4) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 75, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 90, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 119, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 151, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 172, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 188;

[0117] (b5) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 77, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 94, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 123, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 153, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 173, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 190;

[0118] (b6) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 78, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 96, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 125, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 154, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 174, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 192;

[0119] (b7) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 79, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 98, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 127, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 155, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 175, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 194;

[0120] (b8) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 81, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 100, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 129, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 156, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 176, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 196;

[0121] (b9) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 82, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 102, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 131, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 157, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 172, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 198;

[0122] (b10) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 83, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 104, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 133, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 159, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 171, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 200;

[0123] (b11) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 84, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 106, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 135, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 160, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 177, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 202;

[0124] (b12) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 85, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 108, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 137, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 161, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 174, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 204;

[0125] (b13) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 84, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 110, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 139, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 163, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 171, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 206;

[0126] (b14) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 86, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 112, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 141, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 164, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 178, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 208;

[0127] (b15) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 87, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 114, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 143, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 165, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 179, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 210;

[0128] (b16) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 88, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 116, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 145, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 166, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 180, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 212;

[0129] (b17) HCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 82, HCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 118, HCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 147, LCDR1 comprises an amino acid sequence set forth in SEQ ID NO. 168, LCDR2 comprises an amino acid sequence set forth in SEQ ID NO. 181, and LCDR3 comprises an amino acid sequence set forth in SEQ ID NO. 214.

[0130] In some embodiments, the anti-TAQ DNA antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions HCDR1, HCDR2, and HCDR3, and / or a light chain variable region comprising complementarity determining regions LCDR1, LCDR2, and LCDR3.

[0131] The HCDR1, HCDR2, and HCDR3 comprise an amino acid sequence identical to HCDR1, HCDR2, and HCDR3 of a heavy chain variable region set forth in any one of SEQ ID NOs. 1-17.

[0132] The LCDR1, LCDR2, and LCDR3 comprise an amino acid sequence identical to LCDR1, LCDR2, and LCDR3 of a light chain variable region set forth in any one of SEQ ID NOs. 18-34.

[0133] The HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3 of the variable region is defined by any one of Kabat, Chothia, IMGT, ABM, or Contact, or a combination of multiple definition systems. In some aspects, the combination of definitions is the intersection of multiple definitions, resulting in a consensus sequence.

[0134] Table 1 shows the CDR regions of exemplary antibody E1 (heavy chain variable region amino acid sequence set forth in SEQ ID NO. 1, light chain variable region amino acid sequence set forth in SEQ ID NO. 18) according to Kabat and the combination of definitions, respectively.

[0135] Table 1

[0136] Table 2 shows the CDR regions of exemplary antibody E2 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 2, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 19) according to the definitions by Kabat and Chothia, respectively.

[0137] Table 2

[0138] Table 3 shows the CDR regions of exemplary antibody E3 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 3, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 20) according to the definitions by Kabat and Chothia, respectively.

[0139] Table 3

[0140] Table 4 shows the CDR regions of exemplary antibody E4 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 4, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 21) according to the definitions by Kabat and Chothia, respectively.

[0141] Table 4

[0142] Table 5 shows the CDR regions of exemplary antibody E5 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 5, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 22) according to the definitions by Kabat and Chothia, respectively.

[0143] Table 5

[0144] Table 6 shows the CDR regions of exemplary antibody E6 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 6, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 23) according to the definitions by Kabat and Chothia, respectively.

[0145] Table 6

[0146] Table 7 shows the CDR regions of exemplary antibody E7 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 7, amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 24) according to the definitions by Kabat and Chothia, respectively.

[0147] Table 7

[0148] Table 8 shows the CDR regions of exemplary antibody E8 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 8, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 25) according to the definitions by Kabat and Chothia, respectively.

[0149] Table 8

[0150] Table 9 shows the CDR regions of exemplary antibody E9 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 9, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 26) according to the definitions by Kabat and Chothia, respectively.

[0151] Table 9

[0152] Table 10 shows the CDR regions of exemplary antibody E10 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 10, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 27) according to the definitions by Kabat and Chothia, respectively.

[0153] Table 10

[0154] Table 11 shows the CDR regions of exemplary antibody 13D8 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 11, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 28) according to the definitions by Kabat and Chothia, respectively.

[0155] Table 11

[0156] Table 12 shows the CDR regions of exemplary antibody 6J12 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 12, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 29) according to the definitions by Kabat and Chothia, respectively.

[0157] Table 12

[0158] Table 13 shows the CDR regions of exemplary antibody 7M9 (amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO. 13, and the amino acid sequence of the light chain variable region is set forth in SEQ ID NO. 30) according to the definitions by Kabat and Chothia, respectively.

[0159] Table 13

[0160] Table 14 shows the CDR regions of the exemplary antibody 10C13 (the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 14, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 31) according to the CDR definitions by Kabat and Chothia, respectively.

[0161] Table 14

[0162] Table 15 shows the CDR regions of the exemplary antibody 7M17 (the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 15, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 32) according to the CDR definitions by Kabat and Chothia, respectively.

[0163] Table 15

[0164] Table 16 shows the CDR regions of the exemplary antibody 10D12 (the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 16, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 33) according to the CDR definitions by Kabat and Chothia, respectively.

[0165] Table 16

[0166] Table 17 shows the CDR regions of the exemplary antibody 17M12 (the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 17, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 34) according to the CDR definitions by Kabat and Chothia, respectively.

[0167] Table 17

[0168] In the above Tables 1 to 17, "Combined" means the CDR according to the CDR definitions by Kabat, Chothia, IMGT, ABM and Contact.

[0169] In an alternative embodiment, the antibody comprises a heavy chain framework region and / or a light chain framework region, which is of one or more of the following species origin: rabbit, bovine, equine, bovine, porcine, ovine, caprine, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, cock, human and mutants thereof.

[0170] In an alternative embodiment, the three CDRs of the above antibody or antigen-binding fragment thereof against Taq DNA polymerase are separated by flanking portions known as framework regions (FR, the light chain FRs comprise LFR1, LFR2, LFR3 and LFR4, and the heavy chain FRs comprise HFR1, HFR2, HFR3 and HFR4).

[0171] In an optional embodiment, the HFR1 comprises the HFR1 of the heavy chain variable region as set forth in any one of SEQ ID NO. 1-17.

[0172] In an optional embodiment, the HFR2 comprises the HFR2 of the heavy chain variable region as set forth in any one of SEQ ID NO. 1-17.

[0173] In an optional embodiment, the HFR3 comprises the HFR3 of the heavy chain variable region as set forth in any one of SEQ ID NO. 1-17.

[0174] In an optional embodiment, the HFR4 comprises the HFR4 of the heavy chain variable region as set forth in any one of SEQ ID NO. 1-17.

[0175] In an optional embodiment, the LFR1 comprises the LFR1 of the heavy chain variable region as set forth in any one of SEQ ID NO. 18-34.

[0176] In an optional embodiment, the LFR2 comprises the LFR2 of the heavy chain variable region as set forth in any one of SEQ ID NO. 18-34.

[0177] In an optional embodiment, the LFR3 comprises the LFR3 of the heavy chain variable region as set forth in any one of SEQ ID NO. 18-34.

[0178] In an optional embodiment, the LFR4 comprises the LFR4 of the heavy chain variable region as set forth in any one of SEQ ID NO. 18-34.

[0179] In an optional embodiment, the HFR1, HFR2, HFR3 and HFR4 comprise the HFR1, HFR2, HFR3 and HFR4 of the heavy chain variable region as set forth in any one of SEQ ID NO. 1-17. The CDR regions thereof are determined according to the Kabat definition, Chothia definition, AbM definition, Contact definition or IMGT definition, and the FR regions thereof are determined according to the structure of the heavy chain variable region.

[0180] In an optional embodiment, the antibody or antigen-binding fragment thereof against Taq DNA polymerase has a heavy chain variable region as set forth in any one of SEQ ID NO. 1-17 or a heavy chain variable region having at least 73% (73%, 74%, 75%, 77%, 78%, 80%, 82%, 85%, 87%, 89%, 90%, 91%, 92%, 95%, 96%, 97%, 98% or 99%) sequence identity to the amino acid sequence as set forth in any one of SEQ ID NO. 1-17.

[0181] In an optional embodiment, the antibody or antigen-binding fragment thereof against Taq DNA polymerase has a light chain variable region having an amino acid sequence as set forth in any one of SEQ ID NO. 18 to 34 or having at least 75% (75%, 76%, 77%, 78%, 79%, 80%, 82%, 85%, 87%, 89%, 90%, 91%, 92%, 95%, 96%, 97%, 98%, or 99%) sequence identity to the amino acid sequence as set forth in any one of SEQ ID NO. 18 to 34.

[0182] In an optional embodiment, the antibody or antigen-binding fragment thereof against Taq DNA polymerase includes a heavy chain variable region and a light chain variable region of any one of (e1) to (e17):

[0183] (e1) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 1; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 18;

[0184] (e2) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 2; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 19;

[0185] (e3) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 3; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 20;

[0186] (e4) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 4; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 21;

[0187] (e5) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 5; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 22;

[0188] (e6) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 6; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 23;

[0189] (e7) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 7; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 24;

[0190] (e8) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO. 8; and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO. 25;

[0191] (e9) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 9; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 26;

[0192] (e10) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 10; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 27;

[0193] (e11) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 11; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 28;

[0194] (e12) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 12; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 29;

[0195] (e13) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 13; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 30;

[0196] (e14) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 14; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 31;

[0197] (e15) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 15; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 32;

[0198] (e16) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 16; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 33;

[0199] (e17) a heavy chain variable region of an amino acid sequence as shown in SEQ ID NO. 17; and a light chain variable region of an amino acid sequence as shown in SEQ ID NO. 34.

[0200] In an alternative embodiment, the antigen binding fragment comprises one or more of F(ab')2, Fab', Fab, Fv, scFv, dsFv, and a minimal recognition unit of an antibody.

[0201] In an alternative embodiment, any of the antibodies of (a15) to (a17), (b15) to (b17), and (e15) to (e17) above is a Fab antibody.

[0202] In an alternative embodiment, the anti-Taq DNA polymerase antibody or antigen-binding fragment thereof comprises a portion or all of a sequence of a constant region.

[0203] In an alternative embodiment, the constant region sequence is selected from a portion or all of a constant region sequence of any one of IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, including their subclasses and mutant forms.

[0204] In an alternative embodiment, the species origin of the constant region is one or more of rabbit, bovine, equine, bovine, porcine, ovine, caprine, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, cock, human and mutants thereof.

[0205] In an alternative embodiment, the anti-Taq DNA polymerase antibody or antigen-binding fragment thereof comprises a heavy chain constant region of an amino acid sequence as shown in SEQ ID NO. 35, 36 or 37.

[0206] In an alternative embodiment, the anti-Taq DNA polymerase antibody or antigen-binding fragment thereof comprises a light chain constant region of an amino acid sequence as shown in SEQ ID NO. 38, 39 or 40.

[0207] In an alternative embodiment, the amino acid sequence of the anti-Taq DNA polymerase antibody is selected from any one of the following (El) to (E17):

[0208] (E1) a heavy chain of an amino acid sequence as shown in SEQ ID NO. 41 and a light chain of an amino acid sequence as shown in SEQ ID NO. 58;

[0209] (E2) a heavy chain of an amino acid sequence as shown in SEQ ID NO. 42 and a light chain of an amino acid sequence as shown in SEQ ID NO. 59;

[0210] (E3) a heavy chain of an amino acid sequence as shown in SEQ ID NO. 43 and a light chain of an amino acid sequence as shown in SEQ ID NO. 60;

[0211] (E4) a heavy chain of an amino acid sequence as shown in SEQ ID NO. 44 and a light chain of an amino acid sequence as shown in SEQ ID NO. 61;

[0212] (E5) a heavy chain of an amino acid sequence as shown in SEQ ID NO. 45 and a light chain of an amino acid sequence as shown in SEQ ID NO. 62;

[0213] (E6) a heavy chain of an amino acid sequence represented by SEQ ID NO. 46 and a light chain of an amino acid sequence represented by SEQ ID NO. 63;

[0214] (E7) a heavy chain of an amino acid sequence represented by SEQ ID NO. 47 and a light chain of an amino acid sequence represented by SEQ ID NO. 64;

[0215] (E8) a heavy chain of an amino acid sequence represented by SEQ ID NO. 48 and a light chain of an amino acid sequence represented by SEQ ID NO. 65;

[0216] (E9) a heavy chain of an amino acid sequence represented by SEQ ID NO. 49 and a light chain of an amino acid sequence represented by SEQ ID NO. 66;

[0217] (E10) a heavy chain of an amino acid sequence represented by SEQ ID NO. 50 and a light chain of an amino acid sequence represented by SEQ ID NO. 67;

[0218] (E11) a heavy chain of an amino acid sequence represented by SEQ ID NO. 51 and a light chain of an amino acid sequence represented by SEQ ID NO. 68;

[0219] (E12) a heavy chain of an amino acid sequence represented by SEQ ID NO. 52 and a light chain of an amino acid sequence represented by SEQ ID NO. 69;

[0220] (E13) a heavy chain of an amino acid sequence represented by SEQ ID NO. 53 and a light chain of an amino acid sequence represented by SEQ ID NO. 70;

[0221] (E14) a heavy chain of an amino acid sequence represented by SEQ ID NO. 54 and a light chain of an amino acid sequence represented by SEQ ID NO. 71;

[0222] (E15) a heavy chain of an amino acid sequence represented by SEQ ID NO. 55 and a light chain of an amino acid sequence represented by SEQ ID NO. 72;

[0223] (E16) a heavy chain of an amino acid sequence represented by SEQ ID NO. 56 and a light chain of an amino acid sequence represented by SEQ ID NO. 73;

[0224] (E17) a heavy chain of an amino acid sequence represented by SEQ ID NO. 57 and a light chain of an amino acid sequence represented by SEQ ID NO. 74.

[0225] The antibody or antigen-binding fragment thereof against Taq DNA polymerase provided in the first aspect is capable of specifically binding to Taq DNA polymerase, and in some embodiments, is capable of blocking the polymerization activity and / or exonuclease activity of Taq DNA polymerase, and improving the stability of Taq DNA polymerase.

[0226] The second aspect also provides an antibody composition comprising at least two (e.g., 2, 3, or 4) antibodies or antigen-binding fragments thereof against Taq DNA polymerase as described in the first and second aspects.

[0227] In an alternative embodiment, at least one of the Taq polymerase antibodies in the antibody composition has blocking exonuclease activity, and at least one of the Taq polymerase antibodies has blocking polymerization activity.

[0228] In an alternative embodiment, the antibody composition comprises at least two of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in (a1)-(a17), (b1)-(b17), (e1)-(e17), and (E1)-(E17) described above, and an antigen-antibody complex formed by binding of the antibodies or antigen-binding fragments thereof to Taq DNA polymerase.

[0229] In an alternative embodiment, the antibody composition comprises at least two of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in (a1)-(a17) described above.

[0230] In an alternative embodiment, the antibody composition comprises at least two of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in (b1)-(b17) described above.

[0231] In an alternative embodiment, the antibody composition comprises at least two of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in (e1)-(e17) described above.

[0232] In an alternative embodiment, the antibody composition comprises at least two of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in (E1)-(E17) described above.

[0233] The third aspect also provides a biological material selected from (i) a nucleic acid molecule, (ii) a vector, or (iii) a recombinant cell;

[0234] The (i) nucleic acid molecule encodes the antibody or antigen-binding fragment thereof against Taq DNA polymerase described in the first aspect;

[0235] The (ii) vector carries the (i) nucleic acid molecule;

[0236] The (iii) recombinant cell expresses an antibody or antigen-binding fragment thereof to Taq DNA polymerase of the first aspect, or contains the (i) nucleic acid molecule, or contains the (ii) vector.

[0237] The fourth aspect also provides the use of an antibody or antigen-binding fragment thereof to Taq DNA polymerase of the first aspect, or the antibody composition of the second aspect, or the biological material of the third aspect in any of (i) to (x) below:

[0238] (i) to prepare an antibody-modified Taq DNA polymerase.

[0239] (ii) to prepare a hot-start Taq DNA polymerase.

[0240] (iii) to block the polymerisation activity of Taq DNA polymerase below 75°C (e.g. 75°C, 70°C, 65°C, 60°C, 55°C or 50°C).

[0241] (iv) to prepare a product for blocking the polymerisation activity of Taq DNA polymerase below 75°C (e.g. 75°C, 70°C, 65°C, 60°C, 55°C or 50°C).

[0242] (v) to block the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C (e.g. 75°C, 70°C, 65°C, 60°C, 55°C or 50°C).

[0243] (vi) to prepare a product for blocking the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C (e.g. 75°C, 70°C, 65°C, 60°C, 55°C or 50°C).

[0244] (vii) to reduce the non-specific amplification of Taq DNA polymerase.

[0245] (viii) to prepare a product for reducing the non-specific amplification of Taq DNA polymerase.

[0246] (ix) to increase the thermostability of Taq DNA polymerase.

[0247] (x) to prepare a product for increasing the thermostability of Taq DNA polymerase.

[0248] In optional embodiments, in the use of the (iii) and (iv) aspects, the antibody or antigen-binding fragment thereof against Taq DNA polymerase comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (a1), (a2), (a3), (a4), (a6), (a9), (a10), (a12), and (a17); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (b1), (b2), (b3), (b4), (b6), (b9), (b10), (b12), and (b17); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (e1), (e2), (e3), (e4), (e6), (e9), (e10), (e12), and (e17); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (E1), (E2), (E3), (E4), (E6), (E9), (E10), (E12), and (E17).

[0249] In optional embodiments, in the use of the (v) and (vi) aspects, the antibody or antigen-binding fragment thereof against Taq DNA polymerase comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (a2), (a5), (a7), (a8), (a11), (a12), (a13), (a14), (a15), and (a16); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (b2), (b5), (b7), (b8), (b11), (b12), (b13), (b14), (b15), and (b16); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (e2), (e5), (e7), (e8), (e11), (e12), (e13), (e14), (e15), and (e16); or comprises at least one of the antibodies or antigen-binding fragments thereof against Taq DNA polymerase in the aforementioned (E2), (E5), (E7), (E8), (E11), (E12), (E13), (E14), (E15), and (E16).

[0250] In a fifth aspect, there is also provided an antibody-modified Taq DNA polymerase, which is an antigen-antibody complex formed by the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect binding to the Taq DNA polymerase, or is an antigen-antibody complex formed by the antibody composition of the second aspect binding to the Taq DNA polymerase.

[0251] In an alternative embodiment, the modified Taq DNA polymerase is an antigen-antibody complex formed by binding of at least one of the aforementioned (a1) to (a17), (b1) to (b17), (e1) to (e17), and (E1) to (E17) antibodies or antigen-binding fragments thereof against Taq DNA polymerase to Taq DNA polymerase.

[0252] In an alternative embodiment, the modified Taq DNA polymerase is an antigen-antibody complex formed by binding of the aforementioned first antibody and the aforementioned second antibody to Taq DNA polymerase.

[0253] In a sixth aspect, there is also provided a composition for nucleic acid amplification, comprising (A) and (B):

[0254] (A) the antibody-modified Taq DNA polymerase of the fifth aspect;

[0255] (B) one or more of deoxynucleotide triphosphates, primers, probes, metal ions, templates, and buffer components. The primers can optionally include at least one primer pair, and when the composition is used for multiplex amplification, the composition includes a plurality of primer pairs. The probes include at least one probe. The metal ions include, but are not limited to, one or more of Mg 2+ , Na + , K + , and Mn 2+ . The buffer components include components known in the art for constituting a buffer solution, and the present disclosure does not limit thereto.

[0256] In a seventh aspect, there is also provided a nucleic acid amplification kit comprising the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect, or the antibody composition of the second aspect, or the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleic acid amplification of the sixth aspect.

[0257] In an eighth aspect, there is also provided use of the antibody or antigen-binding fragment thereof against Taq DNA polymerase of the first aspect, or the antibody composition of the second aspect, or the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleic acid amplification of the sixth aspect, or the nucleic acid amplification kit of the seventh aspect in any one of (I) to (IV):

[0258] (I) nucleic acid amplification.

[0259] (II) preparation of a product for nucleic acid amplification.

[0260] (III) nucleic acid detection.

[0261] (IV) preparation of a product for nucleic acid detection.

[0262] In an optional embodiment, the nucleic acid in any of the above applications comprises DNA.

[0263] In an optional embodiment, the nucleic acid amplification in any of the above applications comprises PCR.

[0264] In a ninth aspect, there is also provided a nucleic acid amplification method, comprising using the antibody-modified Taq DNA polymerase of the fifth aspect, or the composition for nucleotide amplification of the sixth aspect, or the nucleotide amplification kit of the seventh aspect to perform hot-start PCR.

[0265] In an optional embodiment, the hot-start PCR comprises multiplex PCR, real-time PCR, and real-time quantitative PCR.

[0266] The present disclosure is further illustrated by the following specific examples, but it should be understood that these examples are merely for the purpose of illustrating in more detail and should not be construed as limiting the present disclosure in any form.

[0267] Example 1 Antibody discovery and preparation

[0268] 1. Anti-Taq DNA polymerase antibody discovery

[0269] The rabbit monoclonal antibody against Taq DNA polymerase was obtained by hybridoma technology, phage display technology, and single B cell cloning technology to obtain antibody sequences. The specific implementation method is as follows:

[0270] Example 1 Hybridoma technology for discovering anti-Taq DNA polymerase antibody

[0271] (1) Immunization of rabbits

[0272] An emulsified preparation of Taq DNA polymerase protein prepared with incomplete Freund's adjuvant was used to stimulate the immune response of 4-6-week-old New Zealand white rabbits by subcutaneous injection, and pre-immune and post-immune sera were collected on days 0, 14, 28, 42, and 69, respectively; the rabbit spleen was then surgically removed to prepare a spleen cell suspension.

[0273] (2) Cell fusion

[0274] The spleen cell suspension and rabbit fusion partner cells were mixed, and cell fusion was performed by electrofusion to prepare rabbit hybridoma cells, HAT hybridoma screening medium was added, and then the cells were cultured in an incubator.

[0275] (3) Hybridoma screening

[0276] After the hybridoma cells are cultured for 7 days, the supernatant of the hybridoma cells is identified by an ELISA screening method to screen a hybridoma cell strain capable of specifically recognizing and binding to Taq DNA polymerase protein. The hybridoma cell strain against Taq DNA polymerase is subcloned by a limited dilution method, and after 7 days, the supernatant of the monoclonal hybridoma cells is screened and identified by an ELISA screening method to obtain a positive monoclonal hybridoma cell strain against Taq DNA polymerase.

[0277] (4) Hybridoma antibody gene sequencing

[0278] The RNA of the monoclonal hybridoma cell strain against Taq DNA polymerase is extracted and reverse transcribed into cDNA, and then the antibody gene fragment is amplified by PCR, followed by ligation and insertion of the antibody gene fragment into a sequencing T vector (purchased from Takara), and finally, the antibody gene is sequenced to obtain the gene sequence of the antibody variable region.

[0279] Method 2: Phage display technology

[0280] (1) Rabbit immunization

[0281] Refer to the rabbit immunization step in Method 1: Hybridoma technology.

[0282] (2) Construction of phage library

[0283] The RNA in the rabbit spleen cells is extracted and reverse transcribed into cDNA, and the rabbit antibody gene amplification primers are specifically designed to amplify the VHand VLgene fragments using cDNA as the template, and then the VHand VLgene fragments are sequentially inserted into the phage vector V02 by enzyme digestion and ligation. Finally, the ligated phage plasmid is electroporated into TG1 competent cells, and the next day, single clone colonies are selected for PCR identification and antibody gene sequencing to evaluate the quality of the phage library, and after passing the quality control, the phage library is screened.

[0284] (3) Screening of phage library

[0285] The phage library TG1 bacterial liquid is inoculated into a flask and cultured to an appropriate bacterial liquid concentration (OD600 of 0.8-1.0), and then helper phage is added for 1 hour of infection, followed by overnight culture. The next day, the bacterial liquid is centrifuged, and the supernatant is collected and purified by salt precipitation to obtain the displayed phage library. The phage library is subjected to 3-4 rounds of magnetic bead selection, and then single clone phage infection colonies are selected for antibody supernatant expression, followed by ELISA screening to screen and identify the monoclonal phage antibody expression supernatant to obtain a monoclonal phage against Taq DNA polymerase protein.

[0286] (4) Phage antibody gene sequencing

[0287] The monoclonal phage of anti-Taq DNA polymerase protein was subjected to antibody gene sequencing, and through sequence analysis, the unique rabbit monoclonal antibody sequence was obtained by removing repeated and invalid sequences.

[0288] Method 3: Single B cell cloning technology

[0289] (1) Immunization of rabbits

[0290] See the immunization step of rabbits in the hybridoma technology in Method 1: Hybridoma technology. Then, fresh single spleen cells were isolated and cultured overnight in B cell culture medium prepared in the laboratory.

[0291] (2) Fresh single cell suspension was prepared by diluting the spleen cells with PBS containing 2-3% fetal bovine serum and 1 mM EDTA.

[0292] (3) Single B cells were sorted for Taq DNA polymerase antigen specificity using a Sony MA900 flow sorter (Sony biotechnology, Japan) and placed in each single well of a 96-well plate.

[0293] (4) The primary B cells with Taq DNA polymerase specificity were added to the B cell culture medium and then placed in a 37°C, 5.5% CO2 condition for 7-10 days.

[0294] (5) At the end of the primary B cell culture, the B cell culture supernatant was screened and identified by ELISA to obtain B cell positive clones against Taq DNA polymerase.

[0295] (6) B cell antibody gene sequencing:

[0296] The RNA of the B cell positive clone against Taq DNA polymerase was extracted and reverse transcribed into cDNA, and then subjected to PCR amplification of the antibody gene fragment. Next, the antibody gene fragment was inserted and connected to the sequencing T vector (purchased from Takara), and finally, the antibody gene sequencing was performed to obtain the gene sequence of the antibody variable region.

[0297] The rabbit monoclonal antibody sequences against Taq DNA polymerase obtained by the above three methods were subjected to eukaryotic recombinant expression verification.

[0298] 2. Expression plasmid construction

[0299] pcDNA TM 3.4 vector is a recombinant antibody eukaryotic expression vector constructed by introducing a polyclonal enzyme cutting site, hereinafter referred to as 3.4A expression vector; according to the variable region gene obtained in the above experiment, VL and VH gene specific primers are designed respectively, both ends are respectively provided with a restriction endonuclease enzyme cutting site and a protection base, and 0.72 KB of light chain gene fragments and 1.40 kb of heavy chain gene fragments are expanded by PCR amplification method.

[0300] The heavy chain and light chain gene fragments are double enzyme cut by using restriction endonuclease, the 3.4A vector is double enzyme cut by using restriction endonuclease, and after the fragments and the vector are purified and recovered, the heavy chain gene and the light chain gene are respectively connected in the 3.4A expression vector, and the recombinant expression plasmid of the heavy chain and the light chain is obtained respectively.

[0301] 3. Sample preparation of recombinant antibody

[0302] The HEK293 cells are recovered in advance, subcultured to 200 ml system, and the cell density is adjusted to 3-5 x 10 6 cells / ml, and the cell viability is >95%; the cells are centrifuged and washed with culture medium, and the cell density is adjusted to 2.9 x 10 6 cells / ml as a cell diluent. The plasmid DNA and transfection reagent diluent are prepared with culture medium respectively. The transfection reagent diluent is added to the plasmid DNA diluent, mixed and placed at room temperature for 15 min; the mixture is slowly added to the cell diluent within 1 min, mixed, sampled, recorded and observed the cell viability after transfection, and placed in a 35℃ constant temperature incubator for culture, the rotation speed is 120 rmp, the CO2 content is 8%, and the sample is collected by centrifugation after 13 days. The centrifugal supernatant is affinity purified by protein A affinity chromatography column.

[0303] 4. The following 10 selected antibodies are screened by the above three methods, the amino acid sequences of the heavy chain variable region and the light chain variable region of the antibodies are shown in Table 18, the amino acid sequences of the heavy chain constant region of antibodies E1-10 are all shown in SEQ ID NO. 35, and the amino acid sequences of the light chain constant region are all shown in SEQ ID NO. 38. The heavy chain amino acid sequences of antibodies E1-10 are shown in SEQ ID NO. 41-50 respectively, and the light chain amino acid sequences are shown in SEQ ID NO. 58-67 respectively. The CDR sequences of each antibody are shown in Tables 1-10 respectively.

[0304] Table 18

[0305] Example 2 Antibody performance verification

[0306] 1. Antibody binding to Taq DNA polymerase to block polymerization efficiency

[0307] Each of the alternative antibodies and control antibody C1 (from MD010, Guangdong Fipeng Biotechnology Co., Ltd.) was incubated with Taq DNA polymerase to obtain antibody enzymes. The amount of DNA strand incorporation by 15 nmol of dNTP within 30 minutes at 75°C defined the enzyme activity. The calibration of enzyme activity used the macro stone SLAN instrument to determine the fluorescence signal, and the slope of fluorescence represented the polymerase activity of different samples. (Taq DNA polymerase polymerase activity-antibody enzyme polymerase activity)÷Taq DNA polymerase polymerase activity x 100% represented the efficiency of antibody blocking polymerization activity. Table 12 and Figure 1 are the summary of the results of the screening of the polymerization activity of each antibody, and the results show that the antibody blocking polymerization activity efficiency of E1, E2, E3, E4, E6, E9, and E10 is higher than that of the control C1.

[0308] Table 19 Summary of the results of the screening of the polymerization activity of each antibody

[0309] 2. Antibody binding to Taq DNA polymerase to block exonuclease efficiency

[0310] Each of the alternative antibodies and control antibody C2 (from MDAD029, Guangdong Fipeng Biotechnology Co., Ltd.) was incubated with Taq DNA polymerase to obtain antibody enzymes. In order to detect the exonuclease activity of the polymerase, we designed a long hairpin structure primer with the sequence: ACGTAGCGAAGGATGTGAACCTAATCCCTGCTCCCGCGGCCGATCTGCCGGCCGCGGG (SEQ ID NO. 152). In the presence of Taq DNA polymerase, the exonuclease activity of the polymerase will cut the probe to produce fluorescence, and by using the macro stone SLAN instrument to determine the fluorescence signal, the slope of fluorescence represents the exonuclease activity of different samples. (Taq DNA polymerase exonuclease activity-antibody enzyme exonuclease activity)÷Taq DNA polymerase exonuclease activity x 100% represents the efficiency of antibody blocking exonuclease activity. Table 13 and Figure 2 are the summary of the results of the screening of the exonuclease activity of each antibody, and the results show that the antibody blocking polymerization activity efficiency of E2, E5, E7, and E8 is higher than that of the control C2.

[0311] Table 20 Summary of the results of the screening of the exonuclease activity of each antibody

[0312] 3. Stability test of antibody binding to Taq DNA polymerase dimer in qPCR whole-mix system

[0313] Two antibodies (E7 and E10) were incubated with Taq DNA polymerase (Guangdong Feipeng Biological Co., Ltd., MD001) and tested in a qPCR full-mix system. After incubation at 37 degrees Celsius for 7 days, the Taq DNA polymerase (Feipeng, MD001) was compared. As shown in Figure 3, the experiment detected two concentrations of targets (100 copies and 10,000 copies), and the red curve was the Taq DNA polymerase modified by the double antibody, and the purple curve was the Taq DNA polymerase. It can be found that in the qPCR, the enzyme amplification curve of the double antibody modified enzyme can normally present S type, and the fluorescence curve of the Taq DNA polymerase decreases, proving that the TAQ enzyme modified by the double antibody is more stable under the test of 37 degrees Celsius for 7 days.

[0314] 4. Performance test of antibody-bound Taq DNA polymerase dimer in qPCR full-mix system:

[0315] The antibody E7 and E10 bound to the Taq DNA polymerase dimer were incubated with Anstart Taq DNA polymerase (Guangdong Feipeng Biological Co., Ltd., MD006) in a qPCR full-mix system, respectively. After incubation at 37 degrees Celsius for 7 days, the Anstart Taq DNA polymerase (MD006) was compared. As shown in Figure 4, curve 1 is the Taq DNA polymerase modified by the double antibody, and curve 2 is the Anstart Taq DNA polymerase. It can be found that in the qPCR, the enzyme amplification curve of the double antibody modified enzyme and the Anstart Taq DNA polymerase can normally present S type, and the CT value of the antibody-bound Taq DNA polymerase dimer is significantly smaller than that of the Anstart Taq DNA polymerase, proving that the TAQ enzyme modified by the double antibody has better amplification performance under the test of 37 degrees Celsius for 7 days.

[0316] Example 3 Antibody preparation

[0317] Four candidate antibodies were screened according to the method of the example, the amino acid sequences of the variable regions of the heavy chains and the light chains of the antibodies are shown in Table 21, the heavy chain of antibody 13D8 is shown as SEQ ID NO. 51, the light chain is shown as SEQ ID NO. 68; the heavy chain of antibody 6J12 is shown as SEQ ID NO. 52, the light chain is shown as SEQ ID NO. 69; the heavy chain of antibody 7M9 is shown as SEQ ID NO. 53, the light chain is shown as SEQ ID NO. 70; the heavy chain of antibody 10C13 is shown as SEQ ID NO. 54, the light chain is shown as SEQ ID NO. 71. The constant region of the heavy chain of antibody 13D8 and 7M9 is shown as SEQ ID NO. 37, the constant region of the heavy chain of antibody 6J12 and 10C13 is shown as SEQ ID NO. 35; the constant region of the light chain of antibody 13D8 is shown as SEQ ID NO. 40, the constant region of the light chain of antibody 6J12, 7M9 and 10C13 is shown as SEQ ID NO. 38, the CDR sequences of each antibody are shown in Tables 11-14, respectively.

[0318] Table 21

[0319] Example 4 Verification of antibody performance

[0320] 1. Antibody binding to Taq DNA polymerase to block polymerization efficiency

[0321] Each candidate antibody and control antibody C1 (Guangdong Fipeng Biotechnology Co., Ltd., from MD010) were incubated with Taq DNA polymerase to obtain antibody enzyme, the incubation conditions were that 0.3 mg / mL of antibody was incubated with 10 U / uL of Taq enzyme at 25°C for 30 min. The amount of DNA strand incorporation by 15 nmol of dNTP within 30 min at 75°C defined the enzyme activity. The calibration of enzyme activity used the fluorescence signal measured by the macro stone SLAN instrument, and the slope of fluorescence was used to represent the polymerase activity of different samples. (Taq DNA polymerase polymerase activity-antibody enzyme polymerase activity) ÷ Taq DNA polymerase polymerase activity x 100% to represent the efficiency of antibody blocking polymerization activity. Table 22 and Figure 5 are the summary of the screening results of the blocking exonuclease activity of each antibody. The results show that the blocking exonuclease activity of antibody 6J12 is higher than that of control C1.

[0322] Table 22 Summary of antibody blocking polymerization activity screening results

[0323] 2. Antibody binding to Taq DNA polymerase to block exonuclease efficiency

[0324] Each of the alternative antibodies and control antibody C2 (Guangdong Fipeng Biological Co., Ltd., from MDAD029) was incubated with Taq DNA polymerase to obtain an antibody enzyme, and the incubation conditions were that 0.3 mg / mL of the antibody was incubated with 10 U / uL of Taq enzyme at 25°C for 30 min. In order to detect the exonuclease activity of the polymerase, a long hairpin structure primer was designed, and the sequence was: ACGTAGCGAAGGATGTGAACCTAATCCCTGCTCCCGCGGCCGATCTGCCGGCCGCGGG (SEQ ID NO. 152). In the presence of Taq DNA polymerase, the exonuclease activity of the polymerase will cut the probe to produce fluorescence, and the fluorescence signal was measured by using the Macrostone SLAN instrument, and the slope of the fluorescence represents the exonuclease activity of different samples. (Taq DNA polymerase exonuclease activity-antibody enzyme exonuclease activity) ÷ Taq DNA polymerase exonuclease activity x 100% to represent the efficiency of antibody blocking exonuclease activity. Table 23 and Figure 6 are the summary of the screening results of the exonuclease activity of each antibody. The results show that the efficiency of the antibody blocking exonuclease activity is higher than that of the control C2.

[0325] Table 23 Summary of antibody exonuclease activity screening results

[0326] Example 5 Preparation of antibodies

[0327] The following three alternative antibodies were screened according to the method of Example Step 1, and the amino acid sequences of the variable regions of the heavy chains and the light chains of the antibodies are shown in Table 24. The heavy chain of antibody 7M17 is shown as SEQ ID NO. 55, and the light chain is shown as SEQ ID NO. 72; the heavy chain of antibody 10D12 is shown as SEQ ID NO. 56, and the light chain is shown as SEQ ID NO. 73; the heavy chain of antibody 17M12 is shown as SEQ ID NO. 57, and the light chain is shown as SEQ ID NO. 74. The constant region of the heavy chain of antibodies 7M17, 10D12 and 17M12 is shown as SEQ ID NO. 36, and the constant region of the light chain of antibodies 7M17, 10D12 and 17M12 is shown as SEQ ID NO. 39. The CDR sequences of each antibody are shown in Tables 15-17, respectively.

[0328] Table 24

[0329] The antibodies of the present example were prepared according to the following method:

[0330] 1. Construction of expression plasmid

[0331] 1) Vector modification: pcDNA TM 3.4 vector is a recombinant antibody eukaryotic expression vector constructed, the expression vector is modified to introduce a multiple enzyme cutting site, hereinafter referred to as 3.4A expression vector.

[0332] 2) Amplification of light chain and heavy chain gene fragments: according to the light chain variable region gene sequence of the antibody, primers are designed between the light chain variable region and the constant region, and a restriction enzyme cutting site and a protection base are added to the most upstream primer of the light chain variable region and the most downstream primer of the light chain constant region, respectively, and overlap PCR is performed to obtain the light chain.

[0333] According to the heavy chain variable region gene sequence obtained by antibody discovery, primers are designed between the heavy chain variable region and the constant region, and the most downstream primer of the heavy chain constant region is designed according to the requirement of the antibody type at the specified truncated position, for example, Fab antibody is prepared according to the position of the Fab heavy chain constant region, then the most upstream primer of the heavy chain variable region and the most downstream primer of the heavy chain constant region are added with a restriction enzyme cutting site and a protection base, respectively, and overlap PCR is performed to obtain the heavy chain of the required antibody type.

[0334] 3) Construction of expression plasmid: the heavy chain and light chain gene fragments are double digested with restriction enzymes, the 3.4A vector is double digested with restriction enzymes, and the fragments and the vector are purified and recovered, then the heavy chain gene and the light chain gene are connected to the 3.4A expression vector, respectively, to obtain the heavy chain and light chain connection products, respectively; the above connection products are respectively transferred to E. coli, single clone strains are selected and cultured, plasmids are extracted and arranged for first generation sequencing, and whether the construction is correct is determined according to the first generation sequencing result.

[0335] 2. Expression plasmid extraction: select the single clone strain with correct sequencing for overnight amplification culture of 30ml; the next day, arrange plasmid extraction; perform PCR and gel running identification on the extracted plasmid to confirm whether the extracted plasmid is positive and the structure is correct; finally, the plasmid is aliquoted and stored in a -20 degree refrigerator for standby use.

[0336] 3. Preparation of recombinant antibody: HEK293 cells are recovered in advance, subcultured to 200ml system, and the cell density is allowed to reach 3-5×10 6 cells / ml, and the cell viability is >95%; centrifugal washing of the cells is performed, the cells are resuspended with culture medium, the cell count is performed, and the density is 3.1×10 6cells / ml. The plasmid DNA and transfection reagent dilutions were prepared with the culture medium. The transfection reagent dilution was added to the plasmid DNA dilution, mixed and placed at room temperature for 15 min; the mixture was slowly added to the cell dilution within 1 min, mixed, sampled, recorded and observed for cell transfection activity, and placed in a 35°C incubator at 120 rpm and 8% CO2. After 13 days, the sample was collected by centrifugation; the recombinant antibody supernatant was purified by protein G affinity chromatography column to obtain the purified antibody.

[0337] Fab antibodies of 7M17, 10D12 and 17M12 were constructed by the above method and subjected to blocking effect test.

[0338] Example 6

[0339] 1. Polymerization blocking effect test of Fab antibody binding to Taq DNA polymerase:

[0340] The Fab antibody 17M12 and the control antibody C1 (Guangdong Feipeng Biological Co., Ltd., from MD010) were incubated with Taq DNA polymerase to obtain antibody enzymes, and the enzyme to antibody modification molar ratio was 1:2. According to the specific activity of Taq DNA polymerase, the prepared antibody enzyme was diluted to prepare a working solution of 5 U / μL, and the polymerization blocking effect of the antibody enzyme was detected. The detection results are shown in Figure 7. Compared with the combination of Taq DNA polymerase+C1, the fluorescence signal of the combination of Taq DNA polymerase+17M12 antibody enzyme was overlapped with the signal of the no enzyme group (NEC) without rising, indicating that 7M17 can better block the polymerization activity of Taq DNA polymerase.

[0341] 2. Exonuclease blocking effect test of Fab antibody binding to Taq DNA polymerase:

[0342] The antibodies 7M17, TAQ-10D12 and the control antibody C2 (Guangdong Feipeng Biological Co., Ltd., from MDAD029) were incubated with Taq DNA polymerase to obtain antibody enzymes, and the enzyme to antibody modification molar ratio was 1:2. According to the specific activity of Taq DNA polymerase, the prepared antibody enzyme was diluted to prepare a working solution of 5 U / μL, and the exonuclease blocking effect of the antibody enzyme was detected. The detection results are shown in Figure 8. Compared with the combination of Taq DNA polymerase+C2, the fluorescence signal of the combination of Taq DNA polymerase+7M17 antibody enzyme and the combination of Taq DNA polymerase 10D12 antibody enzyme was overlapped with the signal of the no enzyme group (NEC) without rising, indicating that the antibodies 7M17 and 10D12 can better block the exonuclease activity of Taq DNA polymerase.

[0343] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present disclosure, and are not intended to limit the present disclosure; although the present disclosure has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present disclosure.

Claims

1. An antibody against Taq DNA polymerase or an antigen-binding fragment thereof, characterized in that, The antibody or its antigen-binding fragment contains complementarity-determining regions HCDR1, HCDR2 and HCDR3 of the heavy chain variable region, and / or complementarity-determining regions LCDR1, LCDR2 and LCDR3 of the light chain variable region. The HCDR1 includes amino acid residues GY, SN, NY, SH, SY, TF, KY, or an amino acid sequence as shown in SEQ ID NO.

80. The HCDR2 comprises any of the amino acid sequences shown in SEQ ID NO. 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115 and 117; The HCDR3 comprises any of the amino acid sequences shown in SEQ ID NO. 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146 and 148; The LCDR1 includes amino acid residues YSY, SSR, GSY, SSY, FNA, GSN, NNL, GSD, SNL, GDL, YSL, and any of the amino acid sequences shown in SEQ ID NO. 158, 162, and 167. The LCDR2 includes amino acid residues DA, SA, RA, KA, FE, YA, GA, EA, or DS. The LCDR3 includes an amino acid sequence as shown in any of SEQ ID NO. 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213 and 215.

2. The antibody against Taq DNA polymerase or its antigen-binding fragment according to claim 1, characterized in that, According to the Kabat definition: The HCDR1 comprises an amino acid sequence as shown in any of SEQ ID NO 75-79, 81-88; The HCDR2 comprises any of the amino acid sequences shown in SEQ ID NO. 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116 and 118; The HCDR3 comprises any of the amino acid sequences shown in SEQ ID NO. 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145 and 147; The LCDR1 includes an amino acid sequence as shown in any of SEQ ID NO. 149-157, 159-161, 163-166 and 168; The LCDR2 comprises any of the amino acid sequences shown in SEQ ID NO.169-181; The LCDR3 includes an amino acid sequence as shown in any of SEQ ID NO. 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212 and 214.

3. The antibody against Taq DNA polymerase or its antigen-binding fragment according to claim 1 or 2, characterized in that, The complementarity-determining region of the antibody against Taq DNA polymerase or its antigen-binding fragment includes any one of the following (a1) to (a17): (a1)HCDR1 includes the amino acid residue GY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.89, HCDR3 includes the amino acid sequence shown in SEQ ID NO.120, LCDR1 includes the amino acid residue YSY, LCDR2 includes the amino acid residue DA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

183. (a2) HCDR1 includes amino acid residue SN, HCDR2 includes the amino acid sequence shown in SEQ ID NO.91, HCDR3 includes the amino acid sequence shown in SEQ ID NO.122, LCDR1 includes amino acid residue SSR, LCDR2 includes amino acid residue SA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

185. (a3)HCDR1 includes the amino acid residue GY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.89, HCDR3 includes the amino acid sequence shown in SEQ ID NO.120, LCDR1 includes the amino acid residue YSY, LCDR2 includes the amino acid residue RA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

187. (a4)HCDR1 includes the amino acid residue GY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.89, HCDR3 includes the amino acid sequence shown in SEQ ID NO.120, LCDR1 includes the amino acid residue YSY, LCDR2 includes the amino acid residue KA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

189. (a5)HCDR1 includes the amino acid residue NY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.93, HCDR3 includes the amino acid sequence shown in SEQ ID NO.124, LCDR1 includes the amino acid residue GSY, LCDR2 includes the amino acid residue FE, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

191. (a6)HCDR1 includes the amino acid residue NY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.95, HCDR3 includes the amino acid sequence shown in SEQ ID NO.126, LCDR1 includes the amino acid residue SSY, LCDR2 includes the amino acid residue YA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

193. (a7)HCDR1 includes the amino acid sequence shown in SEQ ID NO.80, HCDR2 includes the amino acid sequence shown in SEQ ID NO.97, HCDR3 includes the amino acid sequence shown in SEQ ID NO.128, LCDR1 includes the amino acid residue FNA, LCDR2 includes the amino acid residue GA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

195. (a8)HCDR1 includes the amino acid residue SH, HCDR2 includes the amino acid sequence shown in SEQ ID NO.99, HCDR3 includes the amino acid sequence shown in SEQ ID NO.130, LCDR1 includes the amino acid residue GSN, LCDR2 includes the amino acid residue GA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

197. (a9) HCDR1 includes the amino acid residue SY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.101, HCDR3 includes the amino acid sequence shown in SEQ ID NO.132, LCDR1 includes the amino acid sequence shown in SEQ ID NO.158, LCDR2 includes the amino acid residue KA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

199. (a10)HCDR1 includes the amino acid residue SY,HCDR2 includes the amino acid sequence shown in SEQ ID NO.103,HCDR3 includes the amino acid sequence shown in SEQ ID NO.134,LCDR1 includes the amino acid residue NNL,LCDR2 includes the amino acid residue RA,LCDR3 includes the amino acid sequence shown in SEQ ID NO.

201. (a11)HCDR1 includes the amino acid residue SY,HCDR2 includes the amino acid sequence shown in SEQ ID NO.105,HCDR3 includes the amino acid sequence shown in SEQ ID NO.136,LCDR1 includes the amino acid residue SSY,LCDR2 includes the amino acid residue EA,LCDR3 includes the amino acid sequence shown in SEQ ID NO.

203. (a12)HCDR1 includes the amino acid residue TF,HCDR2 includes the amino acid sequence shown in SEQ ID NO.107,HCDR3 includes the amino acid sequence shown in SEQ ID NO.138,LCDR1 includes the amino acid sequence shown in SEQ ID NO.162,LCDR2 includes the amino acid residue YA, andLCDR3 includes the amino acid sequence shown in SEQ ID NO.

205. (a13)HCDR1 includes the amino acid residue SY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.109, HCDR3 includes the amino acid sequence shown in SEQ ID NO.140, LCDR1 includes the amino acid residue GSD, LCDR2 includes the amino acid residue RA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

207. (a14)HCDR1 includes the amino acid residue KY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.111, HCDR3 includes the amino acid sequence shown in SEQ ID NO.142, LCDR1 includes the amino acid residue SNL, LCDR2 includes the amino acid residue DA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

209. (a15)HCDR1 includes the amino acid residue SY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.113, HCDR3 includes the amino acid sequence shown in SEQ ID NO.144, LCDR1 includes the amino acid residue GDL, LCDR2 includes the amino acid residue GA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

211. (a16)HCDR1 includes the amino acid residue SY,HCDR2 includes the amino acid sequence shown in SEQ ID NO.115,HCDR3 includes the amino acid sequence shown in SEQ ID NO.146,LCDR1 includes the amino acid sequence shown in SEQ ID NO.167,LCDR2 includes the amino acid residue DS, andLCDR3 includes the amino acid sequence shown in SEQ ID NO.

213. (a17)HCDR1 includes the amino acid residue SY, HCDR2 includes the amino acid sequence shown in SEQ ID NO.117, HCDR3 includes the amino acid sequence shown in SEQ ID NO.148, LCDR1 includes the amino acid residue YSL, LCDR2 includes the amino acid residue RA, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

215. Optionally, according to the Kabat definition, the complementarity-determining region of the antibody against Taq DNA polymerase or its antigen-binding fragment includes any one of the following (b1) to (b17): (b1)HCDR1 includes the amino acid sequence shown in SEQ ID NO.75, HCDR2 includes the amino acid sequence shown in SEQ ID NO.90, HCDR3 includes the amino acid sequence shown in SEQ ID NO.119, LCDR1 includes the amino acid sequence shown in SEQ ID NO.149, LCDR2 includes the amino acid sequence shown in SEQ ID NO.169, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

182. (b2) HCDR1 includes the amino acid sequence shown in SEQ ID NO.76, HCDR2 includes the amino acid sequence shown in SEQ ID NO.92, HCDR3 includes the amino acid sequence shown in SEQ ID NO.121, LCDR1 includes the amino acid sequence shown in SEQ ID NO.150, LCDR2 includes the amino acid sequence shown in SEQ ID NO.170, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

184. (b3)HCDR1 includes the amino acid sequence shown in SEQ ID NO.75, HCDR2 includes the amino acid sequence shown in SEQ ID NO.90, HCDR3 includes the amino acid sequence shown in SEQ ID NO.119, LCDR1 includes the amino acid sequence shown in SEQ ID NO.151, LCDR2 includes the amino acid sequence shown in SEQ ID NO.171, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

186. (b4)HCDR1 includes the amino acid sequence shown in SEQ ID NO.75, HCDR2 includes the amino acid sequence shown in SEQ ID NO.90, HCDR3 includes the amino acid sequence shown in SEQ ID NO.119, LCDR1 includes the amino acid sequence shown in SEQ ID NO.151, LCDR2 includes the amino acid sequence shown in SEQ ID NO.172, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

188. (b5)HCDR1 includes the amino acid sequence shown in SEQ ID NO.77, HCDR2 includes the amino acid sequence shown in SEQ ID NO.94, HCDR3 includes the amino acid sequence shown in SEQ ID NO.123, LCDR1 includes the amino acid sequence shown in SEQ ID NO.153, LCDR2 includes the amino acid sequence shown in SEQ ID NO.173, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

190. (b6)HCDR1 includes the amino acid sequence shown in SEQ ID NO.78, HCDR2 includes the amino acid sequence shown in SEQ ID NO.96, HCDR3 includes the amino acid sequence shown in SEQ ID NO.125, LCDR1 includes the amino acid sequence shown in SEQ ID NO.154, LCDR2 includes the amino acid sequence shown in SEQ ID NO.174, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

192. (b7)HCDR1 includes the amino acid sequence shown in SEQ ID NO.79, HCDR2 includes the amino acid sequence shown in SEQ ID NO.98, HCDR3 includes the amino acid sequence shown in SEQ ID NO.127, LCDR1 includes the amino acid sequence shown in SEQ ID NO.155, LCDR2 includes the amino acid sequence shown in SEQ ID NO.175, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

194. (b8) HCDR1 includes the amino acid sequence shown in SEQ ID NO.81, HCDR2 includes the amino acid sequence shown in SEQ ID NO.100, HCDR3 includes the amino acid sequence shown in SEQ ID NO.129, LCDR1 includes the amino acid sequence shown in SEQ ID NO.156, LCDR2 includes the amino acid sequence shown in SEQ ID NO.176, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

196. (b9) HCDR1 includes the amino acid sequence shown in SEQ ID NO.82, HCDR2 includes the amino acid sequence shown in SEQ ID NO.102, HCDR3 includes the amino acid sequence shown in SEQ ID NO.131, LCDR1 includes the amino acid sequence shown in SEQ ID NO.157, LCDR2 includes the amino acid sequence shown in SEQ ID NO.172, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

198. (b10)HCDR1 includes the amino acid sequence shown in SEQ ID NO.83, HCDR2 includes the amino acid sequence shown in SEQ ID NO.104, HCDR3 includes the amino acid sequence shown in SEQ ID NO.133, LCDR1 includes the amino acid sequence shown in SEQ ID NO.159, LCDR2 includes the amino acid sequence shown in SEQ ID NO.171, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.200; (b11)HCDR1 includes the amino acid sequence shown in SEQ ID NO.84, HCDR2 includes the amino acid sequence shown in SEQ ID NO.106, HCDR3 includes the amino acid sequence shown in SEQ ID NO.135, LCDR1 includes the amino acid sequence shown in SEQ ID NO.160, LCDR2 includes the amino acid sequence shown in SEQ ID NO.177, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.202; (b12)HCDR1 includes the amino acid sequence shown in SEQ ID NO.85, HCDR2 includes the amino acid sequence shown in SEQ ID NO.108, HCDR3 includes the amino acid sequence shown in SEQ ID NO.137, LCDR1 includes the amino acid sequence shown in SEQ ID NO.161, LCDR2 includes the amino acid sequence shown in SEQ ID NO.174, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.204; (b13)HCDR1 includes the amino acid sequence shown in SEQ ID NO.84, HCDR2 includes the amino acid sequence shown in SEQ ID NO.110, HCDR3 includes the amino acid sequence shown in SEQ ID NO.139, LCDR1 includes the amino acid sequence shown in SEQ ID NO.163, LCDR2 includes the amino acid sequence shown in SEQ ID NO.171, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

206. (b14)HCDR1 includes the amino acid sequence shown in SEQ ID NO.86, HCDR2 includes the amino acid sequence shown in SEQ ID NO.112, HCDR3 includes the amino acid sequence shown in SEQ ID NO.141, LCDR1 includes the amino acid sequence shown in SEQ ID NO.164, LCDR2 includes the amino acid sequence shown in SEQ ID NO.178, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

208. (b15)HCDR1 includes the amino acid sequence shown in SEQ ID NO.87, HCDR2 includes the amino acid sequence shown in SEQ ID NO.114, HCDR3 includes the amino acid sequence shown in SEQ ID NO.143, LCDR1 includes the amino acid sequence shown in SEQ ID NO.165, LCDR2 includes the amino acid sequence shown in SEQ ID NO.179, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

210. (b16)HCDR1 includes the amino acid sequence shown in SEQ ID NO.88, HCDR2 includes the amino acid sequence shown in SEQ ID NO.116, HCDR3 includes the amino acid sequence shown in SEQ ID NO.145, LCDR1 includes the amino acid sequence shown in SEQ ID NO.166, LCDR2 includes the amino acid sequence shown in SEQ ID NO.180, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.212; (b17)HCDR1 includes the amino acid sequence shown in SEQ ID NO.82, HCDR2 includes the amino acid sequence shown in SEQ ID NO.118, HCDR3 includes the amino acid sequence shown in SEQ ID NO.147, LCDR1 includes the amino acid sequence shown in SEQ ID NO.168, LCDR2 includes the amino acid sequence shown in SEQ ID NO.181, and LCDR3 includes the amino acid sequence shown in SEQ ID NO.

214.

4. An antibody against Taq DNA polymerase or an antigen-binding fragment thereof, characterized in that, The antibody or its antigen-binding fragment contains complementarity-determining regions HCDR1, HCDR2 and HCDR3 of the heavy chain variable region, and / or complementarity-determining regions LCDR1, LCDR2 and LCDR3 of the light chain variable region. The HCDR1, HCDR2, and HCDR3 comprise amino acid sequences consistent with the heavy chain variable regions shown in any of SEQ ID NO. 1 to 17. The LCDR1, LCDR2, and LCDR3 comprise amino acid sequences identical to those of the light chain variable regions shown in any one of SEQ ID NO. 18–34; Optionally, the variable regions HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3 are defined by any one or a combination of multiple definition systems, such as Kabat, Chothia, IMGT, ABM, or Contact.

5. The antibody against Taq DNA polymerase or its antigen-binding fragment according to any one of claims 1 to 4, characterized in that, The antibody contains a heavy chain framework region and / or a light chain framework region, the species of which is derived from rabbit, cattle, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock, human, and mutants thereof.

6. The antibody against Taq DNA polymerase or its antigen-binding fragment according to any one of claims 1 to 5, characterized in that, The antibody against Taq DNA polymerase or its antigen-binding fragment has an amino acid sequence as shown in any one of SEQ ID NO. 1 to 17 or a heavy chain variable region having at least 73% sequence identity with an amino acid sequence as shown in any one of SEQ ID NO. 1 to 17; And / or, the antibody against Taq DNA polymerase or its antigen-binding fragment has an amino acid sequence as shown in any one of SEQ ID NO. 18 to 34 or a light chain variable region having at least 75% sequence identity with an amino acid sequence as shown in any one of SEQ ID NO. 18 to 34; Optionally, the antibody against Taq DNA polymerase or its antigen-binding fragment includes a heavy chain variable region and a light chain variable region of any one of the following (e1) to (e17): (e1) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.1; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.18; (e2) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.2; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.19; (e3) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.3; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.20; (e4) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.4; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.21; (e5) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.5; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.22; (e6) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO. 6; and the light chain variable region of the amino acid sequence shown in SEQ ID NO. 23; (e7) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.7; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.24; (e8) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO. 8; and the light chain variable region of the amino acid sequence shown in SEQ ID NO. 25; (e9) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO. 9; and the light chain variable region of the amino acid sequence shown in SEQ ID NO. 26; (e10) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.10; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.27; (e11) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.11; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.28; (e12) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.12; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.29; (e13) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.13; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.30; (e14) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.14; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.31; (e15) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.15; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.32; (e16) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.16; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.33; (e17) The heavy chain variable region of the amino acid sequence shown in SEQ ID NO.17; and the light chain variable region of the amino acid sequence shown in SEQ ID NO.

34.

7. The antibody against Taq DNA polymerase or its antigen-binding fragment according to any one of claims 1 to 6, characterized in that, The antigen-binding fragment includes one or more of F(ab')2, Fab', Fab, Fv, scFv, dsFv, and the smallest antibody recognition unit; Optionally, the antibody against Taq DNA polymerase or its antigen-binding fragment contains part or all of the constant region sequence; Optionally, the constant region sequence is selected from a portion or all of the constant region sequences of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, or IgD. Optionally, the species source of the constant region is one or more of the following: rabbit, cow, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock, human, and mutants thereof; Optionally, the antibody against Taq DNA polymerase or its antigen-binding fragment comprises a heavy chain constant region; and / or comprises a light chain constant region; Optionally, the antibody against Taq DNA polymerase or its antigen-binding fragment comprises a heavy chain constant region of the amino acid sequence shown in SEQ ID NO. 35, 36 or 37; Optionally, the antibody against Taq DNA polymerase or its antigen-binding fragment comprises a light chain constant region of an amino acid sequence as shown in SEQ ID NO. 38, 39 or 40; Optionally, the amino acid sequence of the antibody against Taq DNA polymerase is selected from any one of the following (E1) to (E17): (E1) The heavy chain of the amino acid sequence shown in SEQ ID NO.41 and the light chain of the amino acid sequence shown in SEQ ID NO.58; (E2) The heavy chain of the amino acid sequence shown in SEQ ID NO.42 and the light chain of the amino acid sequence shown in SEQ ID NO.59; (E3) The heavy chain of the amino acid sequence shown in SEQ ID NO.43 and the light chain of the amino acid sequence shown in SEQ ID NO.60; (E4) The heavy chain of the amino acid sequence shown in SEQ ID NO.44 and the light chain of the amino acid sequence shown in SEQ ID NO.61; (E5) The heavy chain of the amino acid sequence shown in SEQ ID NO.45 and the light chain of the amino acid sequence shown in SEQ ID NO.62; (E6) The heavy chain of the amino acid sequence shown in SEQ ID NO.46 and the light chain of the amino acid sequence shown in SEQ ID NO.63; (E7) The heavy chain of the amino acid sequence shown in SEQ ID NO.47 and the light chain of the amino acid sequence shown in SEQ ID NO.64; (E8) The heavy chain of the amino acid sequence shown in SEQ ID NO.48 and the light chain of the amino acid sequence shown in SEQ ID NO.65; (E9) The heavy chain of the amino acid sequence shown in SEQ ID NO.49 and the light chain of the amino acid sequence shown in SEQ ID NO.66; (E10) The heavy chain of the amino acid sequence shown in SEQ ID NO.50 and the light chain of the amino acid sequence shown in SEQ ID NO.67; (E11) The heavy chain of the amino acid sequence shown in SEQ ID NO.51 and the light chain of the amino acid sequence shown in SEQ ID NO.68; (E12) The heavy chain of the amino acid sequence shown in SEQ ID NO.52 and the light chain of the amino acid sequence shown in SEQ ID NO.69; (E13) The heavy chain of the amino acid sequence shown in SEQ ID NO.53 and the light chain of the amino acid sequence shown in SEQ ID NO.70; (E14) The heavy chain of the amino acid sequence shown in SEQ ID NO.54 and the light chain of the amino acid sequence shown in SEQ ID NO.71; (E15) The heavy chain of the amino acid sequence shown in SEQ ID NO.55 and the light chain of the amino acid sequence shown in SEQ ID NO.72; (E16) The heavy chain of the amino acid sequence shown in SEQ ID NO.56 and the light chain of the amino acid sequence shown in SEQ ID NO.73; (E17) The heavy chain of the amino acid sequence shown in SEQ ID NO.57 and the light chain of the amino acid sequence shown in SEQ ID NO.

74.

8. An antibody composition, characterized in that, The antibody comprising at least two of the anti-Taq DNA polymerases as described in any one of claims 1 to 7, or an antigen-binding fragment thereof; Optionally, at least one Taq polymerase antibody in the antibody composition has blocking exonuclease activity, and at least one Taq polymerase antibody has blocking polymerization activity.

9. A biomaterial, characterized in that, Selected from (i) nucleic acid molecules, (ii) vectors, or (iii) recombinant cells; The (i) nucleic acid molecule encodes an antibody or antigen-binding fragment thereof against the anti-Taq DNA polymerase as described in any one of claims 1 to 7; The (ii) vector carries the (i) nucleic acid molecule; The (iii) recombinant cell expresses the antibody against Taq DNA polymerase as described in any one of claims 1 to 7 or its antigen-binding fragment, or contains the (i) nucleic acid molecule, or contains the (ii) vector.

10. The use of the antibody against Taq DNA polymerase according to any one of claims 1 to 7 or the antigen-binding fragment thereof, or the antibody composition according to claim 8, or the biomaterial according to claim 9, in any one of (i) to (x) below: (i) Preparation of antibody-modified Taq DNA polymerase; (ii) Preparation of hot-start Taq DNA polymerase; (iii) Block the polymerization activity of Taq DNA polymerase below 75°C; (iv) Prepare a product for blocking the polymerization activity of Taq DNA polymerase below 75°C; (v) Block the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C; (vi) Prepare a method for blocking the 5'-3' exonuclease activity of Taq DNA polymerase below 75°C; (vii) Reduce non-specific amplification by Taq DNA polymerase; (ⅷ) Prepare products that reduce the non-specific amplification of Taq DNA polymerase; (ix) Improve the thermal stability of Taq DNA polymerase; (x) Prepare products that improve the thermal stability of Taq DNA polymerase.

11. An antibody-modified Taq DNA polymerase, characterized in that, It is an antigen-antibody complex formed by binding the antibody against Taq DNA polymerase as described in any one of claims 1 to 7 or its antigen-binding fragment to Taq DNA polymerase; or, it is an antigen-antibody complex formed by binding the antibody composition as described in claim 8 to Taq DNA polymerase.

12. A composition for nucleotide amplification, characterized in that, Includes (A) and (B): (A) The antibody-modified Taq DNA polymerase of claim 11; (B) One or more of the following four deoxyribonucleoside triphosphates, primers, probes, metal ions, templates, and buffer components.

13. A nucleotide amplification kit, characterized in that, The antibody comprising any one of claims 1 to 7 anti-Taq DNA polymerase or an antigen-binding fragment thereof, or the antibody composition of claim 8, or the antibody-modified Taq DNA polymerase of claim 11, or the composition for nucleotide amplification of claim 12.

14. The use of the antibody against Taq DNA polymerase according to any one of claims 1 to 7, or the antigen-binding fragment thereof, or the antibody composition according to claim 8, or the antibody-modified Taq DNA polymerase according to claim 11, or the composition for nucleotide amplification according to claim 12, or the nucleotide amplification kit according to claim 13, in any one of (I) to (IV): (I) Nucleic acid amplification; (II) Preparation of products for nucleic acid amplification; (III) Nucleic acid testing; (IV) Preparation of products for nucleic acid detection; Optionally, the nucleic acid includes DNA; Optionally, the nucleic acid amplification includes PCR.

15. A method for nucleic acid amplification, characterized in that, This includes hot-start PCR using the antibody-modified Taq DNA polymerase of claim 11, or the composition for nucleotide amplification of claim 12, or the nucleotide amplification kit of claim 13. Optionally, the hot-start PCR includes multiplex PCR, real-time PCR, and real-time quantitative PCR.

Images