Low-cost, high yield cell-free protein synthesis reagent formulation

Abstract

Disclosed are compositions, formulations, systems, and methods for cell-free protein synthesis, which comprise a unique combination of cell-free metabolites and non- phosphorylated energy substrates to enable protein synthesis at 2-10x greater yields than alternative systems using non-phosphorylated energy substrates.

Description

A LOW-COST, HIGH YIELD CELL-FREE PROTEIN SYNTHESIS REAGENT FORMULATIONCROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[0001] This Application claims the benefit of U.S. Appl. No. 63 / 662,910, filed June 21, 2024. The content of the above-referenced application is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant number W911NF-23-2-0039 awarded by the Army Research Office. The government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] An electronic sequence listing (70258102684. xml; Size: 30,266 bytes; and Date of Creation: June 18, 2025) accompanies this application. The sequence listing is incorporated by reference in its entirety.BACKGROUND

[0004] There is a significant global need for rapid, on-demand production of medical therapeutics to address emergent biological threats. Current manufacturing processes for protein-based biologies are often time-consuming, expensive, and inaccessible to rural and developing regions.SUMMARY

[0004] One aspect of the disclosure is a composition for cell-free protein synthesis, the composition comprising: a) potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and the 20 standard amino acids, and an E. coll extract. A DNA template and / or a RNA template encoding a protein of interest may be added to the composition. The composition or formulation may also include magnesium glutamate, glucose, potassium phosphate, nicotinamide, ribose, and a buffer.

[0005] A second aspect is a cell-free protein synthesis system comprising the disclosed composition comprising: a) potassium glutamate, adenosine monophosphate,cytidine monophosphate, guanosine monophosphate, undine monophosphate, and the 20 standard amino acids, and an E. coll extract, and a DNA template and / or a RNA template encoding a protein of interest.

[0006] Another aspect is a method for cell-free protein synthesis, the method comprising contacting the composition or formulation disclosed herein in a buffer with a DNA and / or a RNA template encoding a protein of interest.

[0007] A further aspect is a method for cell-free protein synthesis in which a cell-free protein synthesis system can synthesize its own reagents from monomer building blocks. In an aspect, the cell-free protein synthesis system can synthesize nucleoside monophosphates (NMPs) from nucleotide bases and sugars.BRIEF DESCRIPTION OF THE FIGURES

[0008] FIG. 1A-C. Cell-free protein synthesis is limited by high costs and low yields. (FIG. 1A) Reagent cost per liter of CFPS reaction was calculated for 8 different reagent formulations and compared against reported protein yield, demonstrating the significantly higher costs associated with phosphorylated energy substrates. Costs are based on only raw materials purchased at the laboratory scale, as calculated in Table 1. Reagents comprise the majority of the costs associated with cell-free protein synthesis reactions. (FIG. IB) sfGFP yields from independent implementation of 8 reagent formulations from (FIG. 1A) in BL21 Star (DE3) lysate. Error bars show standard deviation for n = 3 replicates. (FIG. 1C) Cost of reagents per gram sfGFP produced by the 8 tested reagent formulations. Error bars show propagated standard deviation from cell-free expression yields for n = 3 replicates.

[0009] FIGS. 2A-2BB. Development and validation of a high-yielding, low-cost minimal reagent formulation. (FIG. 2A) Across the reagent optimization campaign, 58 reagents were assessed and optimized via testing of 1,231 different compositions. Each point represents a different reagent composition and the corresponding average yield of sfGFP from n = 3 replicates produced in a BL21 Star (DE3) lysate at 30°C after 20 h. (FIG. 2B) Initial screen of low-cost cell-free reagent compositions. Reagent concentrations are sorted based on their corresponding sfGFP yield. All reactions were run using BL21 Star (DE3) lysate at 30°C for 20 h. sfGFP yield is the average of n = 3 replicates. High concentrations of NMPs were often associated with formation of insoluble precipitates in the reaction mixtures. FIGS. 2C-2E show glutamate minimal reagent formulation behavior. (FIG. 2C) is cell-freesfGFP expression levels over 20 h using either the PANOx-SP or glutamate minimal reagent formulations. The shaded area represents the standard deviation of n = 3 replicates. (FIG. 2D) sfGFP yield from manipulating the concentration of the three reagent components in the glutamate minimal formulation. The scatterplot shows potassium glutamate (KGlu), amino acids, and total NMP concentration, consisting of the sum of AMP, CMP, GMP, and UMP concentrations. (FIG. 2E) show reagent concentrations and sfGFP yield from (FIG. 2D), replotted to show the AMP to CMP / GMP / UMP concentration ratios. All reactions were run with BL21 Star (DE3) lysate at 30°C for 20 h. FIGS. 2F-2K show reagent addition to the glutamate minimal system. (FIG. 2F) sfGFP expression levels resulting from addition of either HEPES or Bis-Tris buffer, both at pH 7.2, to the glutamate minimal system. Error bars represent the standard deviation of n = 3 replicates. (FIG. 2G) Magnesium and potassium glutamate cross-titration and corresponding impact on sfGFP expression level. Heat map cells show the average of n = 3 replicates. (FIG. 2H) Impact of magnesium and potassium glutamate cross-titration on the time the cell-free expression reaction took to reach within 5% of the final 20 h. reaction yield. (FIG. 21) Time courses of sfGFP production after adding alternative energy substrates and different amounts of potassium glutamate to the glutamate minimal reagent formulation. The shaded area represents the standard deviation of n = 3 replicates. (FIG. 2J) sfGFP expression levels when including either 4 mM oxalate, 1.5 mM spermidine, or 1 mM phosphate in the glutamate minimal reagent formulation. (FIG. 2K) sfGFP expression levels when including either fumarate or malate, two tricarboxylic acid cycle intermediates, in the reagent formulation. Error bars in (FIG. 2J) and (FIG. 2K) represent the standard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) lysate at 30°C for 20 h. FIG. 2L shows replacing NMPs with nucleobases or nucleosides. Using the glutamate minimal system as a base, the listed NMP(s) were removed from the reagent formulation and replaced with either their corresponding nucleobase (adenine, cytosine, guanine, and uracil) or nucleoside (adenosine, guanosine, cytidine, and uracil). In some cases, phosphate and / or ribose were added to supplement the nucleotide synthesis pathway or attempt to improve overall system performance. L-Gln addition, a key component in nucleotide biosynthesis, was also assessed. In the reagent composition heat map, boxes with “X” indicate no addition of the reagent. Resultant sfGFP expression levels are shown. Dashed lines show the baseline expression levels for each condition; the purple bar is the unmodified glutamate minimal system. Error bars represent the standard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) lysate at 30°C for 20 h. In many cases, insoluble precipitates were observed at the end of the reaction and are noted inthe figure. FIG. 2M shows multi-factor optimization campaign. Reagent compositions tested after the rational additive studies in Figs. S3-S4. Reagent concentrations are sorted based on their corresponding sfGFP yield. All reactions were run using BL21 Star (DE3) lysate at 30°C for 20 h. sfGFP yield is the average of n = 3 replicates. NMP concentrations were capped at 5 mM to prevent formation of insoluble precipitates, as observed in previous reactions. FIGS. 2N-2O illustrate shift in cell-free reaction cost over the optimization campaign. (FIG. 2N) is cost of reagents per liter cell-free protein synthesis (CFPS) reaction for all tested reagent formulations. (FIG. 20) is cost of reagents per gram of sfGFP produced by each tested reagent formulation. FIG. 2P shows sfGFP expression over the course of 21 h in cell-free reactions using either the PANOx-SP or optimized minimal reagent formulation. FIG. 2Q shows productivity of the optimized minimal reagent system (purple) and PANOx- SP system (gray) across three independent BL21 Star (DE3) lysate batches. The percentage increase in sfGFP yield between the PANOx-SP formula and optimized minimal formula in each lysate is indicated. (FIGS. 2R-2T) show lysate-specific cell-free reaction optimization. (FIG. 2R) Magnesium and phosphate cross-titrations and resultant sfGFP expression for six different lysates using the novel minimal reagent formulation. Heat map cells represent the average of n = 3 replicates. (FIG. 2S) sfGFP expression in six different lysates with optimized magnesium and phosphate concentrations. Error bars represent the standard deviation of n = 3 replicates. (FIG. 2T) Impact of lysate concentration on sfGFP expression levels when using the PANOx-SP or novel minimal reagent formulations. Results from two different laboratories are shown for the minimal reagent system. New optimum magnesium and phosphate concentrations were determined for each lysate concentration. Error bars represent the standard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) lysate at 30°C for 20 h. (FIG. 2U) shows protein production using the optimized minimal reagent system at three different laboratory sites, each using reagents and lysate prepared independently. In all panels, error bars show standard deviation for n = 3 replicates. FIGS. 2V-2BB show minimal reagent formulation stability. sfGFP expression after addition of (FIG. 2V) sodium chloride, (FIG. 2W) Tris-HCl, (FIG. 2X) glycerol, (FIG. 2Y) EDTA, (FIG. 2Z) betaine, and (FIG. 2AA) proline. (FIG. 2BB) sfGFP expression when including either 6.5% or 11.5% v / v of common protein buffers and cryoprotectants in the cell-free reaction. PBS consisted of 137 mM NaCl, 2.7 mM KC1, 10 mM sodium phosphate dibasic, and 1.8 mM potassium phosphate dibasic. S30 buffer consisted of 10 mM Trizma acetate, 14 mM magnesium acetate, and 60 mM potassium acetate. Tris-HCl and NaCl buffer consisted of 100 mM Tris-HCl and 150 mM NaCl. In all panels, error bars represent the standarddeviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) lysate and the novel minimal reagent formulation with the listed additives at 30°C for 20 h.

[0010] FIGS. 3A-Q. Adjusting the reagent formulations alters the cell-free metabolic environment and oxygen dependency. (FIG. 3A) sfGFP yields for the PANOx-SP and optimized minimal reagent formulations, as well as the minimal reagent formulation without including ribose. (FIG. 3B) Inorganic phosphate concentration in the cell-free reaction environment. (FIG. 3C) ATP concentration in the cell-free reaction environment. (FIG. 3D) pH levels in the cell-free reaction environment. For FIGS. 3A-3D, error bars represent the standard deviation of n = 3 replicates. All reactions were run at 30°C for 22 h. using BL21 Star (DE3) lysate. (FIG. 3E) Percent change in metabolite concentration after 20 h. for the two tested minimal reagent formulations compared to the PANOx-SP formula. (FIG. 3F) shows cell-free metabolite traces for different reagent formulations pyruvate, lactate, acetate, citrate, succinate, fumarate, and malate. Reactions were run using the BL21 Star (DE3) lysate for 22 h at 30°C. All error bars represent the standard deviation of n = 3 replicates. (FIG. 3G) shows cell-free metabolite traces during expression of different products phosphate, ATP, pyruvate, lactate, acetate, citrate, succinate, fumarate, malate, glucose and ribose. Reactions were run using the BL21 Star (DE3) lysate and novel minimal reagent formulation for 22 h at 30°C. All error bars represent the standard deviation of n = 3 replicates. FIGS. 3H-3J show influence of reaction volume and geometry' on protein expression. (FIG. 3H) Cell-free sfGFP expression levels from different volume reactions after 20 h incubation at 30°C in either a 2 mL flat-bottomed tube (Axygen MCT-200-A), PCR tube (Thermo Scientific AB 2000), or a 384-well plate (Greiner Bio-One 781096) sealed with an optically clear seal (Bio-Rad MSB 1001). (FIG. 31) Comparison of sfGFP yield and approximate surface area to volume ratio, as determined by manufacturer tube / plate schematics and caliper measurements. Error bars for FIG. 3H-3I represent the standard deviation of n = 3 replicates. (FIG. 3 J) Cell-free reaction opacity in PCR tubes after 20 h. (FIG. 3K) Photo of the in-house bioreactor system. (FIG. 3L) sfGFP production in a 4 mL bioreactor supplemented with either a 20% or 100% O2 feed. (FIG. 3M) Dissolved oxygen content in a 4 mL bioreactor supplemented with either a 20% or 100% O2 feed. For FIGS. 3L-3M the shaded area represents standard deviation for n = 6 bioreactors with a 20% O2 feed and n = 3 bioreactors with a 100% O2 feed. Additional replicates were run for the 20% O2 feed bioreactors due to the increased variability. FIGS. 3N-3O show zoomed-in versions of the bioreactor (FIG. 3N) yield and (FIG. 30) dissolved oxygen plots shown in Fig. 3. The shaded area represents standard deviation for n = 6bioreactors at 20% O2 feed and n = 3 bioreactors at 100% O2 feed. (FIG. 3P) illustrates selected metabolic pathways, metabolites, and cofactors. (FIG. 3Q) shows preliminary addition of cell-free oxidizing reagents. Comparison of protein expression yields using the PANOx-SP system and minimal reagent system when incubated with 500 pM iodoacetamide (IAM), 4 mM oxidized glutathione (GSSG), or 1 mM reduced glutathione (GSH). All reactions were run using BL21 Star (DE3) lysate for 20 h at 30°C. Error bars represent standard deviation for n = 3 replicates.

[0011] FIGS. 4A-4S. Adjusting reaction pH enables the creation of an active oxidizing reaction environment. (FIG. 4A) Impact of oxidized / reduced glutathione (GSSG / GSH) and iodoacetamide (IAM; lo = 25 pM, hi = 500 pM) on sfGFP yield when using the minimal reagent system. FIGS. 4B-4D show manipulation of minimal system oxidizing environment. (FIG. 4B) sfGFP expression levels associated with including different concentrations of total glutathione, holding the 4: 1 oxidized: reduced (GSSG:GSH) ratio constant. (FIG. 4C) sfGFP expression levels after altering the GSSG:GSH ratio, holding total glutathione concentrations constant at 5 mM. (FIG. 4D) Impact of lodoacetamide (IAM) pretreatment on cell-free sfGFP expression at different glutathione concentrations and GSSG: GSH ratios. Error bars in all panels represent standard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) Agor lysate and the novel minimal reagent system at 30°C for 20 h. (FIG. 4E) shows effect of iodoacetamide (IAM) and oxidized / reduced glutathione (GSSG / GSH) on ATP, inorganic phosphate, and reaction pH. All reactions were run using BL21 Star (DE3) Agor lysate and novel minimal reagent formula at 30°C for 21 h. Error bars represent the standard deviation of n = 3 replicates. (FIG. 4F) pH traces over a 21 h reaction when using the PANOx-SP or minimal reagent systems either in their unmodified reducing condition (red.) or with addition of IAM, GSSG, and GSH (ox.). Unless otherwise noted, the HEPES buffer included in each reaction was initially at pH 7.2. (FIG. 4G) Recovery of sfGFP expression levels upon altering HEPES buffer pH and concentration. FIGS. 4H-4J show the impact of buffer choice on oxidizing minimal reagent formulation behavior. (FIG. 4H) sfGFP expression in the oxidizing minimal reagent system associated with the use of HEPES at different concentrations and initial pH levels. (FIG. 41) sfGFP expression associated with the use of Bis-Tris at different concentrations and initial pH levels. (FIG. 4J) Expression of sfGFP, protein D (PD), CRM197, and the trastuzumab Fc domain in the PANOx-SP system and the oxidizing minimal system with 75 mM of either HEPES at pH 7.5 or Bis-Tris at pH 7.2. Error bars in all panels represent thestandard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) Agor lysate at 30°C for 20 h. FIGS. 4K-4P present confirmation of disulfide bond formation using the novel minimal reagent formulation. (FIG. 4K) Autoradiogram of cell-free reactions expressing the trastuzumab Fc domain. Total samples were run directly on SDS-PAGE gels without treatment to preserve the disulfide bonds. (FIG. 4L) Total (gray bars) and soluble (colored bars) trastuzumab Fc cell-free expression yields. (FIG. 4M) Mass fraction of disulfide-bonded trastuzumab Fc dimers, as determined by densitometry. (FIG. 4N) Autoradiogram of cell-free reactions expressing trastuzumab heavy chain and light chain. Total samples were run directly on SDS-PAGE gels without treatment to preserve the disulfide bonds. (FIG. 40) Total (gray bars) and soluble (colored bars) protein expression in reactions expressing trastuzumab heavy chain and light chain. (FIG. 4P) Percent full-length trastuzumab antibody, as determined by densitometry . All error bars represent the standard deviation of n = 3 replicates. All reactions were run using BL21 Star (DE3) Agor lysate at 30°C for 20 h in the novel oxidizing minimal reagent system. FIGS. 4Q-4R show optimization of trastuzumab expression. (FIG. 4Q) Full amount of soluble protein expression from trastuzumab heavy' chain and light chain plasmids after 20 h. (FIG. 4R) Mass fraction of the full-length trastuzumab antibody determined from oxidizing autoradiograms. No densitometry results are reported for 16°C reactions because bands were too faint to be distinguished from the background. Full-length antibody yields reported in FIG. 4S were determined by multiplying total protein yield by the fraction of full-length antibody. Error bars in (FIG. 4Q) and (FIG. 4R) represent the standard deviation of n = 3 replicates. (FIG. 4S) Production and optimization of full-length trastuzumab via adjustment of the reaction temperature and addition of the heavy chain (HC) pDNA at different times. A bacterial DsbC was included in the antibody production reactions at a concentration of 5 pM. All reactions were run at 30°C for 20 h. using BL21 Star (DE3) Agor lysate, unless otherwise noted. Error bars represent the standard deviation of n = 3 replicates.

[0012] FIGS. 5A-5V. The optimized minimal reagent system can express a wide variety of recombinant protein therapeutics. (FIG. 5 A) Expression of 15 recombinant protein therapeutics using three different reagent formulations, as quantified by14C-leucine incorporation. All reactions were run in an oxidizing cell-free environment with BL21 Star (DE3) Agor lysate and included 5 pM of purified bacterial DsbC. Reactions were incubated at 30°C for 20 h. Both total and soluble protein yields are shown for n = 3 replicates and error bars represent standard deviation. Statistical significance for soluble yields was calculated byunpaired two-tailed / -tests. FIG. 5B-5C are oxidizing (FIG. 5B) and reducing (FIG. 5C) autoradiograms for GCSF, IFy, FGF2, streptokinase, vtPA, and CRM197. Correct protein band sizes are marked with a purple arrow. FIGS. 5D-5E are oxidizing (FIG. 5D) and reducing (FIG. 5E) autoradiograms for TRI2-2, myoglobin, Factor X, anthrax protective antigen, colicin M, and brolucizumab. Correct protein band sizes are marked with a purple arrow. FIGS. 5F-5I are oxidizing autoradiograms for caplacizumab (FIG. 5F), ormutivimab (FIG. 5G), ranibizumab (FIG. 5H), and trastuzumab (FIG. 51). Total fractions of cell-free expression reactions were run without treatment on SDS-PAGE gels to visualize disulfide- bonded components. Caplacizumab and ormutivimab were run on the same gel and separated in the above images for easier labeling. The trastuzumab gel was shown previously in Fig. 4N and is repeated here with the Zawada, et al. (2011) samples for easier comparison. Correct protein band sizes are marked with arrows. FIG. 5J-5M are reducing autoradiograms for caplacizumab (FIG. 5 J), ormutivimab (FIG. 5K), ranibizumab (FIG. 5L), and trastuzumab (FIG. 5M). Total cell-free reagent samples were treated with DTT and heated at 70°C for 3 min. to denature the samples and break disulfide bonds between components before running the SDS-PAGE gels. Caplacizumab and ormutivimab samples were run on the same gel and separated in the above images for easier labeling of bands; ranibizumab and trastuzumab gels were treated similarly. Correct protein band sizes are marked with arrows. FIG. 5N shows therapeutic protein reagent cost per gram product. Cost was determined from protein yield (FIG. 5A) and cost of reagents per liter for each system (Table 4). Costs associated with the PANOx-SP and novel minimal reagent formulations are increased to $4,898 / L and $518 / L in these calculations to account for the addition of oxidized and reduced glutathione; the Zawada, et al. (2011) formulation already included glutathione. Cost of the added bacterial DsbC is not included. Costs were calculated for soluble protein produced. For ranibizumab, trastuzumab, and ormutivimab, this was the amount of full-length, soluble protein assemblies as determined by densitometry. FIG. 5O-5P Antibody component expression and assembly. (FIG. 50) Mass fractions of the insoluble, full-length, heavy chain, and light chain components for three antibody constructs. Fractions were determined through densitometry of the oxidizing autoradiograms in Fig. 4K. Error bars represent the standard deviation of n = 3 replicates. (FIG. 5P) Concentration and mass fraction of the heavy and light chain components for three antibody constructs, as determined through densitometry of the reducing autoradiograms in FIG. 5N. Mass fraction error bars represent the standard deviation of n = 2 replicates, and protein concentration error bars represent propagated error from both the n = 3 yield quantification replicates and the n = 2 autoradiogram replicates.(FIG. 5Q) Enzymatic activity of vtPA produced using the minimal reagent formulation. The shaded area represents standard deviation for n = 3 replicates. (FIG. 5R) Viability of CLM24 indicator cells treated with colicin M produced using the minimal reagent formulation. Error bars indicate standard deviation from n = 3 independent cell cultures. Statistical significance was calculated by an unpaired two-tailed / -test. (FIG. 5S) AlphaLISA binding pattern generated by interaction of the cell-free produced TRI2-2 minibinder and the SARS-CoV-2 spike protein. This experiment was run in duplicate, and all results can be found in the supplement. Cell-free reactions used to generate protein for FIGS. 5R-5S were run in an oxidizing cell-free environment at 30°C for 20 h using BL21 Star (DE3) Agor lysate supplemented with 5 pM purified bacterial DsbC. For trastuzumab production, heavy chain pDNA was added after 1.5 h of incubation. FIGS. 5T-5U show TRI2-2 binding activity. Heatmaps demonstrating AlphaLISA luminescence associated with binding between the TRI2-2 minibinder and the SARS-CoV-2 RBD spike protein. Duplicate reactions, FIG. 5T and FIG. 5U, with either a blank cell-free reaction (no DNA) or a cell-free reaction expressing TRI2-2 are shown. (FIG. 5V) Full-length trastuzumab detected using an anti- idiotypic sandwich ELISA assay. Error bars indicate standard deviation from n = 3 replicates. Cell-free reactions used to generate protein were run in an oxidizing cell-free environment at 30°C for 20 h using BL21 Star (DE3) Agor lysate supplemented with 5 pM purified bacterial DsbC. For trastuzumab production, heavy chain pDNA was added after 1.5 h of incubation.DETAILED DESCRIPTION

[0013] Disclosed are compositions, formulation, systems, and methods for cell-free gene expression and cell-free protein synthesis. The disclosed compositions, formulations, systems, and methods use a unique combination of cell-free metabolites and energy substrates that significantly increase protein expression and protein synthesis and at a low cost. The compositions, formulation, systems, and methods enable protein synthesis at 2-10x greater yields than alternative systems using non-phosphorylated energy substrates.

[0014] Cell-Free Protein Synthesis Compositions and Formulations and Improvements Thereof

[0015] Current manufacturing processes for protein-based biologies are often timeconsuming, expensive, and inaccessible, particularly to rural and developing regions. Multi- million-dollar development and production processes also create a highly centralized supply chain and slow, complex therapeutic distribution. Cell-free protein synthesis (CFPS) hasemerged as an alternative to traditional cell-based methods for manufacturing biologies. The cell-free platform does not require specialized bioreactors, and the open reaction environment enables manipulation of physiochemical parameters that would be impossible in a live host. Cell-free protein synthesis has the capacity to integrate into a network of distributed manufacturing, enabling regional or point-of-care production of needed therapeutics. However, high reagent costs and comparatively low protein yields limit the widespread use of cell-free systems. The present technology provides a novel reagent formulation that reduces reagent costs without sacrificing, and often increasing, protein yield.

[0016] Typical cell-free protein synthesis (CFPS) systems produce recombinant proteins in extracts of cells upon incubation with essential substrates (e.g., amino acids, DNA template, energy substrates)1 3. As a complement to cellular, or in vivo, production platforms, cell-free systems provide numerous benefits. They enable consistent product quality by avoiding stochastic cell growth and mutation issues that can lead to inconsistent batch-to- batch performance. Cell-free systems are also modular, high-throughput, and fast. The same crude cell lysate can produce multiple products within hours with automation by simply using different DNA to program multiple, distinct reactions, as compared to having a different cell line for each product. In addition, cell-free systems can be freeze-dried, distributed, stored, and then readily reactivated by just adding water4 7. This makes possible new forms of distributed biomanufacturing.

[0017] Over the past two decades, improvements in the ability7to produce complex proteins using cell-free protein synthesis have opened the door to a wide range of applications1, including diagnostics3 ,6. pathway prototyping17-22, protein design23-27, metabolic engineering28’29, and education30-33. These systems are also well suited for distributed manufacturing paradigms and can be readily scaled from microliter reactions to 100 L bioreactors34"36. A wide variety of biologies, including full-length monoclonal antibodies and glycosylated therapeutics, have been produced in cell-free systems4-6,23,27’34’37-44

[0018] Despite growing use of cell-free gene expression systems, widespread utilization is hampered by high costs and low yields. Many cell-free systems rely on expensive phosphorylated energy substrates, such as phosphoenolpyruvate (PEP), to regenerate the ATP that fuels protein biosynthesis45-47. This results in reagent costs upwards of $4,000 / L and contributes to over 75% of all material costs associated with cell-free protein synthesis (Fig. 1A). Assuming a 1 g / L protein yield, these costs are an order of magnitudehigher than the $10s-$100s / g cost of goods associated with cellular protein production48’49. Manufacturer availability and variability of complex reagents like purified tRNA further complicate implementation. To address high costs, numerous groups have previously developed different reagent formulations that leverage non-phosphorylated energy substrates for reagent costs of <$5OO / L5’36’37’45’50’51(Fig. 1A). However, these reagent systems have not been widely adopted due to lower protein expression yields and increased system sensitivity.

[0019] Here, the inventors demonstrate low-cost, high-yielding minimal cell-free reagent formulations capable of producing > 2 g / L of protein product for only $133 / L, a 97% decrease in reagent cost compared to traditional formulations. The inventors show that these novel formulations can activate homeostatic metabolism and reach yields of 3.7 g / L protein product with oxygen supplementation. The inventors further apply this system to the production of disulfide bonded proteins and demonstrate the synthesis of fifteen therapeutically relevant products, including full-length monoclonal antibodies. The optimized reagent formulations disclosed herein will enable new protein production paradigms and expand access to protein biologies.

[0020] Disclosed herein are novel cell-free protein synthesis (CFPS) reaction compositions or formulations that are cost effective and exhibit improved protein production. In embodiments, the cell-free reagent composition or formulation comprises (1) a CFPS lysate; (2) potassium glutamate; (3) NMPs; and (4) amino acids. In some embodiments, a CFPS reagent composition or formulation further includes magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose. In some embodiments, a CFPS reagent composition or formulation further includes a buffer, which may be any buffer with a pKa of between 6 and 8, for example HEPES buffer or Bis-Tris buffer. In embodiments, a CFPS composition or formulation includes a bacterial cell lysate or extract, for example an Escherichia coli cell lysate or extract. As used throughout this disclosure, ‘lysate” and “extract” as indicated for a bacteria or bacterial cell may be used interchangeably unless specifically stated otherwise.

[0021] Bacterial lysates

[0022] In embodiments, the CFPS lysate comprises a bacterial lysate, and can be formed from one or more bacterial strains; such bacterial strains may be modified or unmodified. By way of example but not by way of limitation, in some embodiments, a CFPS lysate is prepared from a wild-type or a modified bacterial strain (source strain). By way ofexample, but not by way of limitation, bacterial source strains useful in the CFPS reactions disclosed herein include, without limitation, Ecoli AprfA AendA Agor Ame (705), E. coll BL21 Star (DE3), E.coli CLM24, E.coli CLM24 AlpxM, E.coli CLM24 AlpxM CH-IpxE, E.coli CLM24 AlpxM CH-IpxE TT-IpxE, E.coli CLM24 AlpxM CH-IpxE TT-IpxE KL-IpxE, and E.coli CLM24 AlpxM CH-IpxE TT-IpxE KL-IpxE KO-IpxE. In the disclosed aspects, the E. coli strain is a B strain or a K strain. In some embodiments, the E. coli strain is a B strain (e.g., BL21 Star (DE3); T7 expression E. coli strain; SHuffle T7). In some embodiments, the E. coli strain is a K strain (e.g. K-12 strain). In some embodiments, the CFPS lysate or extract is not prepared from a K-strain E. coli and does not comprise an E. coli K-strain (or K-12 strain; laboratory' strain of E coli along with B strain).

[0023] Potassium glutamate

[0024] Potassium glutamate (KGlu) is a primary component of the disclosed compositions and formulations. KGlu, as a regulator of protein synthesis, in included in an amount or concentration of about 300 mM to about 400 mM, preferably about 300 mM, about 325 mM, about 350 mM, about 375 mM, or about 400 mM. In an embodiment, the concentration is 300 mM, or 362mM. Potassium glutamate salt is used here to help mimic the cytoplasmic environment, which has positive and negative ions.

[0025] Nucleotide monophosphates

[0026] Nucleotide monophosphates (NMPs) include but are not limited to one or more of adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate. The disclosed compositions, formulation, systems, and methods may include one of more of the NMPs. In disclosed aspects, adenosine monophosphate may be included in the compositions or formulations, in an amount or concentration of about 1 mM to about 3 mM, preferably about ImM to about 2mM, or about ImM, about 1.5mM, about 2mM, about 2.5mM, or about 3mM. In some embodiments, the concentration is about 1.2 mM or about 3mM.

[0027] In disclosed aspects, cytidine monophosphate may be included in the compositions or formulations. Cytidine monophosphate may be an amount or concentration of about 0.85 mM to about 2.15 mM, preferably about 0.85mM, about 0.86 mM, about 0.87 mM, about 0.88 mM, about 0.89 mM, about 0.90 mM, about 1 mM, about 1.5 mM, about 2 mM, or about 2.15 mM. In disclosed aspects, guanosine monophosphate may be included in the compositions or formulations. Guanosine monophosphate may be an amount orconcentration of about 0.85 mM to about 2.15 m , preferably about 0.85mM, about 0.86 mM, about 0.87 mM. about 0.88 mM, about 0.89 mM, about 0.90 mM, about 1 mM, about 1.5 mM, about 2 mM, or about 2.15 mM. In disclosed aspects, uridine monophosphate may be included in the compositions or formulations. Uridine monophosphate may be an amount or concentration of about 0.85 mM to about 2.15 mM, preferably about 0.85mM, about 0.86 mM, about 0.87 mM, about 0.88 mM, about 0.89 mM, about 0.90 mM, about 1 mM, about 1.5 mM, about 2 mM, or about 2.15 mM.

[0028] Amino acids

[0029] Amino acids used in the disclosed compositions, formulation, systems, and methods may be natural or non-natural. The disclosed compositions, formulation, systems, and methods may include the 20 standard amino acids, alanine, arginine, asparagine, aspartic acid / aspartate, cysteine, glutamine, glutamic acid / glutamate, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In disclosed aspects, the 20 standard amino acids may be provided as a single component, for example a combination, composition, or mixture.

[0030] In the disclosed compositions, formulation, systems, and methods, the 20 standard amino acids may be used in an amount or concentration of about 3mM to about 6 mM. In some aspects, the amount or concentration of the 20 standard amino acids is about 3mM, about 3.25 mM, about 3.5 mM, about 3.75 mM, about 4mM, about 4.25 mM, about 4.5 mM, about 4.75 mM, about 5 mM, about 5.25 mM, about 5.5 mM, about 5.75 mM, or about 6 mM.

[0031] Additional components

[0032] Additional components of the disclosed compositions, formulation, systems, and methods may include one or more of magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose. In disclosed aspects, magnesium glutamate is included in the compositions or formulations, and may be in an amount or concentration of about 8mM. In disclosed aspects, glucose is included in the compositions or formulations, and may be in an amount or concentration of about lOmM. In disclosed aspects, potassium phosphate is included in the compositions or formulations, and may be in an amount or concentration of about 15mM. In disclosed aspects, nicotinamide is included in the compositions or formulations, and may be in an amount or concentration of about 4mM.

[0033] In disclosed aspects, ribose is included in the compositions or formulations. Ribose may be used in an amount or concentration of about 50mM. Ribose and nucleotide bases can be added to synthesize nucleoside monophosphates in the cell-free system (e.g., it is uniquely show that a combination of guanine and ribose can replace GMP without a decrease in system). Ribose can also help regenerate ATP by activating metabolism in the lysate.

[0034] The disclosed compositions, formulation, and systems may include a buffer, which may be any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5. In some aspects, the amount or concentration of the buffer is about 75mM. In some aspects, the buffer is HEPES buffer or Bis-Tris buffer. In some aspects, the buffer is about pH 7.2 to 7.5, preferably 7.2, 7.3, 7.4, or 7.5. In some aspects, the pH of the buffer is 7.2. In some aspects, the pH of the buffer is 7.5. The inventors unexpectedly discovered that pH is important for protein synthesis and increased protein production. In particular, pH level and pH stability are important for complex protein synthesis and high protein synthesis activity, including for increased protein synthesis compared to protein synthesis using non-phosphorylated energy substrates with pH range 7.2, or complex protein synthesis in which the pH is lower than pH 7.5. The inventors unexpectedly discovered that pH is important for protein synthesis and increased protein production. In particular, pH level and pH stability are important for complex protein synthesis and high protein synthesis activity, including for increased protein synthesis compared to protein synthesis using non-phosphorylated energy' substrates with pH range 7.2, or complex protein synthesis in which the pH is lower than pH 7.5.

[0035] In some aspects, the cell-free protein synthesis compositions, formulations, or reaction mixture, and systems further contain lodoacetamide, glutathione, and / or disulfide bond isomerase (e.g., DsbC). In embodiments, the iodoacetamide (IAM) is at an amount or concentration of 25 pM or 500 pM. In embodiments, the glutathione may be oxidized glutathione (GSSG) or reduced glutathione (GSH), and the amount of oxidized glutathione is about 4 mM and reduced glutathione (GSH) is about 1 mM. In embodiments, the disulfide bond isomerase is about 5 pM, for example purified P. damselae DsbC at 5 pM.

[0036] Exemplary novel formulations

[0037] In aspects, the novel CFPS reagent composition or formulation comprises, consists of, or consists essentially of potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, undine monophosphate, and the 20standard amino acids, and an E. coli extract or lysate, and optionally, a DNA template and / or a RNA template encoding a protein of interest. The novel CFPS reagent composition or formulation may further comprise, consist of, or consist essentially of magnesium glutamate, glucose, potassium phosphate, nicotinamide, ribose, and a buffer. In embodiments, the buffer may be a HEPES buffer or a Bis-Tris buffer. In embodiments, magnesium glutamate and potassium phosphate concentrations must be optimized in tandem to obtain the highest yielding formulation. In all aspects, the E. coli extract or lysate is an E. coli B strain extract or an E. coli K strain extract. In some embodiments, the E. coli strain is a B strain (e.g., BL21 Star (DE3); T7 expression E. coli strain; SHuffle T7). In some embodiments, the E. coli strain is a K strain (e.g. K-12 strain).

[0038] In an aspect, the CFPS reagent composition or formulation comprises potassium glutamate at is about 300 mM, adenosine monophosphate at about 1.2 mM, cytidine monophosphate at about 0.86 mM, guanosine monophosphate at about 0.86 mM, uridine monophosphate at about 0.86 mM, and the 20 standard amino acids collectively at about 3.25 mM, an E. coli extract or lysate. The E. coli extract or lysate may be included from about 20% v / v to about 50% v / v, about 20% v / v to about 45% v / v, about 30% v / v to about 50% v / v, about 30% v / v to about 45% v / v, or about 20% v / v to about 30% v / v, preferably about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%. 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%, v / v for all values. In all aspects, the E. coli extract or lysate is an E. coli B strain extract or an E. coli K strain extract. In some embodiments, the E. coli strain is a B strain (e.g., BL21 Star (DE3); T7 expression E. coli strain; SHuffle T7). In some embodiments, the E. coli strain is a K strain (e.g. K-12 strain). A buffer may be included at about 75mM, for example a HEPES buffer or a Bis-Tris buffer. A DNA template and / or a RNA template encoding a protein of interest may be included. A plasmid DNA may be included at approximately 13 ng / pL.

[0039] In some aspects, the CFPS reagent composition or formulation comprises: 300 mM potassium glutamate, 1.2 mM adenosine monophosphate, 0.86 mM cytidine monophosphate, 0.86 mM guanosine monophosphate, 0.86 mM uridine monophosphate, 3.25 mM each of the 20 standard amino acids, about 20% v / v to about 50% v / v of an E. coli B strain extract or lysate, such as BL21 Star (DE3) extract, and 75mM buffer, and a plasmid DNA at approximately 13 ng / pL.

[0040] In some aspects, the CFPS reagent composition or formulation is as follows: 8 mM magnesium glutamate, 362 mM potassium glutamate, 3 mM adenosine monophosphate, 2.15 mM cytidine monophosphate, 2.15 mM guanosine monophosphate, 2.15 mM uridine monophosphate, 10 mM D-glucose, 5 mM of each of the 20 standard amino acids, 15 mM potassium phosphate, 50 mM D-ribose, and 7.5 mM HEPES, 20% v / v to 45% v / v E. coll e.g., BL21 Star (DE3) extract (e.g. 20%, 30%, 45%, 46% v / v), and approximately 13 ng / pL plasmid DNA.

[0041] All reagents used in the disclosed compositions, formulation, and methods herein are prepared individually in water and diluted to achieve the final concentrations in a cell-free protein synthesis reaction. The final protein synthesis reaction includes the reagents at listed concentrations, e.g., approximately 20% v / v or 30% v / v E. col extract, and approximately 13 ng / pL plasmid DNA. Numerous variations on the composition or formulation as described herein have been evaluated and the compositions or formulations have been evaluated under different conditions; similar yields may be obtained based on 30%-70% change in concentration of some variables, for example as shown in Fig. 2B, such as K(Glu), 20 standard amino acids, AMP, CMP, GMP, UMP, GSSG, sfGFP, Mg(Glu)2, oxalate, phosphate, and spermidine.

[0042] General Cell-free Protein Synthesis

[0043] Cell-free compositions, formulations, systems, methods, and reagents are known in the art, and aspects of these known compositions, formulations, systems, methods, and reagents can be used in conjunction with, or can be applied to the compositions, formulations, systems, methods, and reagents disclosed herein. See, for example, U.S. Patent Nos. 4,496,538; 4,727,136; 5,478,730; 5,556,769; 5,623,057; 5,665,563; 5,679,352; 6,168,931; 6,248,334; 6,531,131; 6,869,774; 6,994,986; 7,118,883; 7,189,528; 7,338,789; 7,387,884; 7,399,610; 8,703,471; and 8,999,668. See also U.S. Published Application Nos. 2015-0259757, 2014-0295492, 2014-0255987, 2014-0045267, 2012-0171720, 2008- 0138857, 2007-0154983, 2005-0054044, and 2004-0209321. See also U.S Published Application Nos. 2005-0170452; 2006-0211085; 2006-0234345; 2006-0252672; 2006- 0257399; 2006-0286637; 2007-0026485; and 2007-0178551; 2014-0295492; 2018-0016612; 2018-0016614; 2018-0298416; and 2019 / 0284600. See also Published PCT International Application Nos. WO 2003 / 056914; WO 2004 / 013151; WO 2004 / 035605; WO 2006 / 102652; WO 2006 / 119987; and WO 2007 / 120932. See also U.S. Patent Nos. 10,118,950, 9,528,137, and 9,951,392, and U.S. Published Application No. 2017 / 0349928.See also Guarino, C., & DeLisa, M. P. (2012). A prokaryote-based cell-free translation system that efficiently synthesizes glycoproteins. Glycobiology, 22(5), 596-601. The contents of all of these references are incorporated in the present application by reference in their entireties.

[0044] By way of example, in some embodiments, CFPS reactions are performed in in vitro, a vessel, e.g., a single vessel or multiple vessels. The term “vessel,” as used herein, refers to any container suitable for holding on or more of the reactants (e.g., for use in one or more transcription, translation, and / or glycosylation steps) described herein. Examples of vessels include, but are not limited to, a microtiter plate, a test tube, a microfuge tube, a beaker, a flask, a multi-well plate, a cuvette, a flow system, a microfiber, a microscope slide and the like.

[0045] In some embodiments, the disclosed compositions or formulations may be utilized in cell-free protein methods to prepare glycosylated macromolecules (e.g., glycosylated peptides, glycosylated proteins, and glycosylated lipids). Glycosylated proteins that may be prepared using the disclosed bacterial strains and systems may include proteins having N-linked glycosylation (i.e., glycans attached to nitrogen of asparagine and / or arginine side-chains) and / or O-linked glycosylation (i.e., glycans attached to the hydroxyl oxygen of serine, threonine, tyrosine, hydroxylysine, and / or hydroxyproline). Glycosylated lipids may include O-linked glycans via an oxygen atom, such as ceramide.

[0046] By way of example, but not by way of limitation, glycosylated macromolecules may include unbranched and / or branched sugar chains composed of monomers as known in the art such as, but not limited to, glucose (e.g., P-D-glucose), galactose (e.g., (LD-galactose), mannose (e.g., P-D-mannose), fucose (e.g., a-L-fucose), N- acetyl-glucosamine (GlcNAc), N-acetyl-galactosamine (GalNAc), neuraminic acid, N- acetylneuraminic acid (i.e.., sialic acid), and xylose, which may be attached to the glycosylated macromolecule, growing glycan chain, or donor molecule (e.g., a donor lipid and / or a donor nucleotide) via respective glycosyltransferases (e.g., oligosaccharyltransferases, GlcNAc transferases, GalNAc transferases, galactosyltransferases, and sialyltransferases). The glycosylated macromolecules disclosed herein may include glycans as known in the art.

[0047] The disclosed cell-free protein synthesis compositions may utilize components that are crude and / or that are at least partially isolated and / or purified. As used herein, theterm "crude" may mean components obtained by disrupting and lysing cells and, at best, minimally purifying the crude components from the disrupted and lysed cells, for example by centrifuging the disrupted and lysed cells and collecting the crude components from the supernatant and / or pellet after centrifugation. The term “isolated or purified” refers to components that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.

[0048] In some embodiments, a CFPS lysate or extract is prepared from a wild-type or a modified bacterial host strain (source strain). By way of example, but not by way of limitation, bacterial source strains useful in CFPS reactions include, without limitation, Ecoli AprfA AendA Agor Arne (705), E. coll BL21 (DE3), E. coll BL21Star (DE3), E.coli CLM24, E.coli CLM24 AlpxM, E.coli CLM24 AlpxM CH-IpxE, E. coll CLM24 AlpxM CH-IpxE TT- IpxE, E.coli CLM24 AlpxM CH-IpxE TT-IpxE KL-IpxE, and E.coli CLM24 AlpxM CH- IpxE TT-IpxE KL-IpxE KO-IpxE. In the disclosed aspects, the E. coli strain is a B strain or a K strain. In some embodiments, the E. coli strain is a B strain (e.g., BL21 Star (DE3); T7 expression E. coli strain; SHuffle T7). In some embodiments, the E. coli strain is a K strain (e.g. K-12 strain). In embodiments, the CFPS lysate or extract is not prepared from a K-strain E. coli.

[0049] In some embodiments, the modified bacterial host strain (or modified strain) includes a modification that results in an increase in the concentration of a monosaccharide utilized in glycosylation (e.g., glucose, mannose, N-acetyl-glucosamine (GlcNAc), N-acetyl- galactosamine (GalNAc), galactose, sialic acid, neuraminic acid, fucose). As such, the modification may inactivate an enzyme that metabolizes a monosaccharide or polysaccharide utilized in glycosylation. In some embodiments, the modification inactivates a dehydratase or carbon-oxygen lyase enzyme (EC 4.2) (e.g., via a deletion of at least a portion of the gene encoding the enzyme). In particular, the modification may inactivate a GDP-mannose 4,6- dehydratase (EC 4.2.1.47). When the modified strain is E. coli, the modification may include an inactivating modification in the gmd gene (e.g., via a deletion of at least a portion of the gmd gene).

[0050] In some embodiments, the modified strain includes a modification that inactivates an enzyme that is utilized in the glycosyltransferase pathway. In some embodiments, the modification inactivates an oligosaccharide ligase enzyme (e.g., via a deletion of at least a portion of the gene encoding the enzyme). In particular, the modificationmay inactivate an O-antigen ligase that optionally conjugates an O-antigen to a lipid A core oligosaccharide. The modification may include an inactivating modification in the waaL gene (e.g, via a deletion of at least a portion of the waaL gene).

[0051] In some embodiments, the modified strain includes a modification that inactivates a dehydratase or carbon-oxygen lyase enzyme (e.g, via a deletion of at least a portion of the gene encoding the enzyme) and also the modified strain includes a modification that inactivates an oligosaccharide ligase enzyme (e.g, via a deletion of at least a portion of the gene encoding the enzyme). The modified strain may include an inactivation or deletion of both gmd and waaL.

[0052] In some embodiments, the modified strain may be modified to express one or more orthogonal or heterologous genes. In particular, the modified strain may be genetically modified to express an orthogonal or heterologous gene that is associated with glycoprotein synthesis such as a glycosyltransferase (GT) which is involved in the lipid-linked oligosaccharide (LLO) pathway. In some embodiments, the modified strain may be modified to express an orthogonal or heterologous oligosaccharyltransferase (EC 2.4.1.119) (OST). Oligosaccharyltransferases or OSTs are enzymes that transfer oligosaccharides from lipids to proteins.

[0053] In some embodiments, the modified strain may be genetically modified to express an orthogonal or heterologous gene in a glycosylation system (e.g, an N-linked glycosylation system and / or an O-linked glycosylation system). The N-linked glycosylation system of Campylobacter jejuni has been transferred to E. coli. (See Wacker et al. , “N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli,” Science 2002, Nov 29; 298(5599): 1790-3, the content of which is incorporated herein by reference in its entirety). In particular, the modified strain may be modified to express one or more genes of the pgl locus of C. jejuni or one or more genes of a homologous pgl locus. The genes of the pgl locus include pglG, pglF, pglE, wlaJ, pglD, pglC, pglA, pglB, pglJ, pgll, pglH, pglK, and gne, and are used to synthesize lipid-linked oligosaccharides (LLOs) and transfer the oligosaccharide moieties of the LLOs to a protein via an oligosaccharyltransferase.

[0054] Exemplary orthogonal or heterologous oligosaccharyltransferases (OST) that may be expressed in the genetically modified strains may include Campylobacter jejuni oligosaccharyltransferase PglB. PglB catalyzes transfer of an oligosaccharide to a D / E-Y-N- X-S / T motif (Y, X j P) present on a protein. Additional non-limiting examples of OSTenzymes useful in the methods, kits, and systems disclosed herein include Campylobacter coli PglB, Campylobacter lari PglB, Desulfovibrio desulfuricans PglB, Desulfovibrio gigas PglB, and Desulfovibrio vulgaris PglB.

[0055] Crude cell lysates or extracts may be prepared from the same or different unmodified and / or modified strains disclosed herein. The crude cell lysates may be prepared from different modified and / or unmodified strains as exemplified herein and the crude cell lysates may be combined to prepare a mixed crude cell lysate. In some embodiments, one or more crude cell lysates may be prepared from one or more modified strains including a genomic modification (e.g., deletions of genes rendering the genes inoperable) that preferably result in lysates comprising sugar precursors for glycosylation at relatively high concentrations (e.g., in comparison to a strain not having the genomic modification). In some embodiments, one or more crude cell lysates may be prepared from one or more modified strains that have been modified to express one or more orthogonal or heterologous genes or gene clusters that are associated with glycoprotein synthesis.

[0056] The methods disclosed herein may be utilized to prepare crude cell lysates or mixed crude cell lysates that are enriched in glycosylation components, such as lipid-linked oligosaccharides (LLOs), glycosyltransferases (GTs), oligosaccharyltransferases (OSTs), or any combination thereof. In some embodiments, the crude cell lysates or mixed crude cell lysates are enriched in MansGlcNAc2 LLOs representing the core eukaryotic glycan and / or Man3GlcNAc4GahNeu5Ac2 LLOs representing the fully sialy lated human glycan. By way of example, but not by way of limitation, glycan structures useful in the disclosed methods, kits and systems include Francisella tularensis SchuS4 O-polysaccharides, Escherichia coli 078 O-polysaccharides, Escherichia coli 0-7 O-polysacchandes, Escherichia coli 0-9 0- polysaccharides primer, Campylobacter jejuni heptasaccharides N-glycan, Campylobacter lari PglB hexasaccharides N-glycan, engineered Campylobacter lari PglB hexasaccharides N-glycan, Wolinella succinogenes hexasaccharide N-glycan, and eukaryotic Man3GlcNac2 N-glycan structure.

[0057] Exemplary Cell-Free Extract Preparation Protocol

[0058] In some embodiments, a cell-free protein synthesis (CFPS) and / or glycoprotein synthesis (CFGpS) is prepared. The preparation allows for the coordinated transcription, translation, and optionally, the glycosylation of one or more proteins in a cell- free reaction mixture, where the reaction mixture comprises a cell-free fraction obtained bylysing prokaryotic cells to obtain lysed cells (e.g., by sonicating the prokaryotic cells and / or by homogenizing the prokaryotic cells), subjecting the lysed cells to centrifugal separation at a force greater than 5,000 x g and less than about 30,000 x g (or less than about 25,000 x g. 20,000 x g. 18,000 x g, or 15,000 x g) collecting the supernatant to obtain the cell-free fraction. Such compositions typically comprise components for: (i) transcribing and translating the protein in the cell-free reaction mixture; and (ii) optionally glycosylating the protein in the reaction mixture with at least one polysaccharide to obtain the glycosylated protein. In some embodiments, the lysed cells are subjected to centrifugal separation at a force greater than 5,000 x g and less than about 18,000 * g or less than about 15,000 x g. in some embodiments, the lysed cells are subjected to centrifugal separation at a force of about 12,000 g.

[0059] Exemplary cells for the disclosed composition, formulations, systems, methods and platforms include prokaryotic cells. Suitable prokaryotic cells include, but are not limited to, Escherichia coli, as described previously. An exemplary E. coli is an E. coli B strain or an E. coli K strain.

[0060] In some aspects, the cell-free protein synthesis compositions, formulations, or reaction mixture further contains iodoacetamide, glutathione, and / or disulfide bond isomerase (e.g., DsbC). lodoacetamide is added to deactivate reductases. Glutathione is added to create an oxidizing reaction environment. Disulfide bond isomerase is supplemented to aid in disulfide bond formation. In embodiments, the iodoacetamide (IAM) is at an amount or concentration of 25 pM or 500 pM. In embodiments, the glutathione may be oxidized glutathione (GSSG) or reduced glutathione (GSH), and the amount of oxidized glutathione is about 4 mM and reduced glutathione (GSH) is about 1 mM. In embodiments, the disulfide bond isomerase is about 5 pM, for example purified P. damselae DsbC at 5 pM.

[0061] Cell-free protein synthesis systems

[0062] Another aspect is a cell-free protein synthesis system, which includes the disclosed compositions or formulations and a DNA template and / or a RNA template encoding a protein of interest. An exemplary cell-free protein synthesis system may comprise: a) a composition comprising potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and the 20 standard amino acids(coll ection or mixture), as described herein.; (b) an E. coli extract asdescribed herein; and (c) a DNA template and / or a RNA template encoding a protein of interest as described herein.

[0063] The system may also comprise iodoacetamide, glutathione, and disulfide bond isomerase. In embodiments, the iodoacetamide (IAM) is at an amount or concentration of 25 pM or 500 pM. In embodiments, the glutathione may be oxidized glutathione (GSSG) or reduced glutathione (GSH), and the amount of oxidized glutathione is about 4 mM and reduced glutathione (GSH) is about 1 mM. In embodiments, the disulfide bond isomerase is about 5 pM, for example purified P. damselae DsbC at 5 pM.

[0064] In embodiments, the cell-free gene expression system or cell-free protein synthesis system comprises a buffer, which may be any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5. In some aspects, the amount or concentration of the buffer is about 75mM. In some aspects, the buffer is HEPES buffer or Bis-Tris buffer. In some aspects, the buffer is about pH 7.2 to 7.5, preferably pH 7.2, 7.3, 7.4, or 7.5.

[0065] Methods of using the novel cell-free formulations

[0066] Another aspect of the disclosure is methods for cell-free protein synthesis. The methods may include obtaining or preparing the compositions or formulations disclosed herein, and combining the compositions or formulations with a DNA template and / or a RNA template encoding a protein of interest. One aspect is a method of combining a composition comprising potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and a mixture of the 20 standard amino acids, and an E. coll extract, such as a B strain or K strain extract, with a DNA template and / or a RNA template encoding a protein of interest.

[0067] Another aspect is a method of performing cell-free protein synthesis in vitro that includes contacting a disclosed composition or formulation with a DNA and / or a RNA template encoding a protein of interest.

[0068] In the disclosed methods, the amount or concentration of potassium glutamate may be about 300 mM, of adenosine monophosphate may be about 1.2 mM, of cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each about 0.86 mM, and the amino acids is about 3.25 mM.

[0069] The disclosed methods may further comprise magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose. In some aspects, the amount or concentrationof magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, and ribose is about 50mM.

[0070] In each of the disclosed methods, the buffer may be any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5. In some aspects, the amount or concentration of the buffer is about 75mM. In some aspects, the buffer is HEPES buffer or Bis-Tris buffer. In some aspects, the buffer is about pH 7.2 to 7.5, preferably 7.2, 7.3, 7.4, or 7.5. In some aspects, the disclosed methods of cell-free protein synthesis may use buffer at pH 7.2, for example in the reagent mixture and throughout protein synthesis. In some aspects, the disclosed methods of cell-free protein synthesis may use buffer at pH 7.5, which may be at initial reagent mixture and throughout protein synthesis.

[0071] In the disclosed methods, protein yield may be increased to over 2 g / L compared to a control from previously developed cell-free protein synthesis systems and methods using non-phosphorylated energy substrates. In some embodiments, the protein yield is about 2 g / L, about 3 g / L, or about 4 g / L. In some embodiments, the protein yield is 3.7 g / L.

[0072] Further, the disclosed methods reduce reagent costs, for example by 15-fold compared to a control from previously developed cell-free protein synthesis systems and methods using non-phosphorylated energy substrates. Exemplary cost reduction is compared in Table 2.

[0073] In the methods described herein, cell-free protein synthesis may be performed with 100% oxygen. In some aspects, use of 100% oxygen increases protein production rate and yield. In some aspects, use of 100% oxygen increases a rate of protein synthesis 3x faster than ambient air (about 20% oxygen), for example at a rate of about 1 g / l / h compared to about 0.2-0.3 g / l / h in ambient air. In some aspects, use of 100% oxygen increases protein yield, compared to ambient air. Protein yield may be increased more than 40%, for example from 40% to 60%, or 40%, 45%, 50%, 55%, or 60%. In some aspects, use of 100% oxygen increases protein yield to about 3.7 g / L.

[0074] A further aspect is methods of preparing a cell-free protein synthesis system capable of synthesizing reagents needed for protein expression and synthesis. A method may include contacting or combining a composition comprising potassium glutamate, guanine, ribose, the 20 standard amino acids (mixture or collectively), and an E. coli extract (e.g., B strain or K strain), with a DNA template and / or a RNA template encoding a protein of interest.

[0075] Another aspect of the disclosure is a cell-free protein synthesis method of producing recombinant protein containing disulfide bonds. The method comprises a) mixing an E. coll extract with iodoacetamide, glutathione, and disulfide bond isomerase, b) combining the mixture with the compositions disclosed herein, wherein the composition comprises a buffer at a pH of 7.5 (e.g. HEPES buffer or Bis-Tris buffer), and c) contacting the combined mixture of b) with a DNA template and / or a RNA template encoding a protein of interest. In some embodiments, the disulfide-bonded protein is produced at a significantly greater yield than a method using the buffer at a lower pH, for example pH 7.2. As the inventors found for producing recombinant complex protein containing disulfide bonds, glutathione use in the minimal reagent formula can drop the reaction pH, e.g. below pH 7.0. An unexpected solution was increasing the pH of the buffer included in the reagent mixture from pH 7.2 to pH 7.5 that prevented the pH drop when adding reagents (e.g. glutathione), and recovered sfGFP yield (see Fig. 4F-4J). In embodiments, pH of the buffer is maintained at pH 7.5 during protein synthesis. In the embodiments, the buffer (e.g. HEPES or Bis-Tris) buffer at a pH of 7.5 prevents a reaction pH drop and maintains pH and increased protein yield, compared to a reaction with a lower pH, such as pH 7.2. This new discover that the pH level and pH stability are important for complex protein synthesis and high protein synthesis activity was unexpected and greatly improved the cell-free protein synthesis compared to protein synthesis using non-phosphorylated energy substrates with pH range 7.2, or complex protein synthesis in which the pH is lower than pH 7.5. Carefully controlling pH provides significant improvement for oxidative folding of proteins using the novel cell-free protein synthesis compositions and systems.

[0076] In the disclosed cell-free protein synthesis methods, the temperature of the reaction may be in a range of 22° C to 30° C. In methods for producing disulfide-bonded protein, the temperature of the reaction is 22° C.

[0077] In some aspects, the recombinant protein produced in cell-free protein synthesis method may be a therapeutic protein, for example antibody or antibody fragment. In embodiments, the therapeutic protein is produced at a higher yield than a control, for example a control from previously developed cell-free protein synthesis systems and methods using non-phosphoiylated energy substrates.

[0078] Kits

[0079] Also provided are kits that comprise the disclosed compositions or formulations. One aspect is a kit comprising the disclosed compositions or formulations that may include potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and the 20 standard amino acids (collection or mixture) as described herein. The kits may also include one or more of an E. coli strain extract or lysate, for example an E. coli B strain extract and / or an E. coli K strain extract, a DNA template and / or a RNA template, and a buffer, as described herein. The kits may further comprise magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose, as described herein. In addition, a kit may include lodoacetamide, glutathione, and / or disulfide bond isomerase.

[0080] Prior attempts to solve the problem

[0081] Initial work in the field focused on supplementing endogenous cell-free reactions with new energy substrates and enzymes (e.g., creatine phosphate) or identifying key glycolytic intermediates to feed the system. In the growing push towards low-cost minimal systems, researchers have attempted to manipulate existing subsets of reagents in novel ways, either by sequential experimentation or through leveraging Design of Experiments or machine learning approaches. The current disclosure combines a unique subset of reagents in a novel formulation.

[0082] Exemplary Applications and Advantages

[0083] Exemplary applications and advantages of the novel formulations include, but are not limited to one or more of the following: on-demand production of proteins; on- demand production of medically relevant proteins without a cold chain; low-cost production of proteins in distributed manufacturing paradigm; low-cost expression of protein candidates for metabolic or protein engineering campaigns; reduction in the cost of cell-free protein synthesis reactions. Regarding cost reduction, this invention will reduce the cost of cell-free protein synthesis reagents by over two orders of magnitude, contributing to substantial cost reductions for a full cell-free protein synthesis platform. Decreasing cost lowers the barrier for industry or academic uptake of the platform, promoting widespread use of the cell-free platform for both research and manufacturing purposes. In addition, the methods and compositions disclosed herein are generalizable to different E. coli host strains, and require no phosphorylated energy substrates.

[0084] Definitions

[0085] The disclosed subject matter may be further described using definitions and terminology as follows. The definitions and terminology used throughout this disclosure are for the purpose of describing particular embodiments only, and are not intended to be limiting.

[0086] As used in this specification and the claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise. For example, the term “a gene” or “an oligosaccharide” should be interpreted to mean “one or more genes” and “one or more oligosaccharides,” respectively, unless the context clearly dictates otherwise. As used herein, the term “plurality” means “two or more.”

[0087] As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean up to plus or minus 10% of the particular term and “substantially” and “significantly” will mean more than plus or minus 10% of the particular term.

[0088] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of’ should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term “consisting essentially of’ should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.

[0089] The phrase “such as” should be interpreted as “for example, including.” Moreover the use of any and all exemplary language, including but not limited to “such as”, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0090] Furthermore, in those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, Balone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or "B" or “A and B.”

[0091] All language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can subsequently be broken down into ranges and subranges. A range includes each individual member. Thus, for example, a group having 1-3 members refers to groups having 1, 2, or 3 members. Similarly, a group having 6 members refers to groups having 1, 2, 3, 4, or 6 members, and so forth.

[0092] The modal verb “may” refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb “may” refers to an affirmative act regarding how to make or use and aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb “may” has the same meaning and connotation as the auxiliary verb “can.”ILLUSTRATIVE EMBODIMENTS

[0093] The following embodiments are illustrative and should not be interpreted as limiting the scope of the disclosed or claimed subject matter.

[0094] Embodiment 1 is a composition for cell-free protein synthesis, the composition comprising: a) potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and the 20 standard amino acids, and b) an E. coll extract, and c) optionally, a DNA template and / or a RNA template encoding a protein of interest.

[0095] Embodiment 2 is the composition of embodiment 1, wherein the amount or concentration of potassium glutamate is about 300 mM, adenosine monophosphate is about 1.2 mM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridinemonophosphate each is about 0.86 mM or 2. 15 mM, and the amino acids is about 3.25 mM to 5mM;

[0096] Embodiment 3 is the composition of embodiment 1 or embodiment 2 further comprising magnesium glutamate, glucose, potassium phosphate, nicotinamide, ribose, and a buffer.

[0097] Embodiment 4 is the composition of embodiment 3, wherein the buffer is any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5, optionally wherein the buffer is HEPES buffer or Bis-Tris buffer.

[0098] Embodiment 5 is the composition of embodiment 3 or embodiment 4, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, ribose is about 50mM, and the buffer is 75mM, optionally HEPES buffer at 75mM.

[0099] Embodiment 6 is the composition of any of the preceding embodiments, wherein the E. coli extract is an E. coli B strain extract or an E. coli K strain extract.

[0100] Embodiment 7 is the composition of embodiment 6, wherein the E. coli extract is an E. coli B strain lysate, optionally an A'. coli BL21 Star (DE3) lysate, optionally wherein the E. coli extract is an E. coli K strain lysate, preferably a K-12 strain extract.

[0101] Embodiment 8 is the composition of any of the preceding embodiments, wherein the E. coli extract is about 20% v / v to about 50% v / v.

[0102] Embodiment 9 is the composition of any one of embodiments 5-8, wherein the composition comprises 362 mM potassium glutamate, 3 mM adenosine monophosphate, 2.15 mM cytidine monophosphate, 2.15 mM guanosine monophosphate, 2.15 mM uridine monophosphate, 5 mM amino acids, 10 mM glucose, 50 mM D-ribose, 8 mM magnesium glutamate, 15 mM potassium phosphate, and 7 5 mM HEPES.

[0103] Embodiment 10 is the composition of embodiment 9, wherein the amount or concentration of one or more of the composition components may be varied in the composition in a range of from about 30% to about 70% of the given amount or concentration.

[0104] Embodiment 11 is a cell-free protein synthesis system comprising: a) the composition of any one of embodiments 1-10; and (b) a DNA template and / or a RNA template encoding a protein of interest.

[0105] Embodiment 12 is the cell-free protein synthesis system of embodiment 11, wherein the composition comprises an amount or concentration of potassium glutamate at about 300 mM, adenosine monophosphate at about 1.2 mM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each at about 0.86 mM or 2. 15 mM, and the amino acids at about 3.25 mM to 5mM

[0106] Embodiment 13 is the cell-free protein synthesis system of embodiment 11 or embodiment 12, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, ribose is about 50mM, and a buffer at about 75mM.

[0107] Embodiment 14 is the cell-free protein synthesis system of any of embodiments 11-13, wherein the buffer is any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5, optionally wherein the buffer is HEPES buffer or Bis-Tns buffer

[0108] Embodiment 15 is the cell-free protein synthesis system of any of embodiments 11-14, wherein the E. coli extract is an E. coli B strain extract or E. coli K strain extract.

[0109] Embodiment 16 is the cell-free protein synthesis system of embodiment 15, wherein the E. coli extract is an E. coli B strain lysate, preferably an A. coli BL21 Star (DE3) lysate, optionally wherein the E. coli extract is an E. coli K strain lysate, preferably a K-12 strain extract.

[0110] Embodiment 17 is the cell-free protein synthesis system of any of embodiments 11-16, wherein the E. coli extract is about 20% v / v to about 50% v / v.

[0111] Embodiment 18 is the cell-free protein synthesis system of any of embodiments 11-17, wherein the system further comprises iodoacetamide, glutathione, and disulfide bond isomerase, optionally wherein the iodoacetamide (IAM) is at an amount or concentration of 25 pM or 500 pM, the glutathione may be oxidized glutathione (GSSG) or reduced glutathione (GSH), and the amount of oxidized glutathione is about 4 mM andreduced glutathione (GSH) is about 1 rnM, and the disulfide bond isomerase is about 5 pM, optionally wherein the disulfide bond isomerase is purified / ’, damselae DsbC.

[0112] Embodiment 19 is the cell-free protein synthesis system of embodiment 18, wherein the buffer is pH 7.5.

[0113] Embodiment 20 is a method for cell-free protein synthesis, the method comprising: contacting the composition of any one of embodiments 1-10 in a buffer with a DNA and / or a RNA template encoding a protein of interest.

[0114] Embodiment 21 is the method of embodiment 20, wherein the amount or concentration of potassium glutamate is about 300 mM, adenosine monophosphate is about 1.2 rnM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each is about 0.86 mM or 2.15 mM, the amino acids is about 3.25 mM to 5mM, and the buffer is at about 75mM, optionally wherein the buffer is HEPES or Bis-Tris buffer.

[0115] Embodiment 22 is the method of embodiment 20 or embodiment 21, further comprising magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose, wherein the amount or concentration of the magnesium glutamate is about 8mM, the glucose is about 10 mM, the potassium phosphate is about 15mM, the nicotinamide is about 4mM, and the ribose is about 50mM.

[0116] Embodiment 23 is the method of any one of embodiments 20-22, wherein the E. coli extract is an E. coli B strain extract, optionally an E. coli BL21 Star (DE3) lysate.

[0117] Embodiment 24 is the method of any one of embodiments 20-23, wherein the E. coli extract is about 20% v / v to about 50% v / v.

[0118] Embodiment 25 is the method of any one of embodiments 20-24, wherein the method is performed in 100% oxygen.

[0119] Embodiment 26 is the method of any one of embodiments 20-25, wherein the buffer is any buffer with a pKa of between 6 and 8, preferably 6.5 and 7.5, and wherein the buffer is pH 7.2 to 7.5, optionally wherein the buffer is HEPES or Bis-Tris.

[0120] Embodiment 27 is the method of any one of embodiments 20-26, wherein protein is synthesized at a higher yield than a control cell-free protein synthesis method.

[0121] Embodiment 28 is the method of any one of embodiments 20-27, further comprising one or more of iodoacetamide, glutathione, and disulfide bond isomerase, optionally wherein the iodoacetamide (IAM) is at an amount or concentration of 25 pM or 500 pM, the glutathione may be oxidized glutathione (GSSG) or reduced glutathione (GSH), and the amount of oxidized glutathione is about 4 mM and reduced glutathione (GSH) is about 1 mM, and the disulfide bond isomerase is about 5 pM, optionally wherein the disulfide bond isomerase is purified / ’, damselae DsbC..

[0122] Embodiment 29 is the method of embodiment 28, wherein disulfide-bonded protein is synthesized.

[0123] Embodiment 30 is the method of embodiment 29, wherein disulfide-bonded protein is synthesized at a higher yield than a control cell-free protein synthesis method.

[0124] Embodiment 31 is the method of embodiment 29 or embodiment 30, wherein disulfide-bonded protein is synthesized at a lower cost than a control cell-free protein synthesis method.

[0125] Embodiment 32 is the methods of any one of embodiments 29-31, wherein the disulfide-bonded protein is a therapeutic protein.

[0126]

[0127] Embodiment 33 is the method of embodiment 32, wherein the therapeutic protein is an antibody or antibody fragment.

[0128]

[0129] Embodiment 34 is a method for cell-free protein synthesis, wherein a cell-free protein synthesis system can synthesize its own reagents from monomer building blocks.

[0130] Embodiment 35 is the method of embodiment 34, wherein the cell-free protein synthesis system can synthesize nucleoside monophosphates (NMPs) from nucleotide bases and sugars.

[0131] Embodiment 36 is the method of embodiment 34 or embodiment 35, the cell- free protein synthesis system comprises: a) a composition comprising potassium glutamate,guanine or guanosine, ribose, and a mixture of the 20 standard ammo acids, b) an E. coli extract, and c) a DNA template and / or a RNA template encoding a protein of interest.

[0132] Embodiment 37 is the method of embodiment 36, wherein the amount or concentration of potassium glutamate is about 300 mM, guanine or guanosine is about 1.2 mM or about 3 mM, ribose is about 50mM, and the amino acids is about 3.25 mM to 5mM.

[0133] Embodiment 38 is the method of any one of embodiments 34 to 37, wherein the cell-free protein synthesis system is lower cost when synthesizing its own nucleoside monophosphates from monomer building blocks as compared to adding the nucleoside monophosphates directly.

[0134] Embodiment 39 is the method of any one of embodiments 36 to 38, wherein the composition further comprises magnesium glutamate, glucose, potassium phosphate, nicotinamide, and a buffer, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, and the buffer is HEPES or Bis-Tris buffer at about 75mM.

[0135] Embodiment 40 is the method of any one of embodiments 34-39, wherein the E. coli extract is an E. coli B strain extract or an E. coll K strain extract.

[0136] Embodiment 41 is the method of embodiment 40, wherein the E. coli extract is an the E. coli extract is an E. coli B strain lysate, preferably an E. coli BL21 Star (DE3) lysate, optionally wherein the E. coli extract is an E. coli K strain lysate, preferably a K-12 strain extract.

[0137] Embodiment 42 is the method of any one of embodiments 34-41, wherein the E. coll extract is about 20% v / v to about 50% v / v.EXAMPLES

[0138] The following Examples are illustrative and should not be interpreted to limit the scope of the disclosed or claimed subject matter.

[0139] Widespread utilization of cell-free gene expression and protein synthesis systems is hampered by high costs and low yields. Many cell-free systems rely on expensive phosphory lated energy substrates, such as phosphoenolpyruvate (PEP), to regenerate the ATP that fuels protein biosynthesis45 47This results in reagent costs upwards of $4,000 / L andcontributes to over 75% of all material costs associated with cell-free protein synthesis (Fig. 1A). Assuming a 1 g / L protein yield, these costs are an order of magnitude higher than the $10s-$100s / g cost of goods associated with cellular protein production48,49. Manufacturer availability and variability of complex reagents like purified tRNA further complicate implementation. To address high costs, numerous groups have previously developed different reagent formulations that leverage non-phosphorylated energy substrates for reagent costs of <$500 / L5,36,37’45, 50,51(Fig. 1A). However, these reagent systems have not been widely adopted due to lower protein expression yields and increased system sensitivity. Here, the inventors developed new, low-cost, high-yielding minimal cell-free reagent formulations capable of producing significant protein product for a greatly decreased reagent cost compared to traditional formulations. Costs and estimates associated with cell-free protein synthesis reactions are based on raw materials purchased at the laboratory scale as detailed in Table 1 list of reagents used in this work.

[0140] TABLE 1 Reagents used in this workApril 2024. The Roche tRNA price was recorded prior to the vendor stopping product production. No E. coli tRNA is currently offered by any vendor as of 4 April 2024.^Unless otherwise noted, all reagents were dissolved in MilliQ water, flash frozen in liquid nitrogen, and stored at -80°C. All pH adjustments were made with either potassium hydroxide (Sigma P5958) or acetic acid (Sigma A6283).**Reagents with no listed values in this column are typically added on a mass basis, not a molar basis.

[0141] This work aimed to develop a minimal reagent formulation that enables both low-cost and high-yielding cell-free protein synthesis. A key feature of the approach was the focus on reducing the number of components used while simultaneously designing for yield and cost metrics. The goal was to reach less than $100 reagents per gram of protein. Also, multi-dimensional optimizations was used, rather than just changing one component at a time45, with few exceptions52. To achieve this goal, design-driven optimization was carried out to screen 58 cell-free reagent components and their concentrations in 1,231 different reaction combinations. The most productive formulation was able to synthesize 2.4 ± 0.3 g / L superfolder green fluorescent protein (sfGFP) at a reagent cost of S133 / L, or $55 / g. improved oxygen flux was demonstrated to further increase system yields to 3.7 ± 0.2 g / L sfGFP ($36 / g). This CFPS platform was applied to the production of fifteen recombinant protein therapeutics, including full-length monoclonal antibodies and other disulfide bonded products. The optimized formulation improves reagent cost per gram product by an average of 95% in comparison to a traditional phosphorylated energy substrate formulation.

[0142] Example 1. Exploration of Cell-free Reagent Composition Landscape

[0143] Traditional cell-free protein expression reactions depend on small molecule reagent components that include energy substrates (e.g., PEP); DNA, RNA, and protein building blocks (e.g., NTPs, amino acids); cofactors and coenzymes (e.g., CoA, NAD); salts (e.g., magnesium, polyamines), and other chemical components (e.g., buffers). Active metabolic pathways in the crude cell lysate can use these reagents to regenerate ATP and produce other needed metabolites to support protein biosynthesis. Significant work has been applied to the development of unique cell-free reagent formulations,53but in general such studies have focused on linear stepwise optimizations45. It was considered that a combinatorial screen based on Design of Experiments could identify unexpected formulations that would lead to lower costs and increased yields. Moreover, it was also considered that a reduced set of components could lead to greater reproducibility.

[0144] Prior to implementing the disclosed design-driven approach, eight previously developed reagent systems for E. coli crude lysate platforms5-365745 4750were tested, focusing on low-cost variants that leverage non-phosphorylated energy substrates like glucose or glutamate. Reagent formulations are provided in Table 2.

[0145] TABLE 2 Cell-free reagent mixtures used in this work. All numbers indicate concentration in mM, except for folinic acid, tRNA, and maltodextrin, which are given in mg / mL.*1 mM tyrosine.**1.25 mM leucine.

[0146] In the E. coli BL21 Star (DE3) lysate, the PANOx-SP formula produced the highest sfGFP yield and was used as a standard for the remainder of the work (Fig. IB). Although all non-phosphorylated energy' substrate systems produced less total protein than the phosphorylated substrate formulas, the reagent cost per gram of protein ranged from 22- 92% less than that of the PANOx-SP system (Fig. 1C).

[0147] Building on these established reagent formulas, a reagent optimization campaign was conducted to improve total protein yield from low-cost cell-free systems (i.e., $reagent / g protein) with a minimal set of reagents (Fig. 2A). A panel of 11 reagent components was chosen. These components included magnesium glutamate, potassium glutamate, the 20 standard amino acids (counted as a single component), phosphate, oxalate, spermidine, and oxidized glutathione. Design of Experiments-based approaches were used to screen these components (Fig. 2B). This initial analysis of 147 reactions did not establish any clear trends in beneficial reagent concentrations or combinations. However, an active cell- free reagent formula was surprisingly identified that comprised only potassium glutamate, nucleotide monophosphates, and amino acids that produced 0.5 ± 0.1 g / L sfGFP. (Figs. 2C-2E). This glutamate-based minimal system is the smallest set of reagent components reported for any cell-free protein synthesis platform.

[0148] With the glutamate-based minimal reagent mixture as a base, addition of other reagents canonically used in CFPS to improve total protein yields were next explored (Figs. 2F-2K). The search was constrained to components costing less than $50 / L / mM to balance the need for low-cost formulations with increased product yields. Many of the more expensive reagents, including tRNA, coenzy me A, and NAD+, have previously been shown to be unnecessary for cell-free protein expression5,37and so were not included here.

[0149] Because nucleotide monophosphates are the most expensive component in the glutamate-based minimal formulation, the first step was to try to replace them with their corresponding nucleosides and nucleobases (Fig. 2L). Replacing GMP with a combination of guanine and ribose was able to fully recover system activity at 38% of the initial GMP cost, but the same expression recovery was not obtained for any other NMPs. Insoluble precipitates were also observed when using many of these alternative substrates. Given these results, NMPs were kept and other components (e.g., buffers, glucose, ribose) tested.

[0150] Simultaneous addition of multiple reagent components were then examined with known synergistic benefits (e.g., glucose and phosphate50) to the base glutamate minimal system (Fig. 2M). A combination of definitive screening designs and targeted reagent manipulations produced 461 formulations to explore a design space of 221(i.e., 2,097,152) reagent combinations, and an additional set of 524 directed re-formulations further optimized the best performing candidates. This multi-dimensional optimization allowed us to identify beneficial reagent combinations for reagents that alone were deleterious or ineffective.

[0151] Taken together, iterative optimization rounds increased protein yield to over 2 g / L sfGFP (Fig. 2A) and drove down reagent costs 15-fold (Figs. 2N-2O). The best performing minimal reagent formulation produces 2.4 ± 0.3 g / L sfGFP within 20 h (Fig. 2P). This is an 87% increase over the previously best-performing PANOx-SP system, and at $ 133 / L, provides a 97% decrease in total reagent cost. The optimized minimal reagent system costs $55 / g sfGFP, 99% less than the PANOx-SP system and 84% less than the lowest cost system shown in Fig. 1A.

[0152] Example 2. Validation of an optimized minimal reagent formulation

[0153] Consistency and versatility of cell-free systems are crucial for widespread utilization. The disclosed optimized minimal system produces consistent protein yields across three independent BL21 Star (DE3) crude lysate batches (Fig. 2Q). The reagent formulation is also functional for two other B-strain E. coli crude cell lysates, including the commonly used SHuffle T7 strain (Figs. 2R-2T). Using an engineered K-strain E. coli lysate was not successful, suggesting that the formulation requires metabolic or proteomic conditions specific to B-strain cells. Expression levels are directly dependent on lysate volume added to the reactions; increasing from 30% v / v lysate to 46% v / v lysate improves sfGFP production by 49%, while decreasing to 10% v / v lysate reduces protein expression by 97% (Figs. 2R- 2T).

[0154] Cross-laboratory reproducibility can be a challenge for cell-free protein expression54. The optimized minimal reagent formulation was independently tested across three academic institutions, with a different researcher preparing reagents and setting up reactions at each site. Protein expression levels varied by ~9% between sites (Fig. 2U), a level of variation closer to that of a single operator than previously observed cross-laboratory variation of 40% for cell-free protein synthesis55. The minimal reagent formula also is robust to the addition of common salts, osmolytes, and protein buffers (Figs. 2V-2BB), enabling use of the formulation across a variety of workflows.

[0155] Example 3. Characterization of an optimized minimal reagent formulation

[0156] To further understand the behavior of the new optimized minimal reagent formulation, 15 pL CFPS reactions were carried out at 30°C for 20 h using the PANOx-SP system and the new optimized minimal reagent formulation with and without ribose. During the time course, samples were taken to characterize sfGFP, phosphate, ATP, pH, amino acids, and metabolites.

[0157] Protein synthesis yields with the optimized minimal system were almost 2-fold higher than the PANOx-SP system and showed a 2 orders of magnitude improvement in dollar per gram protein (Fig. 3A). As expected,56phosphate concentrations rapidly increased in the PANOx-SP due to the phosphorylated energy substrate PEP (Fig. 3B). Phosphate in the optimized minimal reagent formulation decreased for NTP regeneration from the initially added 15mM and then returned to starting concentration over the reaction lifetime (Fig. 3B). The minimal formulation generates comparable levels of ATP within 30 minutes as thePANOx-SP system, despite starting with no exogenous ATP, and is able to sustain ATP levels at -250 pM for the duration of the reaction (Fig. 3C). This is well above the ATP affinity threshold measured for in vitro protein synthesis57. Although all reactions start at a similar pH, the optimized minimal formulation becomes more acidic in the first four hours while the other systems shift towards higher pH levels (Fig. 3D).

[0158] In terms of small molecules, acetate accumulation is also more pronounced for reactions using the minimal reagent mixtures, while concentrations of lactate and tricarboxylic acid cycle intermediates are reduced (Fig. 3E). Full metabolite traces are provided in Fig. 3F. Metabolite concentrations were consistent when expressing different protein products (Fig. 3G) and are in good agreement with previous studies50,58,59.

[0159] Throughout the reagent optimization campaign and characterization studies, sensitivity to reaction volume and geometry was observed (Fig. 3H-3J). This sensitivity suggested oxygen limitation due to changes in the surface area to volume ratio of the reaction. A membrane-based bioreactor was leveraged with a tunable oxygen feed to further examine this behavior (Fig. 3K). When provided with a 20% O2 feed to mimic ambient air, the bioreactor-housed cell-free protein synthesis reaction produced less than 2 g / L sfGFP (Fig. 3L). Shifting to a 100% O2 feed improved sfGFP production by 45%, achieving 3.7 ± 0.2 g / L at the 4 mL scale and increasing dissolved oxygen (dCh) content in the reaction (Fig. 3M). This is a 59% increase in protein yield compared to the 15 pL reactions leveraged during reagent formula optimization. Protein synthesis is also significantly more rapid, producing 0.91 g L'1h'1for the first four hours in the bioreactor. In contrast, the 20% O2 feed produced roughly 0.29 g L h'1and the 15 pL reaction produced 0.19 g L1h’1. Both oxygen feed rates experienced a sharp drop in dCh in the first 30 min., and measurable sfGFP production began at similar times in conjunction with an increase in dCh levels (Fig. 3N-3O).

[0160] Example 4. Re-optimization of minimal reagent formulation for disulfide bonded proteins

[0161] Having established a highly productive, low-cost minimal reagent formulation, expression of complex proteins containing disulfide bonds was investigated. Lysis of E. coli cells disrupts the periplasmic space used to fold disulfide-bonded proteins, and the resultant extract used in CFPS cannot properly form disulfide bonds60. To mitigate this problem, crude cell lysate is pretreated with iodoacetamide to deactivate reductases, glutathione is added to create an oxidizing reaction environment, and disulfide bond isomerase (e.g., DsbC) issupplemented to aid in disulfide bond shuffling39’60’61. Unfortunately, addition of iodoacetamide and glutathione to the optimized minimal reagent formulation reduced sfGFP production by 97%, with iodoacetamide alone reducing yield by 75% (Fig. 3Q). This phenomenon has been observed previously62and was previously attributed to iodoacetamide indiscriminately interacting with any enzyme that contains a free thiol group.

[0162] Reductases can be selectively removed from the cell lysate to maintain an oxidizing reaction environment with minimal or no iodoacetamide62. An E. coli BL21 Star (DE3) Agor strain was therefore prepared removing glutathione reductase to help stabilize the oxidizing lysate environment. This modification allowed treatment of the crude cell lysate with 20-fold less iodoacetamide and recovery of protein expression levels (Fig. 4A). However, including glutathione in the reagent mixture continued to decrease yields by up to 62% (Fig. 4A). Decreased protein expression was observed regardless of the concentration or ratio of oxidized and reduced glutathione (Figs. 4A-4D). Despite the significant impact on protein expression, inorganic phosphate levels were consistent, and ATP concentration was higher when glutathione was included in the optimized minimal reagent formulation (Fig. 4E). These results suggested that glutathione was not negatively impacting cell-free energy generation.

[0163] Glutathione addition was then determined to be correlated with a decrease in reaction pH for both the minimal reagent formulation and the PANOx-SP system (Fig. 4F). Reactions leveraging the PANOx-SP reagent formula stay within or close to the standard E. coli cytoplasmic pH range of pH 7.4-7.863, even with the drop in pH due to glutathione addition. In contrast, glutathione use in the optimized minimal reagent formula rapidly drops the reaction pH below pH 7.0. Increasing the pH of the HEPES buffer included in the reagent mixture from pH 7.2 to pH 7.5 prevented the original pH drop and recovered sfGFP yield (Figs. 4F-4G). Similar results were obtained by using Bis-Tris buffer at either pH 7.2 or pH 7 5 (Figs. 4H-4J)

[0164] As a model, this re-optimized oxidizing minimal reagent formula was applied to the production of the trastuzumab Fc domain and the full-length trastuzumab monoclonal antibody, which is used to treat HER2 -positive breast and stomach cancers (Figs. 4K-4P). The minimal reagent system successfully facilitated disulfide-bond formation and improved the fraction of assembled Fc domains and full-length antibodies by 44% and 90% compared to an oxidizing PANOx-SP reaction, respectively. Lower reaction temperatures64’65and preliminary IgGl light chain expression38were then examined to further improve full-lengthtrastuzumab folding. Lowering the trastuzumab expression reaction temperature from 30°C to 22°C increases the full-length antibody mass fraction (Figs. 4Q-4R); improvement of full- length antibody yield is not uniformly observed due to lower overall expression yields (Fig. 4S, Figs. 4Q-4R). Adding heavy chain pDNA to the reaction after allowing the light chain to express for 3 h produced 150 pg / rnL full-length trastuzumab, a 295% improvement over synchronous addition of the heavy and light chain plasmids at 22°C (Fig. 4S).

[0165] Example 5. Diverse therapeutic protein production in optimized minimal formulation

[0166] To explore the versatility of the optimized minimal reagent formula, fifteen medically relevant recombinant proteins were expressed and compared product yields to the most productive (PANOx-SP) and lowest $ / g sfGFP cost (Zawada et al. (2011)) reagent mixtures (Fig. 5A). The selected protein library spans 16-147 kDa, 0-16 disulfide bonds, and a variety of clinical applications. Six have been previously expressed in an E. coli cell-free protein expression system4’6,25’37’44’61. All protein yields were determined via14C-leucine incorporation in an oxidizing cell-free reaction environment with added bacterial DsbC and verified with autoradiography (Figs. 5B-5M). Expression of all fifteen therapeutic proteins was observed and >100 pg / mL soluble full-length protein was obtained for twelve biologies in at least one system. The minimal reagent formulation yielded the same or more soluble protein than the PANOx-SP system for 13 / 15 products, corresponding to an average 95% decrease in $ / g protein (Fig. 5N). Compared to the Zawada et al. formula, the new disclosed system here produced the same amount or more protein in all cases and reduced $ / g protein costs for 11 / 15 products. The non-phosphorylated energy systems also reduced insoluble aggregation of antibody constructs (Figs. 5O-5P).

[0167] Improvements in protein expression levels were not uniformly observed across all tested biologies (Fig. 5A). For example, sfGFP and caplacizumab were expressed significantly better using the optimized minimal formulation, while streptokinase and myoglobin showed reduced expression compared to the PANOx-SP system. Similarly, antibody heavy chain and light chain expression ratios varied depending on the reagent formulation used (Figs. 5O-5P)

[0168] The functionality of the expressed biologies is important to their therapeutic relevance. Four of the cell-free produced protein therapeutics were tested to determine whether they retained their function. vtPA is an enzymatically active truncated form of tissueplasminogen activator, which cleaves an arginine-valine peptide bond in plasminogen to activate the protease and dissolve blood clots61,66. The cleavage of fluorescent molecule 7- amino-4-methylcoumarin from a short Ile-Pro-Arg peptide sequence was used as a proxy for this activity (data not shown). vtPA expressed in a cell-free reaction using the disclosed optimized minimal formulation rapidly cleaves AMC from arginine, displaying the desired enzymatic activity' (Fig. 5Q)

[0169] Antimicrobial activity of colicin M, which inhibits E. coli cell wall synthesis67, was assessed in a cell killing assay. Colicin M expressed in the disclosed cell-free reaction formulation was incubated with CLM24 indicator cells. The presence of colicin M decreased E. coli colony formation by a factor of 105compared to a no-DNA cell-free reaction matrix (Fig. 5R)

[0170] Binding ability was tested for TRI2-2 and trastuzumab to examine behavior for both a single-chain protein and a multi-chain assembly requiring disulfide bonds. TRI2-2 is a computationally designed miniprotein inhibitor that binds to the SARS-CoV-2 spike protein25. This binding was assessed via AlphaLISA, a protein-protein interaction assay that produces luminescence based on the proximity of donor and acceptor beads decorated with the proteins of interest. Cell-free reactions containing expressed TRI2-2 produced a luminescent signal 2.4 times that of a no DNA control, indicating successful binding between TRI2-2 and the SARS-CoV-2 spike protein (Figs. 5S-5U). Trastuzumab binding was determined with an anti-idiotypic sandwich ELISA assay, in which the trastuzumab antibody bound to a capture antibody designed to interact with the trastuzumab antigen binding site. Cell-free expressed trastuzumab effectively bound to the capture antibody in all cases, and the minimal system produced ~2-fold more active trastuzumab than the other two cell-free reagent formulations tested (Fig. 5V).

[0171] Discussion

[0172] Cost and productivity have traditionally been barriers to widespread use CFPS systems. Here, 1,231 reaction formulations were explored to establish a low-cost, high- yielding cell-free reagent method capable of producing > 2 g / L protein product for just $ 133 / L in reagents. This is the highest reported protein yield for a reagent mixture leveraging non-phosphorylated energy substrates, corresponding to a decrease of over $4,000 / L compared to traditional cell-free reagent systems (-98% of the original cost per gram protein product). A notable discovery was the importance of dissolved oxygen concentration onsystem performance. Indeed, high DO2 levels were used to increase yields to > 3.7 g / L in a bioreactor that approached the highest yielding cell-free system (4 g / L) in literature, but for a fraction of the cost46.

[0173] The optimized minimal reagent system has several key features. First, it is low-cost and high yielding, as described above. Second, it is robust, working in extracts from multiple E. coli strains, and reproducible, working across multiple laboratories. Third, the platform can produce proteins with disulfide bonds when pH is controlled. These features set the stage for using the platform for producing proteins in protein design, enzyme engineering, and therapeutic production.

[0174] The optimized minimal reagent formulation was showcased by synthesizing fifteen therapeutic proteins, including disulfide-bonded products. All products were produced for -95% less reagent cost ($ / g product) compared to the traditional PANOx-SP system, and in 13 / 15 cases the same or more total protein yield was obtained. This cell-free platform could be integrated into point-of-care or distributed biologies manufacturing paradigms to complement centralized facilities that rely on in vivo protein expression for significantly less than current cell-free systems. The modular and scalable nature of cell-free systems can enable rapid production of a diverse product library, enhancing the flexibility and reduced transportation and storage burdens that characterize distributed manufacturing68 71. Recent advances in purification strategies34-72 74and DNA template preparation65,75would further improve system functionality.

[0175] The optimization campaign described in this disclosure reduced the cost of reagents from 75% of total material costs to only 8%. Further reductions in reagent cost and scale could be realized by building cell-free systems capable of synthesizing their own reagents from a reduced number of low-cost substrates. NMPs were successfully leveraged to produce the NTPs necessary for transcription and translation, produce ATP from simple sugars and salts, and demonstrate in the preliminary glutamate-based minimal system that a combination of guanine and ribose can replace GMP without a decrease in system performance. The metabolic pathways necessary to build and sustain full reagent profiles from glucose appear active. Combining these results with advances in cell-free production and sustenance of translation machinery76,77, DNA templates78, and amino acids79may provide a path to a truly minimal cell-free platform capable of building everything it needs to function.

[0176] In sum, the low-cost, high-yielding cell-free platform developed in this work (~$50 / g protein) offers a robust and versatile approach to producing recombinant proteins. It comprises the smallest number of reagent components for CFPS ever demonstrated. By doubling yields of conventional CFPS technologies, the optimized minimal reagent system is expected to be adopted across numerous application spaces, from supporting protein design efforts to cell-free biomanufacturing at industrial scales for biologies production.

[0177] Methods

[0178] Cell Extract Preparation

[0179] Crude extracts were made from multiple Escherichia coli strains, listed inTable 3

[0180] TABLE 3 E. coli strains used in this work.

[0181] Cells were grown overnight at 37°C in LB media (10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl) to prepare a starter culture. The following day, 1 L cultures of sterilized 2xYTPG media (16 g / L tryptone, 10 g / L yeast extract, 5 g / L NaCl, 7 g / L K2HPO4, 3 g / LKH2PO4, and 18 g / L glucose adjusted to a pH of 7.2 with KOH) were inoculated with the overnight culture to an initial ODeoo of 0.06-0.08 in Tunair shake flasks. Cells were grown at 37°C and 250 rpm to an ODeoo of 0.6 and inoculated with 0.5 mM isopropyl-P-D- thiogalactopyranoside (IPTG) to induce T7 RNA polymerase expression. At an ODeoo of 3.0, cells were harvested by centrifugation at 5,000g for 10 minutes at 4°C. The resulting cell pellets were then resuspended with S30 buffer (10 mM Tris acetate pH 8.2, 14 mM magnesium acetate, and 60 mM potassium acetate) and pelleted by centrifugation at 10,000g for 2 minutes. Cells were washed a total of three times. After the final centrifugation step, the cell pellet mass was recorded and the cells were flash frozen in liquid nitrogen and stored at - 80°C.

[0182] Frozen cells were thawed on ice for 60 minutes and resuspended in 1 mL / g S30 buffer. Cells were then lysed with a single pass at 20,000-25,000 psi through either an Avestin EmusliFlex B15 or C3 homogenizer. The resulting lysate was centrifuged at 12,000g for 10 minutes and the supernatant collected. This step was performed twice. The final clarified lysate was aliquoted, flash frozen in liquid nitrogen, and stored at -80°C.

[0183] Lysate Source Strain Engineering

[0184] The BL21 Star (DE3) Ago / ' strain was constructed using the pcrEG and pEcCpflH plasmids as previously described80. Initially, pEcCpflH was introduced into BL21 Star (DE3) by chemical transformation. The strain containing the editing plasmid was utilized to prepare electro-competent cells and was induced with 50 mM arabinose at ODeoo 0. 1 and harvested at ODeoo 0.6. Cells were washed with two washes of water and two washes of 10% w / v glycerol.

[0185] Concurrently, golden gate assembly was used to construct the cRNA expression plasmid, using the CRISPOR81designed guide ATAGGAAGTATGAATACGGTCGA (SEQ ID NO: 1), targeting the gor gene. Homology directed repair (HDR) templates were designed containing 45 bp up- and downstream of the gor gene and ordered with phosphorothioate modified ends. Both the pcrEG-cRNA plasmid and the HDR templates were transformed into the prepared BL21 Star (DE3) strain containing the editing plasmid and recovered for 2-3 h at 37°C before selection on LB agar containing 50 pg mL'1kanamycin and 100 pg mL'1spectinomycin.

[0186] Once colonies were confirmed for whole gene removal by colony PCR using q% hot start polymerase (NEB) and the primers gor-up-F 5 ’-ATTGAACTGGCGGTACTGCC-3’ (SEQ ID NO: 2) and gor-down-R 5’- GTCAGAAGTACGGGTGGTGC-3’ (SEQ ID NO: 3), the pcrEG-cRNA plasmid was removed by growing in 10 mM rhamnose overnight and streaked onto LB (no antibiotic) plates. Subsequently, the pEcCpflH plasmid was removed by growing the strains overnight in LB containing 5 g L'1glucose and streaked onto LB agar containing 5 g L'1glucose and 10 g L1sucrose.

[0187] Bacterial genome sequencing was performed by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation.

[0188] DNA Template Preparation

[0189] All protein sequences used in this disclosure are listed in Table 4. Signal sequences and propeptides were removed when present to leave only the final, activated sequence. Unless otherwise noted, gene sequences were codon optimized for expression in E. coll and synthesized into a pJLl backbone at the Ndel / Sall restriction sites by Twist Biosciences. Plasmids were purified for use in cell-free expression reactions with the Qiagen HiSpeed Plasmid Midi Kit and further cleaned with an ethanol precipitation.

[0190] TABLE 4 Protein sequences used in this work. All sequences were codon optimized for expression in E. coli and cloned into the pJLl backbone (Addgene 69496)

[0191] Protein Purification

[0192] A plasmid containing P. damselae DsbC with a 5’ CAT-Strep-linker (CSL) tag was transformed into NEB BL21(DE3) Competent E. coll cells and plated on LB agar containing 50 pg / mL kanamycin. The following day, a 50 mL culture of Overnight Express™ Instant TB Media was inoculated with a single colony of transformed BL21(DE3) and grown overnight at 37°C and 250 rpm. Cells were pelleted at 4,000g and 4°C for 20 min. and resuspended in 2 mL of BugBuster® Master Mix. After incubation at room temperature for 15 min., the lysed cells were centrifuged at 10,000g for 10 min. to remove insoluble components. Meanwhile, 1 mL of Strep-Tactin®XT 4Flow® high-capacity resin was loaded onto a polypropylene column (Bio-Rad) and equilibrated with 2 column volumes of Buffer W (IBA). The lysed cell supernatant was added to the column and washed five times with 1 column volume of Buffer W. Protein was eluted with Buffer BXT (IBA). The most concentrated elution fractions were pooled and dialyzed into a buffer containing 100 mM Tris-Cl and 150 mM NaCl at pH 8. Protein yield and purity were assessed with a Bradford assay and SDS-PAGE gel. The purified protein was flash frozen in liquid nitrogen and stored at -80°C.

[0193] Cell-free Protein Synthesis Reactions

[0194] 10-15 LIL cell-free reactions were performed at 30°C in 2 mL microcentrifuge tubes (Axygen) for 20 hours. All reactions contained 13.3 ng / pL plasmid and 30% v / v crude cell extract, unless otherwise noted. Reagent mixture compositions are detailed in Table 2. Reagents were thawed on ice and combined at room temperature to prevent precipitation of NMPs, which were always added to the reagent mixture last. To create an oxidizing reaction environment, cell extracts were treated with 500 pM or 25 pM iodoacetamide (I AM) at room temperature for 30 min. before use. An additional 4 mM oxidized glutathione (GSSG) and 1 mM reduced glutathione (GSH) were added to the reaction mixture. In some noted cases, 5 pM purified P. damselae DsbC was also added to the reaction mixture.

[0195] Bioreactor Tests

[0196] Custom, lab-made bioreactors (Sundberg, et al. In preparation were rinsed with 70% ethanol, followed by deionized water, air-dried, assembled, and autoclaved with a 45-minute hold at 121°C. After autoclaving, the reactors were cooled to 4°C for approximately 20 min. and then warmed to 30°C in the reactor incubator for approximately 30 min. The components of the cell-free reagent mixture were thawed on ice, combined within a biosafety cabinet, and thoroughly vortexed between the addition of individualreagents. The reagent mixture and crude cell lysate were measured and aliquoted from a master mix container into 1.5 mL tubes for each of the three reactors and kept on ice until use. Dissolved oxygen and sfGFP fluorescence sensors were calibrated, and the reactors were flushed with the specified gas for approximately 10 min. prior to initiating the reactions. Cell- free reactions were initiated by drawing 2,800 pL of the reagent mix into a 5 mL syringe equipped with a blunt-tip 18-gauge needle and subsequently introduced into the reactor via a feed line. The impeller and sensors were activated as 1,200 pL of crude cell lysate was introduced into the reactor using a 3 mL syringe. The reactions were conducted for 20 h with a humidified gas flow of 400 cubic centimeters per minute into the reactor jacket, maintaining a constant impeller speed of 500 rpm and a temperature of 30°C. After 20 h, the final cell-free reaction was harvested through the feed line, and the final reaction volume and sfGFP concentrations were assessed using a fluorescein standard.

[0197] Protein Expression Quantification

[0198] To assess the amount of sfGFP production, 2 pL of each CFPS reaction were diluted with 48 pL of nanopure water in a black Coming Costar 96-well flat-bottom plate. Fluorescence was read with 485 nm excitation and 528 nm emission, with values converted to sfGFP concentration via a standard curve derived from sfGFP measured using14C-leucine incorporation.

[0199] All other proteins were quantified using radioactivity, based on previously developed methods82. Briefly, 10 pM14C-leucine was included in standard CFPS reactions. After incubation, 5 pL of the total CFPS reaction was treated with 100 pL 0.1 N KOH and incubated at 37°C for 20 minutes. The remaining CFPS reaction was centrifuged at 16,100g for 10 minutes, and 5 pL of the soluble supernatant was treated with KOH as well. 50 pL aliquots of the treated reactions were spotted onto two strips of Whatman 3MM CHR cellulose chromatography paper and dried under a heat lamp. One of the two chromatography paper strips was then placed in a beaker and washed three times with 5% w / v trichloroacetic acid for 15 minutes at 4°C, followed by a wash with 200 proof ethanol at room temperature. The washed paper strips were dried under a heat lamp. Radioactivity was then measured with a Perkin Elmer MicroBeta2 with CytoScint liquid scintillation cocktail.

[0200] Autoradiograms were developed by separating total fractions of CFPS reactions containing 10 pM14C-leucine via SDS-PAGE. To visualize disulfide bond formation, samples were not denatured before analysis. Otherwise, samples were treated withdithiothreitol and denatured at 70°C for 3 min. SDS-PAGE gels were vacuum-dried between two cellophane sheets with a Hoefer slab gel dryer and exposed via autoradiography for at least three days. Autoradiogram gels were imaged with a Typhoon 7000. Protein bands were analyzed with densitometry.

[0201] Total yield of monoclonal antibodies was calculated by first calculating total yield from the14C -leucine incorporation data assuming 100% heavy chain and 100% light chain production. These values were then averaged, due to the similar ratio of molecular weight to number of leucines. Full-length antibody yields were then calculated by multiplying this total yield by the percent full-length antibody calculated via densitometry from the oxidizing SDS-PAGE gels. Error was propagated through each step and visualized in plots with the error bars.

[0202] Protein Activity Assays

[0203] vtPA activity was determined by diluting cell-free reactions containing expressed vtPA 1:10 in PBS and incubating with 25.5 pM D-Ile-Pro-Arg-AMC peptide (iPR- AMC, Echelon Biosciences 855-18). Peptide cleavage by vtPA was determined by release of the free fluorescent 7-amino-4-methylcoumarin (AMC) over the course of an hour at 26°C and measured via a BioTek Neo2 plate reader with 354 nm excitation and 442 nm emission.

[0204] Colicin M antimicrobial activity was determined through incubation with CLM24 indicator cells, as previously described44. An overnight culture of LB media inoculated with CLM24 cells was diluted 1 : 100 in fresh LB media. The CLM24 culture was incubated at 37°C and 220 rpm to an ODeoo of 0.7-0.9. The cells were then pelleted at 3,000g for 5 min., washed twice with 0.85% w / v sodium chloride, and resuspended in LB media to an ODeoo of 0.1. Cell-free reactions containing diluted colicin M were added to 1.2 mL CLM24 cultures, incubated for 1 h. at 37°C and 220 rpm, and then washed twice with 0.85% w / v sodium chloride. The washed cell cultures were serially diluted, plated on LB agar, and incubated overnight at 30°C before counting colonies.

[0205] TRI2-2 binding to the SARS-CoV-2 spike RBD protein was determined using AlphaLISA, based on previous descriptions25. AlphaLISA reactions were performed in a buffer containing 50 mM HEPES, 150 mM NaCl, 0.015% v / v TritonX-100, and 1 g / L BSA at pH 7.4. 2 LL L reactions were prepared using an Echo 525 liquid handler, transferring solutions from an Echo Qualified 384-well PP PLUS plate (LabCyte PPL-0200) to a ProxiPlate 384- shallow well Plus plate (Revvity 6008280) using the 384_PP_Plus_AQ_GPSA fluid type.Serial dilutions of the His-tagged SARS-CoV-2 Spike RBD Protein (Aero Biosystems SPD- C82E9) and cell-free reactions incubated with either water or the TRI2-2_2xStrep plasmid were prepared using the AlphaLISA buffer. These dilutions were incubated with a final concentration of 0.02 mg / mL Anti-6xHis AlphaLISA acceptor beads (Revvity AL178C) for 1 h at room temperature before addition of Strep-Tactin AlphaLISA donor beads (Revvity AS106D) to a final concentration of 0.08 mg / mL. Following a second 1 h incubation, reaction luminescence was determined with a Synergy Neo2 plate reader with 80 ms excitation, 120 ms delay, and 160 ms integration time. Reactions were allowed to incubate for 10 minutes inside the plate reader before luminescence was recorded.

[0206] Trastuzumab binding was determined using a Trastuzumab Pharmacokinetic ELISA Kit (GenScript L00970). Cell-free reactions containing expressed trastuzumab were diluted 1:3,333 in PBS and assayed according to kit instructions.

[0207] Metabolite Analysis

[0208] Cell-free protein synthesis reactions were run to monitor changes in key metabolites over the course of the reaction. At each time point, a set of reactions in triplicate was quenched 1: 1 with 10% trichloroacetic acid and flash frozen in liquid nitrogen. Samples were then thawed and centrifuged at 20,000g for 10 min. to remove precipitated protein. The supernatant was collected and 5 pL was injected onto an Agilent 1260 HPLC system. Metabolites were separated with an Aminex HPX-87H organic acids column at 60°C with an isocratic flow of 5 mM sulfuric acid at 0.6 mL / min. Metabolite concentration was determined via refractive index detector based on the retention time and intensity of each compound’s standard solution.

[0209] ATP was measured using the Promega CellTiter-Glo 2.0 Cell Viability Assay (G9241). Briefly, the quenched cell-free reaction supernatant was diluted 1:500 in nuclease- free water and mixed 1 : 1 with the CellTiter-Glo reagent; the luminescence was read on a BioTek Synergy Hl plate reader. ATP concentrations were determined based on a standard curve prepared with pure ATP. Inorganic phosphate concentrations were determined with the Sigma- Aldrich Phosphate Assay Kit (MAK308) using a 1:500 dilution of the quenched cell- free reaction supernatant. Reaction pH was measured at the 15 pL scale using an Orion ROSS PerpHecT pH electrode. Cell-free reactions used for pH measurements were not quenched with trichloroacetic acid nor flash frozen in liquid nitrogen.

[0210] References1. Hunt, A. C. et al. Cell-Free Gene Expression: Methods and Applications. Chem. Rev. 125, 91-149 (2025).2. Silverman, A. D., Karim, A. S. & Jewett, M. C. Cell-free gene expression: an expanded repertoire of applications. Nat. Rev. Genet. 21, 151-170 (2020).3. Garenne, D. et al. Cell-free gene expression. Nat. Rev. Methods Primer 1, 1-18 (2021).4. Stark, J. C. et al. On-demand biomanufacturing of protective conjugate vaccines. Sci. Adv. (2021) doi: 10.1126 / sciadv.abe9444.5. Warfel, K. F. et al. A Low-Cost, Thermostable, Cell-Free Protein Synthesis Platform for On-Demand Production of Conjugate Vaccines. ACS Synth. Biol. 12, 95-107 (2023).6. Pardee, K. et al. Portable, On-Demand Biomolecular Manufacturing. Cell 167, 248- 259. el2 (2016).7. Rasor, B. J., Karim, A. S., Alper, H. S. & Jewett, M. C. Cell Extracts from Bacteria and Yeast Retain Metabolic Activity after Extended Storage and Repeated Thawing. ACS Synth. Biol. 12, 904-908 (2023).8. Jung, J. K. et al. Cell-free biosensors for rapid detection of water contaminants. Nat. Biotechnol. 38, 1451-1459 (2020).9. Hunt, J. P. et al. Towards detection of SARS-CoV-2 RNA in human saliva: A paperbased cell-free toehold switch biosensor with a visual bioluminescent output. New Biotechnol. 66, 53-60 (2022).10. Ekas, H. M. et al. Engineering a PbrR-Based Biosensor for Cell-Free Detection of Lead at the Legal Limit. ACS Synth. Biol. 13, 3003-3012 (2024).11. Nishikawa, K. K. et al. Highly multiplexed design of an allosteric transcription factor to sense novel ligands. 2024.03.07.583947 Preprint at doi.org / 10. 1101 / 2024.03.07.583947 (2024).12. Voyvodic, P. L. et al. Plug-and-play metabolic transducers expand the chemical detection space of cell-free biosensors. Nat. Commun. 10, 1697 (2019).13. Silverman, A. D., Akova, U., Alam, K. K, Jewett, M. C. & Lucks, J. B. Design and Optimization of a Cell-Free Atrazine Biosensor. ACS Synth. Biol. 9, 671-677 (2020).14. Thavarajah, W. et al. Point-of-Use Detection of Environmental Fluoride via a Cell- Free Riboswitch-Based Biosensor. ACS Synth. Biol. 9, 10-18 (2020).15. Pardee, K. et al. Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255-1266 (2016).16. Sadat Mousavi, P. et al. A multiplexed, electrochemical interface for gene-circuit- based sensors. Nat. Chem. 12, 48-55 (2020).17. Vogeli, B. et al. Cell-free prototyping enables implementation of optimized reverse 0- oxidation pathways in heterotrophic and autotrophic bacteria. Nat. Commun. 13, 3058 (2022).18. Kelwick, R. et al. Cell-free prototyping strategies for enhancing the sustainable production of polyhydroxy alkanoates bioplastics. Synth. Biol. 3, ysy016 (2018).19. Kightlinger, W. et al. A cell-free biosynthesis platform for modular construction of protein glycosylation pathways. Nat. Commun. 10, 5404 (2019).20. Dudley, Q. M., Karim, A. S., Nash, C. J. & Jewett, M. C. In vitro prototyping of limonene biosynthesis using cell-free protein synthesis. Metab. Eng. 61, 251-260 (2020).21. Liew, F. E. et al. Carbon-negative production of acetone and isopropanol by gas fermentation at industrial pilot scale. Nat. Biotechnol. 40, 335-344 (2022).22. Karim, A. S. et al. In vitro prototyping and rapid optimization of biosynthetic enzymes for cell design. Nat. Chem. Biol. 16, 912-919 (2020).23. Lu, Y., Chan, W., Ko, B. Y , VanLang, C. C. & Swartz, J. R. Assessing sequence plasticity of a virus-like nanoparticle by evolution toward a versatile scaffold for vaccines and drug delivery. Proc. Natl. Acad. Sci. 112, 12360-12365 (2015).24. Martin, R. W. et al. Cell-free protein synthesis from genomically recoded bacteria enables multisite incorporation of noncanonical amino acids. Nat. Commun. 9, 1203 (2018).25. Hunt, A. C. et al. Multivalent designed proteins neutralize SARS-CoV-2 variants of concern and confer protection against infection in mice. Sci. Transl. Med. 14, eabnl252 (2022).26. Landwehr, G. M. et al. Accelerated enzy me engineering by machine-learning guided cell-free expression. Nat. Commun. 16, 865 (2025).27. Pandi, A. et al. Cell-free biosynthesis combined with deep learning accelerates de novo-development of antimicrobial peptides. Nat. Commun. 14, 7197 (2023).28. Garcia, D. C. et al. Elucidating the potential of crude cell extracts for producing pyruvate from glucose. Synth. Biol. 3, ysy006 (2018).29. Yi, T., Lim, H. J., Lee, S. J., Lee, K.-H. & Kim, D.-M. Synthesis of (R,R)-2,3- butanediol from starch in a hybrid cell-free reaction system. J. Ind. Eng. Chem. 67, 231-235 (2018).30. Huang, A. et al. BioBits™ Explorer: A modular synthetic biology education kit. Sci. Adv. 4, eaat5105 (2018).31. Stark, J. C. et al. BioBits™ Bright: A fluorescent synthetic biology education kit. Sci. Adv. 4, eaat5107 (2018).32. Collins, M. et al. A frugal CRISPR kit for equitable and accessible education in gene editing and synthetic biology. Nat. Commun. 15, 6563 (2024).33. Jung, J. K. et al. At-Home, Cell-Free Synthetic Biology Education Modules for Transcriptional Regulation and Environmental Water Quality Monitoring. ACS Synth. Biol. 12, 2909-2921 (2023).34. Adiga, R. et al. Point-of-care production of therapeutic proteins of goodmanufacturing-practice quality. Nat. Biomed. Eng. 2, 675-686 (2018).35. Timm, A. C., Shankles, P. G., Foster, C. M., Doktycz, M. J. & Retterer, S. T. Toward Microfluidic Reactors for Cell-Free Protein Synthesis at the Point-of-Care. Small 12, 810— 817 (2016).36. Zawada, J. F. et al. Microscale to manufacturing scale-up of cell-free cytokine production — a new approach for shortening protein production development timelines. Biotechnol. Bioeng. 108, 1570-1578 (2011).37. Cai, Q. et al. A simplified and robust protocol for immunoglobulin expression in Escherichia coli cell-free protein synthesis systems. Biotechnol. Prog. 31, 823-831 (2015).38. Yin, G. et al. Aglycosylated antibodies and antibody fragments produced in a scalable in vitro transcription-translation system. mAbs 4, 217-225 (2012).39. Murakami, S., Matsumoto, R. & Kanamori, T. Constructive approach for synthesis of a functional IgG using a reconstituted cell-free protein synthesis system. Sci. Rep. 9, 671 (2019).40. Groff, D. et al. Development of an E. coli strain for cell-free ADC manufacturing. Biotechnol. Bioeng. 119, 162-175 (2022).41. Murphy, T. W., Sheng, J., Naler, L. B., Feng, X. & Lu, C. On-chip manufacturing of synthetic proteins for point-of-care therapeutics. Microsyst. Nanoeng. 5, 1-12 (2019).42. Wilding, K. M. et al. Endotoxin-Free E. coli-Based Cell-Free Protein Synthesis: PreExpression Endotoxin Removal Approaches for on-Demand Cancer Therapeutic Production. Biotechnol. J. 14, 1800271 (2019).43. Emslander, Q. et al. Cell-free production of personalized therapeutic phages targeting multidrug-resistant bacteria. Cell Chem. Biol. 29, 1434-1445. e7 (2022).44. Jin, X., Kightlinger, W., Kwon, Y.-C. & Hong, S. H. Rapid production and characterization of antimicrobial colicins using Escherichia coli-based cell-free protein synthesis. Synth. Biol. 3, ysy004 (2018).45. Jewett, M. C. & Swartz, J. R. Mimicking the Escherichia coh cytoplasmic environment activates long-lived and efficient cell-free protein synthesis. Biotechnol. Bioeng. 86, 19-26 (2004).46. Garenne, D., Beisel, C. L. & Noireaux, V. Characterization of the all-E. coli transcription-translation system myTXTL by mass spectrometry. Rapid Commun. Mass Spectrom. 33, 1036-1048 (2019).47. Pandi, A. et al. A versatile active learning workflow for optimization of genetic and metabolic networks. Nat. Commun. 13, 3876 (2022).48. Chen, C., Garcia ,Zoe, Chen , David, Liu ,Hong & and Trelstad, P. Cost and supply considerations for antibody therapeutics. mAbs 17, 2451789 (2025).49. Gupta, P., Kateja, N., Mishra, S., Kaur, H. & Rathore, A. S. Economic assessment of continuous processing for manufacturing of biotherapeutics. Biotechnol. Prog. 37, e3108 (2021).50. Calhoun, K. A. & Swartz, J. R. Energizing cell-free protein synthesis with glucose metabolism. Biotechnol. Bioeng. 90, 606-613 (2005).51. Kim, H.-C., Kim, T.-W. & Kim, D.-M. Prolonged production of proteins in a cell-free protein synthesis system using polymeric carbohydrates as an energy source. Process Biochem. 46, 1366-1369 (2011).52. Borkowski, O. et al. Large scale active-leaming-guided exploration for in vitro protein production optimization. Nat. Commun. 11, 1872 (2020).53. Dopp, B. J. L., Tamiev, D. D. & Reuel, N. F. Cell-free supplement mixtures: Elucidating the history and biochemical utility of additives used to support in vitro protein synthesis in E. coli extract. Biotechnol. Adv. 37, 246-258 (2019).54. Rhea, K. A. et al. Variability in cell-free expression reactions can impact qualitative genetic circuit characterization. Synth. Biol. I. ysacOl l (2022).55. Cole, S. D. et al. Quantification of Interlaboratory Cell-Free Protein Synthesis Variability. ACS Synth. Biol. 8, 2080-2091 (2019).56. Kim, D.-M. & Swartz, J. R. Prolonging Cell-Free Protein Synthesis by Selective Reagent Additions. Biotechnol. Prog. 16, 385-390 (2000).57. Jewett, M. C., Miller, M. L., Chen, Y. & Swartz, J. R. Continued Protein Synthesis at Low [ATP] and [GTP] Enables Cell Adaptation during Energy Limitation. J. Bacterial. 191, 1083-1091 (2009).58. Rasor, B. J. et al. Mechanistic Insights into Cell-Free Gene Expression through an Integrated -Omics Analysis of Extract Processing Methods. ACS Synth. Biol. (2023) doi: 10. 1021 / acssynbio.2c00339.59. Vilkhovoy, M. et al. Sequence Specific Modeling of E. coli Cell-Free Protein Synthesis. ACS Synth. Biol. 7, 1844-1857 (2018).60. Kim, D.-M. & Swartz, J. R. Efficient production of a bioactive, multiple disulfide- bonded protein using modified extracts of Escherichia coli. Biotechnol. Bioeng. 85, 122-129 (2004).61. Yin, G. & Swartz, J. R. Enhancing multiple disulfide bonded protein folding in a cell- free system. Biotechnol. Bioeng. 86, 188-195 (2004).62. Knapp, K. G., Goerke, A. R. & Swartz, J. R. Cell-free synthesis of proteins that require disulfide bonds using glucose as an energy source. Biotechnol. Bioeng. 97, 901-908 (2007).63. Slonczewski, J. L., Rosen, B. P., Alger, J. R. & Macnab, R. M. pH homeostasis in Escherichia coli: measurement by 3 IP nuclear magnetic resonance of methylphosphonate and phosphate. Proc. Natl. Acad. Sci. 78, 6271-6275 (1981).64. O’Brien, E. P , Vendruscolo, M. & Dobson, C. M. Prediction of variable translation rate effects on cotranslational protein folding. Nat. Commun. 3, 868 (2012).65. Rezvani, R. N. et al. Scalable Cell-Free Production of Active T7 RNA Polymerase. Biotechnol. Bioeng. n / a, (2025).66. Gething, M. J. et al. Variants of human tissue-type plasminogen activator that lack specific structural domains of the heavy chain. EMBO J. 7, 2731-2740 (1988).67. El Ghachi, M. et al. Colicin M Exerts Its Bacteriolytic Effect via Enzymatic Degradation of Undecaprenyl Phosphate-linked Peptidoglycan Precursors. J. Biol. Chem. 281, 22761-22772 (2006).68. Algorri, M. et al. Re-Envisioning Pharmaceutical Manufacturing: Increasing Agility for Global Patient Access. J. Pharm. Sci. I l l, 593-607 (2022).69. Srai, J. S. et al. Distributed manufacturing: scope, challenges and opportunities. Int. J. Prod. Res. 54, 6917-6935 (2016).70. Hamer, M. K. et al. Referrals, access, and equity of monoclonal antibodies for outpatient COVID-19: A qualitative study of clinician perspectives. Medicine (Baltimore) 101, e32191 (2022).71. Harrison, R. P., Ruck, S., Medcalf, N. & Rafiq, Q. A. Decentralized manufacturing of cell and gene therapies: Overcoming challenges and identifying opportunities. Cytotherapy 19, 1140-1151 (2017).72. Crowell, L. E. et al. On-demand manufacturing of clinical-quality biopharmaceuticals. Nat. Biotechnol. 36, 988-995 (2018).73. J. Millet, L., D. Lucheon, J., F. Standaert, R., T. Retterer, S. & J. Doktycz, M. Modular microfluidics for point-of-care protein purifications. Lab. Chip 15, 1799-1811 (2015).74. DeWinter, M. A. et al. Point-of-Care Peptide Hormone Production Enabled by Cell- Free Protein Synthesis. ACS Synth. Biol. 12, 1216-1226 (2023).75. Hadi, T. et al. Rolling circle amplification of synthetic DNA accelerates biocatalytic determination of enzyme activity relative to conventional methods. Sci. Rep. 10, 10279 (2020).76. Schwarz- Schilling, M. et al. Autonomous biogenesis of the entire protein translation machinery excluding ribosomes. 2024.10.20.619270 Preprint at doi.org / 10. 1101 / 2024.10.20.619270 (2024).77. Ganesh, R. B. & Maerkl, S. J. Towards Self-regeneration: Exploring the Limits of Protein Synthesis in the Protein Synthesis Using Recombinant Elements (PURE) Cell-free Transcription-Translation System. A CS Synth. Biol. (2024) doi: 10.1021 / acssynbio.4c00304.78. Zheng, X. et al. Cell extract-based in vitro DNA replication enables sustainable cell- free gene expression. 2024.10.01.616023 Preprint at doi.org / 10. 1101 / 2024. 10.01.616023 (2024).79. Chowdhury, S. et al. Carbon Negative Synthesis of Amino Acids Using a Cell-Free- Based Biocatalyst. ACS Synth. Biol. (2024) doi: 10.1021 / acssynbio.4c00359.80. Zhu, X. et al. Combining CRISPR-Cpfl and Recombineering Facilitates Fast and Efficient Genome Editing in Escherichia coli. ACS Synth. Biol. 11, 1897-1907 (2022).81. Concordet, J.-P. & Haeussler, M. CRISPOR: intuitive guide selection for CRISPR / Cas9 genome editing experiments and screens. Nucleic Acids Res. 46, W242-W245 (2018).82. Kim, D.-M., Kigawa, T., Choi, C.-Y. & Yokoyama, S. A Highly Efficient Cell-Free Protein Synthesis System from Escherichia coli. Eur. J. Biochem. 239, 881-886 (1996).83. Garenne, D.; Thompson, S.; Brisson, A.; Khakimzhan, A.; Noireaux, V. The All-E. coli TX TL Toolbox 3.0: New Capabilities of a Cell-Free Synthetic Biology Platform. Synth. Biol. 2021, 6 (1), ysabO17. doi.org / 10.1093 / synbio / ysab017.84. Batista, A. C.; Levrier, A.; Soudier, P.; Voyvodic, P. L.; Achmedov, T.; Reif- Trauttmansdorff, T.; DeVisch, A.; Cohen-Gonsaud, M.; Faulon, J.-L.; Beisel, C. L.; Bonnet, J.; Kushwaha, M. Differentially Optimized Cell -Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts. ACS Synth. Biol. 2022. doi . org / 10.1021 / acssynbio . 1 c00448.85. Kushwaha, M. Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts. ACS Synth. Biol. 2022. doi . org / 10.1021 / acssynbio . 1 c00448.86. Calhoun, K. A.; Swartz, J. R. Total Amino Acid Stabilization during Cell-Free ProteinSynthesis Reactions. J. Biotechnol. 2006, 123 (2), 193-203. doi. org / 10. 1016 / j .j biotec.2005. 11.011.87. Snapyan, M.; Robin, S.; Yeretssian, G.; Lecocq, M.; Marc, F.; Sakanyan, V. Cell-Free Protein Synthesis by Diversifying Bacterial Transcription Machinery. BioTech 2021, 10 (4), 24. doi.org / 10.3390 / biotechl0040024.88. Cai, Q.; Hanson, J. A.; Steiner, A. R.; Tran, C.; Masikat, M. R.; Chen, R.; Zawada, J. F.; Sato, A. K.; Hallam, T. J.; Yin, G. A Simplified and Robust Protocol for Immunoglobulin Expression in Escherichia Coli Cell-Free Protein Synthesis Systems. Biotechnol. Prog. 201 5, 31 (3), 823-831. doi.org / 10.1002 / btpr.2082.89. Kim, T.-W.; Oh, I.-S.; Keum, J.-W.; Kwon, Y.-C.; Byun, J.-Y.; Lee, K-H.; Choi, C.-Y.; Kim, D.-M. Prolonged Cell-Free Protein Synthesis Using Dual Energy Sources: Combined90. Use of Creatine Phosphate and Glucose for the Efficient Supply of ATP and Retarded Accumulation of Phosphate. Biotechnol. Bioeng. 2007, 97 (6), 1510-1515. doi.org / 10. 1002 / bit.21337.91. Jewett, M. C.; Calhoun, K. A.; Voloshin, A.; Wuu, J. J.; Swartz, J. R. An Integrated Cell- Free Metabolic Platform for Protein Production and Synthetic Biology. Mol. Syst. Biol. 2008, 4, 220. doi.org / 10. 1038 / msb.2008.57.92. Li, J.; Gu, L.; Aach, J.; Church, G. M. Improved Cell-Free RNA and Protein Synthesis System. PLOS ONE 2014, 9 (9), el06232. doi.org / 10.1371 / joumal.pone.0106232.93. Pedersen, A.; Hellberg, K.; Enberg, J.; Karlsson, B. G. Rational Improvement of Cell-Free Protein Synthesis. New Biotechnol. 2011, 28 (3), 218-224. doi.org / 10.1016 / j.nbt.2010.06.015.94. Spice, A. J.; Aw, R.; Bracewell, D. G.; Polizzi, K. M. Improving the Reaction Mix of aPichia Pastoris Cell-Free System Using a Design of Experiments Approach to Minimise Experimental Effort. Synth. Sy st. Biotechnol. 2020, 5 (3), 137-144. doi.org / 10.1016 / j.synbio.2020.06.003.95. Caschera, F.; Bedau, M. A.; Buchanan, A.; Cawse, J.; de Lucrezia, D.; Gazzola, G.; Hanczyc, M. M.; Packard, N. H. Coping with Complexity: Machine Learning Optimization of Cell -Free Protein Synthesis. Biotechnol. Bioeng. 2011, 108 (9), 2218-2228. doi.org / 10. 1002 / bit.23178.96. Caschera, F.; Karim, A. S.; Gazzola, G.; d’ Aquino, A. E.; Packard, N. H.; Jewett, M. C.High-Throughput Optimization Cycle of a Cell-Free Ribosome Assembly and Protein Synthesis System. ACS Synth. Biol. 2018, 7 (12), 2841-2853. doi.org / 10.1021 / acssynbio.8b00276.97. Banks, A. M.; Whitfield, C. J.; Broun, S. R.; Fulton, D. A.; Goodchild, S. A.; Grant, C.; Love, J.; Lendrem, D. W.; Fieldsend, J. E.; Howard, T. P. Key Reaction Components Affect the Kinetics and Performance Robustness of Cell-Free Protein Synthesis Reactions. Comput. Struct. Biotechnol. J. 2022, 20, 218-229. doi.org / 10.1016 / j.csbj.202L 12.013.98. Dinglasan, J. L. N.; Sword, T. T.; Barker, J. W.; Doktycz, M. J.; Bailey, C. B. Investigating and Optimizing the Lysate-Based Expression of Nonribosomal Peptide Synthetases Using a Reporter System. ACS Synth. Biol. 2023. doi . org / 10.1021 / acssynbio .2c006 58.

Claims

CLAIMSWe Claim:

1. A composition for cell-free protein synthesis, the composition comprising: a) potassium glutamate, adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, uridine monophosphate, and the 20 standard amino acids, and b) E. coli extract, and c) optionally, a DNA template and / or a RNA template encoding a protein of interest.

2. The composition of claim 1, wherein the amount or concentration of potassium glutamate is about 300 mM, adenosine monophosphate is about 1.2 mM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each is about 0.86 mM or 2. 15 mM, and the amino acids is about 3.25 mM to 5mM;3. The composition of claim 1 or claim 2, further comprising magnesium glutamate, glucose, potassium phosphate, nicotinamide, ribose, and a buffer.

4. The composition of claim 3, wherein the buffer is HEPES buffer or Bis-Tris buffer.

5. The composition of claim 3 or claim 4, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, ribose is about 50mM, and the buffer is HEPES buffer at about 75mM.

6. The composition of any of the preceding claims, wherein the E. coli extract is an E. coli B strain extract or an E. coli K strain extract.

7. The composition of claim 6, wherein the E. coli extract is an E. coli B strain lysate, optionally an E. coli BL21 Star (DE3) lysate.

8. The composition of any of the preceding claims, wherein the E. coli extract is about 20% v / v to about 50% v / v.

9. The composition of any one of claims 5-8, wherein the composition comprises 362 mM potassium glutamate, 3 mM adenosine monophosphate, 2.15 mM cytidine monophosphate, 2.15 mM guanosine monophosphate, 2.15 mM uridine monophosphate, 5 mM amino acids, 10 mM glucose, 50 mM D-ribose, 8 mM magnesium glutamate, 15 mM potassium phosphate, and 7 5 mM HEPES.

10. The composition of claim 9, wherein the amount or concentration of one or more of the composition components may be varied in the composition in a range of from about 30% to about 70% of the given amount or concentration.

11. A cell-free protein synthesis system comprising: a) the composition of any one of claims 1-10; and(b) a DNA template and / or a RNA template encoding a protein of interest.

12. The cell-free protein synthesis system of claim 11, wherein the composition comprises an amount or concentration of potassium glutamate at about 300 mM, adenosine monophosphate at about 1.2 mM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each at about 0.86 mM or 2. 15 mM, and the amino acids at about 3.25 mM to 5mM13. The cell-free protein synthesis system of claim 11 or claim 12, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 mM, potassium phosphate is about 15mM, nicotinamide is about 4mM, ribose is about 50mM, and a buffer at about 75mM.

14. The cell-free protein synthesis system of any of claims 11-13, wherein the buffer is HEPES buffer or Bis-Tris buffer15. The cell-free protein synthesis system of any of claims 11-14, wherein the E. coli extract is an E. coli B strain extract or E. coli K strain extract.

16. The cell-free protein synthesis system of claim 15, wherein the E. coli extract is an E. coli B strain extract, optionally an E. coli BL21 Star (DE3) lysate.

17. The cell-free protein synthesis system of any of claims 11-16, wherein the E. coli extract is about 20% v / v to about 50% v / v.

18. The cell-free protein synthesis system of any of claims 11-17, wherein the system further comprises iodoacetamide, glutathione, and disulfide bond isomerase.

19. The cell-free protein synthesis system of claim 18, wherein the buffer is pH 7.5.

20. A method for cell-free protein synthesis, the method comprising: contacting the composition of claim 1 in a buffer with a DNA and / or a RNA template encoding a protein of interest.

21. The method of claim 20, wherein the amount or concentration of potassium glutamate is about 300 mM, adenosine monophosphate is about 1.2 mM or about 3 mM, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate each is about 0.86 mM or 2. 15 mM, the amino acids is about 3.25 mM to 5mM, and the buffer is HEPES or BisTris buffer at about 75mM.

22. The method of claim 20 or claim 21 , further comprising magnesium glutamate, glucose, potassium phosphate, nicotinamide, and ribose, wherein the amount or concentration of the magnesium glutamate is about 8mM, the glucose is about 10 mM, the potassium phosphate is about 15mM, the nicotinamide is about 4mM, and the ribose is about 50mM.

23. The method of any one of claims 20-22, wherein the E. coli extract iscoli B strain extract, optionally an A coli BL21 Star (DE3) lysate.

24. The method of any one of claims 20-23, wherein the E. coli extract is about 20% v / v to about 50% v / v.

25. The method of any one of claims 20-24, wherein the method is performed in 100% oxygen.

26. The method of any one of claims 20-25, wherein the buffer is HEPES or Bis-Tris, and wherein the buffer is pH 7.2 to 7.5.

27. The method of any one of claims 20-26, wherein protein is synthesized at a higher yield than a control cell-free protein synthesis method.

28. The method of any one of claims 20-27, further comprising one or more of iodoacetamide, glutathione, and disulfide bond isomerase.

29. The method of claim 28, wherein disulfide-bonded protein is synthesized.

30. The method of claim 29, wherein disulfide-bonded protein is synthesized at a higher yield than a control cell-free protein synthesis method.

31. The method of claim 29 or 30, wherein disulfide-bonded protein is synthesized at a lower cost than a control cell-free protein synthesis method.

32. The methods of any one of claims 29-31, wherein the disulfide-bonded protein is a therapeutic protein.

33. The method of claim 32, wherein the therapeutic protein is an antibody or antibody fragment.

34. A method for cell-free protein synthesis, wherein a cell-free protein synthesis system can synthesize its own reagents from monomer building blocks.

35. The method of claim 34, wherein the cell-free protein synthesis system can synthesize nucleoside monophosphates (NMPs) from nucleotide bases and sugars.

36. The method of claim 34 or claim 35, the cell-free protein synthesis system comprises: a) a composition comprising potassium glutamate, guanine or guanosine, ribose, and a mixture of the 20 standard amino acids, b) E. coli extract, and c) a DNA template and / or a RNA template encoding a protein of interest.

37. The method of claim 36, wherein the amount or concentration of potassium glutamate is about 300 mM, guanine or guanosine is about 1.2 mM or about 3 mM, ribose is about 50mM, and the amino acids is about 3.25 mM to 5mM.

38. The method of any one of claims 34 to 37, wherein the cell-free protein synthesis system is lower cost when synthesizing its own nucleoside monophosphates from monomer building blocks as compared to adding the nucleoside monophosphates directly.

39. The method of any one of claims 36 to 38, wherein the composition further comprises magnesium glutamate, glucose, potassium phosphate, nicotinamide, and a buffer, wherein the amount or concentration of magnesium glutamate is about 8mM, glucose is about 10 rnM, potassium phosphate is about 15mM, nicotinamide is about 4mM, and the buffer is HEPES or Bis-Tris buffer at about 75mM.

40. The method of any one of claims 34-39, wherein the E. coll extract is an E. coll B strain extract or an E. coli K strain extract.

41. The method of claim 40, wherein the E. coli extract is an E. coli B strain extract, optionally an E. coli BL21 Star (DE3) lysate.

42. The method of any one of claims 34-41, wherein the E. coli extract is about 20% v / v to about 50% v / v.

Images