Composition for treating hearing loss comprising viral vector
A viral vector with an EF1a promoter is used to express MPZL2 gene, addressing the need for a safe and effective gene therapy for hereditary hearing loss by achieving stable and non-toxic gene expression, thereby improving hearing function.
Patent Information
- Application Number
- PCT/KR2025/006003
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-25
- Filing Date
- 2025-05-02
- Publication Date
- 2026-01-02
AI Technical Summary
Current treatments for hereditary hearing loss, such as wearing hearing aids or cochlear implants, are not fundamental and there is a need for a safe and effective gene therapy method to address the underlying cause of hearing loss caused by MPZL2 mutations.
A viral vector containing an EF1a promoter is used to express the MPZL2 gene, providing stable and non-toxic gene expression to restore hearing function.
The EF1a promoter enables stable gene expression within a non-toxic range, effectively treating hereditary hearing loss caused by MPZL2 mutations, with improved hearing outcomes compared to existing methods.
Smart Images

Figure KR2025006003_02012026_PF_FP_ABST
Abstract
Description
Composition for treating hearing loss including viral vector
[0001] The present invention relates to a composition for treating hearing loss including a viral vector, and more particularly, to a viral vector including an EF1a promoter and expressing MPZL2, and a composition for treating hearing loss including the same.
[0002]
[0003] Hearing loss can be categorized into sensorineural and conductive hearing loss based on the underlying auditory system structure, and hereditary hearing loss can be categorized based on whether the condition is inherited or not. Hereditary hearing loss can be broadly categorized into syndromic and non-syndromic hearing loss, which can then be further divided into autosomal dominant and autosomal recessive inheritance patterns.
[0004] MPZL2 mutations cause autosomal recessive non-syndromic hearing loss (DFNB111), and because the disease is caused by loss of function of both alleles, gene replacement therapy can be applied to express more or supplement the normal gene.
[0005] Currently, the only realistic treatment for hearing loss due to hearing loss is wearing hearing aids or cochlear implants, and there is no established fundamental treatment method. In this context, gene therapy is attracting much attention because it treats the cause of hereditary hearing loss. However, because problems can arise due to in vivo overexpression during the process of delivering exogenous genes, it is crucial that gene expression is achieved within a non-toxic range. The present inventors have diligently researched and developed a method to fundamentally treat hereditary hearing loss, particularly hearing loss caused by MPZL2 mutations. As a result, they discovered that injecting a vector containing the EF1a promoter increased gene expression within a non-toxic range, stably restoring hearing, thereby completing the present invention.
[0006] Numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.
[0007]
[0008] An object of the present invention is to provide a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0009] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating hearing loss, comprising a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0010] The technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.
[0011]
[0012] Hereinafter, various embodiments described herein will be described with reference to the drawings. In the following description, various specific details, such as specific configurations, compositions, and processes, are set forth to provide a thorough understanding of the present invention. However, certain embodiments may be practiced with one or more of these specific details, or without them, or in conjunction with other known methods and configurations. In other instances, well-known processes and manufacturing techniques have not been described in specific detail so as not to unnecessarily obscure the present invention. Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the present invention. Thus, the appearances of "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the present invention. Additionally, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.
[0013] Unless otherwise specifically defined herein, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.
[0014]
[0015] The term "EF1a promoter (Eukaryotic Translation Elongation Factor 1 Alpha promoter)" used herein refers to a DNA sequence that regulates the expression of the EF1a gene, which plays a crucial role in translation. It is derived from the human EF1A1 gene, which encodes Eukaryotic Elongation Factor 1a (Ef-1a), a protein essential for cellular translation. The EF1a promoter can induce high levels of gene expression in many cell types, and is particularly effective in cell lines such as immune cells and stem cells. This is because the EF1a promoter is less susceptible to silencing in these cell types. The EF1a promoter can induce high levels of gene expression in a variety of cell lines, operates in a variety of species, including mammalian, avian, and some plant cell lines, provides long-term, stable gene expression, and contains various regulatory elements to regulate expression. The EF1a promoter can induce significant expression depending on the gene, and is therefore widely adopted for research and therapeutic purposes.
[0016] The term “CAG promoter (CMV early enhancer / chicken beta-actin promoter)” used herein refers to a synthetic promoter formed by combining the early enhancer of cytomegalovirus and the chicken beta-actin-derived promoter. It is particularly effective in neural cells and can be used with regulatory elements to achieve tissue-specific or time-specific expression. The CAG promoter can induce stable and strong gene expression in various cell types, and is therefore widely adopted for research and therapeutic purposes.
[0017] The term “viral vector” in this specification refers to a tool that utilizes the characteristics of a virus to deliver genetic material into a cell, and refers to a virus that has been engineered to be able to deliver a specific gene to a target cell using the viral infection mechanism.
[0018] The term "AAV (Adeno-Associated Virus)" used herein refers to a small, non-pathogenic virus frequently used as a vector for gene therapy. When a desired target gene sequence is inserted between the ITR sequences and injected, the target gene is expressed in the form of an episome for a long period of time in vivo. AAV can also be used to refer to the virus itself or its derivatives, such as AAV vectors, AAV viral particles, and AAV virions. The term AAV encompasses all subtypes, both naturally occurring and recombinant forms.
[0019] The term “AVV-DJ (Adeno-Associated Virus-DJ)” in this specification refers to a variant of an AAV vector that has been recombined for a specific purpose, in which the capsid proteins of AAV2, AAV8, and AAV9 are mixed to increase gene transfer efficiency and targeting efficiency to specific tissues.
[0020] The term “AVV-PHP.eB (Adeno-Associated Virus-PHP.eB)” in this specification refers to a variant of AAV vector targeting the central nervous system (CNS), and has the characteristic of being able to deliver genes to the brain and spinal cord with high efficiency, particularly in a mouse model.
[0021] In this specification, the term “MPZ (Myelin Protein Zero)” refers to a neuronal differentiation protein associated with neurons, which is involved in the formation of myelin sheaths. “MPZL (Myelin Protein Zero-like)” refers to a protein that performs cell-to-cell interaction and a functional role on the cell surface. Although not limited thereto, MPZL is a type of immunoglobulin superfamily (IgSF), and the family includes MPZL1 (Myelin Protein Zero-Like 1), MPZL2, and MPZL3. The immunoglobulin superfamily (IgSF) is composed of various cell surface molecules and performs functions such as immune response, cell adhesion, and signal transduction. The proteins of this superfamily have an immunoglobulin domain in common, and thus play an important role in cell-to-cell interaction and signal transduction. MPZL2 (Myelin Protein Zero-Like2) is a membrane protein located in the cell membrane that plays an important role in various physiological processes such as cell-to-cell signaling, regulation of immune responses, cell adhesion and tissue formation, and contribution to the development and maintenance of the nervous and immune systems. MPZL2 can be expressed in various organs and tissues, and in particular, the expression of MPZL2 may play an important role in the maintenance and development of auditory function. It is expressed in inner hair cells (IHCs), outer hair cells (OHCs), Deiter's cells, and pillar cells of the organ of Corti, and plays an essential role in the normal maintenance and development of auditory function. Mutations in the Mpzl2 gene can cause neurodevelopmental disorders, metabolic disorders, and immune disorders, and can cause DFNB111, a type of autosomal recessive non-syndromic hearing loss.In addition, diseases caused by mutations in the Mpzl2 gene may include, but are not limited to, metabolic disorders related to abnormalities in membrane protein transport function, neurodegenerative diseases related to abnormalities in signal transduction in nerve cells, and cancer, autoimmune diseases, and vascular diseases related to cell adhesion dysfunction (see Am J Hum Genet. 2018 Jul 5;103(1):74-88. doi: 10.1016 / j.ajhg.2018.05.011 and Hum Genet. 2018 Jul;137(6-7):479-486. doi: 10.1007 / s00439-018-1901-4).
[0022] The term "hearing loss" in this specification refers to a state or disease in which sounds cannot be heard properly due to a hearing problem. Hearing loss can be divided into sensorineural hearing loss and conductive hearing loss depending on the structure of the auditory organ causing the hearing loss, and hearing loss can be classified according to whether it is inherited or not. Hereditary hearing loss can be broadly divided into syndromic hearing loss and non-syndromic hearing loss, which can be further divided into autosomal dominant or autosomal recessive inheritance depending on the inheritance method. Sensorineural hearing loss refers to hearing loss caused by damage to the inner ear or auditory nerve, conductive hearing loss refers to hearing loss in which sound is not transmitted to the inner ear due to a problem in the outer or middle ear, symptomatic hearing loss refers to hearing loss that occurs together with other symptoms or medical conditions, and non-syndromic hearing loss refers to hearing loss that occurs independently without being accompanied by other medical symptoms or conditions, and this is the type that most hereditary hearing loss falls into. As used herein, the term “hearing loss” includes, but is not limited to, sensorineural hearing loss, conductive hearing loss, symptomatic hearing loss, and non-syndromic hearing loss.
[0023] The term "metabolic disorder" as used herein refers to a disease in which an abnormality occurs in the body's metabolic process. Metabolism is a general term for chemical reactions that occur within the body, including processes such as converting nutrients into energy or aiding cell growth and repair. Metabolic disorders occur when enzymes or proteins necessary for these metabolic processes are deficient or function abnormally. The metabolic disorders include, but are not limited to, diabetes, hyperthyroidism, hypothyroidism, phenylketonuria, Gaucher disease, galactosemia, organic aciduria, fat storage diseases, and anemia.
[0024] As used herein, the term "neurodegenerative disease" refers to a disease in which nerve cells in the central or peripheral nervous system are progressively damaged and lose function. These diseases worsen over time and result in a loss of physical, cognitive, and functional abilities. Examples of neurodegenerative diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, and prion diseases.
[0025] In this specification, the term “cancer” refers to a disease that can disrupt or destroy the function of a tissue or organ due to abnormal growth and division of normal cells, and abnormalities in cell adhesion proteins play an important role in the process of tumor formation and metastasis. The above cancers may include, but are not limited to, breast cancer, ovarian cancer, colon cancer, stomach cancer, liver cancer, pancreatic cancer, cervical cancer, thyroid cancer, parathyroid cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, or pituitary adenoma.
[0026] As used herein, the term "autoimmune disease" refers to a condition in which the immune system attacks normal tissues and cells, and abnormalities in cell adhesion function can affect the immune system. These autoimmune diseases include, but are not limited to, lupus, rheumatoid arthritis, Crohn's disease, and limbic dysplasia.
[0027] The term "vascular disease" as used herein refers to various diseases that can occur in the vascular system. Abnormalities in intravascular cell adhesion proteins can cause structural instability of blood vessels, which can lead to various diseases. These vascular diseases include, but are not limited to, arteriosclerosis, thrombosis, coronary artery disease, and hypertension.
[0028] The term "ABR (Auditory Brainstem Response)" used herein refers to a test method that measures the auditory brainstem response. It measures how the auditory nerve transmits sound stimuli to the brain. By measuring the electrical signals generated as sound stimuli pass through the inner ear canal, it assesses the functional status of the auditory system.
[0029] The term "Distortion Product Otoacoustic Emissions (DPOAE)" used herein refers to a test method for measuring the level of distortion produced by sound reflections in the inner ear canal using small sounds. It is particularly useful for assessing the degree and type of hearing loss and is commonly used in conjunction with ABR to enhance the completeness of hearing diagnosis.
[0030] The term “express” as used herein means artificially introducing a gene using a gene vector to cause a subject to express an exogenous gene or to increase the natural expression level of an endogenous gene, thereby making the gene replicable as an extrachromosomal element or through chromosomal integration within the subject cell. Therefore, the term “expression” has the same meaning as “transformation,” “transfection,” or “transduction.”
[0031] The term “prevention” as used herein means inhibiting the occurrence of a disease or condition in a subject who has not been diagnosed as having the disease or condition but is susceptible to developing the disease or condition.
[0032] As used herein, the term “treatment” means (a) inhibiting the development of a disease, condition, or symptom; (b) alleviating the disease, condition, or symptom; or (c) eliminating the disease, condition, or symptom. The composition of the present invention can inhibit the development of, eliminate, or alleviate the symptoms of hearing loss caused by a mutation in the Mpzl2 gene by increasing the expression of the Mpzl2 gene through a recombinant vector, ultimately reversibly restoring permanent hearing threshold changes. Therefore, the composition of the present invention can be a composition for treating hereditary hearing loss on its own, or can be administered together with other pharmacological ingredients and used as a therapeutic adjuvant. Accordingly, the terms “treatment” or “therapeutic agent” as used herein include the meaning of “therapeutic aid” or “therapeutic adjuvant.”
[0033] In addition, the composition of the present invention can suppress the development of symptoms of metabolic disorders caused by mutations in the Mpzl or Mpzl2 gene by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector, thereby eliminating or alleviating them.
[0034] The composition of the present invention can suppress the development of, eliminate, or alleviate symptoms of a neurodegenerative disease caused by a mutation in the Mpzl or Mpzl2 gene by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector.
[0035] The composition of the present invention can suppress the development of, eliminate, or alleviate symptoms of a neurodegenerative disease caused by a mutation in the Mpzl or Mpzl2 gene by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector.
[0036] The composition of the present invention can inhibit, eliminate, or alleviate the development of cancer caused by a mutation in the Mpzl or Mpzl2 gene by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector.
[0037] The composition of the present invention can suppress the development of symptoms of an autoimmune disease caused by a mutation in the Mpzl or Mpzl2 gene, eliminate them, or alleviate them by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector.
[0038] The composition of the present invention can suppress the development of symptoms of vascular disease caused by mutation of the Mpzl or Mpzl2 gene, eliminate them, or alleviate them by increasing the expression of the Mpzl or Mpzl2 gene through a recombinant vector.
[0039] As used herein, the term “administration” or “administer” refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the body of the subject.
[0040] In the present invention, the term "therapeutically effective amount" means the content of the composition in which the pharmacological ingredient in the composition is contained in an amount sufficient to provide a therapeutic or preventive effect to a subject to whom the pharmaceutical composition of the present invention is to be administered, and includes the meaning of "prophylactically effective amount".
[0041] The term "subject" as used herein includes, without limitation, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon, or rhesus macaque. Specifically, the subject of the present invention is a human.
[0042] When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier.
[0043] Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweetening agents, flavoring agents, emulsifiers, suspending agents, preservatives, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
[0044] The pharmaceutical composition of the present invention can be administered orally or parenterally, and specifically can be administered subcutaneously, transdermally, intravenously, or intratympanic.
[0045] The appropriate dosage of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity. The preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg / kg for adults.
[0046] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the like. In this case, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersing agent or stabilizer.
[0047] In one embodiment of the present invention, a viral vector is provided comprising an EF1a promoter and a gene encoding a neural differentiation protein. In the embodiment, the viral vector is an adeno-associated virus (AAV), the viral vector is provided as an AAV-DJ, the neural differentiation protein is a vector of MPZ or MPZL protein, the MPZL protein is MPZL1, MPZL2, or MPZL3, the viral vector is provided as a viral vector for use in the treatment or prevention of a disease caused by a Mpzl2 mutation, and the viral vector is provided as a vector targeting hair cells or Deiter's cells (pillar cells).
[0048] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating hearing loss comprising the vector as an active ingredient is provided.
[0049] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating a metabolic disorder is provided, comprising the vector as an active ingredient.
[0050] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating a neurodegenerative disease is provided, comprising the vector as an active ingredient.
[0051] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating cancer is provided, comprising the vector as an active ingredient.
[0052] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating an autoimmune disease is provided, comprising the vector as an active ingredient.
[0053] In one specific embodiment of the present invention, a pharmaceutical composition for preventing or treating vascular disease comprising the vector as an active ingredient is provided.
[0054] In one specific embodiment of the present invention, a method for preventing or treating hearing loss is provided, comprising the step of administering to a subject a pharmaceutical composition comprising a viral vector comprising an EF1a promoter and a gene encoding a neural cell differentiation protein as an active ingredient.
[0055] In the above specific example, the method is provided, wherein the viral vector is an adeno-associated virus (AAV), the method is provided, wherein the neural differentiation protein is an MPZ or MPZL protein, and the method is provided, wherein the hearing loss is an autosomal recessive non-syndromic hearing loss due to a mutation.
[0056] In one specific embodiment of the present invention, a method for preventing or treating a metabolic disorder caused by a mutation in the Mpzl gene is provided, comprising the step of administering to a subject a pharmaceutical composition comprising, as an active ingredient, a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0057] In the above specific example, the method is provided, wherein the metabolic disorder is any one selected from the group consisting of diabetes, hyperthyroidism, hypothyroidism, phenylketonuria, Gaucher disease, galactosemia, organic dysuria, fat storage disease, and anemia.
[0058] In one specific embodiment of the present invention, a method for preventing or treating a neurodegenerative disease caused by a mutation in the Mpzl gene is provided, comprising the step of administering to a subject a pharmaceutical composition comprising, as an active ingredient, a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0059] In the above specific example, the method is provided, wherein the neurodegenerative disease is any one selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, and prion disease.
[0060] In one specific embodiment of the present invention, a method for preventing or treating cancer caused by a mutation in the Mpzl gene is provided, comprising the step of administering to a subject a pharmaceutical composition comprising, as an active ingredient, a viral vector comprising an EF1a promoter and a gene encoding a neural cell differentiation protein.
[0061] In the above specific example, the cancer is any one selected from the group consisting of breast cancer, ovarian cancer, colon cancer, stomach cancer, liver cancer, pancreatic cancer, cervical cancer, thyroid cancer, parathyroid cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, or pituitary adenoma.
[0062] In one specific embodiment of the present invention, a method for preventing or treating an autoimmune disease caused by a mutation in the Mpzl gene is provided, comprising the step of administering to a subject a pharmaceutical composition comprising, as an active ingredient, a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0063] In the above specific example, the method is provided, wherein the autoimmune disease is any one selected from the group consisting of lupus, rheumatoid arthritis, Crohn's disease, and limbic disease.
[0064] In one specific embodiment of the present invention, a method for preventing or treating vascular disease caused by a mutation in the Mpzl gene is provided, comprising the step of administering to a subject a pharmaceutical composition comprising, as an active ingredient, a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein.
[0065] In the above specific example, the method is provided, wherein the vascular disease is any one selected from the group consisting of arteriosclerosis, thrombosis, coronary artery disease, and hypertension.
[0066]
[0067] Hearing loss caused by Mpzl2 mutation can be restored through gene replacement therapy using a viral vector comprising the EF1a promoter of the present invention and a gene encoding a neural cell differentiation protein, or a composition for treating hearing loss comprising the viral vector as an active ingredient. This can achieve a fundamental treatment for hereditary hearing loss for which there is currently no treatment.
[0068] The present invention also enables stable gene expression within a range that does not cause toxicity when using the EF1a promoter, in response to the problem of in vivo overexpression that may occur during the process of delivering an external gene.
[0069]
[0070] Figure 1 is a drawing showing the hearing test at 4 weeks of age of a mouse injected with the AAV-PHP.eB-hMPZL2 CAG promoter, through measurements of ABR (Figure 1a) and DPOAE (Figure 1b) threshold values.
[0071] Figure 2 is a drawing showing the hearing test using ABR and DPOAE threshold values at 4 weeks (Figures 2a and 2b), 8 weeks (Figures 2c and 2d), and 12 weeks (Figures 2e and 2f) of mice injected with the AAV-DJ-hMPZL2 CAG promoter and EF1a promoter.
[0072] Figure 3 is a graph showing the amount of hMPZL2 expression in the cochlea of 4-week-old mice injected with the AAV-DJ-hMPZL2 CAG promoter and EF1a promoter, and comparing the expression level values of actin regulated by the EF1a and CAG promoters with the EF1a promoter under the CAG promoter condition by normalizing the values.
[0073] Figure 4 is a drawing showing the results of immunofluorescence staining in the cochlea of a 4-week-old mouse injected with the AAV-DJ-hMPZL2 CAG promoter and EF1a promoter.
[0074]
[0075] Example 1. Creation of an Mpzl2 mutant hearing-deaf mouse model
[0076] Cyagen Biosciences generated a Mpzl2 mutant deafness mouse model using the CRSPR-CAS9 system. Cas9 mRNA, one donor oligo, and two gRNAs [AATTTCCGACCTCGAGATGG-GGG (forward) and TGCTCACGACCCCCATCTCG-AGG (reverse)] were microinjected into fertilized eggs of C57BL / 6N mice. The mutation in the Mpzl2 gene was confirmed by Sanger sequencing and genotyping.
[0077]
[0078] Example 2. AAV production and injection
[0079] AAV-PHP.eB serotype specific for hair cells and AAV-DJ serotype specific for Deiter's cells and pillar cells were used. AAV-PHP.eB and AAV-DJ viral vectors were constructed to carry the coding sequence of the human MPZL2 gene optimized for mouse codons and to carry the CAG promoter and the EF1a promoter. AAV-PHP.eB-CAG-MPZL2 and AAV-PHP.eB-EF1a-MPZL2 had an 80X10 13 , 1.32Х10 13 Produced by Vector Builder with titers of genome copies per milliliter, AAV-DJ-CAG-MPZL2 and AAV-DJ-EF1a-MPZL2 were 2.03Х10 13 , 1.23Х10 13 Titers of genome copies per milliliter were produced in the vector builder. AAV-PHP.eB-CAG-MPZL2, AAV-PHP.eB-EF1a-MPZL2, AAV-DJ-CAG-MPZL2, and AAV-DJ-EF1a-MPZL2 were stored at -80°C and thawed before in vivo injection.
[0080] Mice harboring the Mpzl2 p.Q74* mutation were anesthetized on ice for approximately 1 minute between days 0 and 3 immediately after birth. AAV-PHP.eB-CAG-hMPZL2, AAV-PHP.eB-EF1a-hMPZL2, AAV-DJ-CAG-hMPZL2, and AAV-DJ-EF1a-hMPZL2 were then injected in vivo through a round window membrane (RWM) to deliver them from the scala tympani into the scala media, where they were delivered to the target hair cells and supporting cells (Deiter's cells, Pillar cells).
[0081]
[0082] Example 3. Hearing measurement
[0083] Mice injected with the viral vector of Example 2 and non-injected mice (control group, Mpzl2-p. Q74) at 4, 8, and 12 weeks of age * ) was tested for hearing loss. Hearing tests were performed using Brainstem Response (ABR) and Distortion Product Otoacoustic Electroencephalography (DPOAE).
[0084] Mice injected with AAV-PHP.eB-CAG-hMPZL2 showed worse hearing than non-injected mice in audiometric ABR (Fig. 1, left) and DPOAE (Fig. 1, right) tests at 4 weeks of age (see Fig. 1), and mice injected with AAV-DJ-CAG-hMPZL2 showed complete hearing loss in audiometric ABR (Fig. 2, upper left) and DPOAE (Fig. 2, upper right) tests at 4 weeks of age. However, it was confirmed that the mice injected with AAV-DJ-EF1a-hMPZL2 had better hearing than the non-injected mice (control group) from 4 weeks of age (Figure 2, upper left) to 8 weeks of age (Figure 2, middle left) and 12 weeks of age (Figure 2, lower left) in the audiometric ABR, and it was also confirmed that the mice injected with AAV-DJ-EF1a-hMPZL2 had better hearing than the non-injected mice (control group) from 4 weeks of age (Figure 2, upper right) to 8 weeks of age (Figure 2, middle right) and 12 weeks of age (Figure 2, lower right) in the DPOAE (see Figure 2).
[0085] To summarize, it was as shown in Table 1 below:
[0086] VirusClick(dB)Hearing Control Group(Mpzl2) Q74* / Q74* )43.333-AAV-PHP.eB-CAG-hMPZL260 worsening AAV-DJ-CAG-hMPZL286.818 loss AAV-DJ-EF1a-hMPZL231.428 improvement
[0087] In the control group that was not injected with a viral vector, the threshold value (decibel, dB) for the Click stimulus was 43.333. The threshold value indicates the sensitivity to sound, and the lower the value, the better it is to hear soft sounds. When the AAV-PHP.eB-CAG-hMPZL2 vector was injected, the Click (dB) was 60, indicating that hearing was worse than the control group (Fig. 1). When the AAV-DJ-CAG-hMPZL2 vector was injected, the Click (dB) was 86.818, indicating that hearing was lost (Fig. 2, top). When the AAV-DJ-EF1a-hMPZL2 vector was injected, the Clic (dB) was 31.428, indicating that hearing was improved compared to the control group (Fig. 2).
[0088]
[0089] Example 4. Western blot
[0090] Two cochlear tissues were used for each sample. Cochlear tissues from mice injected with or without AAV-DJ-CAG-hMPZL2 and AAV-DJ-EF1a-hMPZL2 were isolated and lysed in cell lysis buffer containing a protease and phosphatase inhibitor cocktail (Thermo Scientific, cat. 78440) using a tissue lyser. The lysates were centrifuged at 15,000 rpm for 20 min at 4°C, and only the supernatant was collected. The protein concentration of the lysates was determined using the Bradford method (Bio-Rad, cat. 5000006). For electrophoresis, 20 μg of cochlear lysates were added with 2X SDS loading buffer and boiled at 100°C for 10 min to prepare samples. SDS-PAGE was performed on 4–12% gradient mini protein TGX gels (Bio-Rad), and proteins were transferred to nitrocellulose membranes using a Bio-Rad Trans-Blot Turbo transfer system (250 mA for 100 min). The membranes were then maintained in 5% skimmed milk (Biopure, cat. 8110s) at room temperature for 1 h and incubated with primary antibody (MPZL2 Polyclonal antibody, Proteintech, cat. 11787-1-AP) at a 1:1000 ratio overnight at 4°C. The membranes were washed three times with 1X TBST and incubated with anti-rabbit IgG-HRP (Enzo, cat# ADI-SAB-300-J) at a 1:1000 ratio in 5% skimmed milk for 1 h at room temperature. After washing with 1X TBST, antibody-antigen complexes were detected using Pierce® ECL Western Blotting Substrate (Thermo, cat. 32209), and protein bands were detected in the dark using CP-BU NEW XRAY FILM BLUE (AGFA, cat. CP-BU). The detected protein bands were then quantified using the ImageJ program.
[0091]
[0092] When the expression levels of hMPZL2 in the cochlea of 4-week-old mice injected with AAV-DJ-CAG-hMPZL2 and 4-week-old mice injected with AAV-DJ-EF1a-hMPZL2 were compared, it was confirmed that the expression level of hMPZL2 was approximately 23 times higher when the CAG promoter was injected than when the EF1a promoter was injected (Fig. 3).
[0093]
[0094] Example 5. Immunofluorescence staining
[0095] Cochlear tissues from mice injected with AAV-DJ-CAG-hMPZL2 and AAV-DJ-EF1a-hMPZL2 were isolated at 4 weeks of age. The cochlear tissues were fixed in 4% paraformaldehyde (PFA) solution overnight at 4°C. The fixed cochlear tissues were treated with 5 M EDTA (Intron, cat. IBS-BE002) solution for 3 days. Afterwards, the cochleas were blocked with 0.1% Triton X-100 solution made with donkey serum and Triton X-100 for 1 hour at room temperature and membrane permeabilization was performed. The sample was incubated overnight at 4°C with primary antibody (MPZL2 Polyclonal antibody, Proteintech, cat. 11787-1-AP) at a ratio of 1:200 in 0.1% Triton X-100 solution. After washing three times with 1X PBS, the sample was incubated with Alexa Fluor 594-conjugated secondary antibody (Invitrogen, Alexa FluorTM 594 donkey, anti-rabbit IgG (H+L)) at a ratio of 1:200, 1:100, and 1:400 in 0.1% Triton X-100 solution, respectively, followed by DAPI and Alexa Fluor-conjugated Phalloidin 488 (Thermo Fisher Scientific, Rockford, IL, USA) for 90 minutes at room temperature. After washing three times with 1X PBS for 15 minutes each, the samples treated with antifade reagent (Thermo Fisher Scientific, Rockford, IL, USA) were mounted on glass slides and images were captured using an LSM 780 confocal microscope (Carl Zeiss, Jena, Germany). Images were processed using ZEN (Blue edition) software.
[0096]
[0097] In the case of 4-week-old mice injected with AAV-DJ-CAG-hMPZL2, it was confirmed that hair cells did not die compared to the control group Mpzl2 p.Q74*, and in the case of 4-week-old mice injected with AAV-DJ-EF1a-hMPZL2, it was confirmed that all hair cells died (see Figure 4).
[0098]
[0099] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
[0100]
[0101] Sequence number 1: EF1a promoter
[0102] AGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA
[0103]
[0104] Sequence number 2: hMpzl2
[0105] atgtat ggcaagagct ctactcgtgc ggtgcttctt ctccttggca tacagctcac agctctttggcc tatagcagct gtggaaattt atacctcccg ggtgctggag gctgttaatg ggacagatgc tcggttaaaa tgcactttct ccagctttgc ccctgtgggt gatgctctaa cagtgacctg gaattttcgt cctctagacg ggggacctga gcagtttg tattctacta ccacatagat cccttccaac ccatgagtgg gcggtttaag gaccgggtgt cttgggatgg gaatcctgag cggtacgatg cctccatcct tctctggaaa ctgcagttcg acgacaatgg gacatacacc tgccaggtga agaacccacc tgatgttgat ggggtgatag gggagatccg gctcagcgtc gtgcacactgtacg cttctctgag atccacttcc tggctctggc cattggctct gcctgtgcac tgatgatcat aatagtaatt gtagtggtcc tcttccagca ttaccggaaa aagcgatggg ccgaaagagc tcataaagtg gtggagataa aatcaaaaga agaggaaagg ctcaaccaag agaaaaaggt ctctgtttat ttagaagaca cagactaa
Claims
1. Viral vector containing the EF1a promoter and a gene encoding a neuronal differentiation protein 2. In paragraph 1, A viral vector wherein the above viral vector is an adeno-associated virus (AAV).
3. In paragraph 1, The viral vector is AAV-DJ.
4. In paragraph 1, The above neuronal differentiation protein is a vector that is MPZ or MPZL protein.
5. In paragraph 4, The above MPZL protein is a vector of MPZL1, MPZL2, or MPZL3.
6. In paragraph 1, The above viral vector is a viral vector for use in the treatment or prevention of diseases caused by Mpzl2 mutations.
7. In paragraph 1, The above viral vector is a vector that targets hair cells or Deiter's cells (pillar cells).
8. A pharmaceutical composition for preventing or treating hearing loss, comprising the vector of any one of claims 1 to 7 as an active ingredient.
9. In paragraph 8, The above hearing loss is a pharmaceutical composition for preventing or treating hearing loss, whether symptomatic or non-symptomatic.
10. In paragraph 8, The above hearing loss is a pharmaceutical composition for preventing or treating autosomal recessive non-syndromic hearing loss caused by a mutation.
11. A pharmaceutical composition for preventing or treating metabolic disorders caused by mutations in the Mpzl gene, comprising the vector of any one of claims 1 to 7 as an active ingredient.
12. In paragraph 11, A pharmaceutical composition, wherein the metabolic disorder is any one selected from the group consisting of diabetes, hyperthyroidism, hypothyroidism, phenylketonuria, Gaucher disease, galactosemia, organic dysuria, fat storage disease, and anemia.
13. A pharmaceutical composition for preventing or treating a neurodegenerative disease caused by a mutation in the Mpzl gene, comprising the vector of any one of claims 1 to 7 as an active ingredient.
14. In paragraph 13, A pharmaceutical composition, wherein the neurodegenerative disease is any one selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, and prion disease.
15. A pharmaceutical composition for preventing or treating cancer caused by a mutation in the Mpzl gene, comprising the vector of any one of claims 1 to 7 as an active ingredient.
16. In paragraph 15, A pharmaceutical composition, wherein the cancer is any one selected from the group consisting of breast cancer, ovarian cancer, colon cancer, stomach cancer, liver cancer, pancreatic cancer, cervical cancer, thyroid cancer, parathyroid cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, or pituitary adenoma.
17. A pharmaceutical composition for preventing or treating an autoimmune disease caused by a mutation in the Mpzl gene, comprising the vector of any one of claims 1 to 7 as an active ingredient.
18. In paragraph 17, A pharmaceutical composition wherein the above autoimmune disease is any one selected from the group consisting of lupus, rheumatoid arthritis, Crohn's disease, and limbic disease.
19. A pharmaceutical composition for preventing or treating vascular disease caused by a mutation in the Mpzl gene, comprising the vector of any one of claims 1 to 7 as an active ingredient.
20. In paragraph 19, A pharmaceutical composition, wherein the vascular disease is any one selected from the group consisting of arteriosclerosis, thrombosis, coronary artery disease, and hypertension.
21. A method for preventing or treating hearing loss, comprising the step of administering to an individual a viral vector containing an EF1a promoter and a gene encoding a neural cell differentiation protein as an active ingredient.
22. In paragraph 21, A method wherein the above viral vector is an adeno-associated virus (AAV).
23. In paragraph 21, A method wherein the above neuronal differentiation protein is MPZ or MPZL protein.
24. In paragraph 21, The above hearing loss is an autosomal recessive non-syndromic hearing loss caused by a mutation.
25. A method for preventing or treating metabolic disorders caused by mutations in the Mpzl gene, comprising the step of administering to a subject a viral vector containing an EF1a promoter and a gene encoding a neuronal differentiation protein as an active ingredient.
26. In paragraph 25, A method wherein the metabolic disorder is any one selected from the group consisting of diabetes, hyperthyroidism, hypothyroidism, phenylketonuria, Gaucher disease, galactosemia, organic dysuria, fat storage disease, and anemia.
27. A method for preventing or treating a neurodegenerative disease caused by a mutation in the Mpzl gene, comprising the step of administering to a subject a viral vector containing an EF1a promoter and a gene encoding a neuronal differentiation protein as an active ingredient.
28. In paragraph 27, A method wherein the neurodegenerative disease is any one selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, and prion disease.
29. A method for preventing or treating cancer caused by a mutation in the Mpzl gene, comprising the step of administering to a subject a viral vector containing an EF1a promoter and a gene encoding a neural cell differentiation protein as an active ingredient.
30. In paragraph 29, The method of claim 1, wherein the cancer is any one selected from the group consisting of breast cancer, ovarian cancer, colon cancer, stomach cancer, liver cancer, pancreatic cancer, cervical cancer, thyroid cancer, parathyroid cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, or pituitary adenoma.
31. A method for preventing or treating an autoimmune disease caused by a mutation in the Mpzl gene, comprising the step of administering to a subject a viral vector containing an EF1a promoter and a gene encoding a neuronal differentiation protein as an active ingredient.
32. In paragraph 31, The method wherein the above autoimmune disease is any one selected from the group consisting of lupus, rheumatoid arthritis, Crohn's disease, and limbic disease.
33. A method for preventing or treating vascular disease caused by a mutation in the Mpzl gene, comprising the step of administering to an individual a viral vector containing an EF1a promoter and a gene encoding a neuronal differentiation protein as an active ingredient.
34. In paragraph 33, A method wherein the above vascular disease is any one selected from the group consisting of arteriosclerosis, thrombosis, coronary artery disease, and hypertension.
35. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of hearing loss.
36. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of metabolic disorders caused by mutations in the Mpzl gene.
37. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of neurodegenerative diseases caused by mutations in the Mpzl gene.
38. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of cancer caused by a mutation in the Mpzl gene.
39. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of autoimmune diseases caused by mutations in the Mpzl gene.
40. Use of a viral vector comprising an EF1a promoter and a gene encoding a neuronal differentiation protein in the prevention or treatment of vascular disease caused by a mutation in the Mpzl gene.
Citation Information
Patent Citations
Adeno-associated viruses and their uses for inner ear therapy
US20220348957A1
AAV1-caspase gene therapy induced pyroptosis for the treatment of tumors
US9644215B2
Compositions and methods for treating neurocognitive disorders
WO2020160468A1
KR20220016485A