Novel compound and pharmaceutical use thereof
A compound represented by chemical formula 1 addresses the inadequacies of existing treatments for ischemia-reperfusion injury by reducing PAK4 levels and maintaining GPX3 expression, effectively preventing and treating acute kidney injury.
Patent Information
- Application Number
- PCT/KR2025/009092
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-06-27
- Filing Date
- 2025-06-27
- Publication Date
- 2026-01-02
AI Technical Summary
Current treatments for ischemia-reperfusion injury, such as liver or renal failure following surgeries or organ transplants, are inadequate due to limitations in the efficacy of existing antioxidants, and there is a need for new techniques to prevent or treat this severe inflammatory response and tissue damage.
A pharmaceutical composition comprising a compound represented by chemical formula 1, its optical isomer, hydrate, or pharmaceutically acceptable salt, which can be administered before, during, or after ischemia-reperfusion injury to reduce PAK4 levels and maintain GPX3 expression, thereby enhancing antioxidant capacity.
The compound effectively prevents and treats acute kidney injury by reducing PAK4 levels and maintaining GPX3 expression, thereby alleviating tubular damage and inflammation during ischemia-reperfusion.
Smart Images

Figure KR2025009092_02012026_PF_FP_ABST
Abstract
Description
Novel compounds and their pharmaceutical uses
[0001] This application claims the benefit of Republic of Korea Patent Application No. 10-2024-0084781, filed June 27, 2024, the entire disclosure of which is incorporated herein by reference.
[0002]
[0003] The present invention relates to a pharmaceutical composition for preventing or treating acute ischemic injury, comprising a compound represented by chemical formula 1.
[0004] Surgical procedures such as organ transplants or cardiovascular disease treatments can restrict blood supply to specific tissues. In these cases, ischemia occurs when blood flow to organs that require continuous blood flow, such as the liver, kidneys, heart, and brain, is interrupted. Furthermore, if blood flow is suddenly increased through reperfusion in an ischemic state where oxygen is inadequate, significant damage to cells and tissues can occur due to a variety of complex factors. In particular, liver or renal ischemia-reperfusion injury (IRI) is a major complication that frequently occurs after liver or kidney transplants or cardiac surgery. The temporary interruption of blood supply to the liver or kidneys due to blood flow interruption during surgery, followed by reperfusion, can induce a severe acute inflammatory response and acute tissue damage. In particular, cell apoptosis caused by acute inflammatory responses or inflammatory damage is recognized as a very serious risk factor as it is one of the main causes of liver failure or renal failure. Ischemic reperfusion injury can also occur when blood flow suddenly increases in an oxygen-deprived state, causing a sudden increase in intracellular calcium concentration. This increase in intracellular calcium can mediate mitochondrial damage. At this time, substances released by mitochondrial damage react with ATP to generate reactive oxygen species. The body recognizes this as inflammation and attacks white blood cells, generating more reactive oxygen species, which can ultimately lead to cell damage. Ischemic reperfusion injury is more severe the faster the blood flow is restored, and ischemic reperfusion injury frequently occurs when blood flow is restored after cardiac surgery or organ transplantation.In cases where ischemia-reperfusion injury is predicted, research has reported that damage caused by reactive oxygen species is considered a major factor and that preemptive administration of powerful antioxidants as a treatment can prevent it. However, even with powerful antioxidants, their use has been limited due to limitations in their efficacy. While clinical trials are ongoing for some drugs, no drugs have been developed to directly prevent or treat ischemia-reperfusion injury. Surgical procedures that can cause ischemia-reperfusion tissue damage, such as organ transplantation, are rapidly increasing worldwide. However, there is a pressing medical and social need for new techniques that can restore organ function while suppressing inflammation and cell death after ischemia-reperfusion injury, which is a problem in liver or kidney transplantation. Therefore, there is a continuous need for research and development to treat ischemia-reperfusion injury.
[0005] The purpose of the present invention is to provide a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof.
[0006] [Chemical Formula 1]
[0007]
[0008] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-,
[0009] R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
[0010]
[0011] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof:
[0012] [Chemical Formula 1]
[0013]
[0014] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-,
[0015] R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
[0016]
[0017] Another object of the present invention is to provide a health functional food composition for preventing or improving ischemia-reperfusion injury, comprising a compound represented by chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof.
[0018]
[0019] Another object of the present invention is to provide a method for preventing, treating or improving ischemia-reperfusion injury, comprising administering to a non-human mammal a compound represented by the chemical formula 1.
[0020]
[0021] Another object of the present invention is to provide a use for preventing, treating or improving ischemia-reperfusion injury, comprising administering to a mammal other than a human a compound represented by the chemical formula 1.
[0022] To solve the above object, one aspect of the present invention relates to a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof.
[0023] [Chemical Formula 1]
[0024]
[0025] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-,
[0026] R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
[0027]
[0028] In the present invention, the compound represented by the chemical formula 1 may be a compound that is one or more compounds selected from the following compounds.
[0029] ,
[0030] ,
[0031] ,
[0032] ,
[0033] ,
[0034] ,
[0035] ,
[0036] ,
[0037] , or
[0038] .
[0039]
[0040] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof:
[0041] [Chemical Formula 1]
[0042]
[0043] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-,
[0044] R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
[0045]
[0046] In the present invention, the compound represented by the chemical formula 1 may be a compound that is one or more compounds selected from the following compounds.
[0047] ,
[0048] ,
[0049] ,
[0050] ,
[0051] ,
[0052] ,
[0053] ,
[0054] ,
[0055] , or
[0056] .
[0057]
[0058] The above ischemia may be natural or artificially induced. Artificially induced ischemia involves artificially reducing blood flow in a blood vessel. Artificially reducing blood flow includes occluding or blocking the blood vessel. Occluding the blood vessel involves applying pressure to the blood vessel to reduce its cross-sectional area. Reducing the cross-sectional area of the blood vessel involves clamping or cutting the blood vessel. Artificially reducing blood flow may also be performed during surgery.
[0059]
[0060] The above surgery may include a tissue transplantation, a tissue resection, an anergy repair surgery, or an endarterectomy. The tissue transplantation may include a heart, liver, kidney, lung, pancreas, stomach, small intestine, or colon transplantation. The tissue resection may include a liver, kidney, lung, stomach, small intestine, or colon resection, and may be specifically a kidney or liver, and more specifically a kidney.
[0061]
[0062] Spontaneous ischemia may be caused by an ischemic disorder. Ischemic disorders may include inflammatory diseases, myocardial infarction, atherosclerosis, peripheral vascular disorders, pulmonary embolism, venous thrombosis, transient ischemic attacks, unstable angina, cerebral vascular ischemia, stroke, ischemic neurological disorders, ischemic kidney disease, vasculitis, or trauma. Inflammatory disorders may include rheumatoid arthritis or systemic lupus erythematosus.
[0063]
[0064] The above reperfusion may be natural or artificial. Artificial reperfusion involves artificially increasing blood flow in a blood vessel. Artificially increasing blood flow involves opening a blocked or occluded blood vessel or connecting a severed blood vessel. Artificially increasing blood flow involves supplying blood from outside the body. At least one of the above ischemia and reperfusion may be artificially induced.
[0065]
[0066] The above ischemia and reperfusion may be acute. The term "acute" indicates that the rate of ischemia or reperfusion is rapid, resulting in rapid tissue damage. Acute ischemia and / or reperfusion may involve occlusion and opening of blood vessels. The blood vessels may be arteries, such as the aorta or renal arteries, or hepatic vessels, such as the portal vein. Acute ischemia and / or reperfusion may involve complete occlusion and opening of blood vessels.
[0067]
[0068] The above ischemia-reperfusion injury may be caused by temporary blockage of blood flow during a surgical procedure or may be caused by repeated temporary closure and reopening of blood vessels during surgical procedures.
[0069]
[0070] The ischemia or reperfusion may last for 3 minutes, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, or 60 minutes or more. The ischemia may last for 3 to 60 minutes, 5 to 60 minutes, 10 to 60 minutes, 15 to 60 minutes, 20 to 60 minutes, 30 to 60 minutes, 3 to 50 minutes, 3 to 30 minutes, 3 to 15 minutes, 5 to 60 minutes, 5 to 30 minutes, 10 to 60 minutes, or 10 to 30 minutes, 15 to 60 minutes, or 15 to 30 minutes.
[0071]
[0072] The ischemia-reperfusion injury may be damage to the liver, kidney, heart, lung, small intestine, large intestine, or pancreas. Specifically, the ischemia-reperfusion injury may be a disease resulting from damage caused by any of the following ischemic diseases: a surgical procedure that temporarily occludes any portion of an artery, such as renal resection; an ex vivo culture, preservation, and reimplantation procedure for an organ requiring transplantation, such as the kidney, heart, liver, lung, small intestine, or pancreas; a reduction or interruption of blood flow caused by clamping of a blood vessel during a surgical or hemostasis procedure and subsequent restoration of oxygen and / or nutrient flow to the tissue; or other tissue damage resulting from hypoxia, ischemia, or trauma that may lead to death by apoptosis or autophagy to the point of causing significant anatomical and functional lesions.
[0073]
[0074] The composition may be administered before, simultaneously with, or after ischemia-reperfusion injury. The administration may be administered before, during, or after surgery. The composition may be administered before, simultaneously with, or after occlusion of a blood vessel prior to surgery. The blood vessel may be an artery, including the aorta. The surgery includes alternating occlusion and reperfusion of the blood vessel, and the administration may be administered before occlusion of the blood vessel, between occlusion and reperfusion, or during reperfusion. The composition may be used for acute ischemia-reperfusion injury caused by organ transplantation, which occurs during or after transplantation of any one or more of the liver, kidney, heart, lung, small intestine, or pancreas.
[0075]
[0076] The composition may include a pharmaceutically or food-wise acceptable diluent or carrier. The carrier may be an excipient, a disintegrant, a binder, a glidant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be sodium starch glycolate, calcium hydrogen phosphate anhydrous, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropyl cellulose, hydroxypropyl cellulose, or a combination thereof. The glidant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.
[0077]
[0078] The above composition may be formulated as an oral or parenteral dosage form. The parenteral dosage form may be an injection.
[0079]
[0080] Another aspect of the present invention relates to a health functional food composition for preventing or improving ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof:
[0081] [Chemical Formula 1]
[0082]
[0083] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-,
[0084] R1 or R2 are each independently hydrogen, C 1-20An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
[0085]
[0086] The compound represented by the above chemical formula 1 may be a compound that is one or more compounds selected from the compounds below.
[0087] ,
[0088] ,
[0089] ,
[0090] ,
[0091] ,
[0092] ,
[0093] ,
[0094] ,
[0095] , or
[0096] .
[0097]
[0098] The food composition may contain various flavoring agents or natural carbohydrates as additional ingredients. The natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, a natural sweetener such as thaumatin and stevia extract, or a synthetic sweetener such as saccharin and aspartame may be used. The proportion of the natural carbohydrate may be selected from a range of 0.01 to 0.04 parts by weight, specifically, about 0.02 to 0.03 parts by weight, per 100 parts by weight of the composition.
[0099]
[0100] In addition to the above, the food composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the functional food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.
[0101]
[0102] Another aspect provides a method for preventing or treating ischemia-reperfusion injury in a subject, comprising administering to the subject the pharmaceutical composition described above.
[0103]
[0104] The above-mentioned administration may be administered by any method known in the art. Administration may be administered directly to the subject by any means, including intravenous, intramuscular, oral, or subcutaneous administration. The above-mentioned administration may be systemic or local. The above-mentioned administration may be localized to an area where ischemia-reperfusion is present or expected to occur.
[0105]
[0106] The subject may be a mammal, for example, a human, cow, horse, pig, dog, sheep, goat, or cat.
[0107]
[0108] The above administration may be a “therapeutically effective amount” sufficient to prevent or treat ischemia-reperfusion injury in the subject.
[0109]
[0110] The administration may be 0.1 mg to 1,000 mg of the extract per subject per day, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg.
[0111]
[0112] The above administration may be performed before, simultaneously with, or after the occurrence of ischemia-reperfusion injury.
[0113] The compound of the present invention has an effect of preventing and treating acute kidney injury caused by ischemia-reperfusion by reducing PAK4, which increases during ischemic acute kidney injury, and maintaining GPX 3 expression in renal tissue to increase antioxidant capacity.
[0114]
[0115] The effects of the present invention are not limited to the effects described above, and should be understood to include all effects that can be inferred from the detailed description of the present invention or the composition of the invention described in the claims.
[0116] Figure 1 shows the results of confirming the upregulation of PAK4 during renal ischemia-reperfusion injury in mice. (a and b) Protein and mRNA levels of PAK4 and HIF in the renal cortex 24 hours after renal ischemia-reperfusion, (c) Immunofluorescence staining of kidney sections for PAK4, lectin, and aquaporin 4, (d) Time-course analysis of PAK4 protein levels in renal tissues (Epithelial cells, Glomerular cells, Monocyte / MΦ, and Whole cells) after 25 minutes of ischemia and reperfusion, (e) PAK4-luciferase activity was measured in HK-2 cells infected with mock (control), HIF-1α, or HIF-2α overexpression constructs, and (f) ChIP-qPCR analysis. This is the result of confirming the binding of HIF-1α or HIF-2α to the Pak4 promoter.
[0117]
[0118] Figure 2 shows the results of confirming the alleviation of tubular damage and inflammation caused by ischemia-reperfusion in PAK4 knock-out mice. (a) is the result of confirming PAK4 and lectin through immunofluorescence staining in kidney tissues of wild-type and Pak4KO mice after ischemia-reperfusion, (b) is the result of confirming the plasma levels of blood urea nitrogen (BUN) and creatinine, (c) is the result of quantifying the tubular damage score (H&E), necrotic area (H&E), apoptosis (TUNEL), and macrophage count in kidney tissues by microscopic photographs of kidney sections, and (d) is the result of confirming the apoptosis signal and inflammatory marker molecules through Western blot analysis in kidney tissues after 24 hours of ischemia-reperfusion.
[0119]
[0120] Figure 3 shows the results of confirming the effect of PAK4 deficiency on oxidative stress after renal ischemia-reperfusion. In Pak4KO and WT control mice with renal ischemia-reperfusion injury, (a, b) are the results of analyzing the tissue levels of malondialdehyde (MDA), glutathione disulfide (GSSG), and glutathione (GSH) and the GSH / GSSG ratio after 24 hours of reperfusion, (c) is the result of confirming PAK4 and several antioxidant proteins in renal tissue homogenates after 24 hours of reperfusion by Western blotting, (d) is the result of analyzing glutathione peroxidase (GPx) activity in renal tissue and blood, (e) is the result of analyzing GPx and SOD activities in HK-2 cells after PAK4 knockdown in HK-2 cells, culturing the cells in an anaerobic environment for 1 hour and reoxygenating them for 12 hours, and (f) is the result of analyzing the cell Results of Western blotting for GPx3 in lysate (WCM) and culture medium (CM).
[0121]
[0122] Figure 4 shows the results of confirming the phosphorylation of GPx3-T47 by PAK4. (a) is the result of confirming the interaction of PAK4 and candidate proteins by exposing HK-2 cells to hypoxia-reoxygenation (H / R) and treating the cell lysate with co-immunoprecipitation (co-IP), (b) is the result of analyzing PAK4 binding to GPx3 by PLA after overexpressing PAK4 in HK-2 cells, (c) is the result of confirming GPx3 phosphorylation by PAK4 in the presence of oligopeptides (P', P1, P2) through an in vitro kinase assay, and (d) is the result of a prediction model for the interaction between PAK4 (green) and GPx3 (sky blue) in a ternary structure.
[0123]
[0124] Figure 5 shows the results of confirming the proteasome-dependent degradation of GPx3 by PAK4. (a) shows the results of comparing the degradation of GPx3 by PAK4 after overexpressing wild-type or mutant GPx3 in HK-2 cells and treating them with cycloheximide (CHX, 30 μg / ml) for 1 hour or 3 hours, and (b) shows the results of comparing the degradation of GPx3 by PAK4 in HK-2 cells overexpressing HA-Ub with WT (GPx3 WT ) or mutant GPx3 (GPx3 T47A ), the cells were exposed to H / R with MG132 (3 μM) for 12 h, and the cell lysates were immunoprecipitated with GPx3 antibody, followed by immunoblotting with ubiquitin (Ub) antibody. (c, d) are the results of transfection of 6-week-old male Ggt1-CreKO mice with eGFP (AAV2-eGFP) and wild-type GPx3 (AAV2-GPx3) using AAV2 vector. WT ) or GPx3 T47A (AAV2-GPx3 T47A ) was injected intravenously, and after 24 hours of reperfusion, tissue damage caused by I / R and protein levels of GPx3 in renal tissue were measured.
[0125]
[0126] Figure 6 shows the results of confirming the inhibition of fatty acid β-oxidation in the kidney by PAK4. (a) is the result of analyzing triglyceride (TG) in renal tissue after 24 hours of reperfusion, (b) is the result of confirming fat accumulation in renal tissue through perilipin immunostaining, (c) is the result of confirming fatty acid β-oxidation and de novo lipogenesis-related proteins through Western blotting analysis, and (d to f) are the results of confirming the inhibition of fatty acid β-oxidation in HK-2 cells by control (AdLacZ), PAK4 (AdPAK4), or kinase-inactive mutant PAK4. S474A (AdPAK4 S474A) After infection with adenovirus expressing PAK4, (d) cell lysates were immunoprecipitated with antibodies to NCoR1 or PPARα, and then immunoblotted with antibodies to PAK4, PARα, or NCoR1. (e) is the result of analyzing PPARα binding to NCoR1 using the PLA method. (f) is the result of measuring PPRE-luciferase activity and quantifying it as a fold change compared to the control group after overexpressing or knocking down PAK4 in HK-2 cells. (g) is the result of measuring oxygen consumption using the Seahorse analysis system.
[0127]
[0128] FIG. 7 is a result confirming the reduction of renal ischemia-reperfusion injury by the compound of the present invention, (a) is a chemical structural formula of the compound of the present invention, (b) is a schematic diagram of C57BL / 6 mice treated with the compound of the present invention, (c) is a microscopic photograph of a kidney section and a result of quantifying renal tubular damage, and (d) is a result of a prediction model for the interaction between PAK4 and GPx3.
[0129]
[0130] Figure 8 shows the results of confirming the relationship between PAK4 expression in human kidney tissue before and after kidney transplantation and the outcome of human transplantation. (a) shows the results of analyzing PAK4 and p-GPx3-T47 in kidney tissue before (pre) or after (post) kidney transplantation through Western blot analysis and quantifying the proteins, and (b) shows the results of confirming the correlation between PAK4 protein levels (PAK4 / HSP90) on the first day after surgery and plasma BUN and creatinine levels.
[0131] Hereinafter, the present disclosure will be described in detail through examples and experimental examples. The present disclosure can be modified in various ways and can have various embodiments. Therefore, specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present disclosure to specific embodiments, but should be understood to include all modifications, equivalents, and alternatives included in the spirit and technical scope of the present disclosure. In describing the present disclosure, if a detailed description of a related known technology is judged to obscure the gist of the present disclosure, the detailed description thereof will be omitted.
[0132]
[0133] Example 1. Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(4-((4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazin-1-yl)methyl)piperidin-1-yl)isoindoline-1,3-dione
[0134]
[0135] Step 1: Preparation of 2-(4-((1-(tert-butoxycarbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-5-nitrobenzoic acid (1)
[0136]
[0137] To a solution of tert-butyl 4-(piperazin-1-ylmethyl)piperidine-1-carboxylate (4.6 g, 16 mmol) and 2-fluoro-5-nitrobenzoic acid (3.6 g, 20 mmol) in THF (250 mL) was added iPr2NEt (8.5 mL, 49 mmol). After stirring at room temperature for 2 h, the reaction mixture was poured into water and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (CH2Cl2 / MeOH = 10:1) to give 1 (9.50 g, 97%). 1H NMR (600MHz, CD3OD) δ8.34 (d,J= 2.8 Hz, 1H), 8.13 (dd,J= 9.1, 2.8 Hz, 1H), 7.09 (d,J= 9.1 Hz, 1H), 4. 10 (d,J= 13.2 Hz, 2H), 3.47 (s, 4H), 3.11 (s, 3H), 2.78 (s, 4H), 1.98 (s, 1H), 1.80 (m, 2H), 1.46 (s, 10H), 1.16 (m, 2H). C 22 H 32 N4O6[M + H] + = HRMS(FAB+) calculation for 449.2400 = 449.2401.
[0138]
[0139]
[0140]
[0141] Step 2: Preparation of tert-butyl(R)-4-((4-(2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]py-ramidin-4-yl)amino)piperidine-1-carbonyl)-4-nitrophenyl)piperazin-1-yl)methyl)piperidine-1-carboxylate (2)
[0142]
[0143] 2-(4-((1-(tert-butoxycarbonyl)piperidin-4-yl)methyl)piperazin-1-yl)-5-nitrobenzoic acid (1) (1.6 g, 3.6 mmol) and (R)-2-chloro-N-(piperidin-3-yl)-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]pyrimidin-4-amine (1. 8 g, 3.6 mmol) obtained in Step 1 were added to DMF (35 mL), EDCI (2.0 g, 11 mmol), iPr2NEt (3.1 mL, 18 mmol), and DMAP (44 mg, 0.36 mmol). After stirring at room temperature for 24 h, the reaction mixture was poured into water and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc / n-hexane = 1:1) to give 2 (1.7 g, 59%). 1 H NMR (600 MHz, CD3OD) δ 7.92 (dd,J= 9.1, 2.8 Hz, 1H), 7.46 (d,J= 2.7 Hz, 1H), 7.07 (dd,J= 19.0, 6.3 Hz, 2H), 6. 66 (dd,J= 11.5, 3.6 Hz, 1H), 5.55-5.46 (m, 2H), 5.25 (d,J= 11.0 Hz, 1H), 4.42 (d,J= 12.6 Hz, 1H), 4.05 (d,J= 12.5 Hz, 3H), 3.96 (s, 1H), 3.63-3.44 (m, 3H), 3.26-3.12 (m, 4H), 2.76 (s, 1H), 2.29 (d, J = 7.2 Hz, 2H), 2.10 (d, J = 9.7 Hz, 1H), 1.79(s, 4H), 1.45(m, 13H), 1.09(dd, J = 18.3, 5.9 Hz, 3H), 0.91-0.83(m, 2H), -0.07(d, J = 3.3 Hz, 9H). C 39 H 58 ClN9O6Si[M + H] + = HRMS(FAB+) calculation for 812.4046 = 812.4039.
[0144]
[0145]
[0146]
[0147] Step 3: Preparation of tert-butyl(R)-4-((4-(4-amino-2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo-[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)phenyl)piperazin-1yl)methyl)piperidine-1-carboxylate (3)
[0148]
[0149] To a solution of tert-butyl (R)-4-((4-(2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]py-ramidin-4-yl)amino)piperidine-1-carbonyl)-4-nitrophenyl)piperazin-1-yl)methyl)piperidine-1-carboxylate (2) (0.80 g, 0.98 mmol) obtained in the above step 2 and 5% Pd / C (0.42 g, 20 mol%) was placed MeOH (10 mL) under an atmosphere of H2. After stirring at room temperature for 2 h, the reaction mixture was filtered through a pad of Celite. The filtrate was concentrated in vacuo to give 3 (0.61 g, 91%). The residue was used in the next step without further purification. C 39 H 60 ClN9O4Si[M + H] + = HRMS(FAB+) calculation for 782.4304 = 782.4308
[0150]
[0151]
[0152] Step 4: Preparation of tert-butyl 4-((4-((33R)-4-oxo-17-((2-(trimethylsilyl)ethoxy)methyl)-17H-2,6-diaza-1 (4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate (4)
[0153]
[0154] tert-Butyl (R)-4-((4-(4-amino-2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo-[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)phenyl)piperazin-1yl)methyl)piperidine-1-carboxylate (3) (0.32 g, 0.41 mmol), Pd(dba)3 (93 mg, 25% mol), xantphos (0.18 mg, 0.30 mmol), and NaOt-Bu (0.20 g, 2.0 mmol) obtained in step 3 were added to 1,4-dioxane (12 mL). After stirring at 100°C for 12 h, the reaction mixture was poured into water and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (acetone / n-hexane = 2:3) to give tert-butyl 4-((4-((33R)-4-oxo-17-((2-(trimethylsilyl)ethoxy)methyl)-17H-2,6-diaza-1 (4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate (4) (0.15 g, 50%). 1H NMR (600 MHz, CD3OD) δ 8.49 (d, J = 2.5 Hz, 1H), 7.23 (dd, J = 8.6, 2.5 Hz, 1H), 7.17 (d, J = 8.6 Hz, 1H), 7.02 (d, J = 3.6 Hz, 1H), 5.51 (s, 2H), 4.75 (d, J = 12.8 Hz, 1H), 4.57 - 4.50 (m, 1H), 4.12 (d, J = 13.4 Hz, 2H), 3.93 (s, 2H), 3.67-3. 53 (m, 5H), 3.12 (d, J = 6.9 Hz, 4H), 3.02 (d, J = 12.0 Hz, 1H), 2.88-2.72 (m, 3H), 2.71-2.58 (m, 1H), 2.21 (m, 1H), 2. 10 (m, 1H), 2.01 (m, 1H), 1.94-1.83 (m, 2H), 1.79 (m, 2H), 1.46 (s, 9H), 1.24-1.17 (m, 2H), 0.93-0.87 (m, 3H), -0.04 (s, 9H). C 39 H 59 N9O4Si[M + H] + = HRMS(FAB+) calculation for 746.4537 = 746.4538
[0155]
[0156] Step 5: Preparation of (33R)-56-(4-(piperidin-4-ylmethyl)piperazin-1-yl)-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidine-3(3,1)-piperidin-5(1,3)-benzenacyclohexapan-4-one (5)
[0157]
[0158] To a solution of tert-butyl 4-((4-((33R)-4-oxo-17-((2-(trimethylsilyl)ethoxy)methyl)-17H-2,6-diaza-1 (4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazin-1-yl)methyl)piperidine-1-carboxylate (4) (0.15 g, 0.20 mmol) obtained in step 4 in CH2Cl2 (2 mL) was added TFA (2 mL) at 0 °C. After stirring for 2 hours, the reaction mixture was concentrated in vacuo to obtain (33R)-56-(4-(piperidin-4-ylmethyl)piperazin-1-yl)-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidine-3(3,1)-piperidine-5(1,3)-benzenacyclohexapan-4-one(5) (150 mg, 99%). 1 H NMR (600 MHz, CD3OD) δ 8.56 (d, J = 2.5 Hz, 1H), 7.38-7.19 (m, 3H), 7.09 (d, J = 3.6 Hz, 1H), 6. 64 (d, J = 3.6 Hz, 1H), 5.62 (d, J = 2.2 Hz, 2H), 4.83(d, J = 12.6Hz, 1H), 4.64-4.57(m, 1H), 4.03(dd, J = 14.7, 7.2 Hz, 2H), 3.73 (s, 1H), 3.54 (d, J = 12.9 Hz, 3H), 3.26 (d, J = 7.1 Hz, 3H), 3.13 (t, J = 12.9 Hz, 3H), 2. 92-2.80 (m, 1H), 2.71 (s, 1H), 2.40-2.26 (m, 2H), 2.18 - 2.07 (m, 4H), 1.95 (m, 2H), 1.61 (m, 3H). C 28 H 37 N9O[M + H] + = HRMS(FAB+) calculation for 516.3199 = 516.3200.
[0159]
[0160]
[0161] Step 6: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(4-((4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazin-1-yl)methyl)piperidin-1-yl)isoindoline-1,3-dione
[0162]
[0163] To a solution of (33R)-56-(4-(piperidin-4-ylmethyl)piperazin-1-yl)-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidine-3(3,1)-piperidine-5(1,3)-benzenacyclohexapan-4-one(5) (150 mg, 0.29 mmol) and 2-(2,6-dioxopiperidin-3-yl)-5,6-difluoroisoindoline-1,3-dione (0.17 g, 0.58 mmol) obtained in Step 5 above in DMSO (5.8 mL) was added iPr2NEt (1.0 mL, 5.8 mmol). After stirring at 100°C for 24 h, the reaction mixture was poured into brine and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (CH2Cl2 / MeOH = 10:1) to obtain the target compound 1 (or SJ05, 130 mg, 57%). 1H NMR (600 MHz, DMSO-d6)δ11.10(s,1H),10.99(s,1H),8.32-8.19(m,2H),7.70(d,J= 11.4 Hz, 1H), 7.40 (m, 2H), 7.07 (dd,J= 8.6, 2.4 Hz, 1H), 6.93 (d,J= 8.6 Hz, 1H), 6.77 (dd,J= 3.4, 2.3 Hz, 1H), 6.35 (dd,J= 3.4, 2.0 Hz, 1H), 5.10 (dd,J= 12.9, 5.4 Hz, 1H), 4.61 (d,J=11.0 Hz, 1H), 4.45 (d,J= 10.3 Hz, 1H), 4.10 (m, 1H), 3.71-3.56 (m, 3H), 3.17 (d,J= 5.3 Hz, 3H), 2.87 (m, 3H), 2.67 (m, 3H), 2.62-2.56 (m, 1H), 2.45-2.35 (m, 4H), 2.20 (m, 2H), 2.12- 1.98 (m, 2H), 1.90-1.80 (m, 3H), 1.77-1.62 (m, 3H), 1.30-1.17 (m, 4H). HC 41 H 44 FN 11 O5[M + H] + = HRMS(FAB+) calculation for 790.3589 = 790.3582.
[0164]
[0165]
[0166] Example 2. Preparation of 2-(2,6-d-dioxopiperidin-3-yl)-5-fluoro-6-(4-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-56-yl)piperazine-1-carbonyl)piperidin-1-yl)isoindoline-1,3-dione
[0167]
[0168] Step 1: Preparation of (R)-3-[(2-chloro-7-2-(trimethylsilyl)ethoxymethyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]piperidin-1-yl-(2-fluoro-5-nitrophenyl)methanone (10)
[0169]
[0170]
[0171] (R)-2-Chloro-N-(piperidin-3-yl)-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]pyrimidin-4-amine hydrochloride (890 mg, 2.126 mmol), 2-fluoro-5-nitrobenzoic acid (330 mg, 2.126 mmol), HATU (1040 mg, 3.19 mmol), and i-Pr2NEt (1.14 ml, 6.38 mmol) were added to CH2Cl2 (10 ml). After stirring at room temperature for 17 h, the reaction mixture was poured into water and extracted with CH2Cl2. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc / n-Hexane = 1:1) to give compound 10 (825 mg, 71%). ¹H NMR (600 MHz, CDCl₃) δ 8.39-8.30 (m, 1H), 8.19 (s, 1H), 7.33 (t, J = 8.6 Hz, 1H), 7.08 (d, J = 4.1 Hz, 1H), 6.32 (d, J = 3.5 Hz, 1H), 5.53 (dd, J = 14.7, 4.0 Hz, 2H), 4.18-4.09 (m, 1H), 3.54 (td, J = 7.9, 1.0 Hz, 2H), 3.43-3.26 (m, 1H), 2.22-2.10 (m, 1H), 2.01-1.92 (m, 2H), 1.91-1.79 (m, 3H), 1.73-1.43 (m, 3H), 0.93 (dd, J = 8.8, 7.6 Hz, 2H), -0.06 (s, 9H).
[0172]
[0173]
[0174] Step 2: Preparation of tert-butyl (R)-4-(4-(2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)-4-nitrophenyl)piperazine-1-carbonyl)piperidine-1-carboxylate (11)
[0175]
[0176] (R)-3-[(2-chloro-7-2-(trimethylsilyl)ethoxymethyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]piperidin-1-yl-(2-fluoro-5-nitrophenyl)methanone (10) (33 mg, 0.058 mmol), tert-butyl 4-(piperazine-1-carbonyl)piperidine-1-carboxylate (18 mg, 0.058 mmol), and i-Pr2NEt (31 uL, 0.176 mmol) were added to MeCN (2 ml). The mixture was heated at 110 ˚C for 17 h, cooled to room temperature, poured into water, and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc / n-Hexane = 1:1) to obtain 11 (32 mg, 66%). ¹H NMR (600 MHz, CDCl₃) δ 8.01 (dd, J = 9.0, 2.8 Hz, 1H), 7.70 (d, J = 2.7 Hz, 1H), 7.07 (d, J = 3.6 Hz, 1H), 6.96 (d, J = 9.1 Hz, 1H), 6.27 (d, J = 3.6 Hz, 1H), 5.57 (d, J = 10.8 Hz, 1H), 5.33 (d, J = 10.8 Hz, 1H), 4.26-4.13 (m, 3H), 4.12-4.09 (m, 1H), 3.74 (q, J = 5.5, 5.0 Hz, 2H), 3.67 (s, 2H), 3.50-3.46 (m, 2H), 3.37 (s, 2H), 3.17 (d, J = 24.0 Hz, 2H), 2.77 (s, 2H), 2.67-2.60 (m, 1H), 2.15-2.08 (m, 1H), 1.95 (dd, J = 9.5, 4.2 Hz, 1H), 1.87 (dd, J = 14.2, 4.6 Hz, 1H), 1.80 (dd, J = 9.9, 4.3 Hz, 1H), 1.71 (d, J = 35.1 Hz, 4H), 1.57 (s, 3H), 1.46 (s, 9H), 0.93 (ddd, J = 13.8, 10.5, 5.9 Hz, 2H), -0.06 (s, 9H).
[0177]
[0178]
[0179] Step 3: Preparation of tert-butyl (R)-4-(4-(4-amino-2-[3-((2-chloro-7-2-(trimethylsilyl)ethoxymethyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl]phenyl)piperazine-1-carbonyl)piperidine-1-carboxylate (12)
[0180]
[0181] Tert-Butyl (R)-4-(4-(2-(3-((2-chloro-7-((2-(trimethylsilyl)ethoxy)methyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl)-4-nitrophenyl)piperazine-1-carbonyl)piperidine-1-carboxylate (27.5 mg, 0.033 mmol) and SnCl2 (38 mg, 0.166 mmol) were added to ethanol (1 mL) and stirred at 60˚C for 5 hours. After cooling to room temperature, saturated aqueous NaHCO3 solution was added to the reaction mixture, and extracted with EtOAc. The organic layer was washed with brine, dried over MgSO4, filtered, concentrated under reduced pressure, and washed with diethyl ether to obtain a white solid compound 12 (18 mg, 68%).
[0182]
[0183]
[0184] Step 4: Preparation of tert-butyl 4-4-[(33R)-4-oxo-17-2-(trimethylsilyl)ethoxy)methyl-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzeneacylohexapain-56-yl]piperazine-1-carbonylpiperidine-1-carboxylate (13)
[0185]
[0186] Tert-butyl (R)-4-(4-(4-amino-2-[3-((2-chloro-7-2-(trimethylsilyl)ethoxymethyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidine-1-carbonyl]phenyl)piperazine-1-carbonyl)piperidine-1-carboxylate (12) (18 mg, 0.022 mmol), Pd2(dba)3 (5 mg, 25% mol), xantphos (6.5 mg, 50% mol), and Cs2CO3 (0.22 mg, 0.067 mmol) obtained in step 3 were added to 1,4-dioxane (2 mL). After stirring at 100°C for 17 h, water was added to the reaction mixture, and it was extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (CH2Cl2 / MeOH = 30:1) to obtain compound 13 (7 mg, 20%). ¹H NMR (600 MHz, CDCl₃) δ 8.38 (d, J = 2.5 Hz, 1H), 6.94 (dd, J = 8.5, 2.5 Hz, 1H), 6.92-6.89 (m, 1H), 6.83 (d, J = 3.7 Hz, 1H), 6.57 (s, 1H), 6.23 (d, J = 3.6 Hz, 1H), 5.48-5.40 (m, 2H), 4.89-4.84 (m, 1H), 4.79 (s, 1H), 4.64 (dd, J = 12.6, 2.6 Hz, 1H), 3.98 (d, J = 13.3 Hz, 1H), 3.85 (ddd, J = 14.6, 7.5, 2.8 Hz, 1H), 3.65 (d, J = 12.9 Hz, 1H), 3.57-3.48 (m, 5H), 3.44 (dd, J = 11.6, 5.3 Hz, 1H), 3.10 (t, J = 9.2 Hz, 1H), 2.81-2.76 (m, 2H), 2.71 (td, J = 12.7, 3.4 Hz, 3H), 2.67-2.61 (m, 1H), 2.50 (dd, J = 12.8, 9.9 Hz, 1H), 2.14 (d, J = 11.4 Hz, 1H), 1.99-1.94 (m, 1H), 1.87 (dt, J = 17.2, 5.8 Hz, 2H), 1.81-1.72 (m, 4H), 1.45 (s, 9H), 0.89-0.85 (m, 2H), -0.03 (s, 9H).
[0187]
[0188]
[0189] Step 5: Preparation of (33R)-56-(4-(piperidine-4-carbonyl)piperazin-1-yl)-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-4-one (14)
[0190]
[0191] To a solution of 13 (7 mg, 0.009 mmol) obtained in step 4 in CH2Cl2 (1 mL) was added TFA (0.2 mL) at 0°C. After stirring at room temperature for 2 h, the reaction mixture was concentrated in vacuo, and ethylenediamine (0.2 mL) was added under DMF (1 mL), followed by stirring at room temperature for 17 h. The reaction mixture was poured with brine, and extracted with EtOAc. The combined organic layers were dried over MgSO4, concentrated in vacuo, and washed with diethyl ether to obtain compound 14 (6 mg, 99%).
[0192]
[0193]
[0194]
[0195] Step 6: Preparation of 2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-[4-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexapan-56-yl)piperazine-1-carbonyl)piperidin-1-yl)]isoindoline-1,3-dione (15)
[0196]
[0197] To a solution of (33R)-56-(4-(piperidine-4-carbonyl)piperazin-1-yl)-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenecyclohexapan-4-one (14) (6 mg, 0.011 mmol) and 2-(2,6-dioxopiperidin-3-yl)-5,6-difluoroisoindoline-1,3-dione (3.5 mg, 0.012 mmol) obtained in Step 5 above in DMSO (1 mL) was added i-Pr2NEt (6 uL, 0.033 mmol). After stirring at 100 °C for 24 h, the reaction mixture was poured with brine and extracted with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo. The residue was purified by flash column chromatography (CH2Cl2 / MeOH = 10:1) to obtain the target compound 15 (4 mg, 45%). 1H NMR (600 MHz, Methanol-d4) δ 8.45 (d, J = 2.5 Hz, 1H), 7.53 (d, J = 11.1 Hz, 1H), 7.49 (d, J = 7.4 Hz, 1H), 7.10 (dd, J = 8.5, 2.5 Hz, 1H), 7.03 (d, J = 8.5 Hz, 1H), 6.78 (d, J = 3.5 Hz, 1H), 6.36 (d, J = 3.5 Hz, 1H), 4.77 (d, J = 13.0 Hz, 1H), 4.62 (d, J = 12.8 Hz, 1H), 3.86 (d, J = 11.2 Hz, 1H), 3.71 (d, J = 13.3 Hz, 5H), 3.61 (t, J = 8.4 Hz, 1H), 3.10 (t, J = 9.0 Hz, 1H), 3.03 - 2.96 (m, 2H), 2.85 - 2.76 (m, 4H), 2.56 (dd, J = 12.5, 10.0 Hz, 1H), 2.18 (s, 1H), 2.03 (d, J = 14.7 Hz, 4H), 1.93 (d, J = 10.6 Hz, 2H), 1.87 (d, J = 11.1 Hz, 4H), 1.62 - 1.52 (m, 3H).
[0198]
[0199]
[0200]
[0201] Using the methods of Examples 1 and 2 above, compounds 1 to 10 shown in Table 1 below were prepared.
[0202]
[0203] Compound No. Common name and structure NMR data 1 (SJ05) 2-(2,6-Dioxopiperidin-3-yl)-5-fluoro-6-(4-((4-((3 3 R)-4-oxo-1 7H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)methyl)piperidin-1-yl)isoindoline-1,3-dione 1 H NMR (600 MHz, DMSO-d6) δ 11.10 (s, 1H), 10.99 (s, 1H), 8.32 - 8.19 (m, 2H), 7.70 (d, J = 11.4 Hz, 1H), 7.40 (m, 2H), 7.07 (dd, J = 8.6, 2.4 Hz, 1H), 6.93 (d, J = 8.6 Hz, 1H), 6.77 (dd, J = 3.4, 2.3 Hz, 1H), 6.35 (dd, J = 3.4, 2.0 Hz, 1H), 5.10 (dd, J = 12.9, 5.4 Hz, 1H), 4.61 (d, J = 11.0 Hz, 1H), 4.45 (d, J = 10.3 Hz, 1H), 4.10 (m, 1H), 3.71 - 3.56 (m, 3H), 3.17 (d, J = 5.3 Hz, 3H), 2.87 (m, 3H), 2.67 (m, 3H), 2.62 - 2.56 (m, 1H), 2.45 - 2.35 (m, 4H), 2.20 (m, 2H), 2.12 - 1.98 (m, 2H), 1.90 - 1.80 (m, 3H), 1.77 - 1.62 (m, 3H), 1.30 - 1.17 (m, 4H).2(SJ06)2-(2,6-Dioxopiperidin-3-yl)-5-(4-((3 3 R)-4-oxo-1 7 H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, DMSO-d6) δ 11.02 (s, 1H), 8.37 - 8.28 (m, 2H), 7.73 - 7.63 (m, 2H), 7.43 - 7.34 (m, 2H), 7.29 (d, J = 8.7 Hz, 1H), 7.12 (dd, J = 8.6, 2.4 Hz, 1H), 6.99 (d, J = 8.6 Hz, 1H), 6.79 (dd, J = 3.4, 2.3 Hz, 1H), 6.36 (dd, J = 3.4, 2.1 Hz, 1H), 5.08 (dd, J = 12.8, 5.5 Hz, 1H), 4.64 (d, J = 10.3 Hz, 1H), 4.50 (d, J = 11.9 Hz, 1H), 4.05 (dt, J = 17.6, 6.5 Hz, 2H), 3.70 (s, 1H), 3.51 (d, J = 5.8 Hz, 4H), 3.29 (dd, J = 5.7, 3.0 Hz, 5H), 2.95 - 2.84 (m, 1H), 2.80(m, 2H), 2.69 (m, 1H), 2.03 (m, 1H), 1.96 (m, 1H), 1.87 (s, 1H), 1.76 - 1.67 (m, 1H), 0.83 (s, 2H).3(SJ02)2-(2,6-Dioxopiperidin-3-yl)-5-fluoro-6-(4-((3 3 R)-4-oxo-1 7 H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)isoindoline-1,3-dione 1 H NMR (600 MHz, CD3OD). 1H NMR (600 MHz, MeOD) δ 8.40 (s, 1H), 7.53 (m, 2H), 7.25 - 7.16 (m, 2H), 6.94 (d, J = 3.5 Hz, 1H), 6.57 (d, J = 3.5 Hz, 1H), 5.09 (dd, J = 12.8, 5.5 Hz, 1H), 4.77 (d, J = 15.4 Hz, 1H), 4.52 (d, J = 12.4 Hz, 1H), 3.95 (d, J = 10.6 Hz, 1H), 3.44 - 3.34 (m, 7H), 3.18 (m, 1H), 3.03 (m, 2H), 2.85 (m, 2H), 2.79 - 2.66 (m, 3H), 2.20 (s, 1H), 2.15 - 2.08 (m, 1H), 2.04 - 1.95 (m, 2H), 1.94 - 1.84 (m, 3H), 0.87 (m, 2H).4(SJ07)2-(2,6-Dioxopiperidin-3-yl)-4-(4-((3 3 R)-4-oxo-1 7 H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, DMSO-d6) δ 11.01 (s, 1H), 8.37 - 8.24 (m, 2H), 7.70 (dd, J = 16.4, 8.1 Hz, 1H), 7.40 (s, 1H), 7.39 - 7.35 (m, 2H), 7.11 (dd, J = 8.6, 2.4 Hz, 1H), 7.01 (dd, J = 8.6, 3.4 Hz, 1H), 6.78 (dd, J = 3.4, 2.3 Hz, 1H), 6.35 (dd, J = 3.4, 2.0 Hz, 1H), 5.10 (dd, J = 12.5, 5.7 Hz, 1H), 4.63 (d, J = 11.6 Hz, 1H), 4.50 (d, J = 12.1 Hz, 1H), 3.69 (s, 1H), 3.44 (s, 2H), 3.27 (d, J = 3.0 Hz, 2H), 2.88 (m, 2H), 2.68 (m, 1H), 2.08 - 1.98 (m, 2H), 1.86 (s, 1H), 1.73 (m, 2H), 1.24 (m, 5H), 0.91 - 0.79 (m, 2H).5(SJ03)2-(2,6-Dioxopiperidin-3-yl)-5-(4-((4-((3 3 R)-4-oxo-1 7 H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)methyl)piperidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, CD3OD) δ 8.48 (s, 1H), 7.88 (t, J = 7.4 Hz, 1H), 7.56 (d, J = 11.0 Hz, 1H), 7.50 (s, 1H), 7.25 (m, 2H), 6.97 (d, J = 3.4 Hz, 1H), 6.59 (d, J = 3.2 Hz, 1H), 5.16 - 5.07 (m, 2H), 4.77 (d, J = 10.7 Hz, 1H), 4.52 (d, J = 12.8 Hz, 1H), 3.96 (d, J = 10.5 Hz, 2H), 3.73 (dd, J = 13.1, 7.0 Hz, 4H), 3.66 (s, 3H), 3.28 - 3.11 (m, 7H), 3.07 (d, J = 12.0 Hz, 1H), 2.98 (t, J = 11.6 Hz, 2H), 2.90 - 2.79 (m, 2H), 2.27 - 2.07 (m, 5H), 1.96 (m, 6H), 1.68 - 1.51 (m, 3H), 1.34 - 1.20 (m, 2H), 0.90 (s, 1H).6(SJ04)2-(2,6-Dioxopiperidin-3-yl)-4-(4-((4-((3 3 R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-5 6 -yl)piperazin-1-yl)methyl)piperidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, CD3OD) δ 8.48 (d, J = 2.5 Hz, 1H), 7.87 (d, J = 7.6 Hz, 2H), 7.53 (dd, J = 33.2, 9.2 Hz, 2H), 7.29 - 7.17 (m, 2H), 6.96 (d, J = 3.5 Hz, 1H), 6.57 (d, J = 3.5 Hz, 1H), 5.10 - 5.06 (m, 1H), 4.77 (d, J = 10.8 Hz, 1H), 4.53 (d, J = 10.6 Hz, 1H), 3.96 (s, 2H), 3.69 (dd, J = 36.2, 11.9 Hz, 4H), 3.21 - 3.18 (m, 2H), 3.06 (t, J = 11.7 Hz, 1H), 2.96 (d, J = 11.7 Hz, 1H), 2.90 - 2.84 (m, 3H), 2.76 - 2.65 (m, 5H), 2.13 (m, 4H), 2.05 - 1.88 (m, 5H), 1.61 - 1.50 (m, 2H), 0.94 - 0.78 (m, 2H).7(SJ11)2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(4-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-56-yl)piperazine-1-carbonyl)piperidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, Methanol-d4) δ 8.45 (d, J = 2.5 Hz, 1H), 7.53 (d, J = 11.1 Hz, 1H), 7.49 (d, J = 7.4 Hz, 1H), 7.10 (dd, J = 8.5, 2.5 Hz, 1H), 7.03 (d, J = 8.5 Hz, 1H), 6.78 (d, J = 3.5 Hz, 1H), 6.36 (d, J = 3.5 Hz, 1H), 4.77 (d, J = 13.0 Hz, 1H), 4.62 (d, J = 12.8 Hz, 1H), 3.86 (d, J = 11.2 Hz, 1H), 3.71 (d, J = 13.3 Hz, 5H), 3.61 (t, J = 8.4 Hz, 1H), 3.10 (t, J = 9.0 Hz, 1H), 3.03 - 2.96 (m, 2H), 2.85 - 2.76 (m, 4H), 2.56 (dd, J = 12.5, 10.0 Hz, 1H), 2.18 (s, 1H), 2.03 (d, J = 14.7 Hz, 4H), 1.93 (d, J = 10.6 Hz, 2H), 1.87 (d, J = 11.1 Hz, 4H), 1.62 ? 1.52 (m, 3H).8(SJ08)2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(4-(2-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-56-yl)piperazin-1-yl)ethyl)piperidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, Methanol-d4) δ 8.43 (d, J = 2.5 Hz, 1H), 7.52 (d, J = 11.2 Hz, 1H), 7.47 (d, J = 7.3 Hz, 1H), 7.09 (dd, J = 8.5, 2.5 Hz, 1H), 7.04 (d, J = 8.6 Hz, 1H), 6.78 (d, J = 3.5 Hz, 1H), 6.36 (d, J = 3.5 Hz, 1H), 5.09 (dd, J = 12.8, 5.5 Hz, 1H), 4.77 (d, J = 12.7 Hz, 1H), 4.62 (dd, J = 12.4, 2.5 Hz, 1H), 3.85 (t, J = 10.5 Hz, 1H), 3.70 - 3.64 (m, 2H), 3.20 (dt, J = 3.2, 1.6 Hz, 2H), 2.92 - 2.86 (m, 4H), 2.76 - 2.72 (m, 1H), 2.71 - 2.65 (m, 3H), 2.56 - 2.52 (m, 2H), 2.23 - 2.16 (m, 1H), 2.12 (ddt, J = 13.0, 5.5, 2.7 Hz, 1H), 2.04 (d, J = 14.8 Hz, 4H), 1.89 - 1.83 (m, 4H), 1.60 - 1.55 (m, 4H), 1.45 (d, J = 10.8 Hz, 2H).9(SJ09)2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(4-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-56-yl)piperazin-1-yl)piperidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, DMSO-d6) δ 11.09 (s, 1H), 10.98 (t, J = 2.2 Hz, 1H), 8.27 (d, J = 2.5 Hz, 1H), 8.22 (s, 1H), 7.71 (d, J = 11.4 Hz, 1H), 7.43 (d, J = 7.4 Hz, 1H), 7.37 (d, J = 3.4 Hz, 1H), 7.05 (dd, J = 8.6, 2.5 Hz, 1H), 6.90 (d, J = 8.6 Hz, 1H), 6.76 (dd, J = 3.4, 2.3 Hz, 1H), 6.34 (dd, J = 3.4, 2.0 Hz, 1H), 5.09 (dd, J = 12.9, 5.4 Hz, 1H), 4.61 (d, J = 12.1 Hz, 1H), 4.51 - 4.39 (m, 1H), 3.72 - 3.65 (m, 2H), 3.23 (t, J = 4.8 Hz, 4H), 2.96 - 2.91 (m, 1H), 2.87 (ddd, J = 17.1, 13.8, 5.5 Hz, 1H), 2.67 - 2.64 (m, 6H), 2.60 (dq, J = 4.9, 2.9, 2.4 Hz, 1H), 2.44 (ddd, J = 11.1, 9.2, 5.9 Hz, 2H), 2.32 - 2.26 (m, 1H), 2.06 - 2.01 (m, 2H), 1.87 - 1.84 (m, 1H), 1.76 (t, J = 7.7 Hz, 3H), 1.72 - 1.63 (m, 2H), 1.50 - 1.45 (m, 2H).10(SJ10)2-(2,6-dioxopiperidin-3-yl)-5-fluoro-6-(3-(4-((33R)-4-oxo-17H-2,6-diaza-1(4,2)-pyrrolo[2,3-d]pyrimidina-3(3,1)-piperidina-5(1,3)-benzenacyclohexaphane-56-yl)piperazin-1-yl)azetidin-1-yl)isoindoline-1,3-dione 1H NMR (600 MHz, Methanol-d4) δ 8.47 (d, J = 2.5 Hz, 1H), 7.45 (d, J = 10.9 Hz, 1H), 7.11 (dd, J = 8.5, 2.5 Hz, 1H), 7.06 (d, J = 8.6 Hz, 1H), 6.97 (d, J = 7.5 Hz, 1H), 6.81 (d, J = 3.6 Hz, 1H), 6.40 (d, J = 3.5 Hz, 1H), 4.68 (dd, J = 12.3, 2.6 Hz, 1H), 4.40 - 4.31 (m, 2H), 4.13 (q, J = 7.9 Hz, 2H), 3.90 (t, J = 11.7 Hz, 1H), 3.52 - 3.46 (m, 1H), 3.25 (dt, J = 3.4, 1.7 Hz, 2H), 2.93 (dq, J = 11.2, 6.8, 5.7 Hz, 2H), 2.84 - 2.79 (m, 2H), 2.65 - 2.56 (m, 4H), 2.25 - 2.21 (m, 1H), 2.16 (dtd, J = 13.0, 5.4, 2.8 Hz, 1H), 2.08 (d, J = 14.1 Hz, 4H), 2.04 (d, J = 5.9 Hz, 1H), 1.93 - 1.88 (m, 2H), 1.59 (s, 2H).
[0204]
[0205]
[0206] laboratory animals
[0207]
[0208] Pak4 at the Jackson Laboratory (Bar Harbor, Maine, USA) flox / flox Mouse (#015828, B6.129S2-Pak4 tm2.1Amin / J) and Ggt1-Cre mice (#012841, Tg(Ggt1-Cre)M3Egn / J) were obtained to generate proximal tubule-specific Pak4 knockout mice (Pak4 flox / flox; Ggt1-Cre) were bred to generate primary mice. All mice were backcrossed to the C57BL / 6J strain for at least six generations, and heterozygous offspring were intercrossed to generate primary mice. For genotyping, tail tips were placed in STE buffer (0.2% SDS, 100 mM Tris, 5 mM EDTA, 200 mM NaCl, pH 7.4), treated with 5 mg / ml proteinase K at 56°C for 12 h, and then two-step PCR was performed using specific forward (5′-GATGCAACGAGTGATGAG-3′) and reverse (5′-TCGGCTATACGTAACAGG-3′) primers. PAK4 genotype was confirmed by amplification of a 496-bp band. Pak4 KO mice and WT (Pak4 flox / flox ) were fed a standard laboratory diet. Food intake and body weight were monitored weekly during the experimental period. All experimental mice were housed in a controlled isolation facility (12-h light / dark cycle, 22±1°C, 60-70% humidity). This study protocol was approved by the Institutional Animal Experiment Ethics Committee of Chonbuk National University Hospital (Permit Number: JBUH-2021-14).
[0209]
[0210] Patients and biopsy materials
[0211]
[0212] Human kidney tissues were procured from renal transplants performed in the Department of Surgery, Chonbuk National University Hospital, from March 2022 to January 2024. Of the 15 collected kidney tissues, 8 were from living donors and 7 were from deceased donors. Punch needle core biopsies were obtained from all transplanted kidneys at two time points: 1) before reperfusion, after nephrectomy, by rinsing with cold histidine-tryptophan-ketoglutarate solution (Custodiol®); and 2) after reperfusion, approximately 20–40 minutes after reperfusion, just before wound closure. All biopsies were immediately frozen in liquid nitrogen and stored at -80°C. No significant differences were observed between living and deceased donor renal allografts in terms of donor age, HLA-A, -B, and -DR mismatches, number of retransplantations, anastomosis time, or recipient sex. All patients provided written informed consent, and this study was approved by the Institutional Review Board of Chonbuk National University Hospital (Permit Number: JBUH 2022-02-029).
[0213]
[0214] Ischemia-reperfusion induction
[0215]
[0216] Renal ischemia-reperfusion was performed using 12-week-old male mice anesthetized with xylazine hydrochloride (25 mg / ml, intravenous injection) as described previously, with slight modifications. In the ischemia-reperfusion group, bilateral renal pedicles were clamped for 25 minutes via a midline abdominal incision using non-traumatic microvascular clips, followed by reperfusion at various time points. Another group of mice underwent only a midline abdominal incision (sham group). Body temperature was controlled at 36.8–37.2°C during surgery using a temperature-controlled operating table. Blood samples were collected to assess renal function, and kidneys were harvested for histopathology, Western blot, and qPCR analysis.
[0217]
[0218] Biochemical analysis
[0219]
[0220] Blood urea nitrogen (BUN, #K024-H1), creatinine (#K002-H1, Arbor Assays, USA), TNF-α (#BMS607-3), IL-6 (#KHC-0061, Invitrogen, USA), IL-1β (eBioscience, USA), CCL2 (Peprotech, USA), TG (#80-INSMS-E01, ALPCO, USA), MDA (#ab118970), GSH (#ab235670), GSSG (#ab65322), GPx3 (#ab256470), and GPx activity (#ab102530, Abcam, England) were measured using specific kits according to the manufacturer's instructions.
[0221]
[0222] Histological analysis
[0223]
[0224] Kidneys were collected, fixed in 10% formalin at room temperature for 24 hours, and then embedded in paraffin. Tissues were cut into 5-μm-thick sections, stained with hematoxylin and eosin (H&E) at room temperature, and examined by light microscopy. Histopathological damage was defined as necrosis, brush border effacement, cast formation, and tubular dilatation. The extent of tubular damage was estimated at ×200 magnification using 10 randomly selected fields from each kidney according to the following criteria: The estimated criteria were as follows:
[0225] 0, normal;
[0226] 1, Damage to less than 10% of the tubules;
[0227] 2, damage to 10-25% of the renal tubules;
[0228] 3, 26-45% damage to the renal tubules;
[0229] 4, 46-75% damage to the renal tubules;
[0230] 5, 75-100% damage to the renal tubules.
[0231] Tubular necrosis was quantified as the percentage of tubules in the outer medulla in which epithelial necrosis or necrotic debris was observed in H&E-stained sections.
[0232]
[0233] Immunohistochemistry
[0234]
[0235] Kidney tissues were placed in fixative (10% formalin in 0.1 M PBS). Immunohistochemical staining was performed using the DAKO Envision system (DAKO, USA). After deparaffinization and hydration, tissue sections (5 μm) were stained with primary antibodies against PAK4 (#sc390507, Santa Cruz Biochemicals, USA), F4 / 80 (#ab6640), aquaporin-4 (#ab259318), Lotus tetragonolobuslectin (#ab190834), Plin2 (#ab1083230), and CD11b (#ab128797, Abcam, England) overnight at 4°C. After washing with PBS, the sections were incubated with secondary antibodies (#A11001, Alexa Fluor 488-conjugated goat anti-mouse IgG1 or #A11012, Alexa Fluor 594-conjugated goat anti-rabbit IgM, Thermo Fisher Scientific, USA) for 1 h at 37°C. The sections were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI). The slides were photographed using a GenBlue microscope. Quantification of intensity, staining area, and cell number was performed using Image J 1.52p software.
[0236]
[0237] TUNEL analysis
[0238]
[0239] Apoptotic cells were detected using a TUNEL assay kit (#G3250, Promega, USA). After treatment with a nucleotide mixture and terminal deoxynucleotidyl transferase (rTdT), tissue sections were incubated at 37°C for 1 h, and apoptotic cells counted with hematoxylin were counted under a microscope (×400) and expressed as apoptotic index (number of apoptotic bodies / 100).
[0240]
[0241] Subcellular fractionation, Western blotting, and co-immunoprecipitation (Co-IP)
[0242]
[0243] Tissue homogenates or cell lysates (20 μg) were separated by 7–12% SDS-PAGE and transferred to PVDF membranes. After blocking with 5% nonfat milk, the blots were probed with primary antibodies directed against specific antibodies. For co-immunoprecipitation, 500 μg protein was incubated overnight at 4°C with anti-PAK4 (#G222) or nonspecific IgG (#2729, Cell Signaling Technology, USA), followed by incubation with protein G agarose (#15920-010, Invitrogen, USA) for 2 h at 4°C. The blots were probed with antibodies against calreticulin (#92635), HSP60 (#4870, Cell Signaling Technology, USA), spectrin (#ab154811, Abcam), or GPx3 (#ab256470, Abcam, England). Signals were detected with horseradish peroxidase (HRP)-conjugated goat anti-mouse (#11001), goat anti-mouse (#11012, Thermo Fisher Scientific, USA), or goat anti-rabbit IgG (#2729, Cell Signaling Technology, USA). Immunoreactive bands were detected with a Las-4000 imager (GE Healthcare, USA).
[0244]
[0245] RNA isolation, qPCR, and genotyping
[0246]
[0247] Total RNA was extracted from frozen kidney tissue or HK-2 cells using TRIzol reagent (Invitrogen). RNA was precipitated with isopropanol, dried with 70% ethanol, and dissolved in diethyl carbonate-treated distilled water. First-strand cDNA was generated using random hexamer primers provided in the first-strand cDNA synthesis kit (Applied Biosystems, USA). Specific primers were designed using PrimerBank (https: / / pga.mgh.harvard.edu / primerbank, Table 2). qPCR reactions were performed in a final volume of 10 ml containing 10 ng of reverse-transcribed total RNA, 200 nm forward and reverse primers, and a PCR master mix. qPCR was performed in 384-well plates using an ABI Prism™ 7900HT Sequence Detection System (Applied Biosystems).
[0248]
[0249] GeneForward (5′- 3′)Reverse (5′- 3′)Access No.Pak4GCTCCCCTTTGAAGATGTCA(Base Sequence 1)GACCCACAAGGACTCAAGGA(Base Sequence 2)NM_027470.3PAK4GGACATCAAGAGCGACTCGAT(Base Sequence 3)CGACCAGCGACTTCCTTCG(Base Sequence 4)NM_001014834Gpx1CCACCGTGTATGCCTTCTCC(Base Sequence 5)AGAGAGACGCGACATTCTCAAT(Base Sequence 6)NM_008160Gpx3CCTTTTAAGCAGTATGCAGGCA(Base Sequence 7)CAAGCCAAATGGCCCAAGTT(Base Sequence 8)NM_008161TnfaGCGGCCACAGAAAACACTC(Base Sequence 9)CTCCCAATGGTCAAGGCATC(base sequence 10)NM_001001495Il6TGGGGCTCTTCAAAAGCTCC(base sequence 11)AGGAACTATCACCGGATCTTCAA(base sequence 12)NM_028430Il1GAAATGCCACCTTTTGACAGTG(base sequence 13)TGGATGCTCTCATCAGGACAG(base sequence 14)NM_008361Ccl2TTCTTCGATTTGGGTCTCCTTG(base sequence 15)GTGCAGCTCTTGTCGGTGAA(base sequence 16)NM_001013412ItgaxCTGGATAGCCTTTCTTCTGCTG(base sequence 17)GCACACTGTGTCCGAACTCA(base sequence 18)NM_021334Kim1ACATATCGTGGAATCACAACGAC(base sequence 19)ACTGCTCTTCTGATAGGTGACA(base sequence 20)NM_001166631ChipCAGCTAGTCACATGCCTCCA(base sequence 21)TCAGCAGGTAAAAGCCCTCA(base sequence 22)
[0250]
[0251] Cell culture and transient infection
[0252]
[0253] Human embryonic kidney 293T fibroblasts (HEK293T, #CRL-3216) and human proximal tubule cells (HK-2, #CRL-2190) were purchased from the American Type Culture Collection. Penicillin (100 U / mL) and streptomycin (100 mg / mL) were added to the culture medium. Both cell lines were cultured in DMEM containing 10% FBS. Cells were maintained at 37°C in a humidified atmosphere with 5% CO2. For analysis of GPx3 transcriptional activity, HK-2 cells with PAK4 knockdown were seeded in 12-well plates. Twenty-four hours after seeding, cells were transfected with 1 μg of a plasmid containing a luciferase promoter (-1.4 kb to TSS) and exposed to hypoxia-reoxygenation (H / R). Luminescence was measured using the GPx3 reporter gene assay (#MPRM39605, GeneCopoeia, USA).
[0254]
[0255] Hypoxia-reoxygenation (H / R) protocol
[0256]
[0257] HK-2 cells were cultured at 37°C in an anaerobic chamber (MYTEMPmini digital incubator, H2200-HC, Benchmark, USA) with oxygen absorber packs (AnaeroGen, Oxoid, England). This method was shown to maintain the oxygen concentration in the bottle below 1%. After 25 min of hypoxia, the chamber was opened, and the hypoxic medium was replaced with oxygenated medium to initiate cell reoxygenation.
[0258]
[0259] Chromatin immunoprecipitation (ChiP) analysis
[0260]
[0261] HK-2 cells were cleaved and cross-linked by incubation in 1% formaldehyde for 15 min at room temperature. Cross-linking was stopped by incubation with 100 mM glycine (pH 7.0) for 3 min. ChIP analysis was then performed using a ChIP enzyme chromatin IP kit (Cell Signaling Technology). Chromatin was immunoprecipitated overnight at 4°C with antibodies to SP1 (#sc17824, Santa Cruz Biochemicals), PPARγ (#2430), or nonspecific IgG (#2729, all Cell Signaling Technology). qPCR of ChIP DNA was performed to confirm the interaction of SP1 or PPARγ with the proximal region of the GPx3 promoter. Data were normalized to the input value.
[0262]
[0263] Proximity ligation assay (PLA)
[0264]
[0265] Protein interactions were assessed using the Duolink PLA kit (#DUO92002, Sigma-Aldrich, USA) as previously described. HK-2 cells were fixed with 10% neutral buffered formalin, permeabilized with PBS / 0.1% Triton X-100, and then incubated with PAK4 antibody (#sc-390507, Santa Cruz Biochemicals), GPx3 (#ab256470), or GPx4 (#ab41787, Abcam). Samples were then incubated with the Duolink in situ PLA probe for 1 h, and the signal was polymerase-activated using in situ detection reagent green. Finally, cells were counterstained with DAPI, and images were captured using an LSM880 confocal laser scanning microscope.
[0266]
[0267] Phosphoprotein analysis
[0268]
[0269] Renal cortex samples (100 mg) were collected from Pak4KO mice after I / R injury and subjected to phosphoproteomic analysis. The primary screening was based on differences in total phosphorylation levels between the two genotypes. The top six proteins with the highest scores were selected based on adjusted phosphorylation ratios (WT / KO > 2), and the protein spots of interest were in-gel resolved and identified by LC-MS / MS. Proteins of interest were defined as 1) phosphorylated peptides that exhibited a ≥2-fold change in phosphorylation status (phosphoprotein / protein) or a ≥2-fold change in either phosphoprotein or phosphoprotein, and 2) a change of p < 0.05 in three replicates.
[0270]
[0271] LC-MS / MS and peak alignment
[0272]
[0273] Phosphopeptides were analyzed using a Q-Exactive HFX mass spectrometer (Orbitrap MS, Thermo Fisher Scientific) coupled to a UHPLC system (Ultimate 3000, Thermo Fisher Scientific) to acquire MS / MS spectra. Peptide samples were separated on a trap column and an analytical column (PepMap RSLC, 3 μm, 100A, 75 μm × 50 cm). 2 μl of each sample was injected into a binary mobile phase consisting of 0.1% formic acid in water as mobile phase A and 0.1% FA in acetonitrile as mobile phase B, and a linear gradient consisting of 7–28% of mobile phase B was used for 60 min at a flow rate of 300 nl / min. Full scan and MS / MS settings were as follows: nanospray source voltage 2 kV, capillary temperature 275 °C, normalized collision energy 28%, maximum injection time 45 ms, and 1.2 m / z separation of precursors. Mass spectra were acquired in full scan mode using data-dependent analysis (ddMS2-top20) with MS / MS resolution of 15,000, target value 1 × 105, maximum injection time 35 ms, dynamic exclusion 20 s, and mass resolution 60,000 between 350 and 1500. Mass ion lock (m / z 445.120024) from ambient air was applied.
[0274] MS / MS spectra for phosphopeptide identification and their sites were acquired using MaxQuant (version 2.1) database analysis software. The resulting data were used to query a database containing 79,740 Homo sapiens entries downloaded from UniProtKB (revised on February 23, 2021). Search parameters included tryptic digestion with up to two missed cleavage sites, carbamidomethylation (Cys) as a fixed modification, and oxidation (Met) and phosphorylation (Ser / Thr / Tyr) as variable modifications. Search results were filtered for false discovery rate (FDR) <1%, a MaxQuant score ≥40, and a phosphorylation site probability ≥0.75. The peptide tolerance was set to 5 ppm, and the MS / MS tolerance for monoisotopic mass was set to 0.02 Da. Reverse and contaminant peptides were removed from the results.
[0275]
[0276] In vitro kinase assay
[0277]
[0278] Recombinant GPx3 (1 μg, #TP720117, Origene, Rockville, MD, USA) was mixed with 5 μCi of [γ- 32 Recombinant PAK4 (0.3 μg, #ab96405, Abcam) was incubated for 30 min at 30°C in assay buffer (50 mM Tris-HCl, 10 mM MgCl2, 2 mM DTT, and 0.1 mM EDTA, pH 7.6) containing [P]ATP. The reaction mixture was then subjected to SDS-PAGE. 32P-labeled proteins were detected by autoradiography. For Coomassie blue staining, gels were stained with Coomassie protein staining buffer (#ab119211, Abcam) for 1 h. For peptide competition assays, synthetic 15-residue oligopeptides corresponding to each region, consisting of T47 (P1: IYEYGALTIDGEEYI), S165 (P2: PTSELLGTSDRLFWE), or a negative control (P′: LLLAGFVSQSRGQEK), were used.
[0279]
[0280] Generation of mutations in GPx3
[0281]
[0282] The human GPx3 plasmid vector (#EX-M0197-M09, GeneCopoeia) was purchased from GenScript (Japan). GPx3 mutants were synthesized using site-directed mutagenesis (Cosmo-genetic, Korea). Point mutations of threonine or serine residues in GPx3 to alanine or aspartic acid were introduced to generate the following mutants: GPx3-T47A (ACC - GCC), GPx3-T47D (ACC - GAC), GPx3-T165A (TAC - GAC).
[0283]
[0284] Preparation of recombinant adeno-associated virus (AAV)
[0285]
[0286] AAV2-GPx3 containing a coding gene sequence located in reverse orientation between two floxed regions and a Ggt1-Cre recombinase binding moiety. WT and AAV2-GPx3 T47A Expression of WT or mutant GPx3 was induced in Pak4KO renal tubular cells using AAV2-eGFP. AAV2-GPx3 was used as a control. WT , AAV2-GPx3T47A and GPx3, GPx3 reverse-ordered to generate AAV2eGFP T47A And cDNA fragments encoding eGFP were individually cloned into AAV2 inverted terminal repeats (VectorBuilder, USA) harboring the Ggt1-Cre recombinase binding motif, respectively. Then, AAV2 vectors were packaged into HEK293T cells with a helper vector (E4) and AAV8:Rep-cap (VectorBuilder) vector at a 1:1:3 ratio. Infection was performed using branched polyethyleneimine (PEI, Sigma-Aldrich, 1:3 μg DNA to μg PEI ratio). After 72 h, cells and supernatants were separated by centrifugation at 1000 × g, lysed on ice, and sonicated four times with 1-s pulses to obtain clear supernatants. The supernatants were precipitated overnight at 4°C by adding 500 mM NaCl and 40% PEG 8000 solution (Sigma-Aldrich). Purified AAV2 was washed with washing buffer and eluted using a gravity column from the AAV-pro purification kit (#6232, Takara Bio, Japan). A purity of ≥90% was confirmed by SDS-PAGE. All AAV2 was isolated and stored at -80°C for further study.
[0287] For renal tubule cell-specific delivery of GPx3, 6-week-old male Ggt1-Cre mice were randomly injected with AAV2-eGFP, AAV2-GPx3-WT, or AAV2-GPx3-TA (1 × 10 per mouse). 12 One of the viral particles (AAV2) was injected intravenously. One week after injection, the expression level of eGFP in various tissues was determined by qPCR to confirm the efficacy of AAV2 delivery.
[0288]
[0289] Predicted PAK4-GPx3 complex model
[0290]
[0291] To predict the interaction between PAK4 and GPx3, protein-protein docking was performed using the X-ray crystal structures of human PAK4 (PDB id: 4XBR) and GPx3 (PDB id: 2R37). Docking was performed using ClusPro with attractive constraints applied between S474PAK4 and T47GPx3. The top 10 models were selected for further evaluation based on clustering analysis. These models were analyzed to identify the most biologically relevant interactions by considering docking scores and visually inspecting the interfaces. The final docking model was further refined based on short molecular dynamics simulations (50 ns, including backbone constraints) using the Desmond module implemented in Schrödinger (Schrödinger, LLC, USA) to confirm the stability and validity of the predicted protein-protein interactions.
[0292]
[0293] Predicted PAK4-CRBN-PROTAC complex model
[0294]
[0295] The tertiary complex structure of PAK4, CRBN, and the PROTAC molecule SJ-05 was predicted using computer simulations. The X-ray crystal structures of PAK4 (PDB id: 4XBR) and CRBN (PDB id: 5FQD) bound to casein kinase 1 were prepared using the Protein Preparation Wizard in Maestro version 13.8 (Schrödinger). The protonation states of the residues were generated at pH 7.4 using the Schrödinger Epik module. The ligand molecules were prepared in their ionized state at pH 7.4 using the Schrödinger LigPrep module. The simulations used the optimized liquid simulated potentials (OPLS) 4 force field. The induced fit docking (IFD) protocol was used to account for protein flexibility. This protocol accurately predicted the ligand-binding mode and the associated structural adjustments of the receptor by utilizing the Glide Docking and Prime Refinement modules. In this study, the warhead and anchor motif of the compound of the present invention were individually docked into the ATP-binding site of PAK4 and the thalidomide-binding site of CRBN, respectively. All docking calculations were performed in Glide's standard precision mode, and residues within 5 Å of the docked conformation were refined using the Prime module.
[0296] Protein-protein docking simulations were performed using ClusPro using the docked conformation of the warhead of the compound of the present invention and the CRBN-SJ-05 anchor. The attractive forces were based on the previously reported geometry of CRBN and the kinase domain of casein kinase (CK1). The resulting complex structure was energy minimized with an optimal distance of 8.0 ± 0.2 Å between the piperazine-N and piperidine-N atoms in the compound of the present invention. The linker moiety was manually modeled, and further optimization was performed via short MD simulations (50 ns, including backbone constraints) for the entire tertiary structure, i.e., PAK4, CRBN, and the fully constructed molecules of the compound of the present invention. All molecular graphics were generated using PyMOL v. 2.5.4 (Schrödinger).
[0297]
[0298] Pharmacokinetic studies
[0299]
[0300] In vivo pharmacokinetic studies in mice were conducted as previously described. The compound of the present invention was dissolved in a mixture of DMSO, Cremophor EL, polyethylene glycol 400, and double-distilled water (10 / 10 / 40 / 40%, v / v) and orally administered at 10 mg / kg to overnight-fasted mice. Blood samples were collected at 30, 60, 120, 240, 480, and 1440 minutes after oral administration. The blood samples were immediately centrifuged at 14,000 rpm for 15 minutes at 4°C, and the supernatant (plasma) was stored at -20°C until required.
[0301] The plasma concentration levels of the compounds of the present invention were measured by an LC-MS / MS system. The LC-MS / MS system included an AB SCIEX Triple Quad™ 3500 (TQ3500) mass spectrometer (AB Sciex LLC, USA) connected to an Agilent 1290 HPLC system (USA). Chromatographic separation was performed using a Synergi™ polar reversed-phase column (pore size 80A, particle size 4 μm, size 150 × 2 mm, Phenomenex, Torrance, CA, USA). The mobile phase was a mixture of acetonitrile and 0.1% aqueous formic acid (70:30, v / v), which was injected at a flow rate of 0.2 mL / min, and the injection volume was 2 μL. The optimized MRM conditions in positive electrospray ionization mode by multiple reaction monitoring (MRM) were as follows: m / z 790.456 → 372.1 for the compound of the present invention and m / z 180.035 → 110.0 for the IS. Mass data were processed using Analyst software version 1.5.2 (Applied Biosystems-SCIEX, Concord, Ontario, Canada). Plasma PK and standard samples were deproteinized by adding methanol containing the IS. The plasma calibration curve of the compound of the present invention in the concentration range of 50–5000 ng / mL showed excellent linearity with a correlation coefficient (r=0.9993, weighting factor 1 / x2). Oral pharmacokinetic parameters were calculated by noncompartmental analysis (WinNonlin® software version 8.3, Pharsight Corporation, Mountain View, CA, USA).
[0302] Experimental Example 1. Confirmation of increased PAK4 expression in renal tubules after ischemia-reperfusion (I / R) injury.
[0303]
[0304] We confirmed the expression of PAK4 in mice with renal ischemia-reperfusion injury. As a result, we confirmed that PAK4 and HIF protein levels, as well as PAK4 mRNA levels, increased in response to renal ischemia-reperfusion injury (Figs. 1a and 1b). Histological analysis revealed that PAK4 was specifically upregulated in the renal proximal tubules of mice subjected to ischemia-reperfusion. Furthermore, increased PAK4 expression was observed in L. tetragonolobus lectin-positive tubules (Fig. 1c). The increase in PAK4 expression was evident from 1 hour after ischemia-reperfusion, peaked between 24 and 72 hours, and persisted for up to 120 hours (Fig. 1d).
[0305]
[0306] Based on a previous study showing that PAK4 is upregulated by HIF-1α in mouse hepatocytes after ischemia-reperfusion injury, we hypothesized that PAK4 may be directly regulated by HIF-1α in ischemia-reperfusion-injured renal tissue. As a result, PAK4 promoter-luciferase assays and Pak4 promoter and CHIP assays confirmed that HIF-1α enhances PAK4 transcription (Figures 1e and 1f).
[0307]
[0308] Experimental Example 2. Proximal tubule-specific PAK4 deficiency confirms ischemia-reperfusion mitigation.
[0309]
[0310] To investigate the role of PAK4 in the progression of ischemia-reperfusion injury, renal ischemia-reperfusion was induced in proximal tubule-specific PAK4 knockout mice and WT mice (Fig. 2a). As a result, Pak4 knockout mice exhibited significantly reduced BUN and creatinine levels compared to wild-type mice (Fig. 2b). Histological analysis using H&E, TUNEL, and F4 / 80 immunostaining revealed that ischemia-reperfusion induced proximal tubule loss, necrosis, protein casts, apoptosis, and interstitial inflammation, effects that were significantly attenuated in Pak4 knockout mice (Fig. 2c). Western blotting of renal tissues revealed that Pak4 knockout mice exhibited increased levels of anti-apoptotic Bcl2 protein, along with decreased activation of the IKK / NF-κB pathway, pro-apoptotic Bax, and cleaved caspase 3 (Fig. 2d). Plasma ELISA analysis and qPCR analysis of renal tissues showed that ischemia-reperfusion-induced inflammatory cytokine levels were increased and decreased in PAK4 knockdown mice compared to wild-type mice.
[0311]
[0312] Experimental Example 3. Confirmation of enhanced antioxidant capacity due to PAK4 deficiency.
[0313]
[0314] To determine the role of PAK4 deficiency in protecting the kidney against renal ischemia-reperfusion injury, we assessed renal oxidative stress markers and antioxidant enzyme levels. Compared with wild-type mice, PAK4 knockdown mice had significantly lower levels of malondialdehyde (MDA, an end product of lipid peroxidation) and glutathione disulfide (GSSG, an oxidized form of glutathione), while significantly higher levels of reduced glutathione (GSH) (Figures 3A and B). Western blot analysis revealed that Pak4 knockout mice showed upregulation of antioxidant proteins, such as GPX3 and SOD1 / 3, in renal tissues during ischemia-reperfusion, while no changes were observed in GPx1 / 4 / 7, Nrf2, HO-1, NQO1, and NADPH oxidases NOX1, NOX2, and NOX4 (Figure 3B). Consistently, GPX enzyme activity in renal tissue and blood after ischemia-reperfusion was significantly increased in Pak4 knockout mice (Fig. 3d).
[0315]
[0316] At the cellular level, we confirmed the regulation of GPX3 by PAK4. In response to hypoxia / reoxygenation (H / R) challenge in HK-2 cells, PAK4 knockdown increased GPX enzymatic activity in cell lysates and GPX3 protein levels in the culture medium (Fig. 3e and f). These results confirmed that the protective effect of PAK4 deficiency against renal ischemia-reperfusion injury was associated with increased GPx3 expression.
[0317]
[0318] To analyze the direct interaction between PAK4 and calreticulin, spectrin, HSP60, and GPx3, co-IP assays were performed in cells exposed to hypoxia / reoxygenation or not. All of these molecules co-immunoprecipitated with PAK4 before hypoxia / reoxygenation, and this interaction was slightly increased for calreticulin, whereas no change was observed for spectrin and HSP60 after hypoxia / reoxygenation (Fig. 4a). GPX3 protein levels in PAK4 immunoprecipitates significantly increased after hypoxia / reoxygenation, which was further confirmed by PLA analysis (Figs. 4a and 4b). We then shifted our investigation to closely examine PAK4 regulation of GPx3 through phosphorylation.
[0319]
[0320] Experimental Example 4. Confirmation of phosphorylation and destabilization of GPx3 by PAK4.
[0321]
[0322] In vitro kinase assays were performed to confirm the effective phosphorylation of GPx3 by PAK4. Peptide competition in vitro kinase assays showed that a peptide comprising the T47 domain (P1) efficiently inhibited PAK4-mediated GPx3 phosphorylation, whereas a nonspecific negative peptide (P') or a peptide comprising T165 (P2) had little or no inhibitory effect on PAK4-mediated GPx3 phosphorylation (Fig. 4c). Using the X-ray crystallographic structures of PAK4 (PDB id: 4XBR) and GPx3 (PDB id: 2R37), a protein docking model for the phosphorylation of GPx3-T47 by PAK4 was predicted, and its structural validity was confirmed (Fig. 4b). The structural model above highlighted the spatial accessibility of key residues involved in phosphorylation, the superior conformation and electrostatic complementarity at the binding interface, and the molecular basis of the interaction between PAK4 and GPx3.
[0323] To determine whether GPx3-T47 phosphorylation directly affects GPx3 protein levels, alanine substitutions at the T47 residue (GPx3 T47A ) and aspartic substitution (GPx3 T47D ) were used to generate phosphorylation-inactivated and phosphomimetic mutants. In cycloheximide chase experiments, GPx3 T47A Mutants in GPx3 respond to hypoxia / reoxygenation WT (GPx3 wild type) and GPx3 T47D showed increased protein stability compared to GPx3 (Fig. 5a). Consistently, GPx3 T47A GPx3, not WT Overexpression of PAK4 significantly increased GPx3 ubiquitination in the presence of MG132 (Fig. 5b).
[0324]
[0325] GPx3 in acute kidney injury in mice WT (GPx3 wild type) vs. GPx3 T47A The effects of GPx3 were further investigated in Ggt1-Cre mice. WT or GPx3 T47A AAV2 expressing GPx3 was intravenously injected. Renal tubule-specific delivery of GPx3 was confirmed by qPCR and immunohistochemistry. Similar to previous results, ischemia-reperfusion insertion induced GPx3 WT Increased renal tissue damage in Ggt1-Cre mice harboring AAV2-GPx3 (Fig. 5c). However, AAV2-GPx3 T47A These changes were significantly attenuated by PAK4 injection, as evidenced by decreased apoptosis, inflammation, and oxidative stress in renal tissue and decreased BUN and creatinine levels in plasma. Taken together, these results suggest that phosphorylation of GPx3-T47 by PAK4 destabilizes GPx3, thereby regulating oxidative stress in proximal tubular cells during renal ischemia-reperfusion.
[0326]
[0327] Experimental Example 5. Confirmation of increased fatty acid β-oxidation in renal tissue due to PAK4 deficiency.
[0328]
[0329] Because preservation of redox equilibrium is intricately linked to mitochondrial fatty acid β-oxidation and PAK4 has been shown to inhibit fatty acid β-oxidation in hepatocytes, we investigated whether the renoprotective effect of PAK4 deficiency was related to fatty acid metabolism in renal tubular cells.
[0330]
[0331] Biochemical TG analysis and perilipin immunostaining revealed that severe fat accumulation occurred in wild-type mice after ischemia-reperfusion injury, but this was significantly reduced in PAK4 knockdown mice (Figs. 6a and 6b). Notably, there were no significant changes in the protein levels of de novo lipogenic enzymes, such as fatty acid synthase and acetyl-CoA synthetase, between genotypes. In addition, a marked increase in OxPhos protein along with an increase in mitochondrial fatty acid β-oxidation was observed in PAK4 knockdown mice (Fig. 6c). The effect of PAK4 deficiency on fatty acid β-oxidation was also observed in an in vitro cell culture model. Consistent with previous reports in hepatocytes, PAK4 S474A Overexpression of PAK4, but not PAK4, increased NCoR1 phosphorylation and its interaction with PPARα (Figs. 6d and 6e). These results suppressed PPARα luciferase activity and mitochondrial oxygen consumption in HK-2 cells, whereas PAK4 silencing increased PPARα luciferase activity (Figs. 6f and 6g). In renal tissue, PAK4 deficiency maintains energy dependence on fatty acid β-oxidation, suggesting that this effect is related to its renoprotective activity.
[0332]
[0333] Experimental Example 7. Confirmation of the alleviation of renal ischemia-reperfusion in mice by pharmacological degradation of PAK4.
[0334]
[0335] The compound, a PROTAC-based PAK4 degrader of the present invention, is a heterologous, functional, small-molecule compound consisting of PAK4 and a ligand for the E3 ligase cereblon (CRBN), linked by a chemical linker. The compound was synthesized through a six-step sequence from a compound with promising oral pharmacodynamic properties in mice, and its chemical structure is shown in Figure 7a. The efficacy of the compound in renal ischemia-reperfusion injury was evaluated (Figure 7b). Administration of the compound significantly reduced tubular necrosis, apoptosis, oxidative stress, and inflammatory responses compared to the control group (Figure 7c).
[0336]
[0337] To gain structural insight into the compound's mode of action, the tertiary complex structure of PAK4, CRBN, and the compound was predicted (Fig. 7d). According to this model, the linker moiety of the compound appears to provide good charge transfer between the thalidomide-binding domain of CRBN and the hinge region of the PAK4 kinase domain.
[0338]
[0339] The compound's warhead moiety formed strong H-bond interactions with E396 and L398 of PAK4, effectively occupying the ATP-binding site with a macrocyclic scaffold. Furthermore, this scaffold guided the linker toward CRBN in an optimal orientation, ensuring precise alignment and enhancing overall binding efficiency. The interaction with CRBN appears to closely resemble the typical thalidomide binding of CRBN. This model highlights the spatial arrangement and complementarity of key residues at the binding interface, providing insight into the structural basis for the compound's effective recruitment of CRBN, leading to targeted degradation of PAK4.
[0340]
[0341] Experimental Example 8. Confirmation that PAK4 expression in renal tissue after kidney transplantation is inversely related to renal function.
[0342]
[0343] We investigated the relationship between PAK4 expression and transplant outcome in renal tissues from kidney transplant recipients. Consistent with animal studies, individuals with high PAK4 protein expression in the renal cortex also had higher p-GPx3 levels compared to individuals with low PAK4 protein expression (Fig. 8a). PAK4 expression and GPx3 phosphorylation in the renal cortex were inversely correlated with transplant outcome (BUN and creatinine levels) on day 1 postoperatively, providing further evidence for the role of PAK4 in regulating oxidative stress in the human kidney (Fig. 8b).
Claims
1. A compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-, R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
2. In the first paragraph, the compound represented by the chemical formula 1 is one or more compounds selected from the following compounds: , , , , , , , , , or .
3. A pharmaceutical composition for preventing or treating ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-, R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
4. A pharmaceutical composition in claim 3, wherein the compound represented by the chemical formula 1 is one or more compounds selected from the following compounds: , , , , , , , , , or .
5. A pharmaceutical composition for preventing or treating ischemia-reperfusion injury in the third paragraph, wherein the ischemia is caused by artificially reducing blood flow by blocking or occluding blood vessels during surgery.
6. A pharmaceutical composition for preventing or treating ischemia-reperfusion injury, wherein the surgery comprises tissue transplantation surgery, tissue resection surgery, aneurysm repair surgery, or endarterectomy.
7. A pharmaceutical composition for preventing or treating ischemia-reperfusion injury, wherein the ischemia-reperfusion injury is damage to the liver, kidney, heart, lung, small intestine, large intestine or pancreas.
8. A pharmaceutical composition for preventing or treating ischemia-reperfusion injury, wherein the composition is administered before, simultaneously with, or after the occurrence of ischemia-reperfusion injury in the third paragraph.
9. A health functional food composition for preventing or improving ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-, R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
10. A pharmaceutical composition according to claim 9, wherein the compound represented by the chemical formula 1 is at least one compound selected from the following compounds: , , , , , , , , , or .
11. A method for preventing, treating or improving ischemia-reperfusion injury, comprising administering or ingesting to a subject a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-, R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
12. Use for preventing, treating or improving ischemia-reperfusion injury, comprising a compound represented by the following chemical formula 1, an optical isomer thereof, a hydrate or solvate thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] The above Linker is a direct bond, or a straight or branched chain C 1-20 C alkylene, straight or branched chain 2-20 Alkenylene, straight or branched chain C 2-20 A linker composed of a combination of one or more linkers selected from the group consisting of alkynylene, a C6 to C30 heteroarylalkyl group, -O-, -S-, -S(=O)-, -SO2-, -NH-, -N=, -C(=S)- and -C(=O)-, R1 or R2 are each independently hydrogen, C 1-20 An alkyl group, or a halogen (i.e., F, Cl, Br, or I).
Citation Information
Patent Citations
5-Heteroaryl substituted indazoles as kinase inhibitors
KR1020100032886A
Kinase inhibitors
KR1020120140643A
Cleaning device of cleaning member, substrate cleaning apparatus and cleaning member assembly
KR1020210122141A
Image processing apparatus, image processing method, movable apparatus, and storage medium
KR1020230161877A
A Method Of Processing Engine Monitoring Parameters
KR1020240161764A