Sequencing full-complement polynucleotides using nanopores

The method sequences polynucleotides and their complements using nanopores, forming duplexes and measuring electrical properties to enhance accuracy and identify modified bases, addressing the limitations of existing nanopore sequencing technologies.

WO2026006622A2PCT designated stage Publication Date: 2026-01-02ILLUMINA INC
View PDF 15 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035519
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-26
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing nanopore-based polynucleotide sequencing methods are not sufficiently robust, reproducible, or sensitive for practical applications like genome sequencing, lacking high throughput and accuracy.

Method used

A method involving a construct of a polynucleotide and its complement is sequenced using a nanopore, forming duplexes on either side and measuring electrical properties to determine the sequence, with additional duplex extensions and measurements to enhance accuracy.

Benefits of technology

The method provides high-accuracy sequencing of full-complement polynucleotides with reduced errors, compatible with long reads and capable of identifying modified bases without additional reagents or optical components, overcoming homopolymer issues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035519_02012026_PF_FP_ABST
    Figure US2025035519_02012026_PF_FP_ABST
Patent Text Reader

Abstract

A sequencing method may include generating a construct comprising the polynucleotide and a complement of the polynucleotide. The construct may be disposed through the aperture of a nanopore. A first plurality of measured values may be generated corresponding to the sequence of the polynucleotide. A second plurality of measured values may be generated corresponding to the sequence of the complement. A sequence of the polynucleotide may be generated using the first plurality of measured values and the second plurality of measured values.
Need to check novelty before this filing date? Find Prior Art

Description

SEQUENCING FULL-COMPLEMENT POLYNUCLEOTIDES USING NANOPORESFIELD

[0001] This application generally relates to sequencing polynucleotides using nanopores.BACKGROUND

[0002] A significant amount of academic and corporate time and energy has been invested into using nanopores to sequence polynucleotides. For example, the dwell time has been measured for complexes of DNA with the KI enow fragment (KF) of DNA polymerase I atop a nanopore in an applied electric field. Or, for example, a current or flux-measuring sensor has been used in experiments involving DNA captured in a a-hemolysin nanopore. Or, for example, KF -DNA complexes have been distinguished on the basis of their properties when captured in an electric field atop an a-hemolysin nanopore. In still another example, polynucleotide sequencing is performed using a single polymerase enzyme complex including a polymerase enzyme and a template nucleic acid attached proximal to a nanopore, and nucleotide analogs in solution. The nucleotide analogs include charge blockade labels that are attached to the polyphosphate portion of the nucleotide analog such that the charge blockade labels are cleaved when the nucleotide analog is incorporated into a polynucleotide that is being synthesized. The charge blockade label is detected by the nanopore to determine the presence and identity of the incorporated nucleotide and thereby determine the sequence of a template polynucleotide. In still other examples, constructs include a transmembrane protein nanopore subunit and a nucleic acid handling enzyme.

[0003] Olasagasti et al., “Replication of individual DNA molecules under electronic control using a protein nanopore,” Nature Nanotechnology 5(11): 798-806 (2010) discloses disposing a DNA template through a nanopore. A DNA template-polymerase complex is formed on the first side of an a-hemolysin nanopore, and includes a DNA duplex and a polymerase. The DNA template includes abasic reporter nucleotides that initially are positioned on the second side of the a-hemolysin nanopore. While the polymerase is used to add nucleotides to the duplex based on the sequence of the DNA template, the ionic current through the nanopore is measured (IEBS, where EBS refers to the enzyme bound state). As these nucleotides are added, the abasicreporter nucleotides are drawn towards and subsequently through the a-hemolysin, which causes changes in IEBS.

[0004] However, such previously known compositions, systems, and methods may not necessarily be sufficiently robust, reproducible, or sensitive and may not have sufficiently high throughput for practical implementation, e.g., demanding commercial applications such as genome sequencing in clinical and other settings that demand cost effective and highly accurate operation. Accordingly, what is needed are improved compositions, systems, and methods for sequencing polynucleotides.SUMMARY

[0005] Sequencing full-complement polynucleotides using nanopores is provided herein.

[0006] Some examples herein provide a method of sequencing a polynucleotide using a nanopore including a first side, a second side, and an aperture extending through the first and second sides. The method may include (a) generating a construct including the polynucleotide and a complement of the polynucleotide. The method may include (b) disposing the construct through the aperture of the nanopore such that a 3 ' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore. The method may include (c) forming a first duplex with the construct on the first side of the nanopore, the duplex including a 3 ' end. The method may include (d) characterizing the polynucleotide using operations including (i), (ii), (iii), and (iv). Operation (i) may include extending the first duplex on the first side of the nanopore by adding to the 3 ' end of the first duplex a first nucleotide that is complementary to a nucleotide of the polynucleotide. Operation (ii) may include inhibiting, using the nanopore, translocation of the 3' end of the extended first duplex to the second side of the nanopore. Operation (iii) may include measuring a value of an electrical property of the 3 ' end of the extended first duplex and a single-stranded portion of the polynucleotide. Operation (iv) may include repeating operations (i)-(iii) for a first plurality of nucleotides that are complementary to nucleotides of the polynucleotide to generate a first plurality of measured values.

[0007] Some examples herein provide a method of sequencing a polynucleotide using a nanopore including a first side, a second side, and an aperture extending through the first and second sides. The method may include (a) generating a construct including the sense polynucleotide and a complement of an anti-sense of the polynucleotide. The method may include (b) disposing the construct through the aperture of the nanopore such that a 3' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore. The method may include (c) forming a first duplex with the construct on the first side of the nanopore, the duplex including a 3 ' end. The method may include (d) characterizing the polynucleotide using operations including (i), (ii), (iii), and (iv). Operation (i) may include extending the first duplex on the first side of the nanopore by adding to the 3 ' end of the first duplex a first nucleotide that is complementary to a nucleotide of the polynucleotide. Operation (ii) may include inhibiting, using the nanopore, translocation of the 3' end of the extended first duplex to the second side of the nanopore. Operation (iii) may include measuring a value of an electrical property of the 3 ' end of the extended first duplex and a single-stranded portion of the polynucleotide. Operation (iv) may include repeating operations (i)-(iii) for a first plurality of nucleotides that are complementary to nucleotides of the polynucleotide to generate a first plurality of measured values.

[0008] The methods also may include (e) characterizing the complement using operations including (v), (vi), (vii), and (viii). Operation (v) may include extending the first duplex or a second duplex on the first side of the nanopore by adding to the 3 ' end of the first or second duplex a second nucleotide that is complementary to a nucleotide of the complement. Operation(vi) may include inhibiting, using the nanopore, translocation of the 3 ' end of the extended first or second duplex to the second side of the nanopore. Operation (vii) may include measuring a value of an electrical property of the 3 ' end of the extended first or second duplex and a singlestranded portion of the polynucleotide. Operation (viii) may include repeating operations (v)-(vii) for a second plurality of nucleotides that are complementary to nucleotides of the complement to generate a second plurality of measured values. The method also may include (f) generating a first sequence of the polynucleotide using the first plurality of measured values and the second plurality of measured values.

[0009] In some examples, the methods further includes repeatedly performing operations (c) through (f) to obtain a plurality of additional sequences of the polynucleotide, and generating a consensus sequence using the first sequence and the plurality of additional sequences.

[0010] In some examples, the methods further includes repeatedly performing operations (c) through (f) to obtain additional first and second pluralities of measured values, and generating a consensus set of measured values using the additional first and second pluralities of measured values.

[0011] In some examples, the polynucleotide and the complement of the polynucleotide hybridize to one another on the second side of the nanopore to form a third duplex. In some examples, the third duplex inhibits formation of transient secondary structures on the second side of the nanopore.

[0012] In some examples, the construct includes a hairpin or linker coupling the polynucleotide to the complement of the polynucleotide. In some examples, the method further includes synthesizing the complement of the polynucleotide using the hairpin as a primer.

[0013] In some examples, the polynucleotide includes epigenetic marks. In some examples, the complement of the polynucleotide lacks any epigenetic marks.

[0014] In some examples, the complement of the polynucleotide includes epigenetic marks. In some examples, the polynucleotide lacks any epigenetic marks.

[0015] In some examples, the method further includes generating the first sequence of the polynucleotide includes using the complement of the polynucleotide as a reference.

[0016] In some examples, the method further includes heating the construct to a temperature that inhibits formation of secondary structures on the first side of the nanopore.

[0017] In some examples, the methods further includes heating the construct to a temperature that inhibits formation of secondary structures on the second side of the nanopore.

[0018] In some examples, the methods further includes, after operation (iii) and before repeating operation (i), inhibiting hybridization between the polynucleotide and the complement of thepolynucleotide on the first side of the nanopore by moving only a portion of the polynucleotide from the second side of the nanopore to the first side of the nanopore. Additionally, or alternatively, in some examples, the method further includes, after operation (vii) and before repeating operation (v), inhibiting hybridization between the polynucleotide and the complement of the polynucleotide on the first side of the nanopore by moving only a portion of the complement from the second side of the nanopore to the first side of the nanopore.

[0019] In some examples, the polynucleotide includes native RNA, and the complement of the polynucleotide includes synthetic cDNA. In some other examples, the polynucleotide includes synthetic cDNA, and the complement of the polynucleotide includes native RNA.

[0020] In some examples, the construct further includes a direct repeat of the RNA, and a complement of the direct repeat of the RNA. In some examples, the method further includes characterizing the direct repeat of the RNA to generate a third plurality of measured values; and characterizing the complement of the direct repeat of the RNA to generate a fourth plurality of measured values. In some examples, the first sequence of the polynucleotide further is generated using the third plurality of measured values and the fourth plurality of measured values.

[0021] In some examples, the polynucleotide includes native DNA, and the complement of the polynucleotide includes synthetic DNA. In some other examples, the polynucleotide includes synthetic DNA, and the complement of the polynucleotide includes native DNA.

[0022] In some examples, the polynucleotide includes a sense strand, and optionally a complement of the sense strand. The construct further may include an antisense strand that is complementary to the sense strand, and a complement of the antisense strand. In some examples, the method further includes characterizing the antisense strand to generate a third plurality of measured values; and characterizing the complement of the antisense strand to generate a fourth plurality of measured values. The first sequence of the polynucleotide further may be generated using the third plurality of measured values and the fourth plurality of measured values.

[0023] In some examples, operation (d) is performed before operation (e). In some other examples, operation (e) is performed before operation (d).

[0024] Some examples herein provide a method of generating a signal using a nanopore including a first side, a second side, and an aperture extending through the first and second sides. The method may include disposing a construct through the aperture of the nanopore such that a 3' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore, wherein the construct includes a polynucleotide and a complement of the polynucleotide. The method may include forming a first duplex with the construct on the first side of the nanopore, the first duplex including a 3' end. The method may include forming a second duplex on the second side of the nanopore, the second duplex including the polynucleotide at least partially hybridized to the complement. The method may include extending the first duplex on the first side of the nanopore by adding a first nucleotide that is complementary to a nucleotide of the polynucleotide. The method may include measuring a value of an electrical property of the 3 ' end of the extended first duplex and a single-stranded portion of the polynucleotide while (i) inhibiting, using the nanopore, translocation of the 3 ' end of the extended first duplex to the second side of the nanopore; and (ii) inhibiting, using the second duplex, formation of transient secondary structures on the second side of the nanopore.

[0025] Some examples herein provide a method of making constructs. The method may include coupling a native double-stranded polynucleotide including a sense strand and an antisense strand to first and second stem-loop adapters each including a cleavable moiety. The method may include cleaving the cleavable moiety of each of the first and second stem-loop adapters. The method may include dehybridizing the sense strand from the antisense strand. The method may include synthesizing a complement of the sense strand to form a first partial construct including the sense strand coupled to the complement of the sense strand via the first stem-loop adapter. The method may include synthesizing a complement of the antisense strand to form a second partial construct including the antisense strand coupled to the complement of the antisense strand via the second stem-loop adapter. The method may include coupling a first forked adapter to the first partial construct to form a first construct. The method may include coupling a second forked adapter to the second partial construct to form a second construct.

[0026] Some examples herein provide an alternate method of making constructs. The method may include coupling a native double-stranded polynucleotide including a sense and an antisense strand to a first forked adapter and a second forked adapter. The first forked adapter and thesecond forked adapter each have a complementary linking sequence to each other. Optionally, the complementary linking sequences may have a blocker sequence hybridized to one or both of the complementary linking sequences to prevent adapter dimerization. After the first and second adapters are attached to the ends of the native double-stranded polynucleotide, the method may include dehybridizing the sense and the antisense strands. The complementary linking strands of the first adapter and second adapter hybridize to each other. The sense strand may be extended to synthesize a reverse complement of the antisense strand. The antisense strand may be extended to synthesize a reverse complement of the sense strand.

[0027] In some examples, dehybridizing the sense strand from the antisense strand, synthesizing the complement of the sense strand, and synthesizing the complement of the antisense strand include using a first strand-displacing polymerase to synthesize the complement of the sense strand; and using a second strand-displacing polymerase to synthesize the complement of the antisense strand.

[0028] In some examples, cleaving the cleavable moiety generates a 1-base pair gap flanked by a 3' phosphate and a 5' phosphate, the method further including using a polynucleotide kinase (PNK) to remove the 3' phosphate from the gap, to leave a free 3' OH at the gap.

[0029] In some examples, the forked adapter includes a 3' steric lock.

[0030] In some examples, the first and second stem-loop adapters respectively include unique molecular identifiers (UMIs).

[0031] In some examples, (i) the sense strand includes one or more epigenetic marks, and the complement of the sense strand does not include any epigenetic marks, or (ii) the antisense strand includes one or more epigenetic marks, and the complement of the antisense strand does not include any epigenetic marks.

[0032] In some examples, the complement of the sense strand and the complement of the antisense strand are synthesized using only unmodified nucleotides. In some other examples, the complement of the sense strand and the complement of the antisense strand are synthesized using modified nucleotides.

[0033] In some examples, the native double-stranded polynucleotide is coupled to the first and second stem-loop adapters using ligation.

[0034] In some examples, the first forked adapter is coupled to the first partial construct using ligation, and the second forked adapter is coupled to the second partial construct using ligation.

[0035] Some examples herein provide another method of making a construct. The method may include coupling a native double-stranded polynucleotide including a sense strand and an antisense strand to first and second adapters. The first adapter may include a first stem-loop adapter, and the second adapter may include a target sequence for in situ enzymatic loop formation and may lack any loop. The method may include coupling a forked adapter to the second adapter using the target sequence. The method may include dehybridizing the sense strand from the antisense strand. The first stem-loop adapter may couple the sense strand to the antisense strand after the dehybridizing. The method may include synthesizing a complement of the sense strand hybridized to the sense strand. The method may include synthesizing a complement of the antisense strand hybridized to the antisense strand. The method may include forming a second loop coupling the sense strand to the complement of the sense strand.

[0036] In some examples, the native double-stranded polynucleotide is coupled to the first adapter using a first transposase, and is coupled to the second adapter using a second transposase.

[0037] In some examples, dehybridizing the sense strand from the antisense strand, synthesizing the complement of the sense strand, and synthesizing the complement of the antisense strand include using a strand-displacing polymerase.

[0038] In some examples, the forked adapter includes a 3' steric lock.

[0039] In some examples, the first stem-loop adapter and / or the forked adapter respectively include unique molecular identifiers (UMIs).

[0040] In some examples, the sense strand includes one or more epigenetic marks, and the complement of the sense strand does not include any epigenetic marks, and the antisense strandincludes one or more epigenetic marks, and the complement of the antisense strand does not include any epigenetic marks.

[0041] In some examples, the complement of the sense strand and the complement of the antisense strand are synthesized using only unmodified nucleotides. In some other examples, the complement of the sense strand and the complement of the antisense strand are synthesized using modified nucleotides.

[0042] Some examples herein provide a construct. The construct may include a sense strand. The construct may include an antisense strand that is complementary to the sense strand, is not hybridized to the sense strand, and is coupled to the sense strand via an adapter. The construct may include a complement of the sense strand that is hybridized to the sense strand. The construct may include a complement of the antisense strand that is hybridized to the antisense strand. The construct may include a loop coupling the sense strand to the complement of the sense strand.

[0043] In some examples, the sense strand includes one or more epigenetic marks, and the complement of the sense strand does not include any epigenetic marks, and the antisense strand includes one or more epigenetic marks, and the complement of the antisense strand does not include any epigenetic marks.

[0044] Some examples herein provide another method of making a construct. The method may include coupling a native single-stranded polynucleotide to first and second adapters. The first adapter may include a target sequence and the second adapter may include a primer. The method may include, using the primer, synthesizing a complement of the single-stranded polynucleotide and a complement of the target sequence. The method may include coupling the target sequence to the complement of the target sequence to form a stem-loop adapter.

[0045] In some examples, the native single- stranded polynucleotide is coupled to the first and second adapters using ligation.

[0046] In some examples, the forked adapter includes a 5' steric lock.

[0047] In some examples, the first and second adapters respectively include unique molecular identifiers (UMIs).

[0048] In some examples, the native single-stranded polynucleotide includes one or more epigenetic marks, and the complement of the single-stranded polynucleotide does not include any epigenetic marks.

[0049] In some examples, the complement of the native single-stranded polynucleotide is synthesized using only unmodified nucleotides.

[0050] In some examples, the second adapter includes a 3' steric lock.

[0051] In some examples, the polynucleotide includes RNA, and the complement of the polynucleotide includes cDNA. In some other examples, the polynucleotide includes cDNA, and the complement of the polynucleotide includes RNA.

[0052] It is to be understood that any respective features / examples of each of the aspects of the disclosure as described herein may be implemented together in any appropriate combination, and that any features / examples from any one or more of these aspects may be implemented together with any of the features of the other aspect(s) as described herein in any appropriate combination to achieve the benefits as described herein.BRIEF DESCRIPTION OF DRAWINGS

[0053] FIGS. 1A-1H schematically illustrate use of an example sequencing system, and example compositions and operations, for sequencing a full-complement polynucleotide using a nanopore.

[0054] FIG. 2A schematically illustrates the formation of transient secondary structures on the second side of the nanopore when sequencing a polynucleotide using a nanopore.

[0055] FIG. 2B schematically illustrates an example manner in which a full-complement polynucleotide may inhibit the formation of transient secondary structures when sequencing that full-complement polynucleotide using a nanopore.

[0056] FIG. 3 A schematically illustrates the formation of a secondary structure on the first side of the nanopore when sequencing a full-complement polynucleotide using the nanopore.

[0057] FIG. 3B schematically illustrates an example manner in which the force applied and duration of the force applied to a full-complement polynucleotide may be adjusted to inhibit the formation of a secondary structure on the first side of the nanopore when sequencing the fullcomplement polynucleotide using the nanopore.

[0058] FIGS. 4A-4B schematically illustrate use of the sequencing system of FIGS. 1 A-1H to resequence the same full-complement polynucleotide.

[0059] FIG. 5 illustrates a flow of operations in an example method for sequencing a fullcomplement polynucleotide.

[0060] FIG. 6 schematically illustrates an example workflow for generating a full-complement polynucleotide for sequencing.

[0061] FIG. 7 schematically illustrates an example manner in which a full-complement polynucleotide may be loaded into the sequencing system of FIGS. 1A-1H for sequencing.

[0062] FIGS. 8A-8C illustrate example values of electrical characteristics that may be measured using the system of FIGS. 1A-1H.

[0063] FIG. 8D illustrates an example N-dimensional read map of electrical characteristics that may be used to identify nucleotides using the system of FIGS. 1 A-1H.

[0064] FIG. 9 illustrates an example flow of operations in a method for generating a sequence of a target polynucleotide using a first plurality of measured values from the polynucleotide and a second plurality of measured values from its complement.

[0065] FIG. 10 schematically illustrates example circuitry that may be used in the system of FIGS. 1A-1H.

[0066] FIG. 11 A illustrates example current signals obtained from a polynucleotide and its complement using the system of FIGS. 1A-1H.

[0067] FIG. 1 IB schematically illustrates alignment and joint decoding of the current signals ofFIG. 11 A.

[0068] FIG. 12A schematically illustrate example polynucleotides using fragments of the PhiX genome, prepared for nanopore sequencing using the system of FIGS. 1A-1H.

[0069] FIG. 12B schematically illustrates the polynucleotide of FIG. 12A locked to a nanopore.

[0070] FIGS. 13A-13B schematically illustrate example polynucleotides and complements, and measured accuracy rates for separately and jointly decoding those sequences using the system of FIGS. 1A-1H.

[0071] FIG. 14 schematically illustrates a workflow for preparing a Lambda polynucleotide for nanopore sequencing using the system of FIGS. 1A-1H.

[0072] FIG. 15A schematically illustrate example polynucleotides and complements.

[0073] FIGS. 15B schematically illustrates measured accuracy rates for separately and jointly decoding the sequences of FIG. 15A using the system of FIGS. 1A-1H.

[0074] FIG. 15C schematically illustrates example signals, and errors, obtained from the sequences of FIG. 15A using the system of FIGS. 1A-1H.

[0075] FIG. 16A illustrates example signals obtained using the system of FIGS. 1A-1H without use of a complement.

[0076] FIG. 16B illustrates example signals obtained using the system of FIGS. 1A-1H with use of a complement.

[0077] FIG. 17A illustrates a secondary structure prediction and example signals obtained using the system of FIGS. 1A-1H without use of an elevated temperature.

[0078] FIG. 17B illustrates a secondary structure prediction and example signals obtained using the system of FIGS. 1A-1H with use of an elevated temperature.

[0079] FIGS. 18A-18B illustrate example signals obtained using sequences with different epigenetic marks than one another

[0080] FIG. 19 schematically illustrates an example workflow for generating a full-complement polynucleotide for sequencing where top and bottom native strands, possibly including modified bases, are linked to unmodified synthetic reverse-complement copies of the top and bottom strands.

[0081] FIG. 20 schematically illustrates an example workflow for generating a full-complement polynucleotide for native RNA sequencing that may include modified bases in a native RNA strand and unmodified bases in a synthetic cDNA strand.

[0082] FIGS. 21A-21B schematically illustrate an example workflow for generating a fullcomplement polynucleotide for native RNA sequencing that includes the native RNA strand, a direct-repeat RNA synthetic copy of the native RNA, and cDNA copies of both native and synthetic RNA strands.

[0083] FIG. 22 illustrates example forked adapters with optional blockers.

[0084] FIG. 23 schematically illustrates and example workflow for generating a forward-forward tandem sequencing polynucleotide.DETAILED DESCRIPTION

[0085] Sequencing full-complement polynucleotides using nanopores is provided herein.

[0086] More specifically, in a manner such as described in greater detail below, a construct that includes a target polynucleotide and its complement (together, a “full-complement polynucleotide”) is disposed through the aperture of a nanopore. A first duplex is formed with a portion of the construct, on a first side of the nanopore. A force then is applied that lodges the first duplex within the aperture of the nanopore, and an electrical measurement is made. The particular value of that measurement is based on the particular complementary bases that are located at the 3' end of the first duplex, and the particular sequence of bases that are in a singlestranded portion of the construct, within the aperture of the nanopore. Accordingly, the particular measured value provides information from which the sequence of the bases in theconstruct may be determined. A force then is applied that dislodges the first duplex from within the aperture of the nanopore so that the first duplex may be extended by a nucleotide, and the measurement repeated. The measurements for the target polynucleotide and its complement may be obtained using the same, first duplex, or the measurement for the complement may be obtained using a second duplex which is different from the first duplex. In either case, the repeated measurements provide further information from which the sequence of the bases in the construct may be determined. For example, measured values from the target polynucleotide and from its complement may be aligned and used together to obtain the sequence of the target nucleotide with significantly higher accuracy than if only the target nucleotide (or its complement) was sequenced.

[0087] It will be appreciated that the present subject matter may be used to sequence fullcomplement polynucleotides - such as DNA or RNA constructs - using relatively few reagents and without the need for optical components that otherwise may add cost, weight, and complexity. The present subject matter may be used to identify modified bases, such as methylated bases, without the need to chemically or enzymatically modify the modified bases. The present subject matter is compatible with relatively long reads, e.g., of up to about 1,000 bases, or up to about 2,000 bases, or up to about 5,000 bases, or even up to 10,000 bases or more. The present subject matter overcomes the homopolymer problem traditionally associated with strand-based nanopore sequencing, for improved accuracy of sequencing areas that contain repeating nucleotides. The present subject matter provides for controllable translocation of polynucleotide constructs through a nanopore, thus inhibiting or preventing translocation events that are too fast to go undetected and that may lead to deletion errors or other types of errors that detrimentally affect accuracy. These and other problems are solved by the present systems, compositions, and methods, as will be appreciated from the present disclosure.

[0088] First, some terms used herein will be briefly explained. Then, some example systems, compositions, and methods for sequencing full-complement polynucleotides using nanopores will be described.Terms

[0089] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. The use of the term “including” as well as other forms, such as “include,” “includes,” and “included,” is not limiting. The use of the term “having” as well as other forms, such as “have,” “has,” and “had,” is not limiting. As used in this specification, whether in a transitional phrase or in the body of the claim, the terms “comprise(s)” and “comprising” are to be interpreted as having an open-ended meaning. That is, the above terms are to be interpreted synonymously with the phrases “having at least” or “including at least.” For example, when used in the context of a process, the term “comprising” means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound, composition, or system, the term “comprising” means that the compound, composition, or system includes at least the recited features or components, but may also include additional features or components.

[0090] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.

[0091] The terms “substantially,” “approximately,” and “about” used throughout this specification are used to describe and account for small fluctuations, such as due to variations in processing. For example, they may refer to less than or equal to ±10%, such as less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%.

[0092] As used herein, the term “nucleotide” is intended to mean a molecule that includes a sugar and at least one phosphate group, and in some examples also includes a nucleobase. A nucleotide that lacks a nucleobase may be referred to as “abasic .” Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), guanosinemonophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP).

[0093] As used herein, the term “nucleotide” also is intended to encompass any nucleotide analogue which is a type of nucleotide that includes a modified nucleobase, sugar, backbone, and / or phosphate moiety compared to naturally occurring nucleotides. Nucleotide analogues also may be referred to as “modified nucleic acids.” Example modified nucleobases include inosine, xanthine, hypoxanthine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5- hydroxymethyl cytosine, 2-aminoadenine, 6-methyl adenine, 6-methyl guanine, 2-propyl guanine, 2-propyl adenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15- halocytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil, 4-thiouracil, 8-halo adenine or guanine, 8-amino adenine or guanine, 8-thiol adenine or guanine, 8-thioalkyl adenine or guanine, 8-hydroxyl adenine or guanine, 5-halo substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7- deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3 -deazaadenine or the like. As is known in the art, certain nucleotide analogues cannot become incorporated into a polynucleotide, for example, nucleotide analogues such as adenosine 5'-phosphosulfate. Nucleotides may include any suitable number of phosphates, e.g., three, four, five, six, or more than six phosphates. Nucleotide analogues also include locked nucleic acids (LNA), peptide nucleic acids (PNA), and 5- hydroxylbutynl-2'-deoxyuridine (“super T”).

[0094] As used herein, the term “polynucleotide” refers to a molecule that includes a sequence of nucleotides that are bonded to one another. A polynucleotide is one nonlimiting example of a polymer. Examples of polynucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and analogues thereof such as locked nucleic acids (LNA) and peptide nucleic acids (PNA). A polynucleotide may be a single stranded sequence of nucleotides, such as RNA orsingle stranded DNA, a double stranded sequence of nucleotides, such as double stranded DNA, or may include a mixture of a single stranded and double stranded sequences of nucleotides. Double stranded DNA (dsDNA) includes genomic DNA, and PCR and amplification products. Single stranded DNA (ssDNA) can be converted to dsDNA and vice-versa. Polynucleotides may include non-naturally occurring DNA, such as enantiomeric DNA, LNA, or PNA. The precise sequence of nucleotides in a polynucleotide may be known or unknown. The following are examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, expressed sequence tag (EST) or serial analysis of gene expression (SAGE) tag), genomic DNA, genomic DNA fragment, exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombinant polynucleotide, synthetic polynucleotide, branched polynucleotide, plasmid, vector, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probe, primer or amplified copy of any of the foregoing.

[0095] As used herein, a polynucleotide that is coupled to its complement may be referred to as a “full-complement polynucleotide.” The polynucleotide may be coupled to its complement in any suitable manner, for example via an oligonucleotide that is disposed between, and coupled to each of, the polynucleotide and its complement. A molecule that contains the full-complement polynucleotide, as well as any structure coupling the polynucleotide to its complement, may be referred to herein as a “construct.”

[0096] As used herein, a “polymerase” is intended to mean an enzyme having an active site that assembles polynucleotides by polymerizing nucleotides into polynucleotides. A polymerase can bind a primer and a single stranded target polynucleotide, and can sequentially add nucleotides to the growing primer to form a “complementary copy” polynucleotide having a sequence that is complementary to that of the target polynucleotide. DNA polymerases may bind to the target polynucleotide and then move down the target polynucleotide sequentially adding nucleotides to the free hydroxyl group at the 3' end of a growing polynucleotide strand. DNA polymerases may synthesize complementary DNA molecules from DNA templates. RNA polymerases may synthesize RNA molecules from DNA templates (transcription). Other RNA polymerases, such as reverse transcriptases, may synthesize cDNA molecules from RNA templates. Still other RNA polymerases may synthesize RNA molecules from RNA templates, such as RdRP. Polymerases may use a short RNA or DNA strand (primer), to begin strand growth. Somepolymerases may displace the strand upstream of the site where they are adding bases to a chain. Such polymerases may be said to be strand displacing, meaning they have an activity that removes a complementary strand from a template strand being read by the polymerase.

[0097] Example DNA polymerases include Bst DNA polymerase, 9° Nm DNA polymerase, Phi29 DNA polymerase, DNA polymerase I (E. coll), DNA polymerase I (Large), (Klenow) fragment, Klenow fragment (3 '-5' exo-), T4 DNA polymerase, T7 DNA polymerase, Deep VentR™ (exo-) DNA polymerase, Deep VentR™ DNA polymerase, DyNAzyme™ EXT DNA, DyNAzyme™ II Hot Start DNA Polymerase, Phusion™ High-Fidelity DNA Polymerase, Therminator™ DNA Polymerase, Therminator™ II DNA Polymerase, VentR® DNA Polymerase, VentR® (exo-) DNA Polymerase, RepliPHI™ Phi29 DNA Polymerase, rBst DNA Polymerase, rBst DNA Polymerase (Large), Fragment (IsoTherm™ DNA Polymerase), MasterAmp™ AmpliTherm™, DNA Polymerase, Taq DNA polymerase, Tth DNA polymerase, TH DNA polymerase, Tgo DNA polymerase, SP6 DNA polymerase, Tbr DNA polymerase, DNA polymerase Beta, ThermoPhi DNA polymerase, and Isopol™ SD+ polymerase. In specific, nonlimiting examples, the polymerase is selected from a group consisting of Bst, Bsu, and Phi29. Some polymerases have an activity that degrades the strand behind them (31exonuclease activity). Some useful polymerases have been modified, either by mutation or otherwise, to reduce or eliminate 3' and / or 5' exonuclease activity.

[0098] Example RNA polymerases include RdRps (RNA dependent, RNA polymerases) that catalyze the synthesis of the RNA strand complementary to a given RNA template. Example RdRps include polioviral 3Dpol, vesicular stomatitis virus L, and hepatitis C virus NS5B protein. Example RNA Reverse Transcriptases. A non-limiting example list to include are reverse transcriptases derived from Avian Myelomatosis Virus (AMV), Murine Moloney Leukemia Virus (MMLV) and / or the Human Immunodeficiency Virus (HIV), telomerase reverse transcriptases such as (hTERT), SuperScript™ III, SuperScript™ IV Reverse Transcriptase, ProtoScript® II Reverse Transcriptase.

[0099] As used herein, the term “transposase” is intended to mean an enzyme that, under certain conditions, is capable of coupling an oligonucleotide to a double-stranded polynucleotide. The oligonucleotide includes at least a mosaic end (ME) sequence, which also may be referred to as atransposition end (TE). A “transposome” or “transposition system” is intended to refer to a transposase that is coupled to a respective oligonucleotide including at least an ME sequence. For example, the combination of a transposase and transposon end may be referred to as a “transposome.” A transposome may be activated, under certain conditions, to cut a doublestranded polynucleotide and to couple the oligonucleotide to the cut end. For example, the transposome and the double-stranded polynucleotide may form a “transposition complex” wherein the transposome inserts the oligonucleotide into the double-stranded polynucleotide. In some examples, a transposome may perform a process that may be referred to as “tagmentation” or “transposition” that results in fragmentation of the target polynucleotide and ligation of adapters to the 5' end of both strands of double-stranded DNA fragments, or to the 5' and 3' ends, e.g., in a manner such as described in U.S. 2010 / 0120098 or in WO 2010 / 048605, the entire contents of each of which are incorporated by reference herein.

[0100] One nonlimiting example of a transposase is Tn5. Another nonlimiting example of a transposase is Tn3. Another nonlimiting example of a transposase is Mu. In still further examples, transposases may include integrases from retrotransposons or retroviruses. Other examples of known transposition complexes (or components thereof) that may be used in the present methods include, but are not limited to, Staphylococcus aureus Tn552, Tyl, Transposon Tn7, Tn / O and IS10, Mariner transposase, Tel, P Element, Tn3, bacterial insertion sequences, retroviruses, and retrotransposon of yeast (see, e g., Colegio et al., 2001, J. Bacteriol. 183: 2384- 8; Kirby et al., 2002, Mol. Microbiol. 43: 173-86; Devine and Boeke, 1994, Nucleic Acids Res., 22: 3765-72; International Patent Application No. WO 95 / 23875; Craig, 1996, Science 271 : 1512; Craig, 1996, Review in: Curr Top Microbiol Immunol. 204: 27-48; Kleckner et al., 1996, Curr Top Microbiol Immunol. 204: 49-82; Lampe et al., 1996, EMBO J. 15: 5470-9; Plasterk, 1996, Curr Top Microbiol Immunol 204: 125-43; Gloor, 2004, Methods Mol. Biol. 260: 97-114; Ichikawa and Ohtsubo, 1990, J Biol. Chem. 265: 18829-32; Ohtsubo and Sekine, 1996, Curr. Top. Microbiol. Immunol. 204: 1-26; Brown et al., 1989, Proc Natl Acad Sci USA 86: 2525-9; and Boeke and Corces, 1989, Annu Rev Microbiol. 43: 403-34). Still other example transposition systems include, but are not limited to, those formed by a hyperactive Tn5 transposase and a Tn5-type transposon end or by a MuA transposase and a Mu transposon end including R1 and R2 end sequences; see, e.g., the following references, the entire contents of each of which are incorporated by reference herein: Goryshin et al., “Tn5 in vitro transposition,”J. Biol. Chem. 273: 7367-7394 (1998); Mizuuchi, “In vitro transposition of bacteriophage Mu: a biochemical approach to a novel replication reaction,” Cell 35(3 pt 2): 785-794 (1983); and Savilahti et al., “The phage Mu transposomes core: DNA requirements for assembly and function,” EMBO J. 14(19): 4893-4903 (1995). Transposases may be mutated to modulate their activity and / or the ME sequence may be changed to modulate the transposome’ s activity in a manner such as described in Reznikoff, “Tn5 as a model for understanding DNA transposition,” Mol. Microbiol. 47(5): 1199-1206 (2003), the entire contents of which are incorporated by reference herein.

[0101] Still further examples of transposases and other suitable transposition systems include Staphylococcus aureus Tn552 (see, e.g., Colegio et al., “In vitro transposition system for efficient generation of random mutants of Campylobacter jejuni,” J Bacteriol. 183: 2384-2388 (2001) and Kirby et al., “Cryptic plasmids of Mycobacterium avium: Tn552 to the rescue,” Mol Microbiol., 43(1): 173-186 (2002)); Tyl (Devine et al., “Efficient integration of artificial transposons into plasmid targets in vitro: a useful tool for DNA mapping, sequencing and genetic analysis,” Nucleic Acids Res. 22(18): 3765-3772 (1994) and International Patent Application No. WO 95 / 23875); Transposon Tn7 (Craig, “V(D)J recombination and transposition: Closer than expected,” Science 271(5255): 1512 (1996) and Craig, Review in: Curr Top Microbiol Immunol, 204: 27-48 (1996)); TnlO and IS1O (Kleckner et al., Curr Top Microbiol Immunol, 204: 49-82 (1996)); Mariner transposase (Lampe et al., “A purified mariner transposase is sufficient to mediate transposition in vitro,” EMBO J. 15(19): 5470-5479 (1996)); Tci (Plasterk, Curr Top Microbiol Immunol, 204: 125-143 (1996)), P Element (Gloor, “Gene targeting in Drosophila,” Methods Mol Biol 260: 97-114 (2004)); TnJ (Ichikawa et al., “In vitro transposition of transposon Tn3,” J Biol Chem. 265(31): 18829-18832 (1990)); bacterial insertion sequences (Ohtsubo et al., “Bacterial insertion sequences,” Curr. Top. Microbiol. Immunol. 204: 1-26 (1996)); retroviruses (Brown et al., “Retroviral integration: Structure of the initial covalent product and its precursor, and a role for the viral IN protein,” Proc Natl Acad Sci USA, 86: 2525-2529 (1989)); and retrotransposon of yeast (Boeke et al., “Transcription and reverse transcription of retrotransposons,” Annu Rev Microbiol. 43: 403-434 (1989). Transposases, transposomes, ME sequences, transposons and transposition systems and complexes are generally known to those of skill in the art, as exemplified by the disclosure of US 2010 / 0120098, the entire contents of which are incorporated by reference herein.

[0102] Some transposomes may include transposase monomers. For example, a single unit (monomeric) Tn3 transposase may bind two target sequences simultaneously and change conformation to form the transposome, e.g., in a manner such as described in Nicolas et al., “Unlocking Tn3-family transposase activity in vitro unveils an asymetric pathway for transposome assembly,” PMAS 114(5): E669-E678 (2017), the entire contents of which are incorporated by reference herein. Some transposomes may include transposase dimers. For example, Tn5 transposases may dimerize in a manner such as described in Naumann et al., “Trans catalysis in Tn5 transposition,” PNAS 97(16): 8944-8949 (2000), the entire contents of which are incorporated by reference herein. Some transposomes may include transposase tetramers. For example, Mu transposases may form tetramers in a manner such as described in Harshey, “Transposable phase Mu,” Microbiol Spectr. 2(5): MDNA3 -0007-2014 doi: 10.1128 / microbiolspec.MDNA3-0007-2014 (22 pages) (2014), and in Lamberg et al., “Efficient insertion mutagenesis strategy for bacterial genomes involving electroporation of in vitro-assembled DNA transposition complexes of bacteriophage Mu,” Appl Environ Microbiol. 68(2): 705-712 (2002), the entire contents of each of which are incorporated by reference herein.

[0103] In the context of a polypeptide, the terms “variant” and “derivative” as used herein refer to a polypeptide that includes an amino acid sequence of a polypeptide or a fragment of a polypeptide, which has been altered by the introduction of amino acid residue substitutions, deletions, or additions. A variant or a derivative of a polypeptide can be a fusion protein which contains part of the amino acid sequence of a polypeptide. The term “variant” or “derivative” as used herein also refers to a polypeptide or a fragment of a polypeptide, which has been chemically modified, e.g., by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, a polypeptide or a fragment of a polypeptide can be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, methylation, nitrosylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. The variants or derivatives are modified in a manner that is different from naturally occurring or starting peptide or polypeptides, either in the type or location of the molecules attached. Variants or derivatives further include deletion of one or more chemical groups which are naturally present on the peptide or polypeptide. A variant or a derivative of a polypeptide or a fragment of a polypeptide can be chemically modified by chemical modifications using techniques known to those of skillin the art, including, but not limited to specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. Further, a variant or a derivative of a polypeptide or a fragment of a polypeptide can contain one or more non-classical amino acids. A polypeptide variant or derivative may possess a similar or identical function as a polypeptide, or a fragment of a polypeptide described herein. A polypeptide variant or derivative may possess an additional or different function compared with a polypeptide or a fragment of a polypeptide described herein.

[0104] As used herein, the terms “unique molecular identifier” and “UMI” are intended to mean an oligonucleotide that may be coupled to a polynucleotide and via which the polynucleotide may be identified. For example, a set of different UMIs may be coupled to a plurality of different polynucleotides, and each of those polynucleotides may be identified using the particular UMI coupled to that polynucleotide. One example of a UMI is a “barcode”.

[0105] As used herein, the term “primer” is defined as a polynucleotide to which nucleotides may be added via a free 3' OH group. A primer may include a 3' block inhibiting polymerization until the block is removed. A primer may include a modification at the 5' terminus to allow a coupling reaction or to couple the primer to another moiety. A primer may include one or more moieties, such as 8-oxo-G, which may be cleaved under suitable conditions, such as UV light, chemistry, enzyme, or the like. The primer length may be any suitable number of bases long and may include any suitable combination of natural and non-natural nucleotides. A target polynucleotide may include an “amplification adapter” or, more simply, an “adapter,” that hybridizes to (has a sequence that is complementary to) a primer, and may be amplified so as to generate a complementary copy polynucleotide by adding nucleotides to the free 3' OH group of the primer.

[0106] In other contexts herein, the term “adapter” may be intended to refer to an oligonucleotide that is coupled to a polynucleotide, e.g., is ligated or tagmented to a polynucleotide. In some examples, the oligonucleotide may be synthetic, and the polynucleotide to which it is coupled may be either native (that is, obtained from an organism) or synthetic (e.g., is generated by synthesizing a complementary copy of a native polynucleotide). Adapters may be used for a variety of purposes, such as will be apparent from the following disclosure.

[0107] As used herein, the term “plurality” is intended to mean a population of two or more different members. Pluralities may range in size from small, medium, large, to very large. The size of small plurality may range, for example, from a few members to tens of members. Medium sized pluralities may range, for example, from tens of members to about 100 members or hundreds of members. Large pluralities may range, for example, from about hundreds of members to about 1000 members, to thousands of members and up to tens of thousands of members. Very large pluralities may range, for example, from tens of thousands of members to about hundreds of thousands, a million, millions, tens of millions and up to or greater than hundreds of millions of members. Therefore, a plurality may range in size from two to well over one hundred million members as well as all sizes, as measured by the number of members, in between and greater than the above example ranges. Example polynucleotide pluralities include, for example, populations of about I xlO5or more, 5x l0?or more, or I x lO6or more different polynucleotides. Accordingly, the definition of the term is intended to include all integer values greater than two. An upper limit of a plurality may be set, for example, by the theoretical diversity of polynucleotide sequences in a sample.

[0108] As used herein, the term “double-stranded,” when used in reference to a polynucleotide, is intended to mean that all or substantially all of the nucleotides in the polynucleotide are hydrogen bonded to respective nucleotides in a complementary polynucleotide. A doublestranded polynucleotide also may be referred to as a “duplex.”

[0109] As used herein, the term “single- stranded,” when used in reference to a polynucleotide, means that essentially none of the nucleotides in the polynucleotide are hydrogen bonded to a respective nucleotide in a complementary polynucleotide.

[0110] As used herein, the term “target polynucleotide” is intended to mean a polynucleotide that is the object of an analysis or action, and may also be referred to using terms such as “library polynucleotide,” “template polynucleotide,” “library template,” or “template.” The analysis or action includes subjecting the polynucleotide to amplification, sequencing and / or other procedure. A target polynucleotide may include nucleotide sequences additional to a target sequence to be analyzed. For example, a target polynucleotide may include one or more adapters, including an amplification adapter that functions as a primer binding site, that flank(s) atarget polynucleotide sequence that is to be analyzed. In particular examples, target polynucleotides may have different sequences than one another but may have first and second adapters that are the same as one another. The two adapters that may flank a particular target polynucleotide sequence may have the same sequence as one another, or complementary sequences to one another, or the two adapters may have different sequences. Thus, species in a plurality of target polynucleotides may include regions of known sequence that flank regions of unknown sequence that are to be evaluated by, for example, sequencing (e.g., SBS). In some examples, target polynucleotides carry an amplification adapter at a single end, and such adapter may be located at either the 3' end or the 51end the target polynucleotide. Target polynucleotides may be used without any adapter, in which case a primer binding sequence may come directly from a sequence found in the target polynucleotide.[0U1] The terms “polynucleotide” and “oligonucleotide” are used interchangeably herein. The different terms are not intended to denote any particular difference in size, sequence, or other property unless specifically indicated otherwise. For clarity of description, the terms may be used to distinguish one species of polynucleotide from another when describing a particular method or composition that includes several polynucleotide species.

[0112] As used herein, the term “substrate” refers to a material used as a support for compositions described herein. Example substrate materials may include glass, silica, plastic, quartz, metal, metal oxide, organo-silicate (e.g., polyhedral organic silsesquioxanes (POSS)), polyacrylates, tantalum oxide, complementary metal oxide semiconductor (CMOS), or combinations thereof. An example of POSS can be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In some examples, substrates used in the present application include silica-based substrates, such as glass, fused silica, or other silica-containing material. In some examples, silica-based substrates can include silicon, silicon dioxide, silicon nitride, or silicone hydride. In some examples, substrates used in the present application include plastic materials or components such as polyethylene, polystyrene, poly(vinyl chloride), polypropylene, nylons, polyesters, polycarbonates, and poly(methyl methacrylate). Example plastics materials include poly(methyl methacrylate), polystyrene, and cyclic olefin polymer substrates. In some examples, the substrate is or includes a silica-based material or plastic material or a combination thereof. Inparticular examples, the substrate has at least one surface including glass or a silicon-based polymer. In some examples, the substrates can include a metal. In some such examples, the metal is gold. In some examples, the substrate has at least one surface including a metal oxide. In one example, the surface includes a tantalum oxide or tin oxide. Acrylamides, enones, or acrylates may also be utilized as a substrate material or component. Other substrate materials can include, but are not limited to gallium arsenide, indium phosphide, aluminum, ceramics, polyimide, quartz, resins, polymers and copolymers. In some examples, the substrate and / or the substrate surface can be, or include, quartz. In some other examples, the substrate and / or the substrate surface can be, or include, semiconductor, such as GaAs or ITO. The foregoing lists are intended to be illustrative of, but not limiting to the present application. Substrates can include a single material or a plurality of different materials. Substrates can be composites or laminates. In some examples, the substrate includes an organo-silicate material.

[0113] Substrates can be flat, round, spherical, rod-shaped, or any other suitable shape. Substrates may be rigid or flexible. In some examples, a substrate is a bead or a flow cell.

[0114] Substrates can be non-pattemed, textured, or patterned on one or more surfaces of the substrate. In some examples, the substrate is patterned. Such patterns may include posts, pads, wells, ridges, channels, or other three-dimensional concave or convex structures. Patterns may be regular or irregular across the surface of the substrate. Patterns can be formed, for example, by nanoimprint lithography or by use of metal pads that form features on non-metallic surfaces, for example.

[0115] In some examples, a substrate described herein forms at least part of a flow cell or is located in or coupled to a flow cell. Flow cells may include a flow chamber that is divided into a plurality of lanes or a plurality of sectors. Example flow cells and substrates for manufacture of flow cells that can be used in methods and compositions set forth herein include, but are not limited to, those commercially available from Illumina, Inc. (San Diego, CA).

[0116] As used herein, the term “electrode” is intended to mean a solid structure that conducts electricity. Electrodes may include any suitable electrically conductive material, such as gold, palladium, or platinum, or combinations thereof. In some examples, an electrode may be disposed on a substrate. In some examples, an electrode may define a substrate.

[0117] As used herein, the term “nanopore” is intended to mean a structure that includes an aperture that permits molecules to cross therethrough from a first side of the nanopore to a second side of the nanopore, in which a portion of the aperture of a nanopore has a width of 100 nm or less, e.g., 10 nm or less, or 2 nm or less. The aperture extends through the first and second sides of the nanopore. Molecules that can cross through an aperture of a nanopore can include, for example, ions or water-soluble molecules such as amino acids or nucleotides. The nanopore can be disposed within a barrier, or can be provided through a substrate. Optionally, a portion of the aperture can be narrower than one or both of the first and second sides of the nanopore, in which case that portion of the aperture can be referred to as a “constriction.” Alternatively or additionally, the aperture of a nanopore, or the constriction of a nanopore (if present), or both, can be greater than 0.1 nm, 0.5 nm, 1 nm, 10 nm or more. A nanopore can include multiple constrictions, e.g., at least two, or three, or four, or five, or more than five constrictions, nanopores include biological nanopores, solid-state nanopores, or biological and solid-state hybrid nanopores.

[0118] Biological nanopores include, for example, polypeptide nanopores and polynucleotide nanopores. A “polypeptide nanopore” is intended to mean a nanopore that is made from one or more polypeptides. The one or more polypeptides can include a monomer, a homopolymer or a heteropolymer. Structures of polypeptide nanopores include, for example, an a-helix bundle nanopore and a P-barrel nanopore as well as all others well known in the art. Example polypeptide nanopores include a-hemolysin, Mycobacterium smegmatis porin A, gramicidin A, maltoporin, OmpF, OmpC, PhoE, Tsx, F-pilus, SP1, mitochondrial porin (VDAC), Tom40, outer membrane phospholipase A, CsgG, aerolysin, and Neisseria autotransporter lipoprotein (NalP). Mycobacterium smegmatis porin A (MspA) is a membrane porin produced by Mycobacteria, allowing hydrophilic molecules to enter the bacterium. MspA forms a tightly interconnected octamer and transmembrane beta-barrel that resembles a goblet and includes a central constriction. For further details regarding a-hemolysin, see U.S. 6,015,714, the entire contents of which are incorporated by reference herein. For further details regarding SP1, see Wang et al., Chem. Commun., 49: 1741-1743 (2013), the entire contents of which are incorporated by reference herein. For further details regarding MspA, see Butler et al., “Single-molecule DNA detection with an engineered MspA protein nanopore,” Proc. Natl. Acad. Sci. 105: 20647-20652 (2008) and Derrington et al., “Nanopore DNA sequencing with MspA,” Proc. Natl. Acad. Sci.USA, 107: 16060-16065 (2010), the entire contents of both of which are incorporated by reference herein. Other nanopores include, for example, the MspA homolog from Norcadia farcinica, and lysenin. For further details regarding lysenin, see PCT Publication No. WO 2013 / 153359, the entire contents of which are incorporated by reference herein. For further details regarding aerolysin, see Cao et al., “Single-molecule sensing of peptides and nucleic acids by engineered aerolysin nanopores,” Nature Communications 10: Article number: 4918 (2019), the entire contents of which are incorporated by reference herein.

[0119] A “polynucleotide nanopore” is intended to mean a nanopore that is made from one or more nucleic acid polymers. A polynucleotide nanopore can include, for example, a polynucleotide origami.

[0120] A “solid-state nanopore” is intended to mean a nanopore that is made from one or more materials that are not of biological origin. A solid-state nanopore can be made of inorganic or organic materials. Solid-state nanopores include, for example, silicon nitride (SiN), silicon dioxide (SiCh), silicon carbide (SiC), hafnium oxide (HfCh), molybdenum disulfide (M0S2), hexagonal boron nitride (h-BN), or graphene. A solid-state nanopore may comprise an aperture formed within a solid-state membrane, e.g., a membrane including any such material(s).

[0121] A “biological and solid-state hybrid nanopore” is intended to mean a hybrid nanopore that is made from materials of both biological and non-biological origins. Materials of biological origin are defined above and include, for example, polypeptides and polynucleotides. A biological and solid-state hybrid nanopore includes, for example, a polypeptide-solid-state hybrid nanopore and a polynucleotide-solid-state nanopore.

[0122] As used herein, a “barrier” is intended to mean a structure that normally inhibits passage of molecules from one side of the barrier to the other side of the barrier. The molecules for which passage is inhibited can include, for example, ions or water soluble molecules such as nucleotides and amino acids. However, if a nanopore is disposed within a barrier, then the aperture of the nanopore may permit passage of molecules from one side of the barrier to the other side of the barrier. As one specific example, if a nanopore is disposed within a barrier, the aperture of the nanopore may permit passage of molecules from one side of the barrier to theother side of the barrier. Barriers include membranes of biological origin, such as lipid bilayers, and non-biological barriers such as solid-state membranes or substrates.

[0123] As used herein, “of biological origin” refers to material derived from or isolated from a biological environment such as an organism or cell, or a synthetically manufactured version of a biologically available structure.

[0124] As used herein, “solid-state” refers to material that is not of biological origin.

[0125] As used herein, the term “methylated base” refers to a base that includes a methyl group (-CH3 or -Me) or a derivatized methyl group. For example, “methylcytosine” or “mC” refers to cytosine in DNA (namely, 2'-deoxy cytosine) that includes a methyl group, or is a derivative of methylcytosine. As another example, “methyladenine” or “mA” refers to adenine in DNA that includes a methyl group, or is a derivative of methyladenine. A nonlimiting example of a derivatized methyl group is an oxidized methyl group. A nonlimiting example of an oxidized methyl group is hydroxymethyl (-CH2OH). An mC derivative having a hydroxymethyl group may be referred to as hydroxymethylcytosine or hmC. Another nonlimiting example of an oxidized methyl group is formyl group (-CHO). An mC derivative having a formyl group may be referred to as formylcytosine or fC. Another nonlimiting example of an oxidized methyl group is carboxyl (-COOH). An mC derivative including a carboxyl group may be referred to as carboxycytosine or caC. The methyl group of methylcytosine may be located at the 5 position of the cytosine, in which case the mC may be referred to as 5mC. The oxidized methyl group may be located at the 5 position of the cytosine, in which case the hmC may be referred to as 5hmC, the fC may be referred to as 5fC, or the caC may be referred to as 5caC. The methyl group of methyladenine may be located at the 6 position of the adenine, in which case the mA may be referred to as 6mA.Sequencing full-complement polynucleotides using nanopores

[0126] Some example operations, compositions, and systems for sequencing full-complement polynucleotides using nanopores now will be described with reference to FIGS. 1A-1H, 2A-2B, 3A-3B, 4A-4B, 5, 6, 7, 8A-8C, 9, and 10.

[0127] As provided herein, base calling accuracy may be improved using complementary information, such as from both a target polynucleotide and its complement which are coupled together in the present constructs, and jointly decoded in the present operations and systems. Improved accuracy may be obtained because the errors that occur in either of the polynucleotide or its complement do not always occur on both at the same position. This is generally the case whether there is a random error or a systematic error. As a result, there are fewer errors in the jointly decoded base calls made using the present nanopore sequencing. Additionally, or alternatively, the present constructs may form stable hairpins on the second side of the nanopore which inhibit transient secondary structures from forming that may otherwise add noise to the measurement, and accordingly provide for still more accurate base calling.

[0128] These and other benefits of the present operations, compositions, and systems will be apparent from the disclosure herein.

[0129] FIGS. 1A-1H schematically illustrate use of an example sequencing system, and example compositions and operations, for sequencing a full-complement polynucleotide using a nanopore.

[0130] Referring now to FIG. 1A, sequencing system 100 may include nanopore 110, construct 150, polynucleotide 140 that is hybridized to first portion 155 of construct 150 to form first duplex 154, and circuitry 160. Construct 150 may include target polynucleotide 158 that it is desired to sequence (e.g., that may be unknown), and complement 159 of target polynucleotide 158 (which also may have an unknown) sequence. Together, target polynucleotide 158 and its complement 159 may be referred to as a “full-complement polynucleotide.” Target polynucleotide 158 and complement 159 may be coupled to one another in any suitable manner, e.g., via a linker, an oligonucleotide (e.g., a hairpin such as described with reference to FIG. 6), or other suitable structure.

[0131] In some examples, e.g., such as described below with reference to FIG. 19, polynucleotide 158 is, consists essentially of, or includes DNA, and complement 159 is, consists essentially of, or includes DNA. In other examples, e.g., such as described below with reference to FIG. 20, target polynucleotide 158 is, consists essentially of, or includes RNA, and complement 159 is, consists essentially of, or includes cDNA. Additionally, in a manner such as described below with reference to FIGS. 19 and 21A-21B, construct 150 optionally may includean additional polynucleotide and a complement thereof, where the additional polynucleotide may be related to polynucleotide 158. For example, construct 150 may include both the sense strand and the antisense strand of a native polynucleotide (either or both of which may be considered a target polynucleotide 158), and may include complements of each of the sense strand and the antisense strand (either or both of which may be considered complement 159).

[0132] In some examples, construct 150 also includes structure 157 coupling target polynucleotide 158 to its complement 159. In the nonlimiting example illustrated in FIGS. 1A- 1H, structure 157 includes any suitable number of nucleotides, collectively referred to and illustrated as “X.” In various examples, structure 157 may include one nucleotide, or two or more nucleotides, e.g., three, four, five, six, seven, eight, nine, ten, or more than ten nucleotides. In other examples, structure 157 may include a polymer is made only partially of nucleotides, or which does not include nucleotides at all. Illustratively, structure 157 may include a polymer including or made up of any suitable number of Spacer 18 (Sp 18) molecules. Spacer 18 is an 18- atom hexa-ethyleneglycol spacer which is commercially available, e.g., from Integrated DNA Technologies (IDT, Coralville, Iowa).

[0133] Nanopore 110 may be disposed within barrier 101 and may include first side 111, second side 112, and aperture 113 extending through the first and second sides. Optionally, in some examples, nanopore 1 10 may include constriction 1 14 within aperture 113. Aperture 113 of nanopore 110 may provide a pathway for fluid 120 and / or fluid 120’ to flow through barrier 101. Nanopore 110 may include a solid-state nanopore, a biological nanopore (e.g., MspA such as illustrated in FIG. 1A), or a biological and solid-state hybrid nanopore. In the nonlimiting example illustrated in FIG. 1 A, nanopore 110 may be oriented so that first side 111 of the nanopore includes the majority of aperture 113, such that 3' end 153 of first duplex 154 may fit relatively deeply within aperture 113 so as to be relatively inaccessible to fluid 120 and thus may not be acted upon by any polymerase in the fluid in a manner such as will be described with reference to FIG. IB.

[0134] Barrier 101 may have any suitable structure that normally inhibits passage of molecules from one side of the barrier to the other side of the barrier, e.g., that normally inhibits contact between fluid 120 and fluid 120’. For example, as illustrated in FIG. 1A, barrier 101 mayinclude first layer 107 and second layer 108, one or both of which inhibit the flow of molecules across that layer. Illustratively, barrier 101 may include a lipid bilayer including lipid layers 107 and 108. However, it will be appreciated that barrier 101 may include any suitable structure(s), any suitable material(s), and any suitable number of layers. For example, barrier 101 may include a solid-state barrier, which may include a single layer or multiple layers. Nonlimiting examples of materials that may be used in barriers are provided elsewhere herein. Nonlimiting examples and properties of barriers, nanopores, and nanopore sequencing methods are described elsewhere herein, as well as in the following references, the entire contents of each of which are incorporated by reference herein: US 9,708,655; WO2023 / 049682; WO2023 / 187104;WO2023 / 187112; WO2023 / 187081; WO2023 / 187111; WO2023 / 187106; W02023 / 187110; and PCT / US2024 / 027393.

[0135] Construct 150 may include, for example, DNA and / or RNA. Construct 150 may be disposed through aperture 113 of nanopore 110 such that a first portion 155 of the construct 150 is located, optionally entirely, on first side 111 of the nanopore. The 3' end of construct 150 may be located on the first side 111 of nanopore 110, and the 5' end of construct 150 may be located on the second side 112 of nanopore 110. Optionally, the 3' end of construct 150 may be coupled to, or may include, a first steric lock 151. First steric lock 151 is sufficiently large as not to be able to pass through nanopore 110 or feature thereof (e g., through constriction 114), thus retaining that end on the first side of the nanopore. As an additional or alternative option, the 5' end of construct 150 may be located on second side 112 of nanopore 110 and may be coupled to, or may include a second steric lock 152. Second steric lock 152 is sufficiently large as not to be able to pass through constriction 114 (such as an oligonucleotide hybridized to construct 150), thus retaining the second end of construct 150 on the second side of the nanopore. As such, regardless of the polarity of a bias voltage that circuitry 160 may apply to electrodes 102 and 103 during the operating modes illustrated in FIGS. 1A-1H, construct 150 may remain associated with nanopore 110 during this operating mode. Nonlimiting examples of methods of making construct 150, and example configurations of construct 150, will be described with reference to FIG. 6.

[0136] Polynucleotide 140 may include, for example, DNA and / or RNA. Polynucleotide 140 may include, for example, a primer hybridized to the first portion of construct 150 to form firstduplex 154. The first duplex 154 between polynucleotide 140 and the first portion of construct 150 may be located, optionally entirely, on first side 111 of the nanopore, and may include 3' end 153. In this nonlimiting example, 3' end 153 includes the base pair GC, and it is desired to identify the C as being at this location of the sequence of construct 150, in addition to the sequence of other nucleotides in construct 150. In some examples, the G nucleotide 121 was incorporated into polynucleotide 140 in a prior step based on the sequence of construct 150 using a polymerase, in a manner such as described in greater detail below with reference to FIG. 1C. In other examples, the G nucleotide 121 is part of a primer. Single-stranded second portion 156 of construct 150 (e.g., bases A and T) is not hybridized to polynucleotide 140. Bases of polynucleotide 140 and construct 150 that are not specifically illustrated or labeled should be understood to be present, but omitted for simplicity of illustration.

[0137] The hybridization between polynucleotide 140 and the first portion 155 of construct 150 may be sufficiently strong that, regardless of any bias voltage that circuitry 160 may apply to electrodes 102 and 103 during certain operating modes, the first duplex may remain substantially intact. However, in a manner such as will be described further below with reference to FIGS. 4A-4B, circuitry 160 may be configured to have another operating mode in which the circuitry applies a sufficiently strong force to dissociate polynucleotide 140 from construct 150 so as to make construct 150 available to be re-sequenced using another polynucleotide 140, optionally using the same set of measurement conditions or a different set of measurement conditions.

[0138] In the operating mode illustrated in FIG. IB, circuitry 160 may apply a first force (Fl) disposing the 3' end 153 of first duplex 154 within aperture 113. Nanopore 110 inhibits translocation of 3' end 153 of first duplex 154 to the second side of the nanopore while the first force is applied. For example, at the particular moment illustrated in FIG. IB, circuitry 160 applies a first force Fl (such as a first voltage across nanopore 110) that moves first duplex 154 towards the second side 112 of nanopore 110, while constriction 114 or other feature of nanopore 110 inhibits the passage of 3' end 153 of the first duplex to the second side of the nanopore. In the example illustrated in FIG. IB, first duplex 154 may be wider than constriction 114, and thus sterically hindered from passing through constriction 114. However, it should be appreciated that any suitable portion(s) of nanopore 110 may be used to inhibit the 3' end 153 of first duplex 154 from passing to the second side of the nanopore.

[0139] As should be understood from the presence of first duplex 154 during the operating mode illustrated in FIG. IB, first force Fl is selected so as to be insufficient to cause dissociation of first duplex 154, e.g., dehybridization of polynucleotide 140 from construct 150. Similarly, in other figures herein in which a first duplex is illustrated, it should be understood that the force which circuitry 160 applies is insufficient to cause dissociation of that duplex in the described operating mode; however, other operating modes may be used to intentionally dissociate the duplex. In some examples, first duplex 154 may include one or more nucleotide analogues. Such nucleotide analogue(s) may, for example, enhance stability of first duplex 154 relative to a natural nucleotide. For example, the nucleotide analogue(s) may include one or more locked nucleic acids (LNA) or may include one or more 2'-methoxy (2'-0Me) nucleotides, or may include one or more 2'-fluorinated (2'-F) nucleotides, or may include one or more peptide nucleic acids (PNA). Such analogue(s) may be included, for example, in polynucleotide 140.Illustratively, such analogue(s) may be added to the primer at the time it is synthesized, or potentially triphosphate nucleotides with these modifications could be incorporated into strand 140 by the polymerase. Such analogue(s) may increase the Tm (melting temperature) of first duplex 154. For example, addition of LNA monomers may help to increase the Tm of first duplex 154 and may be used to fine-tune the Tm of first duplex 154. Or, for example, 2'-0Me may increase the Tm of RNA:RNA duplexes and results in only small changes in RNA:DNA stability. Or, for example, 2' Fluoro bases may have a fluorine modified ribose which increases binding affinity (Tm) and also may confer some relative nuclease resistance when compared to native RNA.

[0140] Circuitry 160 may be configured to measure a value of an electrical property of the 3' end 153 of first duplex 154 and a single-stranded portion of construct 150 while applying the first force Fl. For example, circuitry 160 may be in operable communication with first and second electrodes 102, 103 and configured to detect the ionic current passing through the nanopore 110, or an electrical current, electrical resistance, or electrical voltage drop across nanopore 110 during application of the first force Fl . For example, fluid 120 may include one or more salts such as KC1, NaCl, potassium ferrocyanide, potassium ferricyanide, or potassium glutamate. In the nonlimiting example illustrated in FIG. IB, the particular base pair at 3' end 153 of first duplex 154 (e g., GC), and the sequence of one or more bases in single-stranded portion 156 (e g., A,T), may alter the rate at which the salt in fluid 120 moves through aperture 113 and intofluid 120’, and thus may alter the electrical current, ionic current, electrical resistance, or electrical voltage drop across nanopore 110 in such a manner as to be detected by circuitry 160. In some examples, first duplex 154 may include one or more nucleotide analogue(s) that alter the value of the electrical property of the nanopore relative to a natural nucleotide. For example, polynucleotide 140 may include nucleotide analogue(s) such as a 2' modification, or a base modification. Such analogue(s) thus may be identified using circuitry 160. In some examples, the modified base is methylated in target polynucleotide 158, but is not methylated in complement 159, which can aid in detecting the methylated base in a manner such as described in greater detail below with reference to FIGS. 18A-18B, 19, 20, and 21A-21B. In some examples, there are modified bases in the complement 159 (e.g., such as methylation from genomic DNA), and unmodified bases in the target polynucleotide 158, which can aid in detecting the methylated base in a similar manner as described in greater detail below with reference to FIGS. 18A-18B, 19, 20, and 21A-21B.

[0141] The value that circuitry 160 measures during the operation illustrated in FIG. IB may be based on any suitable number of nucleotides in first portion 155 (which portion is hybridized to polynucleotide 140) and in second portion 156 (which portion is single-stranded and not hybridized to polynucleotide 140). For example, the measured value may be at least based on M nucleotides of the single-stranded portion and D pairs of hybridized nucleotides of the duplex, wherein M is greater than or equal to one, and wherein D is greater than or equal to one. M and D may have any suitable values. For example, M may be greater than or equal to two, or M may be greater than or equal to three, or M may be greater than or equal to four. Illustratively, M may be about one. Or, illustratively, M may be about two. Or, illustratively, M may be about three. Or, illustratively, M may be about four. Or, illustratively, M may be about five. Additionally, or alternatively, D may be greater than or equal to two, or D may be greater than or equal to three, or D may be greater than or equal to four. Illustratively, D may be about one. Or, illustratively, D may be about two. Or, illustratively, D may be about three. Or, illustratively, D may be about four. Or, illustratively, D may be about five.

[0142] The value measured by circuitry 160 may include an electrical current, ionic current, electrical resistance, or electrical voltage drop that is based on the M nucleotides and D pairs of hybridized nucleotides. For example, referring now to FIG. IE, the numbers are used to representbases which may affect the measured value under a given force (here, first force Fl). For an MspA nanopore such as illustrated, it may be expected that bases 4, 5, 6, and 4' primarily may affect the measured value, although bases adjacent to these may also influence the measured value in a manner such as described elsewhere herein. For example, bases 3 and 3' may affect the measured value. Additionally, or alternatively, base 7 may affect the measured value. Additionally, or alternatively, base 8 may affect the measured value. In one nonlimiting example, bases 3, 3', 4, 4', 5, 6, 7, and 8 affect the measured value. In another nonlimiting example, bases 3, 3', 4, 4', 5, 6, and 7 affect the measured value. In another nonlimiting example, bases 4, 4', 5, 6, 7, and 8 affect the measured value. In another nonlimiting example, bases 3, 3', 4, 4', 5, and 6 affect the measured value. In another nonlimiting example, bases 4, 4', 5, 6, and 7 affect the measured value. In another nonlimiting example, bases 4, 4', 5, and 6 affect the measured value.

[0143] It will be appreciated that the particular number and locations of base(s) that affect the measured value may depend on the particular nanopore configuration used, the particular circuitry configuration used, and the particular conditions under which the measurement is performed. For example, as illustrated in FIG. IF, under a modified first force (Fl’), the 3' end of first duplex 154 may be disposed at a different location relative to nanopore 110, e.g., may be disposed deeper within aperture 113 if Fl’ is greater than Fl, or more shallowly within aperture 113 if Fl ’ is less than Fl in the nonlimiting example shown in FIG. IF. The ionic current through aperture 113 may be affected differently by the bases within the first duplex 154 and the single-stranded portion 156 of construct 150, for different forces. In a manner such as described further below with reference to FIGS. 8A-8C, 9, and 10, the values of measurements made under different forces may be compared so as to even further enhance the accuracy with which nucleotides are identified.

[0144] In some examples, the value measured by circuitry 160 is affected by an epigenetic mark within construct 150 such as, but not limited to, a methylated base. For example, referring now to FIG. 1G in which the numbers again are used to represent bases which may affect the measured value, it may be expected that if base 5* is methylated (or otherwise modified), such group may affect the measured value differently than would an unmethylated (or otherwise unmodified) base, and that therefore the presence of the methylated (or otherwise modified) basemay be identified via its effect on the measured value. Furthermore, in examples such as will be described in greater detail below with reference to FIGS. 18A-18B, 19, 20, and 21A-21B, nucleotides in the target polynucleotide 158 may be methylated while the nucleotides in its complement 159 are not methylated (e.g., because the target polynucleotide 158 was obtained from a living organism while the complement 159 is synthetic), and the non-methylated nucleotides in the complement may be used as an internal “reference” to facilitate identifying the methylated nucleotides in the target polynucleotide.

[0145] Further details regarding the manner in which circuitry 160 may be used to identify nucleotides using the measured values are provided below, for example with reference to FIGS. 8A-8C, 9, and 10.

[0146] Referring back to FIG. IB, while the first force Fl is applied using circuitry 160, addition of a nucleotide to the 3' end 153 of first duplex 154 may be inhibited. For example, fluid 120 may be in contact with the first side 111 of nanopore 110 and may include a plurality of nucleotides 121, 122, 123, 124, e.g., G, T, A, and C, respectively. Each of the nucleotides 121, 122, 123, 124 in fluid 120 optionally may be modified in a manner such as described in greater detail below, e.g., may include a nucleotide analogue. Fluid 120 further may include a plurality of polymerases 105 that may be used to add nucleotides to polynucleotide 140 using the sequence of construct 150 in a manner such as described with reference to FIG. 1C. However, at the particular time illustrated in FIG. IB, aperture 113 of nanopore 110 may inhibit the addition of a nucleotide to 3' end 153 of first duplex 154. For example, polymerases 105 may be sterically hindered from binding to 3' end 153 while the 3' end is located within aperture 113.

[0147] However, circuitry 160 may be configured so as to switch system 100 to an operational mode in which the 3' end of first duplex 154 may be extended by adding a nucleotide. Such a nucleotide addition operation may be performed, for example, after forming first duplex 154 and before applying the first force Fl, e.g., to add nucleotide 121 prior to the particular time illustrated in FIG. IB (for example, prior to the particular time illustrated in FIG. 1A). FIG. 1C schematically illustrates an example mode for adding a nucleotide to first duplex 154. In this mode, circuitry 160 may be configured to apply a second force F2 (such as a second voltage across nanopore 110 in a direction opposite that of the first voltage) that moves 3' end 153 offirst duplex 154 out of aperture 1 13 such that polymerase 105 may contact the 3' end of the first duplex and may add a nucleotide thereto, e.g., T 122, based on the next nucleotide (e.g., A) in the sequence of construct 150. It will be appreciated that circuitry 160 instead may be configured to as to release the first force Fl, following which release the 3' end 153 of first duplex 154 may naturally diffuse out of aperture 113 such that polymerase 105 may contact the 3' end of the first duplex and may add a first nucleotide thereto, without the need to use the circuitry to actively apply a force causing such motion and making the 3' end of the first duplex available to the fluid 120.

[0148] Although not expressly shown, in some examples system 100 may be configured to continue adding nucleotides to extend first duplex 154 along all or a portion of the length of construct 150, e g., to obtain a duplex such as illustrated in FIG. 1H. As may be understood from FIGS. 1A-1H, nucleotides are added to first duplex 154 based on the sequence of construct 150. More specifically, in the nonlimiting example described with reference to FIGS. 1A-1H, nucleotides first are added to the first duplex which are complementary to target polynucleotide 158; then nucleotide(s) (collectively denoted X') are added to the first duplex which are complementary to structure 157 (collectively denoted X); then nucleotides are added to the first duplex which are complementary to complement 159. However, depending on the particular arrangement of elements within construct 150, the particular order in which respectively complementary nucleotides are added to duplex 154 based on the sequence of construct 150 may vary. Illustratively, in examples in which the locations of polynucleotide 158 and complement 159 are swapped relative to those described with reference to FIGS. 1A-1H, then nucleotides first are added to the first duplex which are complementary to complement 159; then nucleotides are added to the first duplex which are complementary to complement 159. In these examples, a single primer (and a single duplex may be used).

[0149] In examples in which structure 157 includes nucleotides, then nucleotide(s) collectively denoted X' in FIG. 1H are added to the first duplex which are complementary to structure 157 (collectively denoted X). In examples in which structure 157 does not include nucleotides (e.g., includes Spl8s), the duplex may not necessarily be extended or sequenced through structure 157. However, it would be visible / evident in the measurements that this point has been reached since the Spl8s will give currents higher than the nucleotides and the natural extension / addition ofnucleotides would stop. A primer which is complementary to a first portion of complement 159 then may be added to form a second duplex which is extended in a similar manner as described for polynucleotide 158; or in examples in which the locations of polynucleotide 158 and 159 are swapped relative to that in FIGS. 1H, a primer which is complementary to a first portion of polynucleotide 158 then may be added to form a second duplex which is extended in a similar manner as for complement 159. Although certain components and operations may be referred to herein as “first,” “second,” or the like, it should be understood that such terms are merely intended to facilitate identification of such components and operations, rather than to connote a particular ordering of such components relative to one another or a particular ordering of such operations in time.

[0150] Regardless of the particular order in which target polynucleotide 158 and complement 159 are characterized, whether the target polynucleotide 158 is native or synthetic, whether the complement 159 is native or synthetic, and whether the polynucleotide 158 and complement 159 are characterized using the same primer (and same duplex) as one another or using first and second primers (and first and second duplexes), circuitry 160 may be configured to generate a first plurality of measured values for polynucleotide 158, and a second plurality of measured values for complement 159, and to generate a sequence of polynucleotide 158 using the first plurality of measured values and the second plurality of measured values. Nonlimiting examples of operations for generating the sequence of polynucleotide 158 will be described in greater detail with regards to FIGS. 8A-8C and 9.

[0151] Note that any suitable type of polymerase 105 may be used to synthesize any suitable type of polynucleotide 140 based on any suitable type and arrangement of construct 150. For example, a DNA polymerase 105 may be used copy a DNA construct 150 to form a DNA polynucleotide 140. Or, for example, an RNA polymerase 105 may be used to copy a DNA construct 150 to form an RNA polynucleotide 140. Or, for example, an RdRP (RNA dependent RNA polymerase) 105 may be used to copy a construct 150 including an RNA polynucleotide to form an RNA polynucleotide 140. Or, for example, a reverse transcriptase 105 may be used to copy a construct 150 including an RNA polynucleotide to form a DNA polynucleotide 140. Any DNA modifications may occur on the base or the sugar, including the 3’ end. Any RNA modifications may occur on the base or the sugar, including the 2’ end. Example, but non-limiting, modifications to the 2' end include 2'-O-methoxy-ethyl, 2'-0Me, 2'-F and locked nucleic acid (LNA).

[0152] Circuitry 160 may be configured so as to repeatedly switch system 100 between a nucleotide addition mode (FIG. 1C), and a measurement mode (FIG. IB and FIG. ID). For example, after performing the measurement described with reference to FIG. IB, another nucleotide may be added in a manner such as described with reference to FIG. 1C, and another measurement performed. During the measurement mode, the aperture or other feature of nanopore 110 may inhibit polymerase 105 from adding another nucleotide. As such, each cycle of nucleotide measurement may be controlled so as to have any desired duration, e.g., may be electronically controlled using circuitry 160, so as to provide an appropriate signal -to-noise ratio (SNR) for the type of measurement being performed. Generally, the longer the measurement cycle, the better the SNR that may be obtained. In some applications, circuitry 160 may be configured to adjust the length of the measurement mode so as to obtain a sufficiently high SNR (e.g., a SNR exceeding a predefined threshold), even though throughput (number of bases per unit time) may be lower. In other applications, circuitry 160 may be configured to adjust the length of the measurement mode so as to obtain a sufficiently high throughput (e.g., a throughout exceeding a predefined threshold), even though the SNR may be lower.

[0153] Circuitry 160 further may be configured to perform repeated cycles of nucleotide addition and measurement any suitable number of times, so as to sequence both the target polynucleotide 158 and its complement 159 in the same molecule (that is, in construct 150). For example, as illustrated in FIG. ID, after applying the second force F2 during which a nucleotide is added, circuit 160 again may apply the first force Fl. The first force Fl may, in some examples, remove polymerase 105 from contact with 3' end 153 of the first duplex 154, and moves the now-extended 3' end 153 of first duplex 154 into the aperture 113 of nanopore 110, where constriction 114 or other feature of nanopore 110 inhibits translocation of the 3' end to second side 112 of the nanopore in a similar manner as described with reference to FIG. IB.

[0154] Note that in examples including constriction 114, although such constriction 114 occupies only a portion of the length of nanopore 110, it may be the most sensitive region for base discrimination, because the constriction is where the largest voltage drop occurs (as itpresents the largest resistance between electrodes 102 and 103). Typical nanopore constrictions are longer than a single DNA nucleotide of a single-stranded polynucleotide, and therefore a current signal that a nanopore can generate may be dependent on more than one nucleotide, and typically 3, 4, 5, or even 6 or more nucleotides. These nucleotides form what may be termed a “K-mer.” The number of possible K-mers for 4 bases of DNA is 4K. Some previously known strand sequencing methods operate by translocating a single strand of DNA through the constriction of a nanopore (i.e., the “sensing zone”), such as MspA or CsgG, and attempting to associate the currents created by each K-mer with the sequence of the K-mer. One method of performing this association is to create a table of each possible K-mer residing in the nanopore constriction at any time, and the associated current it creates, and then using a look-up table to find the K-mer that corresponds to a measured current. Another method of performing the associations is through the use of machine-learning algorithms. In practice there are several limitations to any method of K-mer based strand sequencing.

[0155] For example, two currents that correspond to unique K-mers may appear to be the same, or may be similar enough that they cannot be distinguished from one another within the bounds of a given experimental setup. The larger the K-mer, the more likely that such “degenerate” cases will occur. For this reason, the a-hemolysin nanopore presents challenges for strand sequencing because the K-mer is large, about 10 nucleotides, so there are about 410possible signals - far too many to be able to realistically deconvolve. For degenerate cases where the K- mers are somewhat shorter, about 6 nucleotides, other methods have sometimes been used to try to distinguish the K-mers. Translocating the DNA through the pore one nucleotide at a time, while permitting time to measure an electrical value for each nucleotide in succession, for example with the use of translocation enzymes (such as a helicase or polymerase), mitigates the K-mer degeneracy problem. This so-called single-base ratcheting mitigates the degeneracy problem because a given K-mer can transition to one of only four possibilities, because the base that leaves the sensing zone is replaced by A, C, G, or T, while the other bases remain unchanged within the sensing zone. For example, for a 4-mer such as ACGT, if the A leaves, CGT will change register, then as a new base enters, the new 4-mer can be only CGTT, CGTA, CGTC, or CGTG, whereas there are actually 44(256) K-mers that can be formed from four nucleotide types. Thus, the list of possibilities for the new K-mer is reduced from 256 to only 4, reducing the potential for degenerate signals.

[0156] Additionally, when homopolymer stretches in the template DNA translocate through the nanopore that are longer than the nanopore sensing zone (e.g., the K-mer length for a particular nanopore type), current strand sequencing methodologies may not be able to accurately determine the length of the homopolymer because there is no indication that the template DNA has translocated. In these cases, the length of time over which the homopolymer transits the nanopore has been attempted to be used to deduce the length of the homopolymer (by multiplying the time by the average number of nucleotides per time unit). However, translocation enzymes do not move at a consistent rate, so time alone may not provide sufficient accuracy for determining the length of the homopolymer. Indeed, because the speed at which the translocating enzymes move cannot be sufficiently controlled, and the time per nucleotide may be inconsistent, some translocation events may occur extremely rapidly and may be too short to be detectable using strand sequencing. As a result, deletion errors may occur. Alternatively, some translocation events may be too slow. As a result, insertion errors may occur, rendering the detected homopolymer length greater than what was present in the physical construct 150.

[0157] The present subject matter mitigates any and all of such issues associated with strand sequencing, and indeed is believed to provide greatly enhanced accuracy, controllability, and repeatability as compared to strand sequencing. Furthermore, the use of the present constructs - which include both the target polynucleotide and its complement in the same molecule, in the same nanopore - provide still further enhancements and benefits such as described herein.

[0158] For example, in a manner such as described with reference to FIGS. 1A-1H, the circuitry 160 measures a signal that is based on a combination of the first or second duplex and a singlestranded portion of construct 150, as well as the particular set of measurement conditions that are used. Moreover, circuitry 160 generates a first plurality of such values for target polynucleotide 158 within construct 150, and a second plurality of such values for complement 159 within the same construct 150. The information which is measured therefore is far richer than for an exclusively single-stranded polynucleotide under a single set of measurement conditions, e.g., as is the case in strand sequencing, and also is far richer than for measuring target polynucleotide 158 alone.

[0159] Through the use of the methods described herein to confirm the addition of a nucleotide to the 3' end of the duplex, the homopolymer issue is solved. For example, each time a new base is added to the 3' end of the first or second duplex (e.g., such as described with reference to FIG. 1C), a discernible signal then is generated (e.g., such as described with reference to FIGS. IB and ID) via which it may be confirmed that a single nucleotide was added. If the signals from different, sequentially added nucleotides are sufficiently similar or identical, then it may be inferred that a homopolymer stretch of construct 150 is being sequenced. Furthermore, different nucleotides within a given homopolymer stretch of construct 150 may yield different measured values of the electrical property, because each of such nucleotides may have different proximities to other, different nucleotides outside of the homopolymer stretch. Accordingly, even nucleotides of the same type, within a homopolymer, may be individually identified using the values that circuitry 160 measures. In the cases where the homopolymer is sufficiently long that it is not possible to identify transitions between nucleotide incorporations or identify the presence of nucleotides outside the homopolymer stretch that may alter the values of circuitry 160, the ability to re-sequence the same construct as many times as needed, as described in reference to FIGS. 4A-B, can further enable accurate homopolymer length determination. This may require, as a non-limiting example, using foreknowledge of the rates for nucleotide incorporation in combination with a minimum (possibly pre-determined) number of resequencing rounds of the same molecule. The correct length of the homopolymer for the regions of unidentified transitions may be inferred based on matching the detected distribution of homopolymer transit times to a statistical model of the time spent in that region for each round of re-sequencing construct 150.

[0160] Furthermore, during the present measurements such as described with reference to FIGS. IB and ID, the 3' end 153 (including the 3' end of polynucleotide 140) may be sequestered within aperture 113 or otherwise inaccessible for addition of another nucleotide until circuitry 160 applies an opposing force that frees 3' end 153 from the aperture 113 and makes the 3' end accessible to fluid, polymerase, and nucleotides for use in adding another nucleotide to 3' end 153.

[0161] The enzyme speed issue, which may lead to deletion errors, is also solved because the present systems and methods provide excellent control of the sequencing process. For example,circuitry 160 may electronically control the duration of the measurement operation to achieve a desired SNR (e.g., a SNR exceeding a predefined threshold) while inhibiting polymerase 105 from adding another nucleotide. Translocation of construct 150 through nanopore 110 also is controlled electronically using circuitry 160, and accordingly is less subject to variable kinetics of a translocation enzyme as is the case with strand sequencing, in which very fast translocation events may go undetected that may otherwise lead to deletion or other types of errors that affect accuracy.

[0162] For example, FIGS. 8A-8C illustrate example values of electrical characteristics that may be measured using the system of FIGS. 1A-1H. More specifically, FIG. 8A illustrates an example sequence of values that may be measured under a first set of measurement conditions as base pairs G (153) C (in 150 and paired to 153) (referred to herein as “GC”), T (153) A (in 150 and paired to 153) (referred to herein as “TA”), and A (153) T (in 150 and paired to 153) (referred to herein as “AT”) respectively become located at the 3' end 153 of duplex 154, and sequences of nucleotides A-T, T-G, and G-C respectively become located in the single- stranded second portion 156 of construct 150, in a manner such as respectively described with reference to FIGS. IB and ID. As illustrated in FIG. 8A, a first value is measured for the combination GC and A-T (FIG. IB), a second value is measured for the combination TA and T-G (FIG. ID), and a third value is measured for the combination AT and G-C (not specifically illustrated). The particular types of nucleotides at the 3' end 153 of duplex 154, and in the sequences of nucleotides located in the single-stranded second portion 156 of construct 150 may affect the ionic current through nanopore 110 and therefore may affect the measured values.

[0163] Indeed, even the particular types of paired nucleotides that are within duplex 154 and spaced apart from the 3' end 153 of duplex 154, and / or the particular types of unpaired nucleotides that in construct 150 and are spaced apart from the single-stranded second portion 156 of construct 150, may affect the ionic current through nanopore 110 and therefore may affect the measured values. For example, FIG. 8B illustrates an example sequence of values that may be measured, again under the first set of measurement conditions, as base pairs GC, TA, and AT respectively become located at the 3' end 153 of duplex 154, and sequences of nucleotides A-T, T-G, and G-C* respectively become located in the single-stranded second portion 156 of construct 150, in a manner such as respectively described with reference to FIGS. IB and ID,but in which C* is a nucleotide analogue, e g., a methylated cytosine. As illustrated in FIG. 8B, a first value is measured for the combination GC and A-T (FIG. IB), a second value is measured for the combination TA and T-G (FIG. ID), and a third value is measured for the combination AT and G-C* (not specifically illustrated). The first value in FIG. 8B may be similar to the first value in FIG. 8A, for example because C* is separated from the 3' end of the duplex by three bases, and therefore may not significantly affect the ionic current through nanopore 110. The second value in FIG. 8B may differ somewhat from the second value in FIG. 8A, for example because C* may somewhat affect the ionic current through nanopore 110, relative to how unmethylated C may affect such current, even though it is separated from the 3' end of the duplex by two bases. The third value in FIG. 8B may differ significantly from the third value in FIG. 8 A, for example because C* may significantly affect the ionic current through nanopore 110, relative to how unmethylated C may affect such current, because it is directly adjacent to the 3' end of the duplex.

[0164] Different sets of measurement conditions also may affect the values which are measured for different combinations of nucleotides at the 3' end 153 of the duplex 154 and in the singlestranded second portion 156 of construct 150. For example, in a manner such as described with reference to FIG. IF, applying a different force using circuitry 160 may move the 3' end 153 of the duplex 154, and the second portion 156 of construct 150, to a different location relative to nanopore 1 10 at which nucleotides in the duplex 154 and construct 150 may affect the ionic current differently than they do at another location (under another force). Changes in the measurement conditions may linearly or nonlinearly affect the measured values, and indeed may change the measured values in different directions for different combinations of nucleotides at the 3' end 153 of the duplex 154 and within the second portion 156 of construct 150.

[0165] For example, FIG. 8C illustrates an example sequence of values that may be measured, under a second set of measurement conditions that differs from the first set of measurement conditions, as base pairs GC, TA, and AT respectively become located at the 3' end 153 of duplex 154, and sequences of nucleotides A-T, T-G, and G-C respectively become located in the single-stranded second portion 156 of construct 150, in a manner such as respectively described with reference to FIGS. IB and ID. As illustrated in FIG. 8C, a first value is measured for the combination GC and A-T (FIG. IB), a second value is measured for the combination TA and T-G (FTG. ID), and a third value is measured for the combination AT and G-C (not specifically illustrated). The first value in FIG. 8C may be different from the first value in FIG. 8A, the second value in FIG. 8C may be different from the second value in FIG. 8A, and the third value in FIG. 8C may be different from the third value in FIG. 8A, even though the sequences are the same, for example because the second set of measurement conditions affects the ionic current through nanopore 110 in a manner that is different, for each combination of nucleotides, than does the first set of measurement conditions. In this nonlimiting example, the second set of measurement conditions decreases the first value, increases the second value, and increases the third value, relative to those values under the first set of measurement conditions.

[0166] Because the measured values are highly reproducible and accurate, even though sequencing the same construct 150 under two or more different sets of measurement conditions may provide different sequences of measured values that may be nonlinearly related to the particular measurement conditions used, it is expected that each such sequence of measured values reliably may be used to identify the sequence of nucleotides in construct 150. Indeed, in a manner such as described below, construct 150 may be sequenced multiple times under different sets of measurement conditions, and / or may be sequenced using multiple sets of conditions during a single round of sequencing construct 150, and the sequences compared to one another to further improve the accuracy of the sequence. Moreover, in a manner such as described further below, measurements from target polynucleotide 158 and its complement 159 within construct 150 may be aligned to one another and bioinformatically combined to obtain significantly better sequencing accuracy for target polynucleotide 158 than may be obtained by sequencing the target polynucleotide (or its complement) alone.

[0167] As further noted above, multiple aspects of the present systems and methods address the homopolymer issue. One such aspect is the contribution of signal from the duplex, as well as from surrounding nucleotides, to the particular value of the signal that may obtained within a given portion of the polymer. The particular types of nucleotides at the 3' end 153 of duplex 154, and in the sequences of nucleotides located in the single-stranded second portion 156 of construct 150 may affect the ionic current through nanopore 110 and therefore may affect the measured values. Indeed, even the particular types of paired nucleotides that are within duplex 154 and spaced apart from the 3' end 153 of duplex 154, and / or the particular types of unpairednucleotides that within construct 150 and are spaced apart from the single-stranded second portion 156 of construct 150, may affect the ionic current through nanopore 110 and therefore may affect the measured values.

[0168] Accordingly, it will be appreciated that signal contributions from different portions of the duplex 154 and / or from additional unpaired bases in the sequence of construct 150 may be used to distinguish different nucleotides in a homopolymer sequence from one another. In this regard, referring back to FIGS. IE and IF, the greater the values of M and / or D, the longer the sequence or “word” that may be read at a given time, the longer the homopolymer stretches that may be reliably read because the more unpaired nucleotides and / or duplex base pairs may contribute to signals by which the nucleotides of the homopolymer may be distinguished from one another. It will be appreciated that the sequence of measurements may be repeated under a different set of measurement conditions, to obtain a different set of values that may distinguish the nucleotides in the homopolymer sequence from one another in a different way.

[0169] Although different combinations of nucleotides and / or duplex base pairs may affect the magnitude of the ionic current through a nanopore, such combinations also or alternatively may affect fluctuations of the ionic current through the nanopore, or noise. Circuitry 160 may measure such fluctuations or noise and use the measured values of those fluctuations or noise to identify nucleotides.

[0170] As provided herein, measurements such as described with reference to FIGS. 8A-8C may be used as input to an algorithm that correlates measured values - each of which may have any desired level of accuracy and may be obtained under any suitable set of measurement conditions - with different combinations of nucleotides respectively within target polynucleotide 158 and its complement 159 within construct 150. The algorithm may be stored in non-volatile computer- readable memory in operable communication with circuitry 160, and circuitry 160 repeatedly may use the algorithm to identify individual nucleotides in the sequence of target polynucleotide 158, based on the values respectively measured from target polynucleotide 158 and complement 159 (regardless of the particular order in which those measurements are obtained).

[0171] For example, as provided herein, measurements such as described with reference toFIGS. 8A-8C may be used to generate a data structure, such as an N-dimensional “read map,”that correlates measured values - each of which may have any desired level of accuracy and may be obtained under any suitable set of measurement conditions - with different combinations of sequences within duplex 154 and construct 150. For example, FIG. 8D illustrates an example N- dimensional read map of electrical characteristics that may be used to identify nucleotides using the system of FIGS. 1A-1H. In the nonlimiting example illustrated in FIG. 8D, read map 800 includes a first axis corresponding to a first type of measured value, a second axis corresponding to a second type of measured value, and a third axis corresponding to a given measurement condition that may be varied between different measurements. Illustratively, the measurement condition may be or include application of a first force Fl such as described with reference to FIGS. IB, ID, and IE, and the measurement condition may be varied (changed along the respective axis in FIG. 8D) by applying a modified first force Fl’, such as described with reference to FIG. IF, that positions the 3' end 153 of the duplex 154 differently relative to nanopore 110, thus causing a change in one or more measured values.

[0172] N-dimensional read map 800 illustrated in FIG. 8D may be generated using a calibration procedure in which a sufficient number of different polynucleotides, the sequences of which are known a priori, are sequenced using measurement operations and nucleotide addition operations in a manner such as described with reference to FIGS. 1 A-1D and 1H. Such a calibration procedure may be performed on a per-system basis, or may be performed in such a manner that the points in read map 800 apply approximately equally to each of a plurality of systems, such that each system need not be individually calibrated to generate its own read map. For example, at a first measurement condition, circuitry 160 may measure the values of one or more electrical properties of the 3' end 153 of the duplex 154 and the second portion 156 of construct 150, such as an electrical current, an ionic current, an electrical resistance, or an electrical voltage drop across nanopore 110, between nucleotide addition steps. Circuitry 160 may store the measured values and the measurement condition in a non-volatile computer readable medium (e.g., memory), and this set of information may be considered to populate a first plane of points in read map 800. Then, at a second (different) measurement condition, circuitry 160 may measure the values of one or more electrical properties of the 3' end 153 of the duplex 154 and the second portion 156 of construct 150, between nucleotide addition steps. Circuitry 160 may store the measured values and the measurement condition in the computer readable medium (e.g., memory), and this set of information may be considered to populate a second plane of points inread map 800. Such operations of measuring and storing measurement values and the respective measurement condition may be repeated any suitable number of times to provide read map 800 with the desired number of dimensions.

[0173] For each of the points that are stored in read map 800, circuitry 160 also may store the identities and respective locations in the sequence of the nucleotide(s) which are known to have contributed to that signal because the sequences of the polynucleotides are known a priori. For example, for each of the points stored in read map 800, circuitry 160 may store the identities and locations in the sequence at least of nucleotides 4, 4’, 5, and 6 illustrated in FIG. IE. Optionally, circuitry 160 also may store the identities of nucleotides 3 and 3’. As a further option, circuitry 160 also may store the identities and locations in the sequence of nucleotides 2 and 2’. As a still further option, circuitry 160 also may store the identities and locations in the sequence of nucleotides 1 and 1’. Additionally, or alternatively, circuitry 160 also may store the identity and location in the sequence of nucleotide 7. As a further option, circuitry 160 also may store the identity and location in the sequence of nucleotide 8. Nonlimiting examples of the numbers and locations of nucleotides that may contribute to the measured signal, and thus may be stored within read map 800, are described with reference to FIGS. 1E-1F.

[0174] As a purely illustrative example, for point 811 in the read map defined by the measured value of electrical current through nanopore 1 10 at a first set of measurement conditions (e.g., first force Fl) illustrated in FIG. IB, and for point 811’ corresponding to the same measurements at a second set of measurement conditions (e.g., modified first force Fl’ described with reference to FIG. IF), circuitry 160 may store the nucleotides and their locations in a format such as G C A T, where it is defined by convention that the first listed nucleotide corresponds to nucleotide 4’ which is located at the 3' end 153 of duplex 154, the second listed nucleotide corresponds to nucleotide 4 which is the base pair of nucleotide 4’, the third listed nucleotide corresponds to nucleotide 5 which is unpaired and adjacent to the base pair, and the fourth listed nucleotide corresponds to nucleotide 6 which is unpaired and adjacent to nucleotide 5. Similarly, for point 812 in the read map defined by the measured value of electrical current through nanopore 110 at a first set of measurement conditions (e.g., first force Fl) illustrated in FIG. 1C, and for point 812’ corresponding to the same measurements at a second set of measurement conditions (e.g., modified first force Fl’ described with reference to FIG. IF), circuitry 160 may store thenucleotides and their locations in a format such as T A T G, using the same convention. Of course, any other suitable format may be used, and any suitable number of nucleotides may be included and their identities and locations indicated in any suitable manner.

[0175] Note that methylated bases, or other modified nucleotides, may be included in the polynucleotides at locations that are known a priori, and the calibration procedure performed. In a manner such as described with reference to FIGS. 1G and 8C, one or more of the values that are measured from sequences including such modified nucleotides may be different from the values that are measured from sequences including unmodified nucleotides. The identity of the nucleotide which circuitry 160 stores may include a suitable indication of whether and how the nucleotide is modified. For example, point 813 in read map 800 may be defined by the measured value of electrical current through nanopore 810 at a first set of measurement conditions (e.g., first force Fl) for a sequence including AT the 3' end, G at location 5, and methylcytosine (C*) at location 6. It may be seen that point 813 may have a different location in read map 800 than may another point for which the cytosine is unmodified, as well as may yet another point for which the cytosine includes a different type of modification.

[0176] It will be appreciated that while the inclusion of a plurality of measured value axes in read map 800 may enhance the accuracy with which circuit 160 identifies nucleotides, in some examples only a single such axis, corresponding to a single type of measured value, is included in read map 800. Conversely, read map 800 may include any suitable number of dimensions, e.g., axes corresponding to any suitable number and types of measured values, standard deviations of measured values, measurement conditions (such as temperature, fluid composition such as salt concentration and / or pH, location in flow cell), types of (e.g., variants of) nanopores, types of (e.g., variants of) polymerases, nucleotide modifications, and the like.

[0177] Read map 800 (or other suitable data structure such as described elsewhere herein) may be stored in non-volatile computer-readable memory in operable communication with circuitry 160, and circuitry 160 may use the read map in any suitable manner to identify individual nucleotides in the sequence of construct 150, e.g., as nucleotides are added to the 3' end 153 of duplex 154. For example, in a manner such as described with reference to FIGS. IB, and ID, circuit 160 may measure the values of one or more electrical properties of the 3' end 153 ofduplex 1 4 and the single-stranded second portion 156 of construct 150 under a given set of measurement conditions. In some examples, circuit 160 may be programmed to use sets of measurement conditions for which read map 800 contains points, so as to facilitate comparison of values that are measured for unknown sequences to values that were previously measured for sequences that were known a priori. In some examples, circuit 160 may locate the set (e.g., plane) of points in the read map corresponding to that set of measurement conditions, may compare the measured value(s) to the corresponding set of values in the read map, and based upon such comparison may select the value or combination of values in that set that is / are closest to the measured value. Then, for the selected value(s), circuit 160 may retrieve the identities and locations of the nucleotides that generated the value(s) during the calibration step. Illustratively, circuit 160 may determine that the measured value(s) for the unknown construct 150 sequence is closest in magnitude to the value(s) for point 811 in read map 800. Based upon such comparison, circuit 160 may determine that the unknown construct 150 sequence includes the base pair GC at the 3' end 153 of the duplex 154 (locations 4’ and 4, respectively), A at location 5, and T at location 6. Such a determination may be referred to as a “base call.”

[0178] Note, however, that circuitry 160 is not limited to using a single point in read map 800 to make a base call, although that is an option. Instead, circuitry 160 may use multiple points within read map in order to significantly enhance the accuracy of the base call. For example, as may be understood from comparing FIGS. IB and ID, the nucleotide that is added to the 3' end 153 of duplex 154 shifts the single-stranded second portion 156 of construct 150 upward by a single nucleotide. As such, the sequence of single-stranded second portion 156 in FIG. IB and the sequence of single-stranded second portion 156 in FIG. ID overlap with one another by at least one nucleotide - in this example, the T which shifts from position 6 in FIG. IB to position 5 in FIG. ID. Circuitry 160 may compare the base call from the measurement made at the time of FIG. IB to the base call from the measurement made at the time of FIG. ID, to confirm whether the same nucleotide(s) are present but are shifted in location by a single nucleotide, as should be the case if (i) a single nucleotide was added in the operation illustrated in FIG. 1C and (ii) the base calls made for FIGS. IB and ID were both correct. If, based upon such a comparison, circuitry 160 determines that the base calls between addition of a nucleotide are consistent with one another (e.g., contain sequences that are shifted by one nucleotide), then circuitry 160 may proceed with the sequencing process. On the other hand, if circuitry 160 determines that thesebase calls are inconsistent with one another, then the circuitry may flag this portion of the sequence as containing an error, may attempt to make the base call again, or even to resequence the construct in a manner such as described elsewhere herein. Note that for a sufficiently long homopolymer stretch, there may not necessarily be any change in the signals. In this case, other information provided by the present systems and methods still may be used to confirm the individual addition of nucleotides in a manner such as described elsewhere herein.

[0179] Circuitry 160 also, or alternatively, may use multiple measurements in order to locate the closest point within read map 800. For example, circuitry 160 may make another base call for the same sequence, but using a second, different set of measurement conditions for which read map 800 contains points, so as to facilitate comparison of values that are measured for unknown sequences to values that were previously measured for sequences that were known a priori. Circuitry 160 may impose the second set of measurement conditions shortly after imposing a first set of measurement conditions, e.g., may apply first force Fl and then may apply modified first force Fl’ before adding another nucleotide. Alternatively, circuitry 160 may impose the second set of measurement conditions while resequencing construct 150 in a manner such as described elsewhere herein. Circuitry 160 may compare the base call from the measurement made with the first set of measurement conditions to the base call from the measurement made with the same set of measurement conditions, to confirm whether the same nucleotide(s) are present at the same locations in both base calls, which should be the case if both of the base calls were correct. For example, base calls made using points 811 and 811’ in read map 800 will be consistent, and a base call made using point 812 and a base call made using point 812’ will be consistent. If, based upon such a comparison, circuitry 160 determines that the base calls for different measurement conditions are consistent with one another (e.g., contain the same sequences), then circuitry 160 may proceed with the sequencing process. On the other hand, if circuitry 160 determines that these base calls are inconsistent with one another, then the circuitry may flag this portion of the sequence as containing an error, may attempt to make one or both of the base calls again, or even to resequence the construct in a manner such as described elsewhere herein.

[0180] Although read map 800 is illustrated graphically for purposes of discussion, it should be understood that the points in read map suitably may be stored any suitable format, within a non-volatile computer-readable medium, that correlates a given measurement condition with one or more values that were measured under that condition and combinations of duplex and singlestranded sequences that were used to generate those values. A look-up table (LUT) is a nonlimiting example of a format that may be used to store correlations between measured values and known combinations of duplex and single-stranded sequences that were used to generate those values. However, it will be understood that any suitable data structure may be used to store correlations between measured values and known combinations of duplex and single-stranded sequences that were used to generate those values. For example, the data structure may be generated by, and appropriately stored for use by, a machine learning algorithm. For example, the data structure may be generated by training a machine learning algorithm to recognize values that are obtained, under each respective given set of measurement conditions, and are known a priori to correspond to respective combinations of duplex and single-stranded sequences, and may be stored in any suitable format within a non-volatile computer-readable medium. The data structure subsequently may be used by the trained machine learning algorithm, implemented by circuitry 160, to generate an output that identifies nucleotides in the sequence of construct 150, based upon an input of values that are measured in between nucleotide addition steps such as described with reference to FIGS. 1A-1H. It will be appreciated that circuitry 160 may be used to train the machine learning algorithm, or different circuitry may be used to train the machine learning algorithm that then is implemented by circuitry 160. In certain examples, the data structure may be generated by, and appropriately stored for use by, a neural network, such as a deep learning algorithm. For example, the data structure may be generated by training a neural network (e.g., deep learning algorithm) to recognize values that are obtained, under each respective set of measurement conditions, and are known a priori to correspond to respective combinations of duplex and single-stranded sequences, and may be stored in any suitable format within a non-volatile computer-readable medium. Accordingly, the data structure may include neurons of the neural network (e.g., deep learning algorithm). The data structure subsequently may be used by the trained neural network (e.g., deep learning algorithm), implemented by circuitry 160, to generate an output that identifies nucleotides in the sequence of construct 150, based upon an input of values that are measured in between nucleotide addition steps such as described with reference to FIGS. 1A-1H. It will be appreciated that circuitry 160 may be usedto train the neural network (e.g., deep learning algorithm), or different circuitry may be used to train the neural network (e.g., deep learning algorithm) that then is implemented by circuitry 160.

[0181] FIG. 9 illustrates an example flow of operations in a method 900 for generating a sequence of a target polynucleotide using a first plurality of measured values from the polynucleotide and a second plurality of measured values from its complement. Method 900 includes aligning a first plurality of measured values, from template polynucleotide 158 in construct 150, to a second plurality of measured values, from complement 159 in that construct 150 (operation 910). For example, FIG. 11A illustrates example current signals obtained from a polynucleotide and its complement using the system of FIGS. 1A-1H. More specifically, FIG. 11 A illustrates an example first plurality of measured values 1111 from template polynucleotide 158 (“Forward (F) reads”), and an example second plurality of measured values 1121 from its complement 159 (“Reverse complement (RC) reads”. In some examples, the first and second pluralities of measured values 1111, 1121 may both be obtained using a first set of measurement conditions (illustratively, an 80 mV bias applied during measurement). Although it is not required that measured values be obtained using multiple different sets of measurement conditions, in the nonlimiting example shown in FIG. 11 A an additional plurality of measured values 1112 from template polynucleotide 158 and an additional plurality of measured values 1122 from complement 159 are obtained using a second set of measurement conditions (illustratively, a 60 mV bias applied during measurement); and an additional plurality of measured values 1113 from template polynucleotide 158 and an additional plurality of measured values 1123 from complement 159 are obtained using a third set of measurement conditions (illustratively, a 40 mV bias applied during measurement).

[0182] Circuit 160 may align the first and second sets of measurements (e.g., currents) in any suitable manner. For example, during preparation of construct 150, one or more barcodes (e.g., one or more oligonucleotides of known sequence) may be disposed at any suitable location or locations within construct 150. Circuit 160 may be configured to detect the presence location(s) of the barcode(s) within construct 150 based on the known sequence of nucleotides within the barcode(s), because the measured values of the construct 150 contain values that correspond to the known sequence of nucleotides within the barcode(s). Circuit 160 may be configured to use the sequences of the barcodes to delineate which portions of the measured values correspond to(i) the 5' end of the template polynucleotide 158, (ii) the 3' end of the template polynucleotide 158, (iii) the 5' end of the complement 159, and (iv) the 3' end of the complement. For alignment, the measured values (as in reference to FIGS. 8A-8C) for the complement 159 may be “inverted” in time in order to match up with the temporal order of the template polynucleotide 158 measured values; such inversion has already been performed in FIG. 11A (and thus in FIG.1 IB as well). In FIG. 11 A the time axis goes from left to right for the forward (F) reads, and from right to left for the reverse complement (RC) reads. Circuit 160 also may be configured to align the portion of the measured values at the 5' end of the template polynucleotide 158 with the portion of the measured values at the 5' end of complement 159; and to align the portion of the measured values at the 3' end of the template polynucleotide 158 with the portion of the measured values at the 3' end of complement 159. For example, 1 IB schematically illustrates alignment of the current signals of FIG. 11 A, in which the first and second sets of measurements1111 and 1121 at the first set of measurement conditions are aligned to obtain aligned measurements 1111’ and 1121’. Additionally, although use of multiple sets of measurement conditions are not required, FIG. 1 IB schematically illustrates that the sets of measurements1112 and 1122 at another set of measurement conditions may be aligned to obtain aligned measurements 1112’ and 1122’, and the sets of measurements 1113 and 1123 at yet another set of measurement conditions may be aligned to obtain aligned measurements 1113’ and 1123’. Alternatively, without direct use of barcodes, alignment of the forward and reverse complement measurements may be initially performed by first base calling each of the first and second sets of measurements separately (e.g., converting 1111 and 1121 into base calls) and by an initial alignment of the forward sequence with the reverse complement using the base called sequences. Such alignment in sequence space may be done with standard methods which may include but are not limited to algorithms such as the Smith-Waterman local alignment algorithm and the Needleman-Wunsch global alignment algorithm. These initial alignments of the plurality of the first and second measurements can then be used with a joint decoding algorithm (described below) to improve the accuracy of the called bases.

[0183] Method 900 includes using a joint decoding algorithm to obtain a joint sequence of the template polynucleotide and its complement based on the aligned values (operation 920). In one nonlimiting example, circuit 160 may be configured to use a joint hidden Markov model (HMM) decoder implementing a Viterbi algorithm to find the most likely joint sequence ofpolynucleotides along both the target polynucleotide 158 and its complement 159, taking as input the aligned values and providing as output the consensus sequence. Illustratively, the HMM may include a mapping of measurements (e.g., ionic currents) of all 4096 possible polynucleotide hexamer states, including AAAAAA, TAAAAA, . .. GGGGGG for each of the different sets of measurement conditions to be used for the sequencing. Each of the possible hexamer “states” may be associated with a current or set of currents. Since only one hexamer sequence of DNA can be in the constriction at any single point in time, the measurements may be associated with the k-mer in the constriction. Later, algorithmically, the “forward” and “reverse complement” strand information may be combined for decoding.

[0184] For example, FIG. 1 IB also schematically illustrates joint decoding of the current signals of FIG. 11A. In this example, the aligned measurements made using all of the different measurement conditions were input to the HMM decoder for joint decoding, and the joint sequence for both the template polynucleotide 158 and complement 159 are output.

[0185] Illustratively, the “forward strand” currents and the “reverse complement” currents are first aligned to each other, for example using the barcode sequences for each separate segment as references. After ensuring proper alignment, a Hidden Markov Model (HMM) using the Viterbi algorithm is used to decode the joint signal. In this example, decoding with the HMM model is performed using 6 features, each of which map to a unique hexamer (e.g. AAAAAA, TAAAAA, and so on). The 6 features comprise: 3 currents for the “forward strand”, corresponding to the 40 mV, 60 mV and 80 mV reads, and 3 currents for the “reverse complement strand” also corresponding to 40 mV, 60 mV and 80 mV reads. The features were obtained from a read map consisting of 46states (all hexamer states). As one example of what the 6 features would look like as a list or vector corresponding to decoding the 6-mer AATTCC: { Feature 1 : 40 mV read for AATTCC, Feature 2: 60 mV read for AATTCC, Feature 3: 80 mV read for AATTCC, Feature 4: 40 mV read for TTAAGG, Feature 5: 60 mV read for TTAAGG, Feature 6: 80 mV read for TTAAGG}. Note that the features 4-6 contain the direct complement sequence of the AATTCC, and can be found by looking it up in the read map. As another example of what the 6 features would look like as a list or vector corresponding to decoding the 6-mer TTAAGG: {Feature 1 : 40 mV read for TTAAGG, Feature 2: 60 mV read for TTAAGG, Feature 3: 80 mV read for TTAAGG, Feature 4: 40 mV read for AATTCC, Feature 5: 60 mV read for AATTCC,Feature 6: 80 mV read for AATTCC}. Note that the features 4-6 contain the direct complement sequence of the TTAAGG, and can be found by looking it up in the read map. As another example of what the 6 features would look like as a list or vector corresponding to decoding the 6-mer ATCGAT: {Feature 1 : 40 mV read for ATCGAT, Feature 2: 60 mV read for ATCGAT, Feature 3: 80 mV read for ATCGAT, Feature 4: 40 mV read for TAGCTA, Feature 5: 60 mV read for TAGCTA, Feature 6: 80 mV read for TAGCTA}.

[0186] For further details regarding algorithms for aligning and / or j ointly decoding polynucleotides and their complements, such as measured using other types of sequencing systems and methods, see the following references, the entire contents of which are incorporated by reference herein: Boza et al., “DeepNano: Deep recurrent neural networks for base calling in MinlON nanopore reads,” PLOS ONE 0178751, 13 pages (2017); and Sylvestre-Ryan et al., “Pair consensus decoding improves accuracy of neural network basecallers for nanopore sequencing,” Genome Biology 22:38, 6 pages (2021).

[0187] It will be understood that any suitable data structure may be used to identify and / or store correlations between measured values and known combinations of nucleotides (e.g., duplex and single-stranded sequences) that were used to generate those values. For example, the data structure may be generated by, and appropriately stored for use by, a machine learning algorithm. For example, the data structure may be generated by training a machine learning algorithm to recognize values that are obtained, under each respective given set of measurement conditions, and are known a priori to correspond to respective combinations of duplex and single-stranded sequences, and may be stored in any suitable format within a non-volatile computer-readable medium. The data structure subsequently may be used by the trained machine learning algorithm, implemented by circuitry 160, to generate an output that identifies nucleotides in the sequence of construct 150, based upon an input of values that are measured in between nucleotide addition steps such as described with reference to FIGS. 1A-1H.

[0188] It will be appreciated that circuitry 160 may be used to train the machine learning algorithm, or different circuitry may be used to train the machine learning algorithm that then is implemented by circuitry 160. In certain examples, the data structure may be generated by, and appropriately stored for use by, a neural network, such as a deep learning algorithm. Forexample, the data structure may be generated by training a neural network (e.g., deep learning algorithm) to recognize values that are obtained, under each respective set of measurement conditions, and are known a priori to correspond to respective combinations of duplex and single-stranded sequences, and may be stored in any suitable format within a non-volatile computer-readable medium. Accordingly, the data structure may include neurons or weights of the neural network (e.g., deep learning algorithm). The data structure subsequently may be used by the trained neural network (e.g., deep learning algorithm), implemented by circuitry 160, to generate an output that identifies nucleotides in the sequence of construct 150, based upon an input of values that are measured in between nucleotide addition steps such as described with reference to FIGS. 1A-1H.

[0189] It will be appreciated that circuitry 160 may be used to train the neural network (e.g., deep learning algorithm), or different circuitry may be used to train the neural network (e.g., deep learning algorithm) that then is implemented by circuitry 160. In some examples, the training data preparation for the present systems and methods may use the following operations: 1) perform some initial basecalling of the raw signal, or level calls from some sequencing data from reference genomes, or a library of DNA fragments of known composition; 2) align the raw signals (or basecalled signals) to the reference genomes, or fragments of the known library; and 3) refine the initial basecalls and / or alignments based on knowledge of the true sequences, and fine-tune the mapping / association between signals and bases.

[0190] However, the training data may be prepared in any suitable manner. Illustratively, the training data preparation for the present systems and methods may use the following operations: 1) take reference genomes (or training data libraries of known composition) and generate a set of predicted current measurements for each template or genome. The predictions will likely be based on a smaller, more hand-curated model - such as a read map. 2) Align the raw signals, or level called signals to the predicted current traces using some algorithm for local / global alignments or dynamic time-warping. 3) Use the aligned values of the raw data (or level calls) to refine the associations between the known bases and the measured signals. 4) Possibly filter out bad alignments and either i) make a new- possibly extended-read map and repeat the process 1-4, or proceed to the next step if the alignments are sufficiently accurate. 5) The aligned / refined values will constitute the training data for the neural network.

[0191] For further details regarding neural network training routines as well as different neural network architectures for use in analyzing signals from polynucleotides passing through a nanopore, see the following references, the entire contents of which are incorporated by reference herein: Pages-Gallego et al., “Comprehensive benchmark and architectural analysis of deep learning models for nanopore sequencing basecalling,” Genome Biol. 24(1): 71, 18 pages (2023); and Teng et al., “Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning,” GigaScience 7(5): giy037, 9 pages (2018).

[0192] It should be noted that operations such as described herein, e.g., operations for measuring values, adding nucleotides, and identifying nucleotides, can be executed using any suitable combination of hardware and software. For example, FIG. 10 illustrates an example circuit 160 for sequencing a construct 150 in a manner such as provided herein. Circuit 160 may include processor 1040 and at least one computer-readable medium 1030. The computer-readable medium 1030 may store a first plurality of measured values 1031 of an electrical property of a 3' end of a first duplex and a single-stranded portion of a polynucleotide 158 within a construct, within an aperture of a nanopore. The computer-readable medium 1030 also may store a second plurality of measured values 1031’ of an electrical property of a 3' end of a duplex (e.g., the first duplex or a second duplex) and a single-stranded portion of a complement 159 of that polynucleotide 158 within that construct 150, within the aperture of the nanopore. The computer-readable medium 1030 may store a data structure 1032 (e g., joint decoding model or trained neurons), wherein the data structure correlates different measured values with different combinations of nucleotides within a duplex 154 and a single- stranded portion of polynucleotide 158 or complement 159 within construct 150, within an aperture 113 of a nanopore 110. Data structure 1032 further may identify a respective measurement condition under which the measured values were obtained, e.g., the magnitude of a bias voltage used to impose first force Fl or modified first force Fl’ during the measurement. In some examples, data structure 1032 further may identify the combination of nucleotides (e.g., at least at locations 4 and 4' at the 3' end 153 of the duplex 154 and at locations 5 and 6 illustrated in FIG. IE) that provided each of the measured values.

[0193] The computer-readable medium 1030 also may store instructions for causing processor1040 to implement operations such as provided herein. For example, the instructions may be forcausing processor 1040 to use the first plurality of measured values and the second plurality of measured values (such as with a joint decoding algorithm or a neural network of trained neurons), to determine the sequence of nucleotides in the sequence of the polynucleotide; and to output a representation of the determined sequence of nucleotides. Illustratively, the instructions may be provided within sequencing module 1033. Sequencing module 1033 may include nucleotide addition module 1034 configured to cause processor 1040 to add a nucleotide to the 3' end 153 of a first or second duplex in a manner such as described with reference to FIGS. IB and ID. For example, circuit 160 may be operably coupled to electrodes 102 and 103. Nucleotide addition module 1034 may cause processor 1040 to apply second force F2 by applying a suitable voltage bias across electrodes 102 and 103. Sequencing module 1033 may include measurement module 1035 configured to cause processor 1040 to measure, in between nucleotide addition operations, values of an electrical property of a 3' end 153 of a first or second duplex including portion of the construct (e.g., polynucleotide or complement) within an aperture of a nanopore in a manner such as described with reference to FIGS. IB, ID, and 1H, and to store the measured values within computer-readable medium 1031. For example, measurement module 1035 may cause processor 1040 to apply first force Fl or modified first force Fl’ by applying a suitable voltage bias across electrodes 102 and 103, and measuring the value of the electrical property while applying such force.

[0194] Circuitry 160 may include one or more sensor(s) 1010, each configured to measure the value of one or more electrical properties. Each sensor 1010 may be configured to measure, for example, an electrical voltage drop across nanopore 110, an electrical current through nanopore 110, or an electrical resistance across nanopore 110, or an intensity of light from a dye the emission from which changes responsive to the amount of ionic current through nanopore 110. Measured values 1031 further may identify a measurement condition under which the measured values were obtained, e.g., the magnitude of a bias voltage used to impose first force Fl or modified first force Fl’ during the measurement.

[0195] In examples in which the measured value is electrical in nature, sensor 1010 may include one or both of electrodes 102 and 103 or may include one or more additional electrodes or other circuit component(s) respectively in contact with fluid 120 and / or fluid 120’. In examples in which the measured value is electrical in nature, the circuit component(s) in contact with fluid120 and / or fluid 120’ may include a field effect transistor configured to sense a voltage drop across fluid 120 and fluid 120’. In examples in which the measured value is optical in nature, sensor 1010 may include any suitable optical detector, such as an active-pixel sensor (APS) including an array of amplified photodetectors configured to generate an electrical signal based on light received by the photodetectors. APSs may be based on complementary metal oxide semiconductor (CMOS) technology known in the art. CMOS-based detectors may include field effect transistors (FETs), e.g., metal oxide semiconductor field effect transistors (MOSFETs). In particular examples, a CMOS imager having a single-photon avalanche diode (CMOS-SPAD) may be used, for example, to perform fluorescence lifetime imaging (FLIM). In other examples, the optical detector may include a photodiode, such as an avalanche photodiode, charge-coupled device (CCD), cryogenic photon detector, reverse-biased light emitting diode (LED), photoresistor, phototransistor, photovoltaic cell, photomultiplier tube (PMT), quantum dot photoconductor or photodiode, or the like. Each sensor 1010 generates an electrical signal corresponding to the measured value, and provides that signal to memory 1030 for storage at 1031. Optionally, circuitry 160 includes amplifier(s) 1020 respectively configured to amplify the electrical signal(s) from respective sensor(s) 1010 prior to storage of that signal at 1031; as a further option, an amplifier 1020 may be included within a respective sensor 1010.

[0196] Sequencing module 1033 also may include nucleotide identification module 1036 configured to cause processor 1040 to identify nucleotides by comparing the first plurality of measured values 1031 and the second plurality of measured values 1031’ to values within data structure 1032 and / or using a joint decoding algorithm or deep learning algorithm, e.g., in a manner such as described with reference to FIGS. 8A-8C and 9. For example, nucleotide identification module 1036 may cause processor 1040 to use measured values from 1031 and 1031 ’ (illustratively, in an order - or inverted order - corresponding to the temporal order in which they were obtained), and to use at least a portion of data structure 1032 that was obtained under the same operating condition as were the measured values. For example, nucleotide identification module 1036 may cause processor 1040 to compare the identification of a measurement condition stored within measured values 1031 or measured values 1031’ to the identification of a measurement condition stored within data structure 1032, and to ignore any values within data structure 1032 that do not match the measurement condition of the measured values 1031 or 1031’. In some examples, nucleotide identification module 1036 may causeprocessor 1040 to perform an operation comparing the measured values to values within the data structure, for example by taking differences between the measured values and values within the data structure, by taking ratios between the measured values and values within the data structure, by performing statistical comparisons such as the T-test, or the like. Nucleotide identification module 1036 may cause processor 1040 to select the value within data structure 1032 that, based on the comparison, is most similar to the measured value, and to select from data structure 1032 the combination of nucleotides (e.g., at least at locations 4 and 4' at the 3' end of the duplex and at locations 5 and 6 illustrated in FIG. IE) that previously provided that measured value. For example, nucleotide identification module 1036 may implement a deep learning algorithmjoint decoding model, or other suitable algorithm for selecting such a combination of nucleotides.

[0197] Nucleotide identification module 1036 may cause processor 1040 to use the selected combinations of nucleotides to construct an electronic sequence of nucleotides that corresponds to the physical sequence of nucleotides in construct 150 to which measured values 1031 and 1031’ correspond. For example, using the labels illustrated in FIG. IE, each measured value 1031 and 1031’ includes contributions from the base pair 4, 4', as well as the unpaired nucleotides 5 and 6. Accordingly, in some examples, nucleotide identification module 1036 may cause processor 1040 to include the nucleotides at locations 4, 5, and 6 within the electronic sequence of nucleotides that corresponds to the physical sequence of nucleotides in construct 150. In this regard, at least some of such nucleotides may already have been included in the electronic sequence, because at least some of such nucleotides also would have contributed to the value measured in the immediately prior measurement step - that is, before the addition of a single nucleotide - but at a location that is shifted by a single nucleotide. As such, the electronic sequence already may include the nucleotides that now are at locations 4 and 5, but were at locations 5 and 6 in the previous measurement step. The nucleotide that is now at location 6 may be added to the electronic sequence; for example, having been at location 7 in the previous measurement step it may not have sufficiently contributed to the value in the previous measurement step in such a manner as to be identifiable during that step, but now is identifiable. Nucleotide identification module 1036 may cause processor 1040 to output the electronic sequence of nucleotides, e.g., by saving the sequence to memory 1030, electronically transmitting the sequence to another device or system (not specifically illustrated), displaying thesequence or a portion thereof on a display screen (not specifically illustrated) that is operably coupled to circuit 160, or the like.

[0198] Nucleotide identification module 1036 optionally may be configured to cause processor 1040 to identify nucleotides, or confirm the identity of nucleotides, using measurements of multiple types of values. For example, in a manner such as described with reference to FIGS. 8A-8C and 9, for any given combination of nucleotides, data structure 1032 optionally may include different values of a particular type that respectively correspond to different measurement conditions. Additionally, or alternatively, for any given combination of nucleotides, data structure 1032 optionally may include different types of measured values. Nucleotide identification module 1036 may cause processor 1040 to use any combination of values obtained using different types of measurements and / or different measurement conditions to identify nucleotides, or confirm the identity of nucleotides. As one illustrative example, nucleotide identification module 1036 may cause processor 1040 to use values from two different types of measurements to identify a point in data structure 1032 corresponding to a particular combination of duplex base pairs and unpaired nucleotides.

[0199] In some examples, nucleotide identification module 1036 additionally, or alternatively, may be configured to cause processor 1040 to confirm the accuracy of an identification using at least the immediately previous or next measurement step, if not even earlier and / or even later measurement step(s). For example, in a manner such as described with reference to FIGS. 8A- 8C, if for a given measurement step processor 1040 identifies nucleotides A, C, and G at locations 4, 5 and 6, and if such identification is accurate, then for the next measurement step (after addition of a single nucleotide using nucleotide addition module 1034) the processor should identify nucleotides C and G at locations 4 and 5. On the other hand, if either the current or previous identification is inaccurate, then one or both of the nucleotides at locations 4 and 5 in one measurement step may not match the nucleotides at locations 5 and 6 in the immediately previous measurement step. So as to enhance accuracy of the electronic sequence obtained, nucleotide identification module 1036 may cause processor 1040 to compare the nucleotides identified for a given measurement step to the nucleotides identified for at least one other (e.g., earlier or later step) measurement step, and to indicate (e.g., flag) an error based on any differences between identified nucleotides that should have been the same as each other.

[0200] Responsive to an indication of a nucleotide identification error, nucleotide identification module 1036 may cause processor 1040 to take one or more remedial actions. For example, nucleotide identification module 1036 may cause processor 1040 to disregard one or more nucleotide identifications that are in error, e.g., by replacing the erroneous identification with an identification that is known to be correct from other measurement steps that are consistent with each other (e.g., because each given nucleotide may contribute to three or more sequential measurement values); or by indicating the nucleotide as not being identified (e.g., using a nonce character such as “Z” to indicate that the nucleotide’s identity is unknown). As another example, which may be implemented in addition to or as an alternative to another remedial action, nucleotide identification module 1036 may cause processor 1040 to attempt to identify the nucleotide again using stored measured values 1031, 1031’ and data structure 1032. As another example, which may be implemented in addition to or as an alternative to another remedial action, nucleotide identification module 1036 may cause processor 1040 to attempt to identify the nucleotide again by obtaining a new measured value 1031 or 1031’ using a different measurement condition (e.g., a modified first force Fl’) and data structure 1032. As another example, which may be implemented in addition to or as an alternative to another remedial action, nucleotide identification module 1036 may cause processor 1040 to attempt to identify the nucleotide again by obtaining a new measured value 1031 or 1031’ using a different measurement type and data structure 1032. As another example, which may be implemented in addition to or as an alternative to another remedial action, nucleotide identification module 1036 may cause processor 1040 to resequence the construct 150 in a manner such as described elsewhere herein. As another example, which may be implemented as an alternative to such remedial measure(s), or may be implemented if such remedial measure(s) are attempted but do not succeed, nucleotide identification module 1036 may cause processor 1040 to indicate in the electronic sequence that the nucleotide was not identified (e.g., using a nonce character such as “Z” to indicate that the nucleotide’s identity is unknown). In some examples, nucleotide identification module 1036 may cause processor 1040 to select from among these or other operations based upon the apparent nature of the error and the options available at the time the error is identified.

[0201] Note that in some examples, data structure 1032 and nucleotide identification module1036 suitably may be implemented using machine learning. For example, data structure 1032may be generated by training any suitable machine learning algorithm, such as a neural network (e g., deep learning algorithm) using measured values, the combinations of nucleotides where are known a priori to correspond to those measured values, and the measurement conditions under which those measured values were obtained. In this regard, data structure 1032 may have a construction that is readily usable by the trained machine learning algorithm, e g., trained neural network, such as a trained deep learning algorithm (nucleotide identification module 1036, implemented by processor 1040) to identify combinations of nucleotides using measured values, but such construction may not necessarily be usable by any other software, module, or algorithm to determine correlations between measured values and combinations of nucleotides. For example, machine learning algorithms (such as neural networks, e.g., deep learning algorithms) may be trained, using the signal output of circuity 160, to make base calls. Non-limiting examples of machine learning algorithms are supervised, semi-supervised, unsupervised, and reinforcement algorithms. Neural network algorithms are a subset of machine learning algorithms and may include deep learning algorithms, convolutional neural networks, recurrent neural networks, generative adversarial networks, and recursive neural networks. Accordingly, the particular construction of data structure 1032 may include, for example, a vector space, graph space, neurons of a neural network, or the like. Alternatively, data structure 1032 may be implemented using any suitable data structure that may be queried using nucleotide identification module, such as a look-up table (LUT), matrix, flat-file database structure, SQL database structure, or the like. Nucleotide identification module 1036 may cause processor 1040 to suitably identify points in the data structure 1032 with measured values, for known combinations of nucleotides, that correspond to the measured values for unknown combinations of nucleotides.

[0202] It should be appreciated that circuitry 160 may be implemented using any suitable combination of digital electronic circuitry, integrated circuitry, application specific integrated circuits (ASICs), field programmable gate arrays (FPGAs), central processing units (CPUs), graphical processing units (GPUs), computer hardware, firmware, software, and / or combinations thereof. For example, one or more functionalities of circuit 160 may be implemented in one or more computer programs that are executable and / or interpretable on a programmable system including at least one programmable processor, which can be special or general purpose, coupled to receive data and instructions from, and to transmit data and instructions to, a storage system, at least one input device, and at least one output device. The programmable system or computingsystem can include clients and servers. A client and server are generally remote from each other and typically interact through a communication network. The relationship of client and server arises by virtue of computer programs running on the respective computers and having a clientserver relationship to each other.

[0203] These computer programs, which can also be referred to as modules, programs, software, software applications, applications, components, or code, can include machine instructions for a programmable processor, and / or can be implemented in a high-level procedural language, an object-oriented programming language, a functional programming language, a logical programming language, and / or in assembly / machine language. As used herein, the terms “memory” and “computer-readable medium” refer to any computer program product, apparatus and / or device, such as magnetic discs, optical disks, solid-state storage devices, memory, and Programmable Logic Devices (PLDs), used to provide machine instructions and / or data to a programmable data processor, including a machine-readable medium that receives machine instructions as a computer-readable signal. The term “computer-readable signal” refers to any signal used to provide machine instructions and / or data to a programmable data processor. The computer-readable medium can store such machine instructions non-transitorily, such as would a non-transient solid-state memory or a magnetic hard drive or any equivalent storage medium. The computer-readable medium can alternatively or additionally store such machine instructions in a transient manner, such as for example as would a processor cache or other random-access memory associated with one or more physical processor cores.

[0204] The computer components, software modules, functions, data stores and data structures described herein can be connected directly or indirectly to each other in order to allow the flow of data needed for their operations. It is also noted that a module or processor includes but is not limited to a unit of code that performs a software operation, and can be implemented for example as a subroutine unit of code, or as a software function unit of code, or as an object (as in an object-oriented paradigm), or as an applet, or in a computer script language, or as another type of computer code. The software components and / or functionality can be located on a single computer or distributed across multiple computers and / or the cloud, depending upon the situation at hand.

[0205] In one nonlimiting example, circuit 160 described with reference to FIG. 10 may be implemented using a computing device architecture. In such architecture, a bus (not specifically illustrated) can serve as the information highway interconnecting the other illustrated components of the hardware. The system bus can also include at least one communication port (such as a network interface) to allow for communication with external devices either physically connected to the computing system or available externally through a wired or wireless network. Processor 1040 may be implemented using a CPU (central processing unit) (e.g., one or more computer processors / data processors at a given computer or at multiple computers) that can perform calculations and logic operations required to execute a program. Memory 1030 may include a non-transitory processor-readable storage medium, such as read only memory (ROM) and / or random access memory (RAM) in communication with processor 1040 and can include one or more programming instructions for the operations provided herein, e g., sequencing module 1033 and its components, and may store measured values 1031 and data structure 1032. Optionally, memory 1030 may include a magnetic disk, optical disk, recordable memory device, flash memory, or other physical storage medium. To provide for interaction with a user, circuit 160 may include or may be implemented on a computing device having a display device (e.g., a CRT (cathode ray tube) or LCD (liquid crystal display) or OLED (organic light emitting diode) or plasma monitor) for displaying information obtained to the user and an input device such as keyboard and / or a pointing device (e.g., a mouse or a trackball) and / or a touchscreen by which the user can provide input to the computer.

[0206] Note that sequencing module 1033 further may be configured to cause processor 1040 to perform additional operations such as will be described with reference to FIGS. 3A-3B, 4A-4B, 5, and 7. Such operations may be implemented using additional modules not specifically illustrated in FIG. 10, or may be implemented using suitable modifications to nucleotide addition module 1034, measurement module 1035, and / or nucleotide addition module 1036.

[0207] Further note that the circuitry described with reference to FIG. 10 is purely illustrative, and that operations described herein may be performed using any suitably configured combination of hardware and software. For example, nucleotide identification module 1036 may include the software / hardware doing the “basecalling”, and may include modules configured to perform operations including data extraction (e.g., signal level calling), alignment (e.g., accountfor offsets), decoding (e.g., converting called signal levels to base calls), and consensus (e.g., combining reads from sequencing and / or resequencing.

[0208] It will further be appreciated that any suitable combination of operations such as described with reference to FIGS. 1A-1H, 3A-3B, 4A-4B, 7, 8A-8C, 9, and 10 may be used to sequence a polynucleotide, e.g., construct 150. For example, FIG. 5 illustrates a flow of operations in an example method for sequencing a full-complement polynucleotide. Method 500 may use a nanopore that includes a first side, a second side, and an aperture extending through the first and second sides, e.g., in a manner such as described with reference to FIGS. 1A-1H and FIG. 7. Method 500 may include generating a construct including a polynucleotide and a complement of the polynucleotide (operation 510). In a manner such as described with reference to FIGS. 1A-1H, construct 150 may include template polynucleotide 158 and its complement 159 coupled thereto, e.g., via structure 157. The template polynucleotide 158 may be located 3' of complement 159, or complement 159 may be located 3' of template polynucleotide 158. Nonlimiting examples of methods for generating construct 150 (that is, for performing operation 510) are described in greater detail with reference to FIG. 6.

[0209] Method 500 may include disposing the construct through the aperture of the nanopore such that a 3' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore (operation 520). Example operations for disposing construct 150 through the aperture of nanopore 110 in such a manner are provided below with reference to FIG. 7. Method 500 may include forming a first duplex with the construct on the first side of the nanopore, the first duplex including a 3' end (operation 530). Such a first duplex may be formed, for example, by hybridizing the first portion 155 of construct 150 to a first primer (polynucleotide 140 or a portion thereof) on the first side of the nanopore, e.g., in a manner such as described below with reference to FIG. 7. In some examples, polynucleotide 140 may be or include a portion of complex 150, e.g., in a manner such as described below with reference to FIG. 6.

[0210] Method 500 may include characterizing the polynucleotide to generate a first plurality of measured values (operation 540). Illustratively, operation 540 may include (i) extending the first duplex on the first side of the nanopore by adding a nucleotide to the 3' end of the first duplex.For example, circuitry 160 may apply second force F2, responsive to which the 3' end of the first duplex is located out of the aperture of the nanopore such that a polymerase may act upon the 3' end of the first duplex to add a nucleotide thereto, e.g., in a manner such as described with reference to FIG. 1C. Operation 540 of method 500 may include (ii) inhibiting, using the nanopore, translocation of the 3' end of the extended first duplex to the second side of the nanopore. For example, constriction 114 or other feature of nanopore 110 may inhibit passage of 3' end 153 of duplex 154 (which in some examples is a first duplex), from the first side 111 of nanopore 110 to the second side 112 of nanopore 110 while first force Fl is applied in a manner such as described with reference to FIGS. IB and ID. Operation 540 of method 500 also may include (iii) measuring a value of an electrical property of the 3' end of the first duplex and a single-stranded portion of the polynucleotide. For example, circuitry 160 may measure such a value of the electrical property while the first force Fl is applied in a manner such as described with reference to FIGS. IB and ID. Operation 540 of method 500 also may include (iv) repeating operations (i)-(iii) for a first plurality of nucleotides that are complementary to nucleotides of the polynucleotide to generate the first plurality of measured values.

[0211] Method 500 also may include characterizing the complement to generate a second plurality of measured values (operation 550). Illustratively, operation 550 may include (v) extending the first duplex or a second duplex on the first side of the nanopore by adding a nucleotide to the 3' end of the first or second duplex. In some examples, the duplex used in operation 550 may be a continuation of the first duplex 140 formed by extending nucleotides through the first portion of the construct 156. In other examples, the duplex used in operation 550 may be a newly formed duplex, similar to duplex 140, which may hybridize to form a second duplex which is specific to a corresponding sequence (e.g., adapter or barcode) in complement 159 of the construct 150. For example, circuitry 160 may apply second force F2, responsive to which the 3' end of the first or second duplex is located out of the aperture of the nanopore such that a polymerase may act upon the 3' end of the first or second duplex to add a nucleotide thereto, e.g., in a manner such as described with reference to FIG. 1C. Operation 550 of method 500 may include (vi) inhibiting, using the nanopore, translocation of the 3' end of the extended first or second duplex to the second side of the nanopore. For example, constriction 114 or other feature of nanopore 110 may inhibit passage of 3' end 153 of a first duplex 154, from the first side 111 of nanopore 110 to the second side 112 of nanopore 110 while first forceFl is applied in a manner such as described with reference to FIGS. IB and ID. Or, for example, constriction 114 or other feature of nanopore 110 may inhibit passage of 3' end 153 of a second duplex, which may be formed by hybridizing a second primer to complement 159, from the first side 111 of nanopore 110 to the second side 112 of nanopore 110 while first force Fl is applied in a manner similar to that described with reference to FIGS. IB and ID. Operation 550 of method 500 also may include (vii) measuring a value of an electrical property of the 3' end of the first or second duplex and a single-stranded portion of the complement. For example, circuitry 160 may measure such a value of the electrical property while the first force Fl is applied in a manner such as described with reference to FIGS. IB and ID. Operation 550 of method 500 also may include (iv) repeating operations (v)-(vii) for a second plurality of nucleotides that are complementary to nucleotides of the complement to generate the second plurality of measured values.

[0212] Note that use herein of numeric designations such as (i), (ii), (iii), (iv), (v), (vi), (vii), and (viii) is for convenience in identifying operations, should not be interpreted as necessarily requiring the operations to be performed in any particular sequence. For example, in a construct in which complement 159 is located 3' of template polynucleotide 158, operations (v)-(viii) may be performed before operations (i)-(iv). Additionally, or alternatively, in operations where first force Fl is applied, operations (ii) and (iii) may be performed concurrently with one another, and similarly operations (vi) and (vii) may be performed concurrently with one another. Other variations are possible.

[0213] Method 500 may include generating a first sequence of the polynucleotide using the first plurality of measured values (obtained in operation 540) and the second plurality of measured values (obtained in operation 550) (operation 560). For example, circuitry 160 may identify a sequence of nucleotides in the construct 150 in a manner such as described with reference to FIGS. 8A-8C, 9, and 10. As shown in FIG. 5, operations 540-560 may be repeated any suitable number of times, e.g., so as to substantially sequence construct 150.

[0214] From the foregoing, it will be appreciated that the use of the present constructs in nanopore sequencing may provide a wide variety of benefits. Additional, or alternative, benefits now will be described with reference to FIGS. 2A-2B. FIG. 2A schematically illustrates theformation of transient secondary structures on the second side of the nanopore when sequencing a polynucleotide using a nanopore. As illustrated in FIG. 2A, polynucleotide 250 may be disposed through nanopore 110 and hybridized to polynucleotide 140 on the first side of the nanopore in a manner similar to that described with reference to FIGS. 1 A-1H, except that polynucleotide 250 is not coupled to its full complement within construct 150, and thus is only partially stable. Without wishing to be bound by any theory, it is believed that on the second side of the nanopore, polynucleotide 250 may spontaneously transition between an “unfolded” (open or partially open) and a “folded” (closed) state. In the “folded” state, polynucleotide 250 spontaneously forms a secondary structure 251 in which a first portion of polynucleotide 250 hybridizes to a second portion of polynucleotide 250 on the second side of the nanopore, e.g., to form a hairpin. For further details regarding the formation of secondary structures on the second side of a nanopore, see Spealman et al., “Inverted duplicate DNA sequences increase translocation rates through sequencing nanopores resulting in reduced base calling accuracy,” Nucleic Acids Research 48(9): 4940-4945 (2020), the entire contents of which are incorporated by reference herein.

[0215] Without wishing to be bound by any theory, it is believed that in nanopore sequencing systems and methods such as provided herein, the formation of secondary structure 251 may apply a downward force on polynucleotide 250 which measurably changes the measurement (e g., ionic current) through nanopore 110 in a manner similar to that described with reference to force Fl’ of FIG. IF. As illustrated in FIG. 2A, secondary structure 251 may spontaneously open (partially or fully), which reduces or removes the downward force which secondary structure 251 had applied to polynucleotide 250, again measurably changing the ionic current through nanopore 110. In some examples, secondary structure 251 is bistable, in that it repeatedly fluctuates between the unfolded and folded states. The effect of these fluctuations may be seen in signals 260 measured in a manner such as described with reference to FIGS. IB and ID, for example in current fluctuations 261 during the measurements made when a given nucleotide is located at the 3' end 153 of duplex 154, under a first set of measurement conditions (here, a measurement voltage of 80 mV). As also may be seen in FIG. 2A, these fluctuations also may be observed in measurements made using other conditions (illustratively, current fluctuations 262 for a measurement voltage of 60 mV, and current fluctuations 263 for a measurement voltage of 40 mV).

[0216] Without wishing to be bound by any theory, it is believed that random fluctuations between the folded and unfolded states may create a challenge for base calling. For example, the fluctuation rate may depend on the length (and strength) of the secondary structure 251 (e.g., hairpin), and may vary widely from hundreds of times per second to fewer than once per second. It may be unknown during a given sequencing measurement whether a polynucleotide is in the folded state (e.g., FIG. 2A, right) or unfolded state (e.g., FIG. 2A, left), or even some combination of folded states and unfolded states, for example in the case of fluctuations that are sufficiently fast relative to the measurement time. Additionally, as the polynucleotide 250 translocates through the nanopore 110 responsive to nucleotides being added to the 3' end of duplex 154, the nature (e.g., location, length, and / or strength) of the secondary structures 251 may change in ways that may be difficult to predict. These fluctuations thus may cause a sequence context-dependent uncertainty in the measured currents, and ultimately may give rise to base calling errors.

[0217] As provided herein, the present constructs 150 may inhibit formation of transient secondary structures 251 on the second side of the nanopore 110. For example, without wishing to be bound by any theory, it is believed that the present constructs 150 may form a secondary structure (such as a hairpin) which is sufficiently stable as to inhibit spontaneous fluctuations between folded and unfolded states such as described with reference to FIG. 2A. FIG. 2B schematically illustrates an example manner in which a full -complement polynucleotide may inhibit the formation of transient secondary structures when sequencing that full-complement polynucleotide using a nanopore. FIG. 2B illustrates nonlimiting examples of 3' first steric lock 151, polynucleotide 140, and 5' second steric lock 152 which will be described in greater detail below with reference to FIGS. 6-7. As illustrated in FIG. 2B, polynucleotide 158 and its complement 159 (joined by structure 157) may hybridize to one another on the second side of nanopore 110 to form a relatively stable secondary structure 252 of sufficient length and strength to inhibit the spontaneous folding and unfolding of other secondary structures on the second side of nanopore 110. In some examples, the secondary structure 252 is or includes a third duplex of any suitable length, e.g., a length of at least about 10 base pairs, or at least about 20 base pairs, or at least about 30 base pairs, or at least about 40 base pairs, or at least about 50 base pairs, or more. Secondary structure 252 may apply a downward force that shifts the measurement (e.g.,ionic current) through the nanopore 110, e.g., in a manner similar to that described with reference to FIG. 2A.

[0218] As complex 150 translocates through the nanopore 110 responsive to nucleotides being added to the 3' end of a first or second duplex, the nature (e.g., location, length, and / or strength) of the secondary structure 252 may change systematically and relatively slowly. As such, for any given measurement or group of measurements, it is expected that the downward force may be relatively stable, for example because secondary structure 252 may not spontaneously unfold during the measurement, especially as compared to secondary structure 251. Accordingly, it is expected that the measurements of the present constructs 150 will be significantly more stable than the fluctuating measurements (e.g., 261, 262, 263) described with reference to FIG. 2A for template polynucleotides which are not coupled to their complement. As such, the present constructs 150 may be expected to significantly improve the accuracy of nanopore sequencing not only by providing the ability to jointly decode measurements made on both a template polynucleotide and its complement, but by significantly improving the quality of the measurements themselves.

[0219] Still further, or alternative, improvements may be implemented. For example, without wishing to be bound by any theory, it is believed that a secondary structure potentially may form on the first side of nanopore 110, e.g., based upon a portion of both the template polynucleotide 158 and its complement 159 concurrently being located on the first side of the nanopore. FIG. 3A schematically illustrates the formation of a secondary structure on the first side of the nanopore when sequencing a full-complement polynucleotide using the nanopore. FIG. 3A illustrates nonlimiting examples of 3' first steric lock 151, polynucleotide 140, and 5' second steric lock 152 which will be described in greater detail below with reference to FIGS. 6-7. As illustrated in FIG. 3A, template polynucleotide 158 and its complement 159 (joined by structure 157) may hybridize to one another on the first side of nanopore 110 to form a relatively stable secondary structure 351 which in some regards is similar to secondary structure 252 described with reference to FIG. 2B. For example, secondary structure 351 similarly may be of sufficient length and strength to inhibit the spontaneous folding and unfolding of other secondary structures on the first side of nanopore 110. However, without wishing to be bound by any theory, it is believed that the formation of secondary structure 351 may reduce the ability ofpolymerase 105 (not specifically shown) to access the 3' end of duplex 1 4, and thus may cause the extension of the duplex to slow down and potentially stop as polynucleotide 140 is extended towards secondary structure 351.

[0220] As provided herein, hybridization between polynucleotide 158 and complement 159 may be inhibited in any suitable manner. FIG. 3B schematically illustrates an example manner in which the force and timing of the force applied to a full-complement polynucleotide may be adjusted to inhibit the formation of a secondary structure on the first side of the nanopore while still allowing enough time for polymerase to bind and extend the 3’ end of the duplex when sequencing the full-complement polynucleotide using the nanopore. In the nonlimiting example illustrated in FIG. 3B, in which polynucleotide 158 is located 3' of complement 159, only a portion of polynucleotide 158 may be moved from the second side of nanopore 110 to the first side of nanopore 110, so as to inhibit hybridization between polynucleotide 158 and complement 159. Such movement may be performed, for example, after operation (iii) and before repeating operation (i) described above with reference to FIG. 5. In another nonlimiting example (not specifically illustrated), in which polynucleotide 158 is located 5' of complement 159, only a portion of complement 159 may be moved from the second side of nanopore 110 to the first side of nanopore 110, so as to inhibit hybridization between polynucleotide 158 and complement 159. Such movement may be performed, for example, after operation (vii) and before repeating operation (v) described above with reference to FIG. 5. In another nonlimiting example (not specifically illustrated), in which polynucleotide 158 is located 5' of complement 159, all or a portion of complement 159 may be moved from the second side of nanopore 110 to the first side of nanopore 110, but the polymerase binding rate is sufficiently fast to access the 3' end of duplex 154 before any secondary structure may form. Such movement may be performed, for example, after operation (vii) and before repeating operation (v) described above with reference to FIG. 5. In another nonlimiting example (not specifically illustrated), in which polynucleotide 158 is located 5' of complement 159, all or a portion of polynucleotide 158 and all or a portion of complement 159 may be repeatedly move from the first side of nanopore 110 to the second side of nanopore 110 and back in such a manner as to disrupt secondary structure formation but retaining access the 3' end of duplex 154 before any secondary structure may form. Such movement may be performed, for example, after operation (vii) and before repeating operation (v) described above with reference to FIG. 5.

[0221] In any of such examples, secondary structure 351 may not be able to form on the first side of the nanopore because both polynucleotide 158 and complement 159 are not both located on that side of the nanopore at the same time as one another, or because the time for the stable secondary structure formation exceeds the time for polymerase binding to the 3’ end of duplex 154. However, as illustrated in FIG. 3B, secondary structure 352 may form on the second side of the nanopore which may be beneficial for reasons such as described with reference to FIGS. 2A- 2B. Movement of only a portion of template polynucleotide 158, or of only a portion of complement 159, to the first side of the nanopore may be achieved by suitably selecting F2 such as described with reference to FIG. 1C. For example, the voltage used to provide F2 may be reduced in time, in amplitude, or in both time and amplitude, relative to a voltage that otherwise may be used to move both template polynucleotide 158 and complement 159 to the first side of nanopore 110. Movement of only a portion or all of template polynucleotide 158, or of only a portion or all of complement 159 to the first side of the nanopore for a sufficiently short time as to inhibit secondary structure formation may be achieved by suitably selecting F2 such as described with reference to FIG. 1C and Fl as described in reference to Fig. ID. For example, the voltage used to provide F2 may be reduced in time, in amplitude, or in both time and amplitude, relative to a voltage that otherwise may be used to move both template polynucleotide 158 and complement 159 to the first side of nanopore 110 and Fl may be may be reduced in time, in amplitude, or in both time and amplitude, relative to a voltage that otherwise may be used to move both template polynucleotide 158 and complement 159 to the second side of nanopore 110.

[0222] Hybridization between polynucleotide 158 and complement 159 may be inhibited in any other manner. For example, the present systems and methods further may include heating the construct to a temperature that inhibits formation of secondary structures on the first side of the nanopore, and / or to a temperature that inhibits formation of secondary structures on the second side of the nanopore. For example, an elevated temperature that inhibits formation of secondary structure 351 may also inhibit formation of secondary structure 252 and / or secondary structure 352. While secondary structures 252 and 352 may be beneficial for inhibiting spontaneous transitions between folded and unfolded states such as described with reference to FIGS. 2A-2B, the elevated temperature that inhibits formation of secondary structure 252 and / or secondarystructure 352 also may inhibit formation of transient secondary structures 251, thus reducing or obviating the need for more stable secondary structures 252 and 352.

[0223] It will be appreciated that the same nanopore may be used in multiple different sequences of operations such as described with reference to FIGS. 1A-1H, 2A-2B, 3A-3B, 5, 7, 8A-8C, 9, and 10, which sequences of operations may use the same constructs 150 as one another. For example, FIGS. 4A-4B schematically illustrate use of the sequencing system of FIGS. 1 A-1H to re-sequence the same construct 150, e.g., to generate a consensus read. Referring now to FIG. 1H, system 100 is shown at a time at which sequencing of construct 150 is substantially complete; alternatively, the sequencing of construct 150 may be partially completed and nucleotide identification module 1042 has caused processor 1040 to take the remedial action of resequencing construct 150. Responsive to circuitry 160 applying the first force Fl as shown in FIG. 1H, construct 150 remains hybridized to the (now-extended) polynucleotide 140 in a manner such as described elsewhere herein. To resequence construct 150, circuitry may be configured to apply a sufficiently high voltage F4 to dissociate duplex 154, that is, to dehybridize extended polynucleotide 140 from construct 150 in a manner such as illustrated in FIG. 4A. Construct 150 optionally may be re-sequenced, e.g., using operations that include hybridizing a new (shorter) polynucleotide 140’, such as a primer, to construct 150 in a manner such as illustrated in FIG. 4B. For example, primers 140’ may be included in fluid 120. The sequence of nucleotide addition and measurement operations provided herein then may be used to partially or fully sequence construct 150 again. As such, the new duplex formed on the first side of the nanopore may include the same first portion 155 of construct 150 as described with reference to FIG. 1A, and may have another 3' end 153 that includes the end of the new polynucleotide 140’. Such sequence of operations described with reference to FIGS. 1A-1H, 5, and 4A-4B may be repeated any desired number of times to sequence construct 150 over and over, e.g., until a desired level of accuracy is achieved to provide desired confidence in the sequence. For example, accuracy is improved by combining multiple reads of the same polynucleotide when errors are random and those can be “averaged out” through the use of consensus algorithms known in the art. Illustratively, operations 540-560 described with reference to FIG. 5 may be repeatedly performed to obtain a plurality of additional sequences of the polynucleotide, and a consensus sequence may be generated using the first sequence and the plurality of additional sequences. Additionally, or alternatively, operations 540-560 may be repeated to obtain additional first andsecond pluralities of measured values, and a consensus set of measured values may be generated using the additional first and second pluralities of measured values. A consensus sequence then may be generated using the consensus set of measured values.

[0224] The present construct 150 may be made in any suitable manner. FIG. 6 schematically illustrates an example workflow (method) 600 for generating a full-complement polynucleotide for sequencing.

[0225] Workflow 600 illustrated in FIG. 6 may include coupling native double-stranded polynucleotide 612 including a sense strand and an antisense strand to first and second stem-loop adapters 611 each including a cleavable moiety 660. In the nonlimiting example shown in FIG.6, a double-stranded polynucleotide 612 (e.g., dsDNA) is fragmented to the desired length, and is subjected to end repair, 5' phosphorylation, and A-tailing as in commercially available sequencing-by-synthesis (SBS) ligation library prep kits (e.g., TruSeq, Illumina, Inc.) At operation 610, stem-loop adapters 611 are coupled (e.g., ligated) to both ends of the processed double-stranded fragments 612 to generate a symmetrical “dumbbell” product including a sense strand 613 and an antisense strand 614. In some examples, adapters 611 include a 3’ dT overhang, a 5' phosphate, and cleavable moiety 660, such as a deoxyuridine (dU) or other cleavable residue, in the 3' portion of the stem. Excess adapter and adapter-dimer products may be removed using solid-phase reversible immobilization (SPRI) beads or other size-selective purification method (not specifically illustrated in FIG. 6).

[0226] Workflow 600 illustrated in FIG. 6 may include cleaving the cleavable moiety 660 of each of the first and second loop adapters 611. For example, at operation 620 illustrated in FIG.6, USER enzyme (uracil glycosylase + endonuclease VIII) (or other cleavage reagent) is used to cleave the dU (or other cleavable) residue in the adapter, generating a 1-base pair gap flanked by a 3' phosphate and a 5’ phosphate (these phosphates not specifically shown in FIG. 6). At operation 630, polynucleotide kinase (PNK) may be used to remove the 3' phosphate from the gap, to leave a free 3 ' OH (not specifically illustrated) at the gap.

[0227] Workflow 600 illustrated in FIG. 6 may include dehybridizing the sense strand 613 from the anti-sense strand 614. For example, at operation 630, the sense strand 613 and antisense strand 614 are separated, facilitated by the gaps in the adapters. In some examples, theseparation of sense strand 613 from antisense strand 614 may be accomplished using heat, or by using a strand-displacing polymerase as polymerase 631.

[0228] Workflow 600 illustrated in FIG. 6 may include synthesizing a complement of the sense strand 613 to form a first partial construct 671 that includes the sense strand 613 coupled to the complement of the sense strand 613’ via a first loop adapter 611. Additionally, workflow 600 illustrated in FIG. 6 may include synthesizing a complement of the anti-sense strand 614 to form a second partial construct 671 that includes the antisense strand 614 coupled to the complement of the antisense strand 614’ via a second loop adapter. For example, as illustrated in FIG. 6, polymerases 631 are used to synthesize complement 613’ to sense strand 613, and to synthesize complement 614’ to antisense strand 614. In some examples, the complements 613’, 614’ are synthesized using the stem-loop adapter 611 (hairpin) as a primer. Note that because sense strand 613 and antisense strand 614 are naturally occurring, they may carry epigenetic marks (such as methylated bases). In comparison, sense complement 613’ and antisense complement 614’ are synthetic, and thus may not necessarily carry epigenetic marks. For example, the complement 613’ of the sense strand and the complement 614’ of the antisense strand may be synthesized using only unmodified nucleotides. Or, for example, the complement 613’ of the sense strand and the complement 614’ of the antisense strand may be synthesized using modified nucleotides. Nonlimiting examples of the manner in which complements 613’ and 614’ respectively may be used to identify epigenetic marks on sense strand 613 and antisense strand 614, with or without the use of modified nucleotides in complements 613’ and 614’, are described further below with reference to FIGS. 18A-18B. For example, complements 613’ and 614’ may be used as an internal reference to provide for, or improve, detection of the epigenetic marks on sense strand 613 and antisense strand 614.

[0229] Alternatively, the sequencing polynucleotide may have a sense strand followed by a reverse complement of the anti-sense strand. This essentially produces in tandem, two sense strand sequences on the same sequencing polynucleotides. Methods for producing a sense-sense sequencing polynucleotide have been disclosed in US application number 63 / 665,758, filed on June 28, 2024, the contents of which are incorporated in their entirety herein. Briefly, paired forked adapters with complementary linking sequences are added to the ends of double stranded nucleic acid. Non-limiting embodiments of the adapters (2300) are shown in FIG. 22 where2301 and 2301 ’ represent the complementary linking sequences. The adapter may have blockers bound to the complementary linking sequences (shown as 2302 and 2302’) to prevent adapter dimer formation. In the embodiment illustrated, each adapter has an optional biotin (2303) on the non-linking strand 2304 and 2305). The biotin may be used to attach the adapters to a surface. FIG 23 illustrates how the sense-sense sequencing polynucleotide is generated. Briefly, the adapters are attached to a double stranded polynucleotide having a sense and an antisense strand. The adapters may be attached to a surface and the double stranded polynucleotide is denatured, along with the blocker, if present. The complementary linking sequences at the 3’ ends at each of the denatured polynucleotide strands hybridize to each other and are extended. Post extension results in one strand having essentially two tandem sense strand sequences and another strand having essentially two tandem antisense strand sequences.

[0230] In this embodiment, the paired forked adaptor can be added using known methods. Nonlimiting examples include A-tailing and ligation or tagmentation. For A-tailing, the nucleic acid may be fragmented before adding the adaptors. Tagmentation, on the other hand, fragments and simultaneously attached the adapter.

[0231] Workflow 600 illustrated in FIG. 6 may include coupling a first forked adapter to the first partial construct 671 to form a first construct 150. Additionally, workflow 600 illustrated in FIG. 6 may include coupling a second forked adapter to the second partial construct 672 to form a second construct (not specifically illustrated in FIG. 6). For example, at operation 640, the respective 3' ends of the complement strands 613’ and 614’ may be A-tailed using a DNA polymerase; however, note that this operation instead can be performed during operation 630 by using an A-tailing polymerase to generate complement strands 613’ and 614’. At operation 640, a forked adapter 641 is coupled to (e.g., ligated onto) the respective free ends of first partial construct 671 and of second partial construct 672, generating asymmetric fork-loop products (product using second partial construct 672 not expressly illustrated), in some examples, forked adapter 641 may include a 3' dT overhang 642 to ligate to the sense strand 613 or antisense strand 614. In some examples, forked adapter 641 may include a 3' first steric lock 151. In some examples, forked adapter 641 may include primer sequence 643 coupled to first steric lock 151. Forked adapter 641 also may include a 5' phosphate to ligate to the sense strand complement 613’ or to antisense strand complement 614’. Forked adapter 641 also may includecomplementary regions 644, 644’ which hybridize to one another so as to facilitate ligation of the forked adapter to 613, 613’ or to 614, 614’ to form construct 150 as illustrated in FIG. 6. Forked adapter 641 also may include 5' phosphate 645 (or other negatively charged modification, such as a branched polymer or polyphosphate) which may be used to drive capture of construct 150 in nanopore 110 in a manner as will now be described with reference to FIG. 7.

[0232] Construct 150 may be disposed within, and optionally locked to, nanopore 110 using any suitable structure(s) and any suitable combination of operations. For example, FIG. 7 schematically illustrates an example manner in which a full-complement polynucleotide may be loaded into the sequencing system of FIGS. 1A-1H for sequencing. In operation A illustrated in FIG. 7, construct 150 may be located within a fluid (not specifically illustrated) which is brought into contact with nanopore 110. In some examples, first steric lock 151 may be coupled to the 3'-end of the construct 150 in a manner such as described with reference to FIG. 6, e.g., as part of forked adapter 641. In other examples, the 3' end of construct 150 may be biotinylated or otherwise functionalized, and first steric lock 151 may include a functional group (such as neutravidin or streptavidin) that will bind to the functionalized (e.g., biotinylated) 3' end of construct 150 and remain bound there until a sufficiently strong force is applied. In still other examples, first steric lock 151 may include LNA or PNA that hybridizes to construct 150 and is of sufficient length to remain hybridized to construct 150 until a sufficiently strong force is applied.

[0233] In operation B illustrated in FIG. 7, construct 150 may be brought into contact with first side 111 of nanopore 110. For example, as noted above with reference to FIG. 6, the 5' end of construct may include a negative charge (e.g., a 5' phosphate or other negatively charged moiety), and this negative charge may be attracted into aperture 113 of nanopore 110 through application of a suitable bias by circuitry 160. In operation C illustrated in FIG. 7, circuitry 160 applies a force sufficient to cause dehybridization of the polynucleotide 158 and complement 159 within construct 150, allowing the 5' end of strand 150 to translocate through nanopore 110. During application of such force, first steric lock 151 may inhibit passage of the 3'-end of construct 150 to the second side of the nanopore through the aperture in a manner such as described with reference to FIGS. 1A-1H. Second steric lock 152 then may be coupled to the 5' end of construct 150 in a manner such as illustrated in operation C of FIG. 7. Illustratively,second steric lock 152 may include LNA or PNA that hybridizes to construct 150 and is of sufficient length to remain hybridized to construct 150 until a sufficiently strong force is applied, or may include a “self-hybridization” step to form a strong hairpin structure on the second side of the pore with proximal nucleotides uncovered by the dehybridization step B. In operation D illustrated in FIG. 7, a first primer (polynucleotide 140) may be hybridized to construct 150 to form a first duplex which may be used to sequence at least a portion of construct 150 in a manner such as described elsewhere herein. For example, in operations El and E2 illustrated in FIG. 7, polymerase 105 may add nucleotide 121 to polynucleotide 140 based on the sequence of construct 150. Operations for identifying the nucleotide, and for adding additional nucleotides, are provided elsewhere herein.Identifying epigenetic marks

[0234] In some examples, accurate detection of epigenetic marks using the full complement library is provided by the fact that one portion of the construct may be synthesized to include reference nucleotides (e.g., unmodified nucleotides or modified nucleotides) and another portion of the construct may be native, e.g., may be of unknown composition and thus may contain possible epigenetic marks (e.g., modified nucleotides) which may be identified using the reference nucleotides in the synthesized portion.

[0235] For example, the present constructs may improve the ability to detect epigenetic marks (such as methylation), without necessarily chemically altering the epigenetic marks such as commonly done (e.g., using bisulfite). For example, the target polynucleotide may be obtained from a living organism, and thus may contain naturally occurring (native) modified nucleotides, while the complement is synthesized from known nucleotides (reference nucleotides) based on the sequence of the target polynucleotide. As provided herein, both the native target polynucleotide and its synthetic complement are coupled together in the same molecule, and sequenced using the same nanopore and circuitry in the same run as one another. Accordingly, the synthetic complement may be used as an internal “reference” against the native target polynucleotide. As provided herein, signals from the native polynucleotide and the reference,complement polynucleotide may be used together to identify epigenetic marks in the native polynucleotide.

[0236] As recognized by the present inventors, the present constructs may be used in several ways to detect epigenetic marks using signals from native polynucleotides and from their synthesized reference polynucleotides. Illustratively, FIGS. 18A-18B illustrate example signals obtained using sequences with different epigenetic marks than one another. More specifically, in FIGS. 18A-18B, the polynucleotide denoted T1 includes the sequence TTTTTTACATTTTTTAC*ATTTTTT, and the polynucleotide denoted T2 includes the sequence TTTTTTAC*ATTTTTTACATTTTTT, where C* denotes methyl cytosine. Accordingly, T1 and T2 have the same sequence as one another, but differ in their epigenetic marks. As recognized by the present inventors, signals from T1 and T2 may be used together to identify the location, and potentially also the type(s), of epigenetic marks on either strand.

[0237] Illustratively, in the region at which T2 has the sequence AC* A, T1 has the sequence ACA. Here, the unmethylated sequence of T1 here may be used as a reference for the corresponding methylated sequence of T2. For example, as illustrated in FIG. 18A, the signals obtained along T2 and T1 are generally similar to one another because the sequences are the same. However, the signals for T2 and Tl differ from one another in FIG. 18A in the region where T2 is methylated and Tl is not, namely where T2 includes AC*A and Tl includes ACA. As another example, in the region at which T1 has the sequence AC*A, T2 has the sequence ACA. Here, the unmethylated sequence of T2 here may be used as a reference for the corresponding methylated sequence of Tl. For example, as illustrated in FIG. 18B, the signals obtained along Tl and T2 are generally similar to one another because the sequences are the same. However, the signals for T 1 and T2 differ from one another in FIG. 18B in the region where Tl is methylated and T2 is not, namely where Tl includes AC*A and T2 includes ACA.

[0238] As recognized by the present inventors, because Tl and T2 are known a priori to have the same sequence as one another - other than for potential epigenetic marks - the difference in signals between Tl and T2 in a given region therefore means that Tl and T2 differ solely by epigenetic mark(s) in that region. More generally, if first and second sequences are directly related to one another (e.g., are the same as, or complementary to, one another), and the firstsequence is a priori known at a given location then any difference in signals may be used as a reference to determine that the second sequence differs from the first sequence in epigenetic mark(s) at this location. This is the case in FIG. 18A where T1 is known to lack methylation and T2 includes methylation; and also is the case in FIG. 18B where T2 is known to lack methylation and T1 includes methylation. Note that to determine whether T2 is methylated in the region shown in FIG. 18A, it need not be known a priori whether or where T2 contains any epigenetic marks; instead, it need only be known that T1 has the same sequence as T2, that T1 does not contain any epigenetic marks, and that there is a signal difference between T1 (reference) and T2 (unknown). Similarly, to determine whether T1 is methylated in the region shown in FIG. 18B, it need not be known a priori whether or where T1 contains any epigenetic marks, only that that T2 has the same sequence as Tl, that T2 does not contain epigenetic marks, and that there is a signal difference between T2 (reference) and Tl (unknown).

[0239] Note also that the polynucleotide being used as the reference may itself include epigenetic mark(s), e.g., may include one or more modified base(s) (such as one or more methylated nucleotide(s)), so long as those modifications are known a priori. Illustratively, it may be a priori known that a first polynucleotide is methylated (or contains other epigenetic mark) at a given location, and it may be unknown whether a second polynucleotide is methylated (or contains other epigenetic mark) at that location. Here, the first polynucleotide may be used as a reference to determine whether the second polynucleotide also is methylated at that location, in similar manner as described above. Indeed, just as above, this is the case in FIG. 18A where Tl lacks methylation and T2 is known to include methylation; and also is the case in FIG. 18B where T2 lacks methylation and Tl is known to include methylation. Note that to determine whether Tl is methylated in the region shown in FIG. 18A, it need not be known a priori whether or where T l contains any epigenetic marks; instead, it need only be known that T2 has the same sequence as Tl, that T2 does contain an epigenetic mark, and that there is a signal difference between Tl (unknown) and T2 (reference). Similarly, to determine whether T2 is methylated in the region shown in FIG. 18B, it need not be known a priori whether or where T2 contains any epigenetic marks, only that that Tl has the same sequence as T2, that Tl does contain an epigenetic mark, and that there is a signal difference between Tl (reference) and T2 (unknown).

[0240] In many examples herein, polynucleotide 158 of construct 150 is a native polynucleotide, e.g., obtained from an organism, and complement 159 is a synthetic polynucleotide, e.g., synthesized using polynucleotide 158 as a template. As such, the presence and location of epigenetic marks (such as base modifications, illustratively methylation) in polynucleotide 158 may be unknown. The sequence of complement 159 is a priori known to be exactly complementary to that of polynucleotide 158, and thus may be considered to be the “same” as that of polynucleotide 158 for purposes of the present disclosure. Additionally, the presence or absence of modified base(s) (such as methylated base(s)) within complement 159 also is a priori known by controlling the composition of nucleotides that are used to synthesize complement 159. Illustratively, if only unmodified (natural) nucleotides are used to synthesize complement 159, then it is a priori known that complement 159 contains no modified bases, and complement 159 may be used as a reference to identify any modified bases within polynucleotide 158. Conversely, if modified nucleotides of a certain type or types are used to synthesize complement 159, then it is a priori known that any nucleotides of that type within complement 159 are modified in that way, and complement 159 may be used as a reference to identify any unmodified bases of that type within polynucleotide 158.

[0241] In still other examples, complement 159 may be synthesized using a known composition or mixture of unmodified and modified nucleotides, which may or may not be the same type of modification present in polynucleotide 158. One possible application for using a mixture of modified and unmodified nucleotides to synthesize complement 159 is for creating test data for a more robust, or alternatively more sensitive, base caller using neural networks or otherwise. For example, to develop a more robust base caller, it may be desirable to use a mixture of modified and natural nucleotides and to train the base caller to be epigenetic modification unaware, which may improve the base caller’s accuracy across different organisms that may have different epigenetic modifications than one another. Additionally, or alternatively, using a mixture of modified and natural nucleotides may help to remove biases from training data, for example that otherwise may arise from the presence of specific epigenetic marks associated with specific sequence contexts in specific organisms.

[0242] Alternatively, complements 159 which are synthesized using a pre-defined set of known modifications may be used to train a more sensitive base calling algorithm that has sensitivity tomore than one kind of epigenetic modification, or potentially other modifications to the nucleotides that may be a result of, for example, DNA damage, DNA damage repair, or otherwise.

[0243] Differences between (i) a first plurality of measured values corresponding to the signal from a polynucleotide with unknown epigenetic marks (e.g., native polynucleotide), and (ii) a second plurality of measured values corresponding to the signal from reference polynucleotide with no epigenetic marks or with known genetic marks (e.g., a complement synthesized using the native polynucleotide as a template, using natural nucleotides, or modified nucleotides, or a mixture of natural nucleotides and modified nucleotides) may be calculated in any suitable manner to identify any epigenetic marks and / or or any lack of epigenetic marks in the polynucleotide with unknown epigenetic marks. For example, the first plurality of measured values may be subtracted from the second plurality of measured values to obtain a plurality of dissimilarity values. Or, for example, the second plurality of measured values may be subtracted from the first plurality of measured values to obtain a plurality of dissimilarity values. Or, for example, the first plurality of measured values may be divided by (e.g., normalized by) the second plurality of measured values to obtain a plurality of dissimilarity values. Or, for example, the second plurality of measured values may be divided by (e.g., normalized by) the first plurality of measured values to obtain a plurality of dissimilarity values. Or, for example, the first and second pluralities of measured values may be input to a machine learning algorithm (such as a neural network) to obtain a plurality of dissimilarity values. In some examples, more than one of such calculations are performed to obtain more than one plurality of dissimilarity values, and the pluralities of dissimilarity values may be compared to one another to provide still further accuracy in identifying epigenetic marks.

[0244] Although not always specifically mentioned, it will be understood that the first and second pluralities of measured values throughout the present application may be aligned to one another before calculating the dissimilarity values.

[0245] It will further be understood that in examples throughout the present application in which the polynucleotide used to generate the second plurality of measured values is a complement of the polynucleotide used to generate the first plurality of measured values, the second plurality ofmeasured values may be suitably computationally processed (e.g., inverted) before calculating the dissimilarity values. There are a few ways this may be accomplished. For example, for duplex templates generated by the workflow in FIG. 6, the complement signal may be run through base calling to generate the complement sequence, and then the reverse complement of the called sequence may be run through a “reverse base-calling” model to generate an expected trace from the sequence for comparison to the native trace; this also may be performed using a joint decoder. As another example, for quadruplex templates generated using the FIG. 19 workflow, each native strand will have an exact copy in the synthetic reverse complement copy of the opposite native strand (e.g., original top strand 1913 in figure 19 will be identical in sequence to synthetic reverse complement bottom strand 1914’). The traces from these copies would then only need to be aligned for the comparison calculation. That is, in some examples “direct repeats” in the same construct may be compared to one another, such as for FIG. 19 constructs where “identical bases” are paired. In other examples, UMIs may be used to “align” the sense strand (e.g. 612) on one template to the “complement of the antisense” (614’) strand on the second template as in FIG. 6. In this case, there also are direct comparisons, such as for the pairs 614 and 613’. As for the case where the “complement” is used to obtain the difference of signals, a suitable algorithm may be used to predict a set of signals for a polynucleotide based on its complement, or vice versa. Any reference herein to “comparing” signals to one another encompasses any pre-processing that may be performed before such comparison, or other assessment of differences between signals from the polynucleotide and its complement, is performed.

[0246] Regardless of the particular manner in which the pluralit(ies) of dissimilarity values are calculated, such values may correspond to differences in epigenetic marks along the lengths of the unknown and reference polynucleotides being compared (e.g., polynucleotide 158 and complement 159). Where the dissimilarity value is relatively small for a location corresponding to a given nucleotide in the sequences of the polynucleotides being compared, there is likely no difference in epigenetic mark at that nucleotide. In comparison, where the dissimilarity value is relatively large for a location corresponding to a given nucleotide in the sequences of the unknown and reference polynucleotides being compared, there is likely a difference in epigenetic mark at that nucleotide. In some examples, the magnitude of the dissimilarity value for a given nucleotide may be compared to a threshold. If the magnitude exceeds the threshold, then theunknown nucleotide may be flagged as having an epigenetic mark. If the magnitude is less than the threshold, then the unknown nucleotide may lack an epigenetic mark. Such examples may be particularly useful where the reference polynucleotide lacks any epigenetic marks, and therefore the magnitudes of the dissimilarity values may be expected to correspond solely to epigenetic marks on the unknown polynucleotide. In other examples, the amplitude of the dissimilarity value for a given nucleotide may be compared to both positive and negative thresholds. If the amplitude exceeds the positive threshold, then the unknown nucleotide may be flagged as having an epigenetic mark that the reference nucleotide lacks, and if the amplitude exceeds the negative threshold, then the reference nucleotide may be flagged as having an epigenetic mark that the unknown nucleotide lacks. If the amplitude is less than the positive threshold and is less than the negative threshold, then both the unknown nucleotide and the reference nucleotide lack an epigenetic mark. Such examples may be particularly useful where the reference polynucleotide contains epigenetic marks, and therefore the amplitudes of the dissimilarity values may be expected to correspond to differences between epigenetic marks on the unknown polynucleotide and epigenetic marks on the reference polynucleotide. In still other examples, the dissimilarity values may be input to a machine learning algorithm (e.g., neural network) which is trained to identify epigenetic marks on the unknown polynucleotide and / or reference polynucleotide using the difference values. In still other examples, for regions of interest flagged for dissimilarity, the plurality of current measurements may be fed into a classifier algorithm (e.g. neural network, Random Forest classifier, Bayesian classifier, Support Vector Machine or any other suitable type of classification algorithm), in order to identify the presence / absence or type of epigenetic mark.

[0247] While comparing signals from first and second polynucleotides that are a priori known to have the same sequence as one other (e.g. whereby the first and second set of polynucleotides are direct repeats on a nucleotide-by-nucleotide basis of one another produced by library preparation) is one way to identify epigenetic marks, another way to detect epigenetic marks may use a sequence decoder (e.g., base caller) that is trained to recognize epigenetic marks, such as modified nucleotides. Illustratively, the sequence decoder may be trained to identify any suitable number of modified nucleotides, e.g., one, two, three, or more than three modified nucleotides, in addition to unmodified (natural) nucleotides. In some examples, a first base caller may be run on the unknown polynucleotide, and a second base caller separately run on the reference polynucleotide. The reference (e.g., synthesized) polynucleotide may be used as a control, andthe unknown (e g., native) polynucleotide may be used as an “experiment.” Statistical confidence of the epigenetic identification may be assigned based on differences in the confidence of the separate base calls between the reference and unknown polynucleotides. Additionally, or alternatively, statistical confidence of the epigenetic mark identification may be assigned based on differences in the confidence of separate base calls made using a model trained to recognize epigenetic marks and using a model trained not to recognize epigenetic marks. For example, a base caller trained to recognize epigenetic marks may be separately run on both the reference and unknown polynucleotides. Similarly, a base caller which is trained to be unaware of epigenetic marks may be separately run on both the reference and unknown polynucleotides. As yet another alternative, a “joint decoder” such as described above may be used that is trained to be aware of epigenetic marks (e.g., modified nucleotides) as well as for base calling.

[0248] Additionally, or alternatively, in some examples, the signal from a reference complement polynucleotide that does not include any modified bases may be used to “predict” what the signal should be from the native (unknown) polynucleotide from which the complement was synthesized. Because the reference does not contain any modified bases, the prediction similarly will not contain any modified bases. As such, at locations at which the native polynucleotide does contain modified bases, the predicted signal will not match the measured signal. Such a prediction may be generated, for example, using a read map such as described with reference to FIGS. 8A-8D. Or, for example, such a prediction may be generated using a context-specific simulator such as described in Li et al., “DeepSimulator: a deep simulator for Nanopore sequencing,” Bioinformatics 34(17): 2899-2908 (2018), the entire contents of which are incorporated by reference herein. In some examples, the procedure may involve obtaining measured values for the reference polynucleotide and the corresponding native polynucleotide; performing base calling for the reference polynucleotide; predicting the sequence (excluding epigenetic marks) for the native polynucleotide; inputting the predicted sequence into the read map or context-specific simulator to obtain predicted measured values for the native polynucleotide; calculating the dissimilarity values between the predicted measured values and the actual measured values for the native polynucleotide; and identifying epigenetic marks in the native polynucleotide using the dissimilarity values. Alternatively, after base calling andgenerating the predicted sequence, a joint-decoder may be used that is nucleotide modification- aware.

[0249] It will be understood that constructs for use in sequencing polynucleotides, and in some examples for also identifying epigenetic marks in the polynucleotides being sequenced, may be made in any suitable manner. For example, the workflow described with reference to FIG. 6 optionally may be modified to include unique molecular identifiers (UMIs) 650. The UMIs 650 are unique barcodes that can be included in stem-loop adapters 611 such that reads respectively coming from the sense strand 613 and antisense strand 614 of the same fragment of native duplexed DNA 612 may be identified algorithmically after sequencing. For example, the workflow described with reference to FIG. 6 may be used to make two complete constructs 150, each containing one native strand (the sense strand 613 in one construct, and the antisense strand 614 in the other construct) and a synthetic “reverse complement” strand 613’ or 614’ coupled to the native strand via stem-loop adapter 611. The two constructs may be sequenced separately from one another, e.g., in one or multiple rounds of sequencing such as described with reference to FIGS. 1 A-1H. The sequences of the UMIs 650 may be used to identify constructs that match one another, because the UMIs will match one another in constructs that are generated from the same fragment of native duplexed polynucleotide as one another. However, it may not necessarily be possible to identify all matching sets of constructs in any given round of sequencing, for example due to sequencing errors that may occur during a given round or from lack of sequencing depth. Nonetheless, with sufficient sequencing depth, matching pairs of constructs may be identified for a significant proportion of the sequenced constructs using the UMIs 650 within the constructs. In the example shown in FIG. 6, following preparation each construct 150 may include a first UMI 650 at the stem-loop adapter 611 and a second, different UMI 650’ at the end which came from a different stem-loop adapter and was added in a manner such as shown in operations 610-630. Epigenetic marks, such as modified nucleotides, in the sense strand 613 and antisense strand 614 obtained from duplexed native polynucleotide 612 may be identified in manner such as described elsewhere herein, for example after aligning the paired constructs together using the UMIs and generating and analyzing dissimilarity values of the polynucleotides therein, and / or by basecalling with a modification-aware algorithm. Note that because sense strand 613 is sequenced using complement 613’ as a reference, and because sense strand 614 is sequenced using complement 614’ as a reference, any difference betweenepigenetic marks on sense strand 613 and epigenetic marks on antisense strand 614 also may be identified.

[0250] Other example methods of making constructs now will be described. It will be appreciated that while such constructs may be particularly useful for identifying epigenetic marks in a manner such as described with reference to FIGS. 18A-18B, their use is not so limited. For example, such constructs may be used in any suitable method for sequencing a polynucleotide, with or without also identifying epigenetic marks in the polynucleotide.

[0251] FIG. 19 schematically illustrates an example workflow 1900 for generating a fullcomplement polynucleotide for sequencing where top and bottom native strands, possibly including modified bases, are linked to unmodified synthetic reverse-complement copies of the top and bottom strands.

[0252] Workflow 1900 may include coupling a native double-stranded polynucleotide 1901 that includes a sense strand 1913 and an antisense strand 1914 to first and second adapters 1911, 1912. As illustrated in operation 1910 of FIG. 19, the native double-stranded polynucleotide 1901 may be coupled to the first adapter 1911 using a first transposome which includes first transposase 1981 and first adapter 1911, and may be coupled to the second adapter 1912 using a second transposome which includes second transposase 1982 and second adapter 1912. The first and second transposomes may fragment the double-stranded polynucleotide while coupling the first and second adapters 1911, 1912 thereto (sometimes referred to as “tagmentation”). In some examples, transposases 1981, 1982 are Tn5 transposases, although other suitable transposases may be used.

[0253] In the nonlimiting example illustrated in FIG. 19, the first adapter 1911 includes a first stem-loop adapter, including first ME sequence 1911’ and its complement ME’ sequence 1911” that hybridize to form a binding site for transposase 1981. Adapter 1911 also includes a DNA loop 1911 ’” linking the 5’ end of ME sequence 1911’ to the 3’ end of 1911”. In some examples, loop 1911 ’” includes a modified base with a branching connection to linker 1971 that anchors the transposome to a solid substrate 1972 (e.g., a magnetic bead) and includes a cleavable moiety 1973.

[0254] Second adapter 1912 may include a transfer strand 1974 containing the ME sequence 1912’ at the 3’ end and a subsequence 1912” that is a target of a telomerase that can be used to form a second stem-loop adapter in a manner such as will be described with reference to operation 1960. Adapter 1912 may also include a distinct nontransfer strand 1975 containing ME’ sequence 1912’” that hybridizes to the ME sequence 1912’ of transfer strand 1974 for the binding site for transposase 1982. Nontransfer strand 1975 may also include a linker 1976 connecting the 3’ end of the ME’ sequence to a solid substrate 1977 (e.g., magnetic bead). Although not specifically illustrated, the first stem-loop adapter 1911 and the forked adapter 1912 respectively may include unique molecular identifiers (UMIs) in a similar manner as described with reference to FIG. 6.

[0255] In the nonlimiting example illustrated in FIG. 19, first adapter 1911 may be covalently coupled to antisense strand 1914, e.g., via subsequence 1911’, and may not be covalently coupled to sense strand 1913. Additionally, in the nonlimiting example illustrated in FIG. 19, second adapter 1912 may be covalently coupled to sense strand 1913, e.g., via subsequence 1912’, and may not be covalently coupled to antisense strand 1914. However, it will be appreciated that the first adapter 1911 instead may be covalently coupled to sense strand 1913 and may not be covalently coupled to antisense strand 1914, and the second adapter 1912 instead may be covalently coupled to antisense strand 1914 and may not be covalently coupled to antisense strand 1913, and the subsequent workflow modified accordingly. First adapter 191 1 may also be coupled to both sense strand 1913 and antisense strand 1914 to form a non- sequenceable “B-B” product; similarly, adapter 1912 may be coupled to both sense strand 1913 and antisense strand 1914 to form a non-looped “A-A” product. Note that if both transposons are anchored to a solid surface such as a magnetic bead, “A-A” products will be released into solution during operation 1920 and removed during a subsequent wash, leaving only “A-B” (asymmetric tagmentation products with adapter 1912 on one end and adapter 1911 on the other, i.e. the desired library fragment) and B-B products linked to the substrate. Following operation 1930, B-B products will be closed-loop “dumbbells” that cannot be captured on the nanopore; thus the design of workflow 1900 ensures that only the correct A-B products will be captured and sequenced.

[0256] Workflow 1900 illustrated in FIG. 19 may include coupling a forked adapter to the second adapter 1912 using the target sequence. For example, as illustrated at operation 1920 of FIG. 19, the transposases 1981, 1982 may be removed, e.g. by mild heating and chelation of the transposase catalytic divalent metal ion by EDTA. As it is removed, transposase 1981 releases first stem 1911’ which then hybridizes to second stem 1911” to form a stem-loop structure which is covalently coupled to antisense strand 1914 and is not covalently coupled to sense strand 1913. After removing transposase 1982, forked adapter 1941 may be hybridized to second adapter 1912 via hybridization between subsequence 1942 of forked adapter 1941 and subsequence 1912” of second adapter 1912. In the nonlimiting example illustrated in FIG. 19, forked adapter 1912 optionally includes a 3' steric lock. As illustrated in operation 1930 of FIG. 19, gap-fill and ligation may be used to covalently couple first adapter 1911 to sense strand 1913 and may be used to covalently couple second adapter 1912 to antisense strand 1914.

[0257] Method 1900 may include dehybridizing the sense strand 1913 from the antisense strand 1914, wherein the first stem-loop adapter 1911 couples the sense strand to the antisense strand after the dehybridizing. For example, at operation 1940, the sense strand 1913 and antisense strand 1914 are dehybridized. In some examples, the dehybridization of sense strand 1913 from antisense strand 1914 may be accomplished using heat, or by using a strand-displacing polymerase as polymerase 1931. Sense strand 1913 and antisense strand 1914 may remain covalently coupled to one another by first adapter 1911, in which subsequences 191 1 ’ and 1911” are dehybridized from one another.

[0258] Method 1900 may include synthesizing a complement 1913’ of the sense strand 1913 hybridized to the sense strand. Method 1900 also may include synthesizing a complement 1914’ of the antisense strand 1914 hybridized to the antisense strand. For example, as illustrated at operation 1940 of FIG. 19, polymerase 1931 is used to synthesize complement 1913’ to sense strand 1913, and to synthesize complement 1914’ to antisense strand 1914. In some examples, the complements 1913’, 1914’ are synthesized using subsequence 1943 of forked adapter 1941 as a primer. Note that because sense strand 1913 and antisense strand 1914 are naturally occurring, they may carry epigenetic marks (such as methylated bases). In comparison, sense complement 1913’ and antisense complement 1914’ are synthetic, and thus may not necessarily carry epigenetic marks. For example, the complement 1913’ of the sense strand and thecomplement 1914’ of the antisense strand may be synthesized using only unmodified nucleotides. Or, for example, the complement 1913’ of the sense strand and the complement 1914’ of the antisense strand may be synthesized using modified nucleotides. Nonlimiting examples of the manner in which complements 1913’ and 1914’ respectively may be used to identify epigenetic marks on sense strand 1913 and antisense strand 1914, with or without the use of modified nucleotides in complements 1913’ and 1914’, are described further above with reference to FIGS. 18A-18B. For example, complements 1913’ and 1914’ may be used as an internal reference to provide for, or improve, detection of the epigenetic marks on sense strand 1913 and antisense strand 1914. Additionally, complement 1913’ will be a direct repeat (i.e., containing the same sequence of bases on a nucleotide by nucleotide basis) of the native strand 1914, so it can be used for direct comparison of the signals to identify epigenetic marks based on signal dissimilarity or otherwise as noted elsewhere herein. Similarly, complement 1914’ will be a direct repeat of the native strand 1913, so it can be used for direct comparison of the signals to identify epigenetic marks based on signal dissimilarity or otherwise as noted elsewhere herein.

[0259] Method 1900 may include forming a second loop coupling the sense strand to the complement of the sense strand. For example, as illustrated at operation 1950 of FIG. 19, a first strand that includes sense strand 1913 and antisense strand 1914, covalently coupled to one another by first adapter 1911, may be hybridized to a newly synthesized second strand that include the complement 1913’ of the sense strand and the complement 1914’ of the antisense strand, covalently coupled to one another by the complement 1915 of first adapter 1911 (which complement is also synthesized during operation 1940). At operation 1950, the first strand and second strand may be hybridized to one another, but may not yet be covalently coupled to one another. As illustrated in operation 1960, an enzyme may be used to couple subsequence 1912” of second adapter 1912 to complement subsequence 1916 within the second strand (which complement is also synthesized during operation 1940). Illustratively, a telomerase 1990 may be used to perform such coupling. A nonlimiting example of such a telomerase is protelomerase TelN of bacteriophage N15, which has cleaving-joining activity in a manner such as described in Deneke et al., “The Protelomerase of Temperate Escherichia Coli Phage N15 Has Cleaving- Joining Activity,” Proceedings of the National Academy of Sciences of the United States of America 97(14): 7721-26 (2000), the entire contents of which are incorporated by referenceherein. In this example, subsequence 1912” may include a TelN target, and complement subsequence 1916 may include the complement of the TelN target.

[0260] Operations 1910 through 1960 may be used to generate construct 150 illustrated in FIG. 19. In this example, construct 150 includes sense strand 1913, an antisense strand 1914 that is complementary to the sense strand, is not hybridized to the sense strand, and is coupled to the sense strand via an adapter 1911. Construct 150 also includes a complement 1913’ of the sense strand that is hybridized to the sense strand 1913, and a complement 1914’ of the antisense strand that is hybridized to the antisense strand. As illustrated in FIG. 19, complement 1913’ may be coupled to complement 1914’ via an adapter 1915. Construct 150 also may include a loop 1991 coupling the sense strand 1913 to the complement 1913’ of the sense strand.

[0261] In a manner similar to that described elsewhere herein, sense strand 1913 may include one or more epigenetic marks, the complement 1913’ of the sense strand may not comprise any epigenetic marks. Similarly, antisense strand 1914 may include one or more epigenetic marks, and the complement 1914’ of the antisense strand may not comprise any epigenetic marks. In such examples, the complement 1913’ of the sense strand and the complement 1914’ of the antisense strand may be synthesized using only unmodified nucleotides. Alternatively, the complement 1913’ of the sense strand and the complement 1914’ of the antisense strand may be synthesized using modified nucleotides. Such examples may be useful for example, to identify the absence of modified nucleotides in the sense strand 1913 and complement strand 1914, or to train a base caller to be modification aware or to train the base caller to be modification unaware in a manner such as described with reference to FIGS. 18A-18B.

[0262] Although construct 150 described with reference to FIG. 19 may be useful for identifying epigenetic marks, construct 150 also or alternatively may be used simply to sequence the polynucleotide 1901. For example, referring back to FIGS. 1A-1H, polynucleotide 158 of construct 150 may correspond to sense strand 1913 described with reference to FIG. 19, and complement 159 of construct 150 may correspond to complement 1913’ described with reference to FIG. 19. Construct 150 further may include antisense strand 1914 that is complementary to the sense strand, and a complement 1914’ of the antisense strand. The method described with reference to FIGS. 1A-1H further may include characterizing the antisense strand 1914 togenerate a third plurality of measured values; and characterizing the complement 1914’ of the antisense strand to generate a fourth plurality of measured values. The first sequence of the polynucleotide 158, 1913 further may be generated using the third plurality of measured values and the fourth plurality of measured values, e.g., in a manner such as described with reference to FIGS. 8A-8D, 9, 10, and 11A-11B.

[0263] Accordingly, FIG. 19 describes a method to create a full complement construct that contains both forward and reverse complement copies of a native double-stranded polynucleotide (e g., native dsDNA) as well as a full set of synthesized complements. Construct 150 described with reference to FIG. 19 may be referred to as a “quadruplex” construct. The quadruplex construct may be made using an A / B tagmentation approach, in which the native double-stranded polynucleotide is first tagmented with “A” type transposomes and “B” type transposomes. The “A” type transposomes include second transposases 1982 and sequences that are adapted to become the “ends” of construct 150 (i.e., the 5' and 3’ ends), as well as the approximate midposition of the final construct 150. The “B” type transposomes include first transposases 1981 and a segment which will be present at approximately 25% and 75% of the way through the final construct 150.

[0264] The quadruplex construct 150 illustrated in FIG. 19 includes both forward (sense, 1913) and reverse complement (antisense, 1914) strands with epigenetic marks (e.g., modified nucleotides), and also a fully synthesized set of complementary polynucleotides. As such, signals from the modified (unknown) strands 1913, 1914 and reference strands 1913’, 1914’ may be directly compared using exactly the same molecule and system, in a single run. This configuration also provides the benefit of having both the forward and reverse complement with modified nucleotides (1913, 1914) and without modified nucleotides (1913’, 1914’). This is useful because it provides a direct internal reference between synthetic strands and modified strands, and also a “cross-reference” which may be used to determine whether both strands of the native polynucleotide were modified, or only one strand. For example, in the case of a methylated C on sense strand 1913, it might be expected to measure a deviation in the measured value in the case of the unknown, nucleotide relative to the unmodified reference nucleotide on complement 1913’, but for the complement (unmethylated) G on the antisense strand 1914, adifference may not be expected (or observed) between the unknown nucleotide and the reference nucleotide on complement 1914’.

[0265] As an additional example feature of quadruplex constructs 150 such as illustrated in FIG.19, both a forward and reverse complement strand (e.g., “original top” sense strand 1913 and “original bottom” antisense strand 1914) may be sequenced without ever losing a “full complement” on the trans side (second side 112 of nanopore 110). For example, after sequencing the “original bottom” 1914 in construct 150 of FIG. 19, the “original top” and “synthetic RC top” remain hybridized to one another, creating a hairpin structure that stabilizes the signal in a manner such as described with reference to FIGS. 2B and 3A-3B. Upon sequencing through the “original top,” at some point it may become even more favorable for the synthetic RC top to pair with the synthetic RC bottom. As such, even while sequencing through the original top, a stable hairpin may form that stabilizes the read. Furthermore, when the synthetic RC top is reached for sequencing, a stable hairpin then may form between the synthetic RC top and the synthetic RC bottom, stabilizing the read. As such, quadruplex constructs 150 such as described with reference to FIG. 19 may be expected to inhibit or reduce split levels for sequencing through at least one full forward and reverse complement pair.

[0266] As noted elsewhere herein, in addition to sequencing DNA, the present systems and methods may be used to sequence any other suitable polynucleotides, such as RNA. Similarly as DNA, RNA may include epigenetic marks. However, it is well known that RNA forms secondary structures. This can make nanopore sequencing challenging, for example, by generating “split levels” similarly as described with reference to FIG. 2A. In a manner as will now be described with reference to FIG. 20, a “full complement” construct including RNA and cDNA may be made that may be sequenced in a manner such as described with reference to FIGS. 1A-1H, and that inhibits formation of RNA secondary structures that otherwise may make it difficult to sequence the RNA. It will be appreciated that method 2000 is not limited for use with RNA, and may be adapted for use in generating a full complement

[0267] FIG. 20 schematically illustrates an example workflow 2000 for generating a fullcomplement polynucleotide for native RNA sequencing that may include modified bases in a native RNA strand and unmodified bases in a synthetic cDNA strand. Workflow 2000 mayinclude coupling a native single-stranded polynucleotide 2001 to 5’ and 3’ adapters. Polynucleotide 2001 could be a full-length mRNA that may include a 5’ cap and 3’ poly-A tail as shown in FIG 20. In another example, polynucleotide 2001 could be a fragmented mRNA lacking a 5’ cap and poly-A tail, a noncoding RNA (e.g. transfer RNA, ribosomal RNA, long non-coding RNA), or a single-stranded DNA to which a poly-A tail or other 3’ primer binding sequence has been added, for example by enzymatic synthesis with a terminal transferase in a manner such as described in Tang et al., “mRNA-seq whole-transcriptome analysis of a single cell,” Nature Methods 6(5): 377-382 (2009), the entire contents of which are incorporated by reference herein, or poly-A polymerase in a manner such as described in Cao et al., “Identification of the gene for an Escherichia Coli poly(A) polymerase,” Proceedings of the National Academy of Sciences of the United States of America 89(21): 10380-10384 (1992), the entire contents of which are incorporated by reference herein. As illustrated in operation 2010, a first adapter 2012 may be covalently coupled to the 5’ end of RNA 2001, and may include a subsequence for directing enzymatic loop formation (e.g. bacteriophage N15 protelomerase TelN discussed above in reference to FIG. 19). Nonlimiting examples that may be used to couple the 5' end of mRNA 2001 to 5’ adapter 2012 include (i) capture of 2012 by a template-switching reverse transcription protocol in a manner such as described in Zhu et al., “Reverse transcriptase template switching: A SMART approach for full-length cDNA Library Construction,” BioTechniques 30(4): 892-897 (2001), the entire contents of which are incorporated by reference herein, followed by ligation of the 3’ end of adapter 2012 to the 5’ end of RNA 2001 using a DNA-splinted RNA ligase (e.g., Chlorella virus RNA ligase such as described in Jin et al., “Sensitive and specific miRNA detection method using splintR ligase,” Nucleic Acids Research 44(13): el 16 (2016), the entire contents of which are incorporated by reference herein. In the case of mRNA, this may require removal of the 5’ cap structure, for example using Schizosaccharomyces pombe Edel -fused Dcpl-Dcp2 decapping enzyme in a manner such as described in Paquette et al., “Application of a Schizosaccharomyces pombe Edcl-fused Dcpl- Dcp2 decapping enzyme for transcription start site mapping,” RNA 24(2): 251-257 (2018), the entire contents of which are incorporated by reference herein; or (ii) non-splinted enzymatic ligation using T4 RNA ligase I in a manner such as described in Romaniuk et al., “Joining of RNA molecules with RNA ligase,” Methods in Enzymology 100: 52-59 (1983), the entire contents of which are incorporated by reference herein; or (iii) chemoenzymatic ligation betweene g. an enzymatically installed synthetic cap structure containing a terminal alkyne and an adapter 2012 including a 3’ azide group using a copper catalyzed “click” reaction. Additionally, 3' ligation handle may be coupled to the 3' end of primer 2011 via which the 3' end of the mRNA 2001 may be coupled to 3' lock 151. Nonlimiting examples that may be used to couple the 3' end of primer 2011 to 3' lock 151 include: nonsplinted enzymatic ligation using T4 RNA ligase I; 3’ addition of an azide-containing terminator ATP to RNA 2001 using poly-A polymerase followed by ‘click’ coupling to a 3’ lock adapter 151 containing a 5’ terminal alkyne; or chemical coupling of the 2’ -3’ terminal diol of 2001 to a 3’ lock adapter containing a 5’ boronic acid in a manner such as described in Lelievre-Buttner et al., “Boronic acid assisted selfassembly of functional RNAs,” Chemistry 29(35): e202300196 (2023), the entire contents of which are incorporated by reference herein. Although not specifically illustrated, the first and second adapters respectively may include unique molecular identifiers (UMIs), e.g., in a manner such as described with reference to FIG. 6.

[0268] Method 2000 also may include using the primer to synthesize a complement of the single-stranded polynucleotide and a complement of the target sequence. For example, as illustrated in operation 2020 of FIG. 20, a construct including primer 2011” coupled to 5' lock 152 may be coupled to mRNA 2001 via hybridization between primer 2011 and primer 2011”. In the nonlimiting example illustrated in FIG. 20, a suitable polymerase (e.g., reverse transcriptase (RT)) is used to generate a cDNA reference polynucleotide using the native mRNA as a template. As illustrated in operation 2030 of FIG. 20, the mRNA 2001 including epigenetic marks may be hybridized to, but not covalently coupled to, cDNA 2001’ which in some examples was synthesized using natural nucleotides and thus lacks epigenetic marks, or which was synthesized using modified nucleotides. Note that polymerase 2031 also synthesizes a complement of target sequence 2012”, which during operation 2030 is hybridized to, but not covalently coupled to, target sequence 2012.

[0269] Method 2000 also may include coupling the target sequence 2012 to the complement of the target sequence 2012” to form a stem -loop adapter. Illustratively, in a manner similar to that described with reference to FIG. 19, at operation 2040 of FIG. 20 a telomerase 2090 may be used to perform such coupling. A nonlimiting example of such a telomerase is protelomerase TelN ofbacteriophage N15. In this example, target sequence 2012” may include a TeTN target, and complement target sequence 2012” may include the complement of the TelN target.

[0270] Operations 2010 through 2040 may be used to generate construct 150 illustrated in FIG. 20. In this example, construct 150 includes native mRNA strand 2001 and cDNA strand 2001’ that is complementary to the mRNA strand, is hybridized to the sense strand, and is coupled to the mRNA strand via loop 2091 formed by telomerase 2090.

[0271] Although construct 150 described with reference to FIG. 20 may be useful for identifying epigenetic marks, construct 150 also or alternatively may be used simply to sequence the polynucleotide 2001. For example, referring back to FIGS. 1A-1H, polynucleotide 158 of construct 150 may correspond to mRNA strand 2001 described with reference to FIG. 20, and complement 159 of construct 150 may correspond to cDNA strand 2001’ described with reference to FIG. 20. Sequencing may be performed for the RNA only, the cDNA only, or both the mRNA and cDNA. For example, if sequencing only the RNA, then a reverse transcriptase may be used for the polymerase 105 in the operations described in FIGS. 1A-1H instead of DNA polymerase. If sequencing only the cDNA, then a DNA polymerase may be used for the polymerase 105 in the operations described with reference to FIGS. 1A-1H.

[0272] If sequencing both the RNA and DNA portions together, the operations described with reference to FIGS. 1A-1H may be modified such that polymerase 105 in fluid 120 on the first side of nanopore 110 includes a mixture of reverse transcriptase and DNA polymerase. In some examples, sequencing may proceed first for the RNA 2001 using the reverse transcriptase as polymerase 105; and then sequencing may proceed for the cDNA using the DNA polymerase as polymerase 105. In some examples, the target sequence 2012 may further include a primer binding sequence which is specific to a DNA primer to allow the DNA polymerase to begin sequencing after the RNA sequencing is complete. Alternatively, sequencing of both RNA and cDNA may be carried out using the same reverse transcriptase as polymerase 105. Example enzymes that are capable of extending from both RNA and cDNA include Avian Myeloblastosis Virus reverse transcriptase, and Malone Murine Leukemia reverse transcriptase.

[0273] In addition to being able to sequence the RNA 2001 more accurately by use of a full complement with cDNA 2001’ (e.g., through the cDNA inhibiting the formation of transientsecondary structures), the cDNA portion also may be used to help detect epigenetic modifications to the RNA in a manner similar to that described elsewhere herein. For example, the cDNA may be sequenced, and used to predict the RNA sequence. The signal for that RNA sequence then may be predicted (e.g., using a read map or context-specific simulator). The values of the predicted signal then may be compared to the actual measured values from the RNA, to calculate dissimilarity values between the predicted measured values and the actual measured values for the native RNA. Epigenetic marks in the native RNA then may be identified using the dissimilarity values. Alternatively, after basecalling and generating the predicted sequence, a joint-decoder may be used that is nucleotide modification-aware. Another benefit to accuracy is that the initial base calling may be much easier for cDNA 2001 which may be synthesized using only natural nucleotides and thus may be base called using a four-base read map, than for native RNA 2001 which has a relatively large number of possible epigenetic marks and therefore a more complicated read map.

[0274] Still further variations are possible. For example, a “quadruplex” RNA construct may be made in a manner which will now be described with reference to FIGS. 21A-21B, and used in a manner similar to that described with reference to FIG. 19.

[0275] FIGS. 21A-21B schematically illustrate an example workflow for generating a fullcomplement polynucleotide for native RNA sequencing that includes the native RNA strand, a direct-repeat RNA synthetic copy of the native RNA, and cDNA copies of both native and synthetic RNA strands.

[0276] FIGS. 21A-21B schematically illustrate another example workflow (method) 2100 for generating a full-complement polynucleotide for sequencing that may include modified bases in a native strand and unmodified bases in a synthetic strand.

[0277] Workflow 2100 may include coupling a native single-stranded polynucleotide 2101 to a first adapter. In this example, polynucleotide 2101 is a full-length native mRNA including 5’ cap and poly-A tail, although it should be noted that workflow 2100 could be adapted to fragmented mRNA or noncoding RNA with methods outline above for method 2000. Additionally, as illustrated in operation 2110, 3' adapter 2111’ may be coupled to 3 ' primer 2111. 3' adapter 2111’ may include first and second strands that are hybridized to each other. The firststrand includes a landing pad and lox site [LOX-1], and the second strand includes complements of the landing pad and lox site [LOX-1 ’] as well as an extension block between the landing pad and lox site. Nonlimiting examples of an extension block include the Spl8 linker or 3-5 sequential synthetic abasic sites (dSpacer). The complement of the landing pad includes a 3' OH group. In a manner such as illustrated at operation 2110, the 5' end of the first strand of 3' adapter 2111’ may be covalently coupled to the 3' end of poly-A tail 2111. Nonlimiting examples that may be used to couple the 3' end of primer 2111 to 3' adapter 2111’ include enzymatic ligation with T4 ligase 1, nontemplated extension using an azide-containing terminator NTP followed by chemical ligation, and terminal diol - boronic acid coupling similar to the methods discussed in reference to method 2000. The polyA tail 2111 may either be present in the native RNA (in the case of mRNA) or may be added by non-templated extension (e g., for fragmented / noncoding RNAs). At operation 2120, a reverse transcriptase (not specifically illustrated) generates cDNA 2101’ based on the sequence of RNA 2101, starting from the 3 ' OH group of the landing pad complement (second strand of 3 ' adapter 2111’). The cDNA 2101’ is complementary to RNA 2101, and hybridized to the RNA to form a duplex.

[0278] Workflow 2100 may include coupling a second adapter to the duplex. For example, at operation 2130 of FIG. 21A, a “template switch oligo” (TSO) hybridizes via its 3' rC residues to nontemplated 3' dC residues added to the cDNA during reverse transcription, and is then used as a template by reverse transcriptase to synthesize a complement strand, covalently linked to the 3' end of cDNA 2101’, to form double stranded adapter 2112. The TSO may include a lox site [LOX-2], Lox sites [LOX-1] and [LOX-2] may include inverted repeat mutations (e.g. the pair lox66 and lox71) to improve Cre-lox recombination efficiency by preventing backreaction in a manner such as described in Albert et al., “Site-specific integration of DNA into wild-type and mutant Lox sites placed in the plant genome,” The Plant Journal: For Cell and Molecular Biology 7(4): 649-659 (1995), the entire contents of which are incorporated by reference herein. Note that the terminal 3’ OH of the TSO will remain unligated (not coupled to the 5’ end of RNA 2101), in contrast to workflow 2000. Note that the TSO usually refers only to the top strand shown here; the bottom strand is copied by the polymerase during template switching. Although not specifically illustrated, the first and second adapters respectively may include unique molecular identifiers (UMIs), e.g., in a manner such as described with reference to FIG.6.

[0279] A circular construct may be formed using the RNA-cDNA complex to which the first and second adapters are coupled. For example, as illustrated at operation 2140, site-specific recombination (e.g., Cre-mediated recombination) may be used to fuse the 3' adapter 2111’ to the 5' adapter 2112 to form the circular complex illustrated at operation 2150. In examples in which the site-specific recombination utilizes the Cre recombinase enzyme, adapters 2111’ and 2112 may include lox sequences that the Cre recombinase specifically targets. In examples in which a different recombinase is used, the adapters instead may include sequences that such recombinase specifically targets.

[0280] As illustrated at operation 2160, a polymerase 2131 may be used to generate an RNA complement 2101” of the cDNA starting from the 3'-OH of the strand of the second adapter which is not covalently coupled to the cDNA. Illustratively, the polymerase 2131 may include a T7 RNA polymerase. As the polymerase synthesizes the RNA complement of the cDNA, the native RNA 2101 dehybridizes from the cDNA. When the polymerase 2131 reaches the extension block of 3' adapter 2111’, the polymerase stops synthesizing the RNA complement. At operation 2170, the partial construct including the native RNA 2101 coupled to the RNA complement 2101” of the cDNA, is decoupled from circular cDNA. At operation 2180, a 5' lock 152 and a 3' lock 151 may be coupled to the partial construct.

[0281] In some examples, the construct 150 formed using operations 2110 through 2180 is used for full-complement sequencing in a manner such as described with reference to FIG. 20. However, while the construct 150 generated in workflow 2000 included both RNA and cDNA, the construct 150 generated in workflow 2100 includes both native RNA 2101 and direct repeat RNA 2101”, the latter of which is generated by making a complement of the cDNA.Accordingly, during operations such as described with reference to FIGS. 1A-1H, a DNA polymerase need not be used, and both the RNA and direct repeat RNA both may readily be sequenced using reverse transcriptase as polymerase 105.

[0282] In other examples, the product of operation 2170 is further processed to form a quadruplex construct. For example, referring now to method 2200 of FIG. 2 IB, at operation 2170 the circular cDNA is removed similarly as described with reference to FIG. 21 A to obtain the partial construct shown at operation 2210 in FIG. 21B. The 5' and 3' ends of the partialconstruct then are coupled to respective adapters. More specifically, similarly as described with reference to FIG. 20, the first adapter may include an enzymatic loop-forming sequence such as the TelN target sequence discussed above in reference to method 2000. Additionally, as illustrated in operation 2220, a 5' ligation handle may be coupled to the 5' end of the mRNA 2101 via which target sequence 2212 may be coupled to the mRNA. Nonlimiting examples that may be used to couple the 5' end of the mRNA 2001 to the target sequence are described with reference to FIG. 20. Additionally, 3' ligation handle may be coupled to the 3' end of poly-A tail 2111 via which the 3 ' end of the mRNA 2101 may be coupled to 3 ' lock 151. Nonlimiting examples that may be used to couple the 3' end of poly-A tail 2111 to 3' lock 151 are described with reference to FIG. 20. Although not specifically illustrated, the first and second adapters respectively may include unique molecular identifiers (UMIs), e.g., in a manner such as described with reference to FIG. 6.

[0283] Method 2200 also may include using the primer to synthesize a complement of the single-stranded RNA 2101, a complement of the direct repeat RNA 2101”, and a complement of the target sequence. For example, as illustrated in operation 2230 of FIG. 21B, a construct including primer 2211” coupled to 5' lock 152 may be coupled to mRNA 2101 via hybridization between the primer region of adapter 152 and a complementary landing pad site in the 3’ c / .s-lock adapter 151. Note that the particular location at which primer hybridizes to the construct is not critical; for example, the primer instead my hybridize to a sequence of cis-lock adapter 141 . In the nonlimiting example illustrated in FIG. 21B, a suitable polymerase 2231 (e.g., reverse transcriptase (RT)) is used to generate a cDNA reference polynucleotide 2201’ using the native mRNA 2101 as a template. As illustrated in operation 2230 of FIG. 2 IB, the mRNA 2101 including epigenetic marks may be hybridized to, but not covalently coupled to, cDNA 2201’ which in some examples was synthesized using natural nucleotides and thus lacks epigenetic marks, or which was synthesized using modified nucleotides. Polymerase 2231 also generates a cDNA reference polynucleotide 2201” using the direct repeat RNA 2101” as a template. Similarly as described with reference to FIG. 20, polymerase 2231 also synthesizes a complement of the target sequence within 5' adapter 2212.

[0284] Method 2200 also may include coupling the target sequence to the complement of the target sequence of the 5' adapter to form a stem-loop adapter. Illustratively, in a manner similarto that described with reference to FIGS. 19 and 20, at operation 2230 of FIG. 21 B a telomerase 2290 may be used to perform such coupling. A nonlimiting example of such a telomerase is protelomerase TelN of bacteriophage N15. In this example, the target sequence of adapter 2212 may include a TelN target, and the complement target sequence may include the complement of the TelN target.

[0285] Operations 2110 through 2170 and 2210 through 2230 may be used to generate “quadruplex” construct 150 illustrated in FIG. 21B. In this example, construct 150 includes native RNA 2101, synthetic cDNA 2201’ that is complementary to the native RNA, is not hybridized to the native RNA, and is coupled to the native RNA via an adapter 2291. Construct 150 also includes a synthetic RNA direct repeat 2101” that has the same sequence as the native RNA 2101 and is covalently coupled to the native RNA, and a cDNA complement 2201” of the RNA direct repeat that is hybridized to the RNA direct repeat.

[0286] In a manner similar to that described elsewhere herein, native RNA 2101 may include one or more epigenetic marks, while the synthetic RNA direct repeat 2101” and synthetic cDNA 2201’ and 2201” may not comprise any epigenetic marks. In such examples, the RNA direct repeat 2101” and cDNA 2201’ and 2201” may be synthesized using only unmodified nucleotides. Alternatively, the RNA direct repeat 2101” and / or cDNA 2201’ and 2201” may be synthesized using modified nucleotides. Such examples may be useful for example, to identify the absence of modified nucleotides in the native RNA 2101 or to train a base caller to be modification aware or to train the base caller to be modification unaware in a manner such as described with reference to FIGS. 18A-18B. Although construct 150 described with reference to FIGS. 21A-21B may be useful for identifying epigenetic marks, construct 150 also or alternatively may be used simply to sequence the polynucleotide 1901, e.g., in a manner such as described with reference to FIGS. 1A-1H, potentially using a mixture of RNA reverse transcriptase and DNA polymerase as polymerase 105.

[0287] In some examples provided herein, the reference strand (whether DNA, cDNA, or RNA) may be synthesized using one homogeneous choice of modified nucleotide which may be targeted specifically to hard-to-sequence (or more error-prone) regions. For regions like GC repeats or other sequences with nearly degenerate transitions, a modified type of nucleotide (suchas super-G) may be used to sufficiently shift the normal G signal to better resolve these types of sequences. The modified nucleotides within the synthetic strand may help to break the degenerate transitions and improve overall base calling accuracy by providing complementary information.

[0288] In some examples, synthesizing the reference strand (whether DNA, cDNA, or RNA) using a mixture of modified and unmodified nucleotides may help to discriminate between hard- to-distinguish genomic regions. For example, homopolymer regions may be difficult to resolve. Having a mixture of modified and unmodified transitions may help to resolve specific sequence types. For example, in the case of homopolymers such as poly C, a mixture of modified C and unmodified C in the synthetic strand may aid in distinguishing “steps” through the homopolymer.WORKING EXAMPLES

[0289] The following examples are intended to be purely illustrative, and not limiting.Example 1. PhiX templates

[0290] System 100 described with reference to FIGS. 1A-1H was used, in which MspA was used as nanopore 110, and in which polynucleotide 158 was sequenced separately from its complement 159 (rather than in a combined construct 150 such as illustrated in FIGS. 1A-1H).

[0291] FIG. 12A schematically illustrate example polynucleotides using fragments of the PhiX genome, prepared for nanopore sequencing using the system of FIGS. 1A-1H. DNA ultramers were obtained from Integrated DNA Technologies, Inc. (IDT, Coralville, Iowa) and underwent a round of annealing with several DNA fragments prior to capture and sequencing on the device. More specifically, the ultramer DNA oligos were subjected to a round of annealing with three other DNA fragments prior to capture and sequencing on the system of FIGS. 1A-1H. The “forward” (polynucleotide 158) templates were annealed to: 1) a 3’ LNA lock hairpin adapter(HPA2 lock, / 5Phos / CTCAAACCATAGTCACGTCTCGTACCACCTCAACCGGATACGGTTGAGGTGGTACGAGACGTGACTATGGTTTGAGCT+C+T+G+C+T+C+G+C+C+G ), 2) a ddC primer to prevent extension of the complementary strand in bulk, prior to capture of the construct on the nanopore, and 3) a ddC terminated block for the 5' end hairpin (SL13; 5’GGGCGGAGCTGGCgataGCCAGCTCCGCCC) self-lock to hold it open so that the DNA oligo could be threaded through the nanopore. For the reverse-complement templates (complement 159) the annealing step was the same, except that the ddC primer which blocks extension in bulk was replaced by a blocking primer containing a 3’ polyT overhang and a 3’ biotin for membrane tethering to promote faster DNA capture on the nanopore from solution. FIG. 12B schematically illustrates the polynucleotide of FIG. 12A locked to a nanopore. The annealed HPA lock remains bound to the template polynucleotide or complement, the 5' hairpin self-locks to form a hairpin preventing the polynucleotide or complement from leaving the nanopore, and the complementary strands for inhibiting DNA extension in bulk (e.g., the complement DNA, the ddC terminated 5' self-lock block, and the ddC or polyT primer with biotin) are stripped off, leaving ssDNA and an extension primer.

[0292] FIGS. 13A-13B schematically illustrate example polynucleotides and complements, and measured accuracy rates for separately and jointly decoding those sequences using the system of FIGS. 1 A-1H. In this example, polynucleotide 158 and complement 159 had the 100-mer PhiX genomic sequences (PhiX test templates) respectively shown in FIG. 13 A. The measurements from polynucleotide 158 and the measurements from complement 159 were jointly input into a Viterbi HMM algorithm in a manner such as described with reference to FIGS. 8A-8C, 9, and 10. As illustrated in FIG. 13 A, the accuracy of the jointly obtained sequence ranged from about 85.9% to about 92.2%, with an average accuracy of about 87.8% as illustrated in FIG. 13B. As illustrated in FIG. 13A, the accuracy of the measurements taken using polynucleotide 158 alone, also input to the Viterbi HMM algorithm, ranged from about 58.0% to about 79.0%, with an average accuracy of 69.0% as illustrated in FIG. 13B. As illustrated in FIG. 13A, the accuracy of the measurements taken using complement 159 alone, also input to the Viterbi HMM algorithm, ranged from about 67.0% to about 81.0%, with an average accuracy of 74.2% as illustrated in FIG. 13B. The average accuracy of the measurements of polynucleotide 158 alone, and complement 159 alone, was 71.6% as illustrated in FIG. 13B. Thus, jointly using the measurements from polynucleotide 158 and the measurements from complement 159 in the Viterbi HMM algorithm provided an improvement of about 16.2% over those from thepolynucleotide 158 alone and the complement alone, as illustrated in FIG. 13B. Accordingly, it may be understood that even without specifically using construct 150, the present methods may be used to significantly improve accuracy of sequencing by jointly using measurements from both a target polynucleotide and its complement (e.g., by at least 5%, or by at least 8%, or by at least 9%, or more).Example 2. Lambda templates

[0293] System 100 described with reference to FIGS. 1A-1H was used, in which MspA again was used as nanopore 110, and in which polynucleotide 158 was sequenced separately from its complement 159 (rather than in a combined construct 150 such as illustrated in FIGS. 1A-1H).

[0294] FIG. 14 schematically illustrates a workflow for preparing a Lambda polynucleotide for nanopore sequencing using the system of FIGS. 1 A-1H. 1 kb templates underwent PCR from Lambda phage using a 3' primer with dU insertions and a 5' primer with a 5' LNA self-lock and a SP18 in the hairpin loop such that the PCR complement held open the hairpin and a self-lock blocking oligo need not be used as described with reference to FIGS. 12A-12B. The PCR construct was digested with USER enzyme which cleaved the dU bases in the complement strand near the 3' end, leaving nicked fragments that dissociated at room temperature in order to liberate the hybridization region at the 3' end for the HPA and primer. Finally, the construct underwent a SPRI purification, and then annealed on the HPA lock and the biotin tagged primer block.

[0295] FIG. 15A schematically illustrate additional example polynucleotides and complements. More specifically, in this example, polynucleotide 158 and complement 159 had the 1 kb Lambda DNA sequences (Lambda templates) respectively shown in FIG. 15 A. The measurements from polynucleotide 158 and the measurements from complement 159 were either separately or jointly input into the Viterbi HMM algorithm in a manner such as described with reference to FIGS. 8A-8E, 9, and 10. As illustrated in FIG. 15 A, the accuracy of the measurements taken using polynucleotide 158 alone, input to the Viterbi HMM algorithm, was about 69.6%. As illustrated in FIG. 15 A, the accuracy of the measurements taken using complement 159 alone, also input to the Viterbi HMM algorithm, was about 68.75%. FIG. 15B schematically illustrates measured accuracy rates for separately and jointly decoding the sequences of FIG. 15A using the system of FIGS. 1A-1H. The average accuracy of themeasurements of polynucleotide 158 alone, and complement 159 alone, was about 69.18%. As illustrated in FIG. 15B, the accuracy of the jointly obtained sequence was about 85.0%. Thus, jointly using the measurements from polynucleotide 158 and the measurements from complement 159 in the Viterbi HMM algorithm provided an improvement of about 15.4% over those from the polynucleotide 158 alone and the complement alone, as illustrated in FIG. 15B. Accordingly, it may be understood that even without specifically using construct 150, the present methods may be used to significantly improve accuracy of sequencing by jointly using measurements from both a target polynucleotide and its complement (e g., by at least 10%, or by at least 15%, or more). FIG. 15C schematically illustrates example signals, and errors, obtained from the sequences of FIG. 15A using the system of FIGS. 1A-1H. It may be understood from FIG. 15C that most of the errors that occur for one strand at a given position do not occur in both strands at the same position, and thus may be substantially eliminated through joint analysis.Example 3. Inhibiting transient secondary structures using complement

[0296] FIG. 16A illustrates example signals obtained using the system of FIGS. 1A-1H without use of a complement. As may be seen in FIG. 16A, the signals corresponding to different nucleotides which are added to duplex 154 fluctuate significantly over time. Without wishing to be bound by any theory, it is believed that the fluctuations may result from spontaneous transitions between folded and unfolded states of transient secondary structures in a manner such as described with reference to FIG. 2A. FIG. 16B illustrates example signals obtained using the system of FIGS. 1A-1H with use of a complement. As may be seen in FIG. 16B, the signals corresponding to different nucleotides which are added to duplex 154 fluctuate significantly less over time than in FIG. 16A. Without wishing to be bound by any theory, it is believed that the reduction in fluctuations relative to those in FIG. 16B may result from the complement inhibiting spontaneous transitions between folded and unfolded states of transient secondary structures in a manner such as described with reference to FIG. 2B.

[0297] For the full-complement data shown in FIG. 16B, the target polynucleotide is from a PhiX sequence. The construct’s full sequence is: / 5Phos / GGGCGGAGCTGGCgataGCCAGCTCCGCCCTTTTTTTTTTTTTTTTGTACAGATA GCTGATACGATGCGATACGCGACATGTCGCTGATGCACTCGGATACGAGTGCATCAGCGACATGTCGCGTATCGCATCGTATCAGCTATCTGTACTGTGTGAGTGTGTGATGTGTACGCTTTGACCTGAGGATcggcgagcagag. The structure is as follows:

[0298] The construct thus included a 3' lock, primer, and barcode sequence, a duplexed region formed between "Sequence a" and "Sequence b," where Sequence a is the PhiX insert, Sequence b is Sequence a’s reverse complement), and a 5' lock. Loop is a standard GATA sequence. This sequence was custom-produced from a commercially available source, and annealed to form the full complement template for tethering as depicted FIG. 2B. For the non-full-complement data shown in FIG. 16A, the target polynucleotide is the PhiX sequence: / 5Phos / GGGCGGAGCTGGCgataGCCAGCTCCGCCCTTTTTTTTTTTTTTTTTTTTCTAGTA TAGCTATCTATACTATAGTCAGCAGTATATACGTGCATCGATGACGAGTGCATCAGC GACATGTCGCGTATCGCATCGTATCAGCTATCTGTACTGTGTAATTGTGTGATGTGTA CGCTTTGACCTGAGGATcggcgagcagag

[0299] Accordingly, it may be understood from FIGS. 16A-16B that the presence of a complement on the second side of the nanopore may inhibit the spontaneous transitions between folded and unfolded states of transient secondary structures, and / or otherwise may reduce fluctuations in signal level.Example 4. Inhibiting transient secondary structures using elevated temperature

[0300] FIG. 17A illustrates a secondary structure prediction and example signals obtained using the system of FIGS. 1 A-1H without use of an elevated temperature (here, 25 °C). The construct sequence is as follows: / 5Phos / GGGCGGAGCTGGCgataGCCAGCTCCGCCCTTTTTTTTTTTTTTTTTTTTTGTGTGATGTGTGATGTGAAACTAACAGTCTGTGAGCCGTGGTGTGTAATGTGTAGGTAAATG TAAACGTAAAGTTAAATTTAAACTTAAAGCTAAATCTAAACCTAAAGATATGTGTGA TGTGTGGCCTCGGCCGGTGCCTGTGCCGTTGCCTTTGCCGCTGCCTCTGCCGGCGCCT GCGCCGTGTGTAATGTGTACTAAGGATAATGATAACGATAAGTATAATTATAACTAT AAGCATAATCATAACCATAATGTGTGATGTGTCTCCTTCTCCGCCTCCTCCGGGCCCT GGCCCGTGCCCTTGCCCGCGCCCTCGCCCGGTCTGTGTAATGTGTAAAAGTAAAATT AAAACTAAAAGCAAAATCAAAACCAAAAGAAAAATAAAAACAAAAAATGTGTGAT GTGTCCCTTCCCCGCCCCCTCCCCCCGGGGGATGGGGTGTGTAAATGTGTGATGTGT CACGCAAACACCTGACCATAACGGCGAGCAGAC. Sequencing proceeded with buffer (400 mM KC1, 5mM MgC12, 50mM HEPES), primer (ATGGTCAGGTGTTTGCGT), membrane tethering and temperature 37 C. The DNA currents versus time for three read voltages (40 mV, 55 mV, and 70 mV) are shown on the right. As may be seen in FIG. 17A, the signals corresponding to different nucleotides which are added to duplex 154 fluctuate significantly over time. Without wishing to be bound by any theory, it is believed that the fluctuations may result from spontaneous transitions between folded and unfolded states of transient secondary structures in a manner such as described with reference to FIG. 2A.

[0301] FIG. 17B illustrates a secondary structure prediction and example signals obtained using the system of FIGS. 1A-1H with use of an elevated temperature (here, 37°C). The same construct was used as described with reference to FIG. 17A. As may be seen in FIG. 17B, the signals corresponding to different nucleotides which are added to duplex 154 fluctuate significantly less over time than in FIG. 17A. Without wishing to be bound by any theory, it is believed that the reduction in fluctuations relative to those in FIG. 17B may result from the elevated temperature inhibiting spontaneous transitions between folded and unfolded states of transient secondary structures in a manner such as described with reference to FIG. 2B. The DNA template secondary structure is shown on the left side of FIGS. 17A and 17B, and was calculated using NUPACK secondary structure prediction software with matching salt concentrations and temperatures corresponding to those at which the data were obtained. The decreased signal fluctuations in FIG. 17B relative to FIG. 17A correlate visually with a reduced amount of secondary structure in the computational predictions in FIG. 17B relative to FIG. 17A.

[0302] Accordingly, it may be understood from FIGS. 17A-17B that the presence of a complement on the second side of the nanopore may inhibit the spontaneous transitions between folded and unfolded states of transient secondary structures, and / or otherwise may reduce fluctuations in signal level.Additional comments

[0303] While various illustrative examples are described above, it will be apparent to one skilled in the art that various changes and modifications may be made therein without departing from the invention. The appended claims are intended to cover all such changes and modifications that fall within the true spirit and scope of the invention.

[0304] It is to be understood that any respective features / examples of each of the aspects of the disclosure as described herein may be implemented together in any appropriate combination, and that any features / examples from any one or more of these aspects may be implemented together with any of the features of the other aspect(s) as described herein in any appropriate combination to achieve the benefits as described herein.

[0305] What is claimed is:

Claims

1. CLAIMS1. A method of sequencing a polynucleotide using a nanopore comprising a first side, a second side, and an aperture extending through the first and second sides, the method comprising:(a) generating a construct comprising the polynucleotide and a complement of the polynucleotide;(b) disposing the construct through the aperture of the nanopore such that a 3' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore;(c) forming a first duplex with the construct on the first side of the nanopore, the duplex including a 3 ' end;(d) characterizing the polynucleotide using operations comprising:(i) extending the first duplex on the first side of the nanopore by adding to the 3 ' end of the first duplex a first nucleotide that is complementary to a nucleotide of the polynucleotide;(ii) inhibiting, using the nanopore, translocation of the 3' end of the extended first duplex to the second side of the nanopore;(iii) measuring a value of an electrical property of the 3 ' end of the extended first duplex and a single-stranded portion of the polynucleotide; and(iv) repeating operations (i)-(iii) for a first plurality of nucleotides that are complementary to nucleotides of the polynucleotide to generate a first plurality of measured values;(e) characterizing the complement using operations comprising:(v) extending the first duplex or a second duplex on the first side of the nanopore by adding to the 3' end of the first or second duplex a second nucleotide that is complementary to a nucleotide of the complement;(vi) inhibiting, using the nanopore, translocation of the 3' end of the extended first or second duplex to the second side of the nanopore;(vii) measuring a value of an electrical property of the 3 ' end of the extended first or second duplex and a single-stranded portion of the polynucleotide; and(viii) repeating operations (v)-(vii) for a second plurality of nucleotides that are complementary to nucleotides of the complement to generate a second plurality of measured values; and(f) generating a first sequence of the polynucleotide using the first plurality of measured values and the second plurality of measured values.

2. The method of claim 1, further comprising repeatedly performing operations (c) through (f) to obtain a plurality of additional sequences of the polynucleotide, and generating a consensus sequence using the first sequence and the plurality of additional sequences.

3. The method of claim 1, further comprising repeatedly performing operations (c) through (f) to obtain additional first and second pluralities of measured values, and generating a consensus set of measured values using the additional first and second pluralities of measured values.

4. The method of any one of claims 1 to 3, wherein the polynucleotide and the complement of the polynucleotide hybridize to one another on the second side of the nanopore to form a third duplex.

5. The method of claim 3, wherein the third duplex inhibits formation of transient secondary structures on the second side of the nanopore.

6. The method of any one of claims 1 to 5, wherein the construct comprises a hairpin or linker coupling the polynucleotide to the complement of the polynucleotide.

7. The method of claim 6, further comprising synthesizing the complement of the polynucleotide using the hairpin as a primer.

8. The method of any one of claims 1 to 7, wherein the polynucleotide comprises epigenetic marks.

9. The method of claim 8, wherein the complement of the polynucleotide lacks any epigenetic marks.

10. The method of any one of claims 1 to 7, wherein the complement of the polynucleotide comprises epigenetic marks.

11. The method of claim 10, wherein the polynucleotide lacks any epigenetic marks.

12. The method of any one of claims 1 to 11, wherein generating the first sequence of the polynucleotide comprises using the complement of the polynucleotide as a reference.

13. The method of any one of claims 1 to 12, further comprising heating the construct to a temperature that inhibits formation of secondary structures on the first side of the nanopore.

14. The method of any one of claims 1 to 13, further comprising heating the construct to a temperature that inhibits formation of secondary structures on the second side of the nanopore.

15. The method of any one of claims 1 to 15, further comprising, after operation (iii) and before repeating operation (i), inhibiting hybridization between the polynucleotide and the complement of the polynucleotide on the first side of the nanopore by moving only a portion of the polynucleotide from the second side of the nanopore to the first side of the nanopore, or after operation (vii) and before repeating operation (v), inhibiting hybridization between the polynucleotide and the complement of the polynucleotide on the first side of the nanopore by moving only a portion of the complement from the second side of the nanopore to the first side of the nanopore.

16. The method of any one of claims 1 to 15, wherein the polynucleotide comprises native RNA, and wherein the complement of the polynucleotide comprises synthetic cDNA.

17. The method of any one of claims 1 to 15, wherein the polynucleotide comprises synthetic cDNA, and wherein the complement of the polynucleotide comprises native RNA.

18. The method of any one of claims 1 to 15, wherein the polynucleotide comprises native DNA, and wherein the complement of the polynucleotide comprises synthetic DNA.

19. The method of any one of claims 1 to 15, wherein the polynucleotide comprises synthetic DNA, and wherein the complement of the polynucleotide comprises native DNA.

20. The method of any one of claims 1 to 15 or 18 to 19, wherein: the polynucleotide comprises a sense strand, and optionally a complement of the sense strand; the construct further comprises an antisense strand that is complementary to the sense strand, and a complement of the antisense strand; and the method further comprises: characterizing the antisense strand to generate a third plurality of measured values; and characterizing the complement of the antisense strand to generate a fourth plurality of measured values; wherein the first sequence of the polynucleotide further is generated using the third plurality of measured values and the fourth plurality of measured values.

21. The method of any one of claims 16 or 17, wherein: the construct further comprises a direct repeat of the RNA, and a complement of the direct repeat of the RNA; the method further comprises: characterizing the direct repeat of the RNA to generate a third plurality of measured values; and characterizing the complement of the direct repeat of the RNA to generate a fourth plurality of measured values; wherein the first sequence of the polynucleotide further is generated using the third plurality of measured values and the fourth plurality of measured values.

22. The method of any one of claims 1 to 21, wherein operation (d) is performed before operation (e).

23. The method of any one of claims 1 to 21, wherein operation (e) is performed before operation (d).

24. A method of generating a signal using a nanopore comprising a first side, a second side, and an aperture extending through the first and second sides, the method comprising:(a) disposing a construct through the aperture of the nanopore such that a 3' end of the construct is on the first side of the nanopore, and a 5' end of the construct is on the second side of the nanopore, wherein the construct comprises a polynucleotide and a complement of the polynucleotide;(b) forming a first duplex with the construct on the first side of the nanopore, the first duplex including a 3 ' end;(c) forming a second duplex on the second side of the nanopore, the second duplex comprising the polynucleotide at least partially hybridized to the complement;(d) extending the first duplex on the first side of the nanopore by adding a first nucleotide that is complementary to a nucleotide of the polynucleotide; and(e) measuring a value of an electrical property of the 3 ' end of the extended first duplex and a single- stranded portion of the polynucleotide while:(i) inhibiting, using the nanopore, translocation of the 3 ' end of the extended first duplex to the second side of the nanopore; and(ii) inhibiting, using the second duplex, formation of transient secondary structures on the second side of the nanopore.

25. A method of making constructs, the method comprising: coupling a native double-stranded polynucleotide comprising a sense strand and an antisense strand to first and second stem-loop adapters each comprising a cleavable moiety; cleaving the cleavable moiety of each of the first and second stem-loop adapters; dehybridizing the sense strand from the antisense strand;synthesizing a complement of the sense strand to form a first partial construct comprising the sense strand coupled to the complement of the sense strand via the first stem-loop adapter; synthesizing a complement of the antisense strand to form a second partial construct comprising the antisense strand coupled to the complement of the antisense strand via the second stem-loop adapter; coupling a first forked adapter to the first partial construct to form a first construct; and coupling a second forked adapter to the second partial construct to form a second construct.

26. The method of claim 25, wherein dehybridizing the sense strand from the antisense strand, synthesizing the complement of the sense strand, and synthesizing the complement of the antisense strand comprise: using a first strand-displacing polymerase to synthesize the complement of the sense strand; and using a second strand-displacing polymerase to synthesize the complement of the antisense strand.

27. The method of claim 25 or claim 26, wherein cleaving the cleavable moiety generates a 1-base pair gap flanked by a 3' phosphate and a 5' phosphate, the method further comprising using a polynucleotide kinase (PNK) to remove the 3' phosphate from the gap, to leave a free 3' OH at the gap.

28. The method of any one of claims 25 to 27, wherein the forked adapter comprises a 3' steric lock.

29. The method of any one of claims 25 to 28, wherein the first and second stem-loop adapters respectively comprise unique molecular identifiers (UMIs).

30. The method of any one of claims 25 to 29, wherein (i) the sense strand comprises one or more epigenetic marks, and wherein the complement of the sense strand does not comprise any epigenetic marks, or (ii) wherein the antisense strand comprises one or more epigenetic marks, and wherein the complement of the antisense strand does not comprise any epigenetic marks.

31. The method of any one of claims 25 to 30, wherein the complement of the sense strand and the complement of the antisense strand are synthesized using only unmodified nucleotides.

32. The method of any one of claims 25 to 30, wherein the complement of the sense strand and the complement of the antisense strand are synthesized using modified nucleotides.

33. The method of any one of claims 25 to 32, wherein the native double-stranded polynucleotide is coupled to the first and second stem-loop adapters using ligation.

34. The method of any one of claims 25 to 33, wherein the first forked adapter is coupled to the first partial construct using ligation, and wherein the second forked adapter is coupled to the second partial construct using ligation.

35. A method of making a construct, the method comprising: coupling a native double-stranded polynucleotide comprising a sense strand and an antisense strand to first and second adapters, wherein the first adapter comprises a first stem-loop adapter, and the second adapter includes a target sequence for in situ enzymatic loop formation and lacking any loop; coupling a forked adapter to the second adapter using the target sequence; dehybridizing the sense strand from the antisense strand, wherein the first stem-loop adapter couples the sense strand to the antisense strand after the dehybridizing; synthesizing a complement of the sense strand hybridized to the sense strand; synthesizing a complement of the antisense strand hybridized to the antisense strand; and forming a second loop coupling the sense strand to the complement of the sense strand.

36. The method of claim 35, wherein the native double-stranded polynucleotide is coupled to the first adapter using a first transposase, and is coupled to the second adapter using a second transposase.

37. The method of claim 35 or claim 36, wherein dehybridizing the sense strand from the antisense strand, synthesizing the complement of the sense strand, and synthesizing the complement of the antisense strand comprise using a strand-displacing polymerase.

38. The method of any one of claims 35 to 37, wherein the forked adapter comprises a 3' steric lock.

39. The method of any one of claims 35 to 38, wherein the first stem-loop adapter and the forked adapter respectively comprise unique molecular identifiers (UMIs).

40. The method of any one of claims 35 to 39, wherein the sense strand comprises one or more epigenetic marks, and wherein the complement of the sense strand does not comprise any epigenetic marks, and wherein the antisense strand comprises one or more epigenetic marks, and wherein the complement of the antisense strand does not comprise any epigenetic marks.

41. The method of any one of claims 35 to 40, wherein the complement of the sense strand and the complement of the antisense strand are synthesized using only unmodified nucleotides.

42. The method of any one of claims 35 to 40, wherein the complement of the sense strand and the complement of the antisense strand are synthesized using modified nucleotides.

43. A construct, comprising: a sense strand; an antisense strand that is complementary to the sense strand, is not hybridized to the sense strand, and is coupled to the sense strand via an adapter; a complement of the sense strand that is hybridized to the sense strand;a complement of the antisense strand that is hybridized to the antisense strand; and a loop coupling the sense strand to the complement of the sense strand.

44. The construct of claim 43, wherein the sense strand comprises one or more epigenetic marks, and wherein the complement of the sense strand does not comprise any epigenetic marks, and wherein the antisense strand comprises one or more epigenetic marks, and wherein the complement of the antisense strand does not comprise any epigenetic marks.

45. A method of making a construct, the method comprising: coupling a native single-stranded polynucleotide to first and second adapters, wherein the first adapter comprises a target sequence and the second adapter comprises a primer; using the primer, synthesizing a complement of the single-stranded polynucleotide and a complement of the target sequence; and coupling the target sequence to the complement of the target sequence to form a stemloop adapter.

46. The method of claim 45, wherein the native single-stranded polynucleotide is coupled to the first and second adapters using ligation.

47. The method of claim 45 or claim 46, wherein the forked adapter comprises a 5' steric lock.

48. The method of any one of claims 45 to 47, wherein the first and second adapters respectively comprise unique molecular identifiers (UMIs).

49. The method of any one of claims 45 to 48, wherein the native single- stranded polynucleotide comprises one or more epigenetic marks, and wherein the complement of the single-stranded polynucleotide does not comprise any epigenetic marks.

50. The method of any one of claims 45 to 49, wherein the complement of the native singlestranded polynucleotide is synthesized using only unmodified nucleotides.

51. The method of any one of claims 45 to 50, wherein the second adapter comprises a 3' steric lock.

52. The method of any one of claims 45 to 51, wherein the polynucleotide comprises RNA, and wherein the complement of the polynucleotide comprises cDNA.

53. The method of any one of claims 45 to 51, wherein the polynucleotide comprises cDNA, and wherein the complement of the polynucleotide comprises RNA.

Citation Information

Patent Citations

  • Transposon end compositions and methods for modifying nucleic acids

    US20100120098A1

  • Characterization of individual polymer molecules based on monomer-interface interactions

    US6015714A

  • Compositions, systems, and methods for detecting events using tethers anchored to or adjacent to nanopores

    US9708655B2

  • In vitro transposition of artificial transposons

    WO1995023875A1

  • Transposon end compositions and methods for modifying nucleic acids

    WO2010048605A1