Compositions and methods for targeting circular RNA to inhibit translation of circnlgn

A mixed base pair oligonucleotide targeting the junction region of circNIgn inhibits its translation, addressing the limitations of existing circRNA therapies by effectively treating conditions like cardiac hypertrophy and colitis while minimizing impact on parent gene transcription.

WO2026006925A1PCT designated stage Publication Date: 2026-01-08SUNNYBROOK RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/CA2025/050940
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-04
Filing Date
2025-07-04
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Current techniques for targeting circular RNAs (circRNAs) as a therapeutic are in early stages and lack compositions and methods that modulate circRNA biogenesis without affecting the parent gene's transcription, leading to potential off-target effects.

Method used

A single-stranded, mixed base pair oligonucleotide comprising ribonucleobases and deoxyribonucleobases with a sequence complementary to the junction region of circular neuroligin RNA (circNIgn) is used to inhibit circNIgn translation, administered to treat conditions associated with increased levels of circNIgn and/or Nlgnl73.

Benefits of technology

The oligonucleotide effectively inhibits circNIgn translation, reducing conditions such as cardiac hypertrophy, colitis, wound scar formation, and cancer progression by minimizing off-target effects on parent gene transcription.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CA2025050940_08012026_PF_FP_ABST
    Figure CA2025050940_08012026_PF_FP_ABST
Patent Text Reader

Abstract

The present application provides compositions and methods for targeting circular RNA, in particular to inhibit translation of circNlgn. Further provided is a single stranded, mixed base pair oligonucleotide ("mixmer") comprising a combination of ribonucleobases and deoxyribonucleobases, wherein the oligonucleotide comprises a sequence that is at least 80% complimentary with at least 10, at least 11, or from 11 to 15 consecutive nucleotides of the junction region of circular neuroligin RNA (circNlgn), and methods for using this mixmer as a medicine, for example, in the treatment of cardiac diseases or disorders, cancers, colitis or wounds.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR TARGETING CIRCULAR RNA TO INHIBIT TRANSLATION OF CIRCNLGNFIELD OF THE INVENTION

[0001] The present application pertains generally to circular RNA compositions and methods for inhibiting translation of circular RNAs. More particularly, the present application relates to compositions and methods for targeting circular RNA to inhibit translation of circNIgn and their use in the treatment of conditions characterized by overexpression of circNIgn.BACKGROUND

[0002] Circular RNAs (circRNAs) are a large group of non-coding RNAs having a unique circular structure formed from covalently linking the 3'-end to the 5'-end by back-splicing of the linear transcripts of their parent mRNAs, thereby forming endless single-stranded RNAs. These circular molecules were discovered more than 40 years ago but failed to raise scientific interest until recently. Increasing studies have found that these circular RNAs might not just be byproducts of the splicing process but may possess important regulatory functions through different cellular events. In particular, RNA sequencing has shown that some circRNAs are differentially expressed in disease states compared to the normal physiological conditions [1], The circRNAs that are differentially overexpressed, have high abundance in tissue and exert potent functions in disease development.

[0003] Most known circRNAs are expressed at very low abundance, and have no ascribed function. Only a relatively small number of circRNAs have been reported to possess functional roles and most of these function through sponging miRNAs, binding to circRNA- binding proteins, and encoding proteins [1,14 -16], A small group of circRNAs have been reported to encode protein isoforms different from their parental mRNA counterparts

[0016] , Some protein-coding circRNAs have been found to possess strong functions in disease development [17-21],

[0004] There have been reports showing successful application of other non-coding RNAs, such as long non-coding RNAs (IncRNAs) and microRNAs (miRNAs), in RNA therapy [22,23],However, circRNAs are different than other non-coding RNAs in that circRNAs are mostly expressed from protein-coding genes

[0024] , They share common sequences with their mRNA counterparts, but IncRNAs and miRNAs are expressed by unique genes. This feature makes circRNA targeting more difficult since affecting the functions of their parental genes should be avoided or minimized to prevent or minimize off target effects. Current techniques in circRNA targeting include delivery of the siRNAs / shRNAs targeting the junction sequence of the respective circRNAs [25,26], ectopic expression of circRNAs using AAV vector or plasmids, and delivery of the circular antisense circRNA (cA-circRNA). However, to date, these techniques for targeting circRNAs as a potential therapy are still in the early stages of research and have not resulted in a clinical therapeutic

[0027] ,

[0005] A need remains for compositions and methods for modulating circRNA biogenesis specifically, without affecting, or with minimal effect on, transcription of the parent gene(s). Such compositions and methods would be useful for providing therapeutics in treating diseases and disorder in which abnormal expression of circRNAs occurs.

[0006] The above information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.SUMMARY OF THE INVENTION

[0007] An object of the present application is to provide compositions and methods for targeting circular RNAs, in particular to inhibit translation of circNIgn, as described in this application.

[0008] In accordance with one aspect of the present invention, there is provided a single stranded, mixed base pair oligonucleotide comprising a combination of ribonucleobases and deoxyribonucleobases, wherein the oligonucleotide comprises a sequence that is at least 80% complimentary with at least 10, at least 11, or from 11 to 15 consecutive nucleotides of the junction region of circular neuroligin RNA (circNIgn).

[0009] In accordance with another aspect of the present application, there is provided a single stranded, mixed base pair oligonucleotide comprising a combination of ribonucleobases and deoxyribonucleobases, wherein the oligonucleotide comprises a sequence that is at least 80% complimentary with at least 10, at least 11, or from 11 to 15 consecutive nucleotides of the junction region of circular neuroligin RNA (circNIgn), for use as a medicine. In some embodiments, the medicine is for treatment or prevention of a condition associated with increased levels of circNIgn and / or Nlgnl73.

[0010] In accordance with another aspect of the present application there is provided a method for treatment or prevention of a condition associated with increased levels of circNIgn and / or Nlgnl73 comprising administering a single stranded, mixed base pair oligonucleotide comprising a combination of ribonucleobases and deoxyribonucleobases, wherein the oligonucleotide comprises a sequence that is at least 80% complimentary with at least 10, at least 11, or from 11 to 15 consecutive nucleotides of the junction region of circular neuroligin RNA (circNIgn) to a subject diagnosed with or at risk of developing the condition associated with increased levels of circNIgn and / or Nlgnl73.

[0011] In some embodiments, the sequence of the junction region of circNIgn is the sequence of SEQ ID NO:2.

[0012] In some embodiments, the use or method described above is for: improving cardiac function; for treatment or prevention of a cardiovascular disease or disorder, such as cardiac hypertrophy, remodeling, cardiomyopathy, artery diseases, and myocardial infarction; for treatment or prevention of colitis, for example, ulcerative colitis or acute ulcerative colitis; for treatment of a wound; for minimizing scar formation during wound healing; or for treatment of cancer progression, for example for inhibiting prostate cancer progression.

[0013] In accordance with another aspect of the present application there is provided a method for treatment or prevention of colitis, such as ulcerative colitis or acute ulcerative colitis, comprising administering a compound that inhibits expression of circNIgn to a subject diagnosed with or suspected of having colitis or at risk of developing colitis.

[0014] In accordance with another aspect of the present application there is provided a method for treatment of a wound in a subject, comprising administering a compound that inhibits expression of circNIgn to the subject. In some embodiments, the compound is administered to the subject at an amount effective to provide wound healing and / or minimize scar formation during wound healing in the subject.BRIEF DESCRIPTION OF FIGURES

[0015] For a better understanding of the application as described herein, as well as other aspects and further features thereof, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:

[0016] Figure 1 schematically depicts formation of circular neuroligin RNA (circNIgn) by back-splicing of the neuroligin gene, which is translated to produce a circular RNA-derived peptide (Nlgnl73) with a 9-amino-acid nuclear localization motif corresponding to translation of the junction sequence formed as a result of the back-splicing. The 9-amino- acid nuclear localization motif has the sequence of GYRPAANWI (SEQ ID NO:1), which corresponds to coding sequence adjacent to the junction within circNIgn.

[0017] Figure 2 illustrates that targeting circNIgn represses cardiac fibrosis: (A) In situ hybridization and immunofluorescence staining showed that the PO mouse tissues expressed increased levels of circNIgn and Nlgnl73 protein relative to the sham mice; (B) In situ immunofluorescent staining showed that PO mouse hearts expressed high levels of Nlgnl73 protein that was localized in the nuclei of cardiomyocytes (connexin 43 staining, upper) and cardiac fibroblasts (vimentin staining, lower); (C) In situ hybridization and immunofluorescence staining showed that silencing circNIgn with siRNAs repressed expression of circNIgn and Nlgnl73 in PO mouse hearts; and (D) Heart tissues from sham, PO, PO+oligo, PO+si-cirNIgl, and PO+si-cirNlg2 mice were subjected to immunoblotting. PO mouse heart tissues expressed higher levels of Nlgnl73 protein than the sham mice, which was inhibited by circNIgn siRNAs.

[0018] Figure 3 illustrates expression of circNIgn and Nlgnl73 in PO mice: in situ hybridization and immunofluorescence staining showed that the PO mouse tissues expressed increased levels of circNIgn and Nlgnl73 protein relative to the sham mice.

[0019] Figure 4 illustrates that targeting circNIgn translation represses heart fibrosis in PO mice: (A) 8-week-old C57BL6 mice were processed to PO, and injected intraperitoneally with the control oligo, circNIgn Mixmer (50 pg / each, twice / week) for 12 weeks. Typical images of Echocardiography and HE staining showed that delivery of circNIgn Mixmers prevented heart function decrease induced in PO model. (n=10); (B) Real-time PCR confirmed that circNIgn levels were significantly higher in the PO mice model than the sham mice. **p<0.01 versus PO+oligo ±SD (n=6); (C) Echocardiography showed that the PO mice displayed decreased dp / dt, which was prevented by delivery of the circNIgn Mixmer. **p<0.01 versus PO+oligo ±SD (n=10); (D) The PO mice showed increased LVEDD (left) and LVESD (middle), resulting in decreased LVEDD-LVESD (right) in echocardiography, which was prevented by delivery of the circNIgn Mixmer. **p<0.01 versus PO+oligo ±SD (n=10); (E) The PO mice showed decreased LVEF and LVFS in echocardiography, which was prevented by delivery of the circNIgn Mixmer. **p<0.01 versus PO+oligo ±SD (n=10); (F) The PO mice displayed increased SGK3 (left) and ING4 (left) levels, which was prevented by delivery of the circNIgn Mixmer. **p<0.01 versus PO+oligo ±SD (n=6); and (G) Typical images of Sirius red staining and Masson's trichrome staining showed that delivery of circNIgn Mixmers prevented fibrosis induced in PO model. (n=10).

[0020] Figure 5 illustrates that targeting SGK3 or ING4 represses cardiac fibrosis induced in PO mice: (A) 8-week-old C57BL6 mice were processed to PO, and injected intraperitoneally with control oligo and siRNAs silencing SGK3 or / and ING4 (5 pg / each, twice / week) for 12 weeks. Typical images of Echocardiography and HE staining showed that delivery of the siRNAs prevented heart function decrease in the PO model (n=10); (B) Decreased levels of dp / dt were detected in the PO mice, which was inhibited by delivery of the siRNAs targeting SGK3 and ING4. **p<0.01 versus PO+oligo ±SD (n=10); (C) Increased levels of LVEDD (left) and LVESD (middle), resulting in decreased levels of LVEDD-LVESD (right) in echocardiography were observed in the PO mice relative to the control oligo, which was prevented by delivery of the siRNAs targeting SGK3 and ING4. **p<0.01 versus PO+oligo ±SD (n=10); (D-E) Decreased levels of LVEF (D) and LVFS (E) in echocardiography were observed, which were inhibited by delivery of the siRNAs targeting SGK3 and ING4.**p<0.01 versus PO+oligo ±SD (n=10); (F) The PO mice displayed increased SGK3 (left) and ING4 (right), which was prevented by delivery of the siRNAs targeting SGK3 and ING4.**p<0.01 versus PO+oligo ±SD (n=6); (G) Increased expression of circNIgn was detected in PO mice model. **p<0.01 versus PO+oligo ±SD (n=6); (H) Sirius red staining and Masson's trichrome showed that delivery of the siRNAs prevented heart function decrease and fibrosis induced in the PO model (n=10); (I) PO mice showed increased Masson's trichrome (upper) and Sirius red (lower) staining, which was abolished by delivery of the siRNAs targeting SGK3 or ING4. **p<0.01 versus PO+oligo ±SD (n=6); and (J) Total RNA was extracted from the heart tissues followed by real-time PCR. The PO mice displayed increased collagen-l (left) and collagen-ll I (right), which was abolished by delivery of the siRNAs silencing SGK3 or ING4. **p<0.01 versus PO+oligo ±SD (n=6).

[0021] Figure 6 shows that targeting laminBl represses cardiac fibrosis induced in PO mice: (A) PCFs were isolated from WT and circN lgn(+) mice and transfected with control oligo and laminBl siRNAs. Cell lysates were prepared for Western blotting. Transgenic expression of circNIgn increased SGK3 and ING4 levels that was blocked by laminBl siRNA treatment. Subcellular fraction analysis showed that silencing LaminBl prevented the translocation of Nlgnl73 protein from cytosol to nuclei; (B) PCFs isolated from sham and PO mice were transfected with control oligo, and laminBl siRNAs, and subjected to RT-PCR. The PCFs isolated from PO mice expressed higher levels of circNIgn than the PCFs isolated from sham. **p<0.01 versus sham ±SD (n=6); (C) The PCFs isolated from PO mice expressed higher levels of collagen-l (left) and collagen-ill (right) that was abolished by laminBl siRNAs. **p<0.01 versus sham ±SD (n=6); (D) The PCFs isolated from PO mice expressed higher levels of SGK3 (left) and ING4 (right) that was abolished by laminBl siRNAs. **p<0.01 versus sham ±SD (n=6); (E) The PCFs were cultured on 96-well dishes for indicated time points and processed to MTT assays. The PCFs from PO mice displayed enhanced cell proliferation, which was inhibited by silencing laminBl. **p<0.01 versus sham ±SD (n=6); (F) The PCFs isolated from PO mice expressed higher levels of fibrosis markers including collagen-l, collagen-ill, fibronectin, and vimentin that were inhibited by laminBl siRNAs. **p<0.01 versus sham ±SD n=6).

[0022] Figure 7 illustrates that beta-blockers prevent fibrotic effect of circNIgn induced by norepinephrine (NE) in cells: (A) The PCFs were cultured in serum-free medium with or without 10 pM NE for 3 days. RT-PCR showed that treatment with 10 pM NE increased circNIgn and Nlgn pre-mRNA levels, but had little effect on Nlgn mRNA expression. *p<0.05,**p<0.01 versus control medium ±SD (n=4); (B) Left, PCFs were cultured in 10 % FBS basal medium with or without 10 pM NE at indicated time points. NE treated PCFs showed enhanced cell proliferation in the tested time points. Right, the cells were also cultured for 24 h. NE treated PCFs showed increased cell cycle entry in flow cytometry analysis. **p<0.01 versus without NE ±SD (n=6); (C) Left, PCMs were cultured with serum-free medium with or without NE for indicated time points. Cells cultured with NE showed decreased cell survival. Right, PCMs were cultured in serum-free medium with or without NE for 48 h, and subjected to Annexin V staining followed by flow cytometry analysis. Cells cultured with NE showed enhanced cell apoptosis. **p<0.01 versus control medium ±SD (n=6); (D) PCMs and PCFs cultured in the medium treated with 10 pM NE for 24 h were subjected to immunoblotting. NE treated cells showed increased Nlgnl73, SGK3, p-S9-GSK30 and ING4; (E) PCFs were transfected with circNIgn siRNAs, and cultured in 15 % FBS basal medium with 10 pM NE for 2 days. Silencing circNIgn decreased cell proliferation. **p<0.01 versus oligo ±SD (n=6); (F) PCFs were transfected with circNIgn siRNAs and cultured in 10 % FBS basal medium with 10 pM NE for 24 h. PCR showed that silencing circNIgn with siRNAs repressed fibrosis marker collagen-l, collagen-l 11, fibronectin and vimentin. **p<0.01 versus oligo ±SD (n=6); (G) The PCFs were cultured in basal medium supplemented with NE (10 pM) or NE+ 0- blockers (10 pM and 100 pM respectively). Cells cultured in basal medium with NE showed enhanced expression of circNIgn but not in NE supplemented with 0-blockers (10 pM Metoprolol and 100 pM ICI118551). **p<0.01 versus control medium ±SD (n=4). (H) The PCFs were cultured with basal medium with NE (10 pM) or NE+ 0-blockers (10 pM Metoprolol and 100 pM ICI 118,551). Cells cultured in basal medium supplemented with NE showed decreased cell viability but not in NE supplemented with 0-blockers (10 pM Metoprolol and 100 pM ICI118551). **p<0.01 versus control medium ±SD (n=4).

[0023] Figure 8 shows norepinephrine (NE) mediated the effects of circNIgn: (A) PCMs were cultured with serum-free medium with or without NE for 48 h, and subjected to Annexin V staining followed by flow cytometry analysis. Typical images showed cells cultured with NE showed enhanced cell apoptosis; (B) PCM and PCF cells were transfected with control oligo and circNIgn siRNAs and cultured in basal medium with 10 pM NE for 24 h. PCR showed that silencing circNIgn with siRNAs decreased circNIgn expression (upper), but didn't affect Nlgn mRNA expression levels (lower). **p<0.01 versus oligo ±SD (n=4); (C) PCF were isolated,transfected with circNIgn siRNAs, and cultured in 15 % FBS basal medium with 10 pM NE for 2 days. Silencing circNIgn repressed cell cycle entry. **p<0.01 versus oligo ±SD (n=6); and (D) Typical Images showed the cell cycle entry analyzed by flow cytometry.

[0024] Figure 9 shows that silencing circNIgn represses PCF proliferation and enhances PCM survival: (A) In situ hybridization and immunofluorescence staining showed silencing circNIgn with siRNAs decreased circNIgn and Nlgnl73 protein levels in PCFs; (B) PCM were isolated and cultured with serum-free mediumwith or without 10 pM NE for 3 days. PCR showed that treatment with serum-free mediumwith 10 pM NE increased circNIgn. *p<0.05, **p<0.01 versus control medium ±SD (n=4); (C) PCM were transfected with circNIgn siRNAs, and cultured in serum-free basal medium with 10 pM NE for indicated days. Silencing circNIgn with siRNAs enhanced PCM survival in serum-free medium. *p<0.05, **p<0.01 versus oligo ±SD (n=4); and (D) Isolated PCM and PCF were transfected with circNIgn siRNAs, and cultured in 10 % FBS basal medium with 10 pM NE for 24 h. PCR showed silencing circNIgn with repressed SGK3 (upper) and ING4 (lower) expression on mRNA levels.**p<0.01 versus oligo ±SD (n=4).

[0025] Figure 10 illustrates cardiomyocytes and cardiac fibroblasts expressed increase circNIgn levels in norepinephrine: (A) Left, PCFs were cultured with basal medium with NE (10 pM) or NE+ P blockers (10 pM Metroprolol and 100 pM ICI 118,551) for 48 h and flow cytometry. Cells cultured in basal medium with NE showed enhanced cell cycle entry, but not in NE with blockers. **p<0.01 versus control medium ±SD (n=6); Right, Typical images showed that cells cultured in basal medium with NE showed enhanced cell cycle entry, but not in NE with P blockers; (B) The PCFs were cultured in basal medium supplemented with NE (10 pM) or NE+ P blockers (10 pM and 100 pM respectively) for the indicated time points. Cells cultured in basal medium with NE showed enhanced cell proliferation but not in NE supplemented with P blockers (10 pM Metroprolol and 100 pM ICI118551); and (C) The PCFs were cultured with basal medium with NE (10 pM) or NE+ P blockers (10 pM Metroprolol and 100 pM ICI 118,551) for 48 h and subjected to RT-PCR. Cells cultured in basal medium supplemented with NE showed enhanced expression of fibrosis marker collagen-l, collagen-ll I, fibronectin and vimentin, but not in NE with P blockers.

[0026] Figure 11 shows additive effects NE and H2O2 on circNIgn expression in PCF: (A) Isolated PCFs were cultured in serum-free medium, 50 pM H2O2, 0.1 pM Doxrubicin or 1 pM C2 Ceramide, with or without 10 pM NE for 24 h. PCFs showed increased circNIgn (left) and Nlgn pre-mRNA (middle) in above stress medium, especially in those with NE. However, the Nlgn mRNA levels (right) didn't show significant change after above treatment. *p<0.05, **p<0.01 versus without NE; #p<0.05, ##p<0.01 versus without basal medium ±SD (n=4); and (B-D) Isolated PCFs were cultured with 50 pM H2O2 with or without 10 pM NE for 24 h, and subjected to in situ hybridization and immunofluorescence staining: (B) Typical images showed expression of Nlgnl73 (red) and circNIgn (yellow) in treated cells; (C) Graphs showed increased expression of circNIgn in H2O2 and NE treated cells; and (D) Graphs showed increased nuclear expression of Nlgnl73 in NE treated cells. **p<0.01 versus control medium ±SD (n=6).

[0027] Figure 12 shows additive effects NE and H2O2 on circNIgn expression and function in cardiomyocytes: (A) PCM and PCF cells were transfected with control oligo and circNIgn siRNAs, cultured in basal medium with 10 pM NE and 50 pM H2O2 for 48 h, followed by immunoblotting. NE and H2O2 treatment induced expression of Nlgnl73 protein that was inhibited by circNIgn siRNAs; (B) PCM were isolated, transfected with circNIgn siRNAs, and cultured in 10 % FBS basal medium with 10 pM NE and H2O2 with indicated concentration for 24 h. Silencing circNIgn with siRNAs enhanced PCM survival in H2O2. *p<0.05, **p<0.01 versus oligo ±SD (n=4); (C) PCM were transfected with circNIgn siRNAs, cultured in in 10 % FBS basal medium with 10 pM NE and H2O2 for 12 h, and followed with Annexin V staining and follow cytometry analysis. circNIgn siRNAs transfected cells showed repressed apoptosis. **p<0.01 versus oligo ±SD (n=4); (D) Typical images of flow cytometry analysis after Annexin V staining of PCM treated with 250 pM H2O2 for 12 h; and (E) Heart cell lines HL-1, MCF and AC16 were transfected with circNIgn siRNAs, and cultured in NE+ H2O2 with indicated concentration for 24 h. PCR showed that silencing circNIgn with siRNAs decreased circNIgn expression in these cell lines (left), but didn't affect Nlgn mRNA expression levels (right). **p<0.01 versus oligo ±SD (n=4).

[0028] Figure 13 Delivery of 0 blockers prevented NE induced cardiomyocyte apoptosis in cell stress models: (A) PCFs and PCMs were cultured with basal medium with NE (10 pM) or NE+ 0 blockers (10 pM Metroprolol and 100 pM ICI 118,551) for 24 h. Cells cultured in basalmedium with NE showed increased circNIgn levels but not in NE with 0 blocker. **p<0.01 versus control medium ±SD (n=4); (B) Isolated PCFs were cultured with basal medium, 10 pM NE+ 50 pM H2O2, or 10 pM NE+ 50 pM H2O2 with 10 uM Metroprolol (01 blocker) and 100 nM ICI 118,551 (02 blocker) for 24 h. PCR showed that 10 pM NE+ 50 pM H2O2treatment increased SGK3 (left) and ING4 (right) expression in PCFs, which could be prevented by 0 blockers. **p<0.01 versus cells cultured in medium ±SD (n=4); (C) PCMs were cultured in serum-free or containing H2O2 basal medium with NE (10 pM) or NE+ 0 blockers (10 pM Metroprolol and 100 pM ICI 118,551) for indicated time points. Cells cultured in medium with NE showed decreased cell survival, but not in NE with 0 blocker. **p<0.01 versus control medium ±SD (n=4); and (D) PCMs were cultured in 200 pM H2O2 / basal medium with NE (10 pM) or NE+ 0 blockers (10 pM Metroprolol and 100 pM ICI 118,551) for 12 h and subjected to Annexin V staining. Flow cytometry analysis showed that cells cultured in medium with NE displayed enhanced cell apoptosis, but not in NE with 0 blocker. **p<0.01 versus control medium ±SD (n=4). Typical images showed that cells cultured in medium with NE displayed enhanced cell apoptosis, but not in NE with 0 blocker.

[0029] Figure 14 Beta-blockers prevent fibrotic effect of circNIgn induced by norepinephrine (NE) in mice: (A) 8-week-old C57BL6 mice were intraperitoneally injected with 1.5 mg / kg NE in ascorbic acid saline twice daily, with oral administration of vehicle, 10 mg / kg carvedilol and bisoprolol daily for 15 days. Typical images of echocardiography and HE staining showed that NE induced mouse cardiac hypertrophy, which could be prevented by 0-blocker carvedilol and bisoprolol; (B) Heart tissues were lysed and subjected to RT-PCR. Injection of NE promoted circNIgn expression in the heart tissues, which was prevented by oral administration of carvedilol and bisoprolol. *p<0.05, **p<0.01 versus control ±SD (n=7); (C) Echocardiography showed that injection of NE did not significantly change mouse heart LVEDD-LVESD, LVEF, and LVFS. *p<0.05, **p<0.01 versus control ±SD (n=7); and (D) Echocardiography showed that injection of NE increased mouse heart interventricular septum (IVS, left), and left ventricle posterior wall (LVPW, right) which was prevented by oral administration of carvedilol and bisoprolol. *p<0.05, **p<0.01 versus control ±SD (n=7).

[0030] Figure 15 Beta-blocker prevented PO-induced circNIgn expression in the heart: (A) 8- week-old C57BL6 mice were subjected to PO, and orally administrated with vehicle, carvedilol, and bisoprolol (10 mg / kg) daily, or intraperitoneally injected with circNIgnconjugated with PEG and AuNP (50 pg / each, twice / week) for 8 weeks. Typical M-mode images of echocardiography showed the heart function in the treated mice; (B) Echocardiography showed that delivery of carvedilol and bisoprolol prevented the PO- induced decreased dp / dt, in which bisoprolol displayed better outcome than carvedilol significantly. Mice delivered with circNIgn reduced the effect of carvedilol on dp / dt relative to the mice delivered with carvedilol alone. *p<0.05, **p<0.01 versus control ±SD (n=10); (C) Echocardiography showed that PO mice displayed increased LVEDD and LVESD, and decreased LVEDD-LVESD, which could be prevented by oral administration of carvedilol and bisoprolol. Mice delivered with carvedilol and circNIgn showed increased LVEDD and LVESD, and decreased LVEDD-LVESD compared to carvedilol after PO. *p<0.05, **p<0.01 versus control ±SD (n=10); (D) Echocardiography showed that delivery of carvedilol and bisoprolol prevented PO induced decreased LVEF and LVFS, which could be prevented by oral administration of carvedilol and bisoprolol. Mice delivered with carvedilol and circNIgn showed lower levels of LVEF and LVFS than carvedilol only after PO. *p<0.05, **p<0.01 versus control ±SD (n=10); and (E) Real-time PCR showed that the PO mouse heart tissues expressed increased circNIgn levels, which could be prevented by oral administration of carvedilol and bisoprolol. Mice delivered with carvedilol and circNIgn expressed much higher levels of circNIgn than the control and mice delivered with carvedilol alone in the heart tissues after PO. *p<0.05, **p<0.01 versus control ±SD (n=7).

[0031] Figure 16 Beta-blockers prevent PO-induced heart fibrosis: (A) HE staining, Sirius red and Masson's trichrome staining showed that delivery of carvedilol and bisoprolol prevented heart fibrosis induced in the PO mice. Mice delivered with carvedilol and circNIgn displayed significant fibrosis compared with those delivered with carvedilol alone after PO; (B) Analysis of Sirius red and Masson's trichrome staining showed that delivery of carvedilol and bisoprolol prevented heart fibrosis induced in the PO mice. Mice delivered with carvedilol and circNIgn displayed significant fibrosis compared with those delivered with carvedilol alone after PO. *p<0.05, **p<0.01 versus control ±SD (n=6); (C) Real-time PCR showed that the PO mouse hearts expressed increased levels of collagen-l and collagen-ill mRNAs, which could be prevented by oral administration of carvedilol and bisoprolol. Mice delivered with carvedilol and circNIgn expressed much higher levels of collagen-l and collage n-l 11 mRNAs than those delivered with carvedilol alone in the heart tissues after PO.*p<0.05, **p<0.01 versus control ±SD (n=6); (D) MCF cells were cultured in serum free DMEM medium supplemented with 10 nM NE and 10 pM bisoprolol, and 10 pM carvedilol for 24 h, followed by RT-PCR. NE treatment promoted circNIgn and Nlgn pre-mRNA expression. Delivery of 0-blockers bisoprolol and carvedilol prevented NE induced circNIgn expression. **p<0.01 versus control ±SD (n=6); and (E) Diagram showing the targeting of circNlgn / Nlgnl73 by Mixmer and P-blockers.

[0032] Figure 17 Upregulation of circNIgn in acute ulcerative colitis: (A) Heatmap illustrating differentially expressed circular RNA profiles in human colon mucus with or without A-UC;(B) IHC staining showing Nlgnl73 protein levels in human colon mucus with acute ulcerative colitis (A-UC) and recessive ulcerative colitis (R-UC). ImageJ analysis showed human colon tissues with A-UC expressed high levels of Nlgnl73 protein. **p<0.01 versus normal (n=6);(C) In situ hybridization immunofluorescence staining showing circNIgn and Nlgnl73 protein levels in human colon mucus with acute ulcerative colitis (A-UC) and recessive ulcerative colitis (R-UC). ImageJ analysis demonstrated elevated levels of circNIgn and Nlgnl73 protein in human colon tissues with A-UC. **p<0.01 versus normal (n=6); (D) Human colon mucus collected from inflamed and unaffected areas of A-UC cases and subjected to RT-PCR, showing that inflamed mucus expressed high levels of circNIgn. **p<0.01 versus unaffected (n=18); € Human colon mucus with A-UC or R-UC was lysed and subjected to RT-PCR, showing that A-UC mucus expressed high levels of circNIgn. **p<0.01 versus normal (normal, n=26; A-UC and R-UC, n=22); (F) Left, C57BL / 6J mice were orally administered with 1.5 % or 3 % DSS for 7 days followed by a return to tap water for 3 days. Colonic mucosa was collected and subjected to in situ hybridization staining. ImageJ analysis showed that DSS- treated mice expressed higher levels of circNIgn than the control group, with a dosedependent effect. **p<0.01 versus H2O group (n=6); Right, ImageJ analysis of the colonic mucosa slides showed that the DSS treated mouse colonic mucosa expressed higher levels of Nlgnl73 than the control group, which was dose related. **p<0.01 versus H2O group (n=6); and (G) Left, In the 2% DSS and 2.5% TNBS-induced mouse colitis models, mouse colonic mucosa was collected at the indicated time points. RT-PCR showed that the colonic mucosa of DSS or TNBS-treated mice expressed high levels of circNIgn. **p<0.01 versus H2O or 50 % ethanol (n=5). Right, The above mouse colonic mucosa was lysed and subjected toWestern blot with antibody against Nlgnl73, showing that DSS or TNBS-treated mouse colonic mucosa expressed high levels of Nlgnl73.

[0033] Figure 18 provides images showing increased Nlgnl73 protein expression in human colon mucus (A-UC): In situ hybridization immunofluorescence staining showed circNIgn and Nlgnl73 protein levels in human colon mucus with colitis, which were high in acute ulcerative colitis (A-UC).

[0034] Figure 19 Assessment of Colon Damage, Cellular Proliferation, and Apoptosis in Response to DSS Treatment: (A) Left, Histological damage score analysis of HE staining revealed that DSS treatment induced damage to colon mucosa, and the damage was dosedependent. **p<0.01 versus H2O group (n=6), Middle, ImageJ analysis indicated that mildly damaged colon mucosa exhibited increased Ki67 (1.5 % DSS group), while severely damaged colon mucosa showed significantly decreased Ki67 expression (3 % DSS group). **p<0.01 versus H2O group (n=6), Right, upper, Representative images of HE staining of treated mouse colon sections, Right, lower, Typical Ki67 staining images of treated mouse colon section; (B) C57BL / 6J mice were exposed to 1.5 % or 3 % DSS for 7 days, followed by a return to tap water for 3 days. The colon tissue sections were subjected to TUNEL staining, revealing increased apoptosis in the DSS-treated tissues, Right, ImageJ analysis showed that DSS treatment significantly elevated TUNEL-positive cells in colon mucosa, especially in the 3% DSS-treated mice. **p<0.01 versus H2O group (n=6); and (C) Representative images of in situ hybridization staining demonstrated the expression of circNIgn (red) and Nlgnl73 (green) in the mouse colon mucosa, with DAPI used to stain nuclei (blue).

[0035] Figure 20 Susceptibility of colitis in the circNIgn transgenic mice: (A) Experimental mice were administered 1.5% DSS or 2.0% TNBS, and body weight was assessed daily until euthanized. circNlgn(+) mice exhibited decreased body weight compared to wild type (WT) mice after DSS or TNBS treatment. circN lgn(+) mice showed higher bleeding score than WT mice after DSS or TNBS treatment. circN lgn(+) mice showed higher stool score than WT mice after DSS or TNBS treatment. circN Ign (+) mice showed higher disease activity index (DAI) than WT mice after DSS or TNBS treatment. **p<0.05, **p<0.01 versus WT (n=10); (B) Mice were fed with FITC-dextran (600mg / kg) 4h before euthanized, and serum levels of FITC- dextran were assessed by ELISA. circNlgn(+) mice was exhibited high levels of FITC-dextranin the serum after DSS or TNBS treatment. **p<0.01 versus WT (n=10); (C) Kaplan-Meier survival test showed that circNlgn(+) transgenic mice exhibited decreased survival in the DSS or TNBS induced mouse colitis model. **p<0.05, **p<0.01 versus WT (control, n=5; chemical treated, n=10); (D) Left, the graph showed that circNlgn(+) mice had shorter colon length compared to the WT mice after DSS or TNBS treatment. **p<0.01 versus WT (n=10). Right, typical images showing the length of colon in above WT and circNlgn(+) mice; (E) Typical images of immunofluorescence staining showing Ki67 expression in mouse colonic mucosa of the above mice; and (F) Colon mucosa was collected and subjected to RT-PCR, showing that circN lgn(+) mouse mucosa expressed much higher levels of IL-10, 11-2, 11-6, TNFa and G- CSF mRNA after DSS (upper) or TNBS treatment (lower). **p<0.05, **p<0.01 versus WT (n=4).

[0036] Figure 21 circNIgn enhanced colitis development. (A) RT-PCR revealed significantly higher levels of circNIgn expression in circNlgn(+) colon mucosa compared to wild-type (wt) mice. **p<0.01 versus wt(n=6); (B) Left, ImageJ analysis of in situ hybridization staining showed that circN Ign (+) colon mucosa expressed much higher levels of circNIgn than wt. **p<0.01 versus wt(n=6), Right, ImageJ analysis of immunofluorescence staining showed substantially higher Nlgnl73 protein levels in circNlgn(+) colon mucosa compared to wt. **p<0.01 versus wt(n=6); and (C) Typical images showing the expression of circNIgn (red) and Nlgnl73 (green) in mouse colon mucosa from wtor circNlgn(+) mice, with or without DSS or TNBS treatment.

[0037] Figure 22 circNIgn expression enhanced apoptosis: (A) Left, Typical images of HE staining of mouse colon sections of above mice. Right, The graph displayed that colon sections from circNlgn(+) mice exhibited higher histological damage scores than wtmice after DSS or TNBS treatment. (B) ImageJ analysis of immunofluorescence staining revealed that circNlgn(+) colon mucosa expressed lower Ki67 levels compared to wtafter DSS or TNBS treatment; (C) ImageJ analysis of immunofluorescence staining indicated that circN lgn(+) colon mucosa had a higher intensity of TUNEL staining following DSS or TNBS treatment; (D) Typical images of TUNEL staining of mouse colon mucosa sections; and (E) Colon mucosa was cultured in DMEM for 24 hours, and the supernatant was subjected to ELISA assays, demonstrating that circNlgn(+) mouse mucosa secreted significantly higher levels of IL-10, IL-6, TNFa, and G-CSF after DSS (upper) or TNBS treatment (lower).

[0038] Figure 23 Silencing circNIgn or blocking circNIgn translation decreased colitis symptoms: (A) Upper, Mice were administrated with 3 % DSS, and the body weight was assessed daily until euthanized. Silencing circNIgn with siRNAs or blocking circNIgn translation with a mixmer mitigated DSS enhanced body weight losing. **p<0.05, **p<0.01 versus oligo (n=10), Middle, The graph showed that silencing circNIgn with siRNAs or blocked circNIgn translation with a mixmer mitigated DSS induced bleeding score increase. **p<0.05, **p<0.01 versus oligo (n=10), Lower, The graph showed that silencing circNIgn with siRNAs or blocked circNIgn translation with a mixmer mitigated DSS induced stool score increase. **p<0.05, **p<0.01 versus oligo (n=10); and (B) Silencing circNIgn with siRNAs or blocked circNIgn translation with a mixmer prevented the shortened colon length induced by DSS treatment. A typical image showed the colon length of mice in the various groups with or without DSS treatment.

[0039] Figure 24 Improvement of colitis outcome by targeting Nlgnl73: (A) A graph showing that silencing circNIgn with siRNAs or blocking circNIgn translation with a mixmer mitigated DSS induced DAI increase. **p<0.05, **p<0.01 versus oligo (n=10); (B) A graph showing that circNIgn siRNAs or mixmer delivered mice had lower FITC-dextran levels in the serum after DSS treatment. **p<0.01 versus oligo (n=10); (C) Mice were delivered with circNIgn siRNAs or mixmer by nanoparticles as the Methods described, and administrated with 3 % DSS or H2O. Kaplan-Meier survival test showed that silencing circNIgn with siRNAs or blocking circNIgn translation with a mixmer enhanced mouse survival in the 3 % DSS induced mouse colitis model. **p<0.05, **p<0.01 versus oligo (H2O, n=5; 3 % DSS, n=20); (D) Left, A graph showing that silencing circNIgn with siRNAs or blocking circNIgn translation with a mixmer prevented colon shortening induced by DSS treatment. **p<0.01 versus oligo (n=10); (E) Left, A graph showing that circNIgn siRNAs or mixmer delivered mouse colon sections displayed lower histological damage score than control mice after DSS treatment. **p<0.01 versus oligo (n=6); (F) Immunofluorescence staining showed that circNIgn siRNAs or mixmer delivered mouse mucosa expressed higher Ki67 levels than control mice after DSS treatment; (G) Left, ImageJ analysis of TUNEL staining showed that circNIgn siRNAs or mixmer delivered mouse mucosa displayed lower TUNEL intensity than those of control mice after DSS treatment. **p<0.01 versus oligo (n=6); (H) ImageJ analysis of in situ hybridization staining showed that circNIgn siRNAs delivered colonic mucosa expressedlower levels of Nlgnl73 in the nucleic. **p<0.01 versus oligo (n=6); and (I) Left, Colonic mucosa was collected and subjected to RT-PCR, showing that circNIgn siRNAs or mixmer delivered mouse mucosa expressed much lower levels of IL-10, 11-2, 11-6, TNFa and G-CSF mRNA after DSS treatment. **p<0.05, **p<0.01 versus oligo (n=4).

[0040] Figure 25 Silencing circNIgn or blocking circNIgn translation mitigated colitis: (A) The colon sections from mice that received circNIgn siRNAs or mixmersexhibited lower histological damage scores than the control mice after DSS treatment. Typical images of HE staining of mouse colon sections; (B) Left, ImageJ analysis of immunofluorescence staining revealed that mice receiving circNIgn siRNAs or mixmershad higher Ki67 levels in the colon mucosa than control mice after DSS treatment. **p<0.01 versus oligo (n=6). Right, Typical images of Ki67 IHC staining of untreated mouse colon mucosa; and (C) TUNEL staining showed that mice receiving circNIgn siRNAs or mixmersdisplayed lower TUNEL intensity than control mice after DSS treatment. Typical images of TUNEL staining of mouse colon mucosa.

[0041] Figure 26 Silencing circNIgn or blocking circNIgn translation decreased cytokine expression: (A) RT-PCR showed that colonic mucosa from mice receiving circNIgn siRNAs expressed lower levels of circNIgn than those receiving oligos. **p<0.01 versus oligo (n=6); (B) Left, ImageJ analysis of in situ hybridization staining showed that colonic mucosa from mice receiving circNIgn siRNAs expressed lower levels of circNIgn than those receiving oligos. **p<0.01 versus oligo (n=6); (C) ImageJ analysis of immunofluorescence staining showed that colonic mucosa from mice receiving circNIgn siRNAs or mixmersexpressed lower levels of Nlgnl73 protein than those receiving oligos, both with or without DSS treatment. **p<0.01 versus oligo (n=6); and (D) Colonic mucosa was cultured in DMEM for 24 h, and the supernatant were subjected to ELISA assays, showing that mice receiving circNIgn siRNAs or mixmers secreted significantly lower levels of IL-10, IL-6, TNFa, and G-CSF after DSS treatment. **p<0.05, **p<0.01 versus oligo (n=4).

[0042] Figure T1 Nlgnl73 suppressed nuclear actin polymerization: (A) Primary mouse colonic epithelial cells (mCECs) were isolated from WT and circNlgn(+) transgenic mice and subjected to immunoprecipitation assay with antibody against Nlgnl73. Mass spectrometry identified a list of Nlgnl73-binding proteins. (B) Nuclear extracts of mCECs were subjectedto immunoprecipitation with an antibody against actin. Mass spectrometry revealed a list of actin-binding proteins. In the presence of Nlgnl73, actin did not precipitate Arp2 / 3; (C) In the 2% DSS and 2.5% TNBS induced mouse colitis models, mouse colonic mucosa was collected, lysed and subjected to actin polymerization assay. The mucosa lysis of DSS or TNBS treated mice suppressed actin polymerization; (D) A diagram showing the interaction of Nlgnl73 and actin; (E) The mucosa was subjected to subcellular fractionation, and processed to actin polymerization assay. Total lysate and nuclear lysate from the DSS- and TNBS-treated mice suppressed actin polymerization; (F) Colonic mucosa from WT and circN lgn(+) mice treated with or without 1.5% DSS was collected and processed to actin polymerization assay. Lysate of nuclear extract from circN Ign (+) mucosa showed suppression of actin polymerization; (G) Left, Image J analysis showed that circN lgn(+) mCEC nuclei expressed higher levels of G-actin relative to the WT. Right, Image J analysis showed that circN Ign (+) mCEC nuclei expressed lower levels of F-actin relative to WT. **p<0.01 versus WT (n=6); and (H) Left, Delivery of circNIgn siRNAs and mixmer in mCECs decreased G-actin in the nuclei. Right, Delivery of circNIgn siRNAs and mixmer increased F-actin in the nuclei. **p<0.01 versus oligo (n=6).

[0043] Figure 28 Fig S8. Nlgnl73 repressed nuclear actin polymerization: (A) Left, mCECsisolated from wtand circNlgn(+) mice treated with 1.5% DSS were collected and processed to actin polymerization assay. Total lysate and nuclear lysate of circNlgn(+) mucosa suppressed actin polymerization, Right, Colonic mucosa from wt and circNlgn(+) mice treated with 2% TNBS was processed to actin polymerization assay. Lysate of nuclear extract from circNlgn(+) mucosa showed suppression of actin polymerization; (B) Left, Colonic mucosa from circNIgn siRNA-and mixmer-delivered mice treated with or without 1.5% DSS was processed to actin polymerization assay. The nuclear extract of circNIgn siRNAs and mixmer-delivered mouse mucosa displayed increased actin polymerization compared with oligo control. Right, mCECs isolated from circNIgn siRNA-and mixmer- delivered mice treated with or without 1.5% DSS were processed to actin polymerization assay. The nuclear extract of mCECs treated with the siRNAs and mixmer displayed increased actin polymerization; (C) HCT116 cells transfected with circNIgn were subjected to subcellular fractionation and actin polymerization assay. The nuclear extracts from the circN Ign-transfected cells decreased actin polymerization; (D) mCECs isolated from wt andcircN lgn(+) mice, and transfected with LaminBl siRNAs were subjected to subcellular fractionation. The nuclear extract from the cells transfected with the siRNAs showed increased actin polymerization, but the cytosol had opposite effect; and (E) Upper, FHC cells was transfected with XPO6 or IPO9 siRNAs and cultured in 0.1 pM Jaspfor 24 h and subjected to actin fractionation. Western blot showed that silencing XPO6 increased and silencing IPO9 decreased nuclear F-actin levels. Silencing XPO6 / IPO9 didn't change actin dynamics in total cell lysate. Right, FHC cells were transfected with XPO6 or IPO9 siRNAs and co-transfected with mDia2. Western blot showed that silencing XPO6 increased and silencing IPO9 decreased nuclear F-actin levels. Silencing XPO6 / IPO9 didn't change actin dynamics in total cell lysate.

[0044] Figure 29 Levels of nuclear G-actin and F-actin affected by circNIgn expression: (A) Typical z-stack images (xy, xz and yz projection and orthogonal view) showed nuclear F-actin (Phalloidin staining, red) and G-actin (Deoxyribonuclease I staining, green) of circNIgn transgenic mouse colon mucus after 1.5 % DSS (upper) and 2 % TNBS (lower) treatment; and (B) Image J analysis displayed the intensity of G-actin (upper) and F-actin (lower) in wt and circNlgn(+) mouse mucosa treated with 1.5% DSS and 2% TNBS (n=6).

[0045] Figure 30 Levels of nuclear G-actin and F-actin associated with circNIgn expression: (A) Typical z-stack images (xy, xz and yz projection and orthogonal view) showed nuclear F- actin (Phalloidin staining, red) and G-actin (Deoxyribonuclease I staining, green) of circNIgn siRNAs or mixmer delivered mouse colon mucus after 3 % treatment; and (B) Image J analysis showed the G-actin (left) and F-actin (right) intensity in mouse colon mucosa delivered with circNIgn siRNAs and mixmer after treated with 3% DSS (n=6).

[0046] Figure 31 Levels of nuclear G-actin and F-actin associated with colitis development: (A) Typical z-stack images (xy, xz and yz projection and orthogonal view) showed nuclear F- actin (Phalloidin staining, red) and G-actin (Deoxyribonuclease I staining, green) of human colonic mucus with A-UC or R-UC; (B) Image J analysis showed the G-actin and F-actin intensity in above human colonic mucosa (n=6); and (C) Image J analysis showed that human A-UC mucosa expressed increased nuclear G-actin and decreased nuclear F-actin compared to normal colon (n=6).

[0047] Figure 32 Nlgnl73 repressed nuclear actin polymerization was Arp2 / 3 dependent: (A) Left, Coomassie blue staining confirmed the purification of Nlgnl73 from the circNIgn- transfected 293T cells. Right, The purified Nlgnl73 suppressed actin polymerization.Inclusion of LatB completely blocked actin polymerization; (B) Solid phase microplate protein binding assay confirmed the interaction between F-actin and Arp2 / 3 with or without Nlgnl73. The purified Nlgnl73 repressed Arp2 / 3 binding to F-actin. **p<0.01 versus Arp2 / 3+F-actin (n=6); (C) F-actin (40 pg) and G-actin (40 pg) were mixed with 5 pg Arp2 / 3 (from Actin binding protein biochem kit, Cat#BK001) with or without 5 pg purified Nlgnl73. The mixture was subjected to fractionation to separate F-actin (pellet) and G-actin (supernatant), followed by Western blot. Incubation with Arp2 / 3 increased F-actin levels, and incubation with Nlgnl73 increased G-actin levels. Incubation with Nlgnl73 abolished the effect of Arp2 / 3 on increasing F-actin levels. Arp2 / 3 bound F-actin, which was blocked by Nlgnl73. Nlgnl73 bound F-actin, but the binding did not decrease after incubated with Arp2 / 3. Immunoprecipitation with an antibody against actin showed that both Arp2 / 3 and Nlgnl73 bound F-actin. Binding of Nlgnl73 to F-actin decreased the interaction of Arp2 / 3 with F-actin; (D) mCECs isolated from WT and circNlgn(+) mice were subjected to subcellular fractionation followed by Western blot. Nlgnl73 was mainly detected in the nuclei, where the levels of actin and Arp2 / 3 were lower compared to cytosol. Immunoprecipitation with an antibody against Nlgnl73 co-precipitated actin in the nuclei. Immunoprecipitation with an antibody against actin co-precipitated Arp2 / 3 and Nlgnl73 in the nuclei. Expression of Nlgnl73 decreased Arp2 / 3 binding to actin. Immunoprecipitation with an antibody against Arp2 or Arp3 co-precipitated actin in the nuclei. Expression of Nlgnl73 decreased actin binding to Arp2 / 3; and (E) Precipitation of actin pulled down Arp2 / 3 and Nlgnl73 in the nuclei. Expression of Nlgnl73 decreased Arp2 / 3 binding to actin in the nuclei.Immunoprecipitation with an antibody against Arp2 or Arp3 co-precipitated actin in the nuclei. Expression of Nlgnl73 decreased actin binding to Arp2 / 3.

[0048] Figure 33 Effect of Nlgnl73 on Arp2 / 3-mediated nuclear actin polymerization: (A) The purified Nlgnl73 repressed actin polymerization in a dose-dependent manner; (B) The purified Nlgnl73 repressed Arp2 / 3 dependent actin polymerization; (C) mCECs were transfected with circNIgn siRNAs and cultured with 100 pM NE for 24 h. The cells were subjected to subcellular fractionation and Western blot. Nlgnl73 was mainly detected innuclei; (D) Immunoprecipitation with an antibody against Nlgnl73 precipitated Nlgnl73 that pulled down actin in the nuclei; (E) mCECs from wt or circNlgn(+) mice were transfected with LaminBl siRNAs and subjected to subcellular fractionation and Western blot. Silencing LaminBl blocked Nlgnl73 translocation from cytosol to the nucleus; and (F) Immunoprecipitation with antibody against Nlgnl73 co-precipitated actin in the nucleus of circN lgn(+) mCESs and actin in the cytosol of LaminBl siRNA-transfected circN lgn(+) mCESs. Actin precipitation pulled down Arp2 / 3 and Nlgnl73. Arp2 / 3 precipitation pulled down actin. Silencing LaminBl decreased Nlgnl73 binding to actin in nuclei but increased its binding to actin in the cytosol. Silencing LaminBl increased Arp2 / 3 binding to actin in nuclei but decreased its binding to actin in the cytosol.

[0049] Figure 34 Expression of circNIgn Represses Arp2 / 3 Binding to Actin in mCECs Nuclei: (A) Upper, mCECs were isolated from WT and circNlgn(+) mice treated with 1.5% DSS or 2% TNBS and subjected to Western blot. Treatment with DSS and TNBS increased Nlgnl73 levels. Lower, Subcellular fractionation and Western blot showed that treatment with DSS and TNBS increased Nlgnl73 levels in the nuclei; (B) Immunoprecipitation with an antibody against Nlgnl73 co-precipitated actin in the nuclei. Actin precipitation co-precipitated Arp2 / 3 and Nlgnl73. Arp2 / 3 precipitation pulled down actin. Increased expression of Nlgnl73 decreased actin binding to Arp2 / 3. (C) mCECs transfected with circNIgn siRNAs and mixmer were subjected to Western blot. Delivery of circNIgn siRNAs and mixmer decreased Nlgnl73 expression in mCECs. Subcellular fractionation followed by Western blot detected Nlgnl73 in the mCECs nuclei; and (D) Immunoprecipitation with antibody against Nlgnl73 showed that decreased Nlgnl73 expression precipitated lower levels of actin in the nuclei. Immunoprecipitation with an antibody against actin co-precipitated Arp2 / 3 and Nlgnl73. Arp2 / 3 precipitation pulled down actin. Increased expression of Nlgnl73 repressed Arp2 / 3 binding to actin.

[0050] Figure 35 Expression of circNIgn promotes tyrosine-53 phosphorylation of nuclear F- actin: (A) mCECs were isolated from WT, circNIgn (-) and circNIgn (+) mice. The nuclei were subjected to F / G-actin fractionation. Expression of circNIgn (+) decreased F-actin levels in the nuclei. Immunoprecipitation with antibody against actin followed by Western blot probed with antibodies against phospho-threonine, serine and tyrosine showed that circNIgn expression promoted F-actin phosphorylation at tyrosine; (B) The nuclear F-actinfraction was subjected to actin immunoprecipitation. Precipitation of F-actin pulled down Nlgnl73. Loading amount of precipitated products was modulated until similar expression levels of nuclear F-actin were detected for each sample. Phosphorylation of threonine and serine levels did not change, while phospho-tyrosine levels increased in F-actin. The levels of p-Tyrosine-actin increased in the precipitated F-actin, while the pulled down Arp2 / 3 amount decreased; (C) F-actin was precipitated with 20 pl biotin-phalloidin (50 pM). Precipitation of F-actin pulled down more Nlgnl73 and p-Tyr-53, but less Arp2 / 3 in mCECs expressing circNIgn; (D) F / G-actin was fractionated from mCECs transfected with circNIgn siRNAs and treated with 100 pM DSS for 24 h. Silencing circNIgn increased F-actin levels in the nuclei. Immunoprecipitation with an antibody against actin co-precipitated Nlgnl73. Silencing circNIgn decreased the precipitated amount; (E) Immunoprecipitation with an antibody against actin precipitated increased nuclear F-actin by silencing circNIgn. At an equal loading amount of precipitated F-actin, the levels of threonine and serine phosphorylation did not change, while phospho-tyrosine levels decreased in mCECs transfected with circNIgn siRNAs, which also showed decreased precipitation of Nlgnl73 and p-Tyr-53, but more Arp2 / 3 by nuclear F-actin pull down; (F) F-actin precipitation with 20 pl biotin-phalloidin (50 pM) precipitated less Nlgnl73 and p-Tyrosine, but more Arp2 / 3 in mCECs transfected with circNIgn siRNAs; (G) Mouse colonic mucosa isolated from WT and circN lgn(+) mice treated with 1.5% DSS and 2% TNBS were subjected to nuclear fractionation and immunoprecipitation with biotin-phalloidin. Expression of circNIgn decreased F-actin levels in the nuclei, which was promoted by DSS and TNBS treatment. At an equal amount of the precipitated products, F-actin pulled down more Nlgnl73 and p-Tyr-53, but less Arp2 / 3 in the circN Ign (+) mucosa, which was promoted by DSS and TNBS treatment; and (H) Mucosa isolated from mice delivered with circNIgn siRNAs and mixmer treated with 3% DSS were subjected to nuclear fractionation and immunoprecipitation with biotin-phalloidin.Increased F-actin was detected in the nuclei when Nlgnl73 decreased, which was promoted by DSS treatment. At equal amount of F-actin, precipitation of F-actin pulled down less Nlgnl73 and p-Tyr-53, but more Arp2 / 3 when Nlgnl73 levels decreased, which was enhanced by DSS treatment.

[0051] Figure 36 Nlgnl73 decreases PIAS3 expression but activates STAT3 and NF-kB: (A)Left, Mouse colon mucus was lysed and subjected to RT-PCR to assess mRNA levels of 17colitis-related genes. *p<0.05, **p<0.01 versus WT (n=6). Right, Human colon mucus with A- UC and R-UC was lysed and subjected to RT-PCR. Both A-UC and R-UC mucus expressed lower levels of PIAS3 than the normal tissues. **p<0.01 versus normal (normal, n=26; A-UC and R-UC, n=22); (B) mCEC cells were transfected with XPO6 and IPO9 siRNAs and cultured in 0.1 pM Jasp for 24 h. RT-PCR showed that silencing XPO6 up-regulated, while silencing IPO9 down-regulated expression of PIAS3; (C) Left, mCEC cells were cultured in 0.1 pM jasplakinolide (Jasp), 0.05 pM latrunculin B (LatB) and 1 pM cytochalasin-D (CytD) for 24 h, followed by RT-PCR. mCEC cells showed increased PIAS3 levels when treated with Jasp, but decreased PIAS3 levels when treated with LatB and CytD. *p<0.05, **p<0.01 versus NC (n=6). Right, Colonic epithelial cell line FHC was transfected with XPO6 and IPO9 siRNAs and cultured in 0.1 pM Jasp for 24 h or co-transfected with mDia2. RT-PCR showed that silencing XPO6 up-regulated, while silencing IPO9 down-regulated expression of PIAS3. **p<0.01 versus oligo (n=6); (D) FHC cells were transfected with control vector, YFP-NLS-P-actin (NLS- p-actin), YFP-NLS-p-actin S14C (SMC), YFP-NLS-p-actin G13R (G13R) and NLS-p-actin R62D (R62D) mCherry. Expression of S14C increased PIAS3 levels. **p<0.01 versus vector (n=6); (E) Left, mCEC cells were isolated from WT and circNIgn transgenic mice. CircNlgn(+) Mcec cells showed high levels of circNIgn and decreased PIAS3. **p<0.01 versus wt (n=6). Right, Western blot showed decreased expression of Pias3, but activation of Stat3 and NFkb in nucleic; (F) ImageJ analysis showing that circNIgn transgenic mouse colon tissues expressed low levels of PIAS3, and high levels of p-STAT3 and NFkB-p65. **p<0.01 versus wt (n=6); (G) Typical images showing IHC staining of PIAS3, p-STAT3 and NFkB-p65 in human colon mucus of A-UC and R-UC; (H) ImageJ analysis showed that A-UC tissues expressed lower levels of PIAS3, high levels of p-STAT3, and high nuclear levels of NFkB-p65. **p<0.01 versus normal (n=6); and (I) A diagram showing that circNIgn promoted A-UC via suppressing nuclear actin polymerization.

[0052] Figure 37 Modulation of Pias3 expression and inflammatory signaling by actin- targeting compounds: (A) mCECcells were cultured in 0.1 pM jasplakinolide (Jasp), 0.05 pM latrunculin B (LtB) or 1 pM cytochalasin-D (cytD) for 24 h, and subjected to RT-PCR. mCEC cells showed increased Pias3 when treated with Jasp, and expressed decreased pias3 when treated with LtBor CytD. *p<0.05, **p<0.01 versus NC (n=6); and (B) Representative imagesdisplayed IHC staining of Pias3, p-Stat3 and NF-kB p65 in the colon mucus of circNIgn transgenic mice after treatment with 1.5% DSS or 2% TNBS.

[0053] Figure 38 Effect of silencing circNIgn on inflammatory signaling: (A) mCECcells were transfected with circNIgn siRNAs. Silencing circNIgn with siRNAs enhanced expression levels of Pias3 of mCECcells. **p<0.01 versus oligo (n=6); (B) Western blot showing expression of Pias3, p-Stat3 and NF-kB p65 in mouse colon mucus receiving circNIgn siRNAs or mixmer after treated with 3 % DSS; (C) Typical images showed IHC staining of Pias3, p-Stat3 and NF- kB p65 in mouse colon mucus receiving circNIgn siRNAs or mixmer after treated with 3 % DSS; and (D) ImageJ analysis demonstrated that mice treated with circNIgn siRNAs or mixmer displayed increased Pias3 levels and decreased p-Stat3 in the colon mucus, and decreased NF-kB p65 cell nuclei. **p<0.01 versus oligo (n=6).

[0054] Figure 39 Ectopic delivery of circNIgn retarded wound healing: (A) Left, Transgenic and wildtype mice were subjected to splinted full-thickness excisional wounds on the dorsum. Graphs illustrate delayed healing in circNlgn(+) mice. **p<0.01 versus WT (n=10). Right, Representative images showing significantly delayed healing in circNIgn transgenic mice; (B) Representative wound images of WT and circNlgn(+) mice on Day 12 after wounding; (C) Representative H&E staining of wounds from WT and circNlgn(+) mice on Day 9 after wounding; (D-E) In situ hybridization and immunofluorescence staining showed expression of circNIgn and Nlgnl73 protein in the wounds of WT and circNlgn(+) mice on Day 9. ImageJ analysis showed that higher levels of circNIgn and Nlgnl73 protein in the wound of circNlgn(+) mice relative to WT (D). **p<0.01 versus WT (n=6). Typical images of immunofluorescence staining are shown (E); (F) C57BL / 6J mice at 8-week-old were subjected to splinted full-thickness excisional wounds on the dorsum. The wound tissues were collected in the indicted days and processed to RT-PCR. The wound tissues expressed increased circNIgn within 5 days after wounding. **p<0.01 versus unwounded (n=4); (G) Primary dermal fibroblasts (PDFs) were isolated from WT, circN Ign(-) and circNlgn(+) mice, and subjected to RT-PCR. PDFs isolated from circNlgn(+) mice expressed higher levels of circNIgn than the controls. **p<0.01 versus WT (n=6); (H) PDFs from circNlgn(+) showed decreased cell proliferation when cultured in 10% FBS / DMEM medium. **p<0.01 versus WT (n=6); and (I) Left, PDFs from circNlgn(+) showed decreased cell survival when cultured in serum-free DMEM for 6 days. Right, The cells from circNlgn(+) showed decreased cellsurvival when cultured in basal medium containing 400 pM and 600 pM H2O2 for 24 h. **p<0.01 versus WT (n=6).

[0055] Figure 40 Expression of circNIgn repressed cell growth: (A) Left, Flow cytometry analysis showed that circNlgn(+) PDFs exhibited decreased cell cycle entry. **p<0.01 versus wt (n=6). Right, Representative images showed cell cycle patterns of PDFs isolated from circNlgn(+) mice; (B) Human keratinocyte cell line HaCat and mouse fibroblast cell lineNIH3T3 cells were transfected with control vector or circNIgn, and subjected to RT-PCR. Transfection of circNIgn significantly increased circNIgn expression (left), but did not affect Nlgn mRNA expression levels (right). **p<0.01 versus wt (n=6); (C) Left, The transfected HaCat and NIH3T3 cells were cultured in 10% FBS / DMEM medium for 6 days. Expression of circNIgn repressed cell proliferation. **p<0.01 versus vector (n=6). Middle, HaCat cells were transfected with control vector or circNIgn, and cultured in for 10% FBS / DMEM medium 6 days. Expression of circNIgn repressed proliferation at the indicated time points. **p<0.01 versus vector (n=6). Right, NIH3T3 cells were transfected with control vector or circNIgn, and cultured in for 10% FBS / DMEM medium 6 days. Expression of circNIgn repressed proliferation in the indicated time points. **p<0.01 versus vector (n=6); and (D) Left, HaCat and NIH3T3 cells were transfected with control vector or circNIgn, and subjected to cell cycle analysis. Expression of circNIgn repressed cell cycle entry. **p<0.01 versus vector (n=6). Right, Representative images showed expression of circNIgn repressed NIH3T3 cell cycle entry.

[0056] Figure 41 Expression of circNIgn decreased cell survival: (A) Left, Representative images showed that Annexin V staining of circN lgn(+) PDFs after cultured in serum-free medium for 2 days or 300 pM H2O2for 12 h. Right, Flow cytometry analysis showed that circNlgn(+) PDFs exhibited enhanced cell apoptosis after cultured in serum-free medium for 2 days or 300 pM H2O2for 12 h. **p<0.01 versus wt (n=6); (B) Left, HaCat and NIH3T3 cells transfected with circNIgn and the control vector were cultured in serum free basal medium for 6days. Expression of circNIgn repressed cell survival. Middle, The cells were cultured in serum-free basal medium for 6 days, and expression of circNIgn repressed cell survival. Right, The cells were cultured in serum-free basal medium for 6 days. Expression of circNIgn repressed cell survival. **p<0.01 versus vector (n=6); (C) Left, HaCat and NIH3T3 cells transfected with circNIgn and the control vector were cultured in 500 pM H2O2 with basalmedium for 24 h. Expression of circNIgn repressed cell survival. Middle, NIH3T3 cells were transfected with control vector or circNIgn, and cultured in basal medium with H2O2 for 24 h. Expression of circNIgn repressed cell survival in H2O2. Right, HaCat cells were transfected with control vector or circNIgn, and cultured in basal medium with H2O2 for 24 h. Expression of circNIgn repressed cell survival in H2O2. **p<0.01 versus vector (n=6); and (D) Left, HaCat and NIH3T3 cells were transfected with control vector or circNIgn, cultured in 300 pM H2O2 with basal medium for 12 h, and subjected to Annexin V staining followed by flow cytometry analysis. Expression of circNIgn enhanced cell apoptosis. **p<0.01 versus vector (n=6). Right, Representative images showed expression of circNIgn enhanced NIH3T3 cell apoptosis after cultured in 300 pM H2O2 with basal medium for 12 h.

[0057] Figure 42 Silencing circNIgn promoted wound healing: (A) Four splinted full-thickness excisional wounds were created on the dorsum of 8-week-old C57BL / 6J mice. Each wound was delivered with 2 pg oligo-, mixmer- or circNIgn siRNA-PEG-Au NP complex every other day. Representative images showed that delivery of circNIgn mixmer or siRNAs promoted wound healing; (B) Wound images of 5 experimental mice on Day 0 and Day 8. The left front wounds were delivered with oligo, the right front wounds were delivered with mixmer, the left back wounds were delivered with circNIgn siRNA-1, and the right back wounds were delivered with circNIgn siRNA-2; (C) Delivery of circNIgn mixmer or siRNAs promoted wound healing. **p<0.01 versus oligo (n=10); (D) Representative H&E staining of the wounds on Day 5, showing that delivery of circNIgn mixmer or siRNAs promoted wound healing; (E) In situ hybridization and immunofluorescence staining showed expression of circNIgn and Nlgnl73 protein in the wounds. ImageJ analysis showed that delivery of circNIgn siRNAs decreased circNIgn and Nlgnl73 levels in the wound, while delivery of miximer repressed Nlgnl73 expression. **p<0.01 versus WT (n=6); (F) The transfected PDFs were cultured in 10% FBS / DMEM medium for 6 days. Silencing circNIgn enhanced cell proliferation at indicated time points. **p<0.01 versus vector (n=6); (G) The transfected PDFs were cultured in serum-free DMEM medium for 6 days. Silencing circNIgn enhanced cell survival at indicated time points. **p<0.01 versus vector (n=6); and (H) Left, The transfected PDFs were cultured in 10% FBS / DMEM medium for 6 days. Transfection with circNIgn mixmer enhanced cell proliferation at indicated time points. Right, The transfected PDFs werecultured in serum-free DMEM medium for 6 days. Transfection with circNIgn mixmer enhanced cell survival. **p<0.01 versus vector (n=6).

[0058] Figure 43 Silencing circNIgn enhanced PDF proliferation: (A) In situ hybridization and immunofluorescence staining showed expression of circNIgn (Green) and Nlgnl73 protein (red) in the wounds. Levels of circNIgn decreased in siRNAs delivered wounds, and levels of Nlgnl73 decreased in both mixmer and siRNAs delivered wounds; (B) PDFs were transfected with control oligo or circNIgn siRNAs, and subjected to RT-PCR. Silencing circNIgn decreased circNIgn levels (left), but did not change Nlgn mRNA (right). **p<0.01 versus oligo (n=6); (C) HaCat and NIH3T3 cells were transfected with control oligo or circNIgn siRNAs, and subjected to RT-PCR. Silencing circNIgn decreased circNIgn levels, but did not change Nlgn mRNA expression. **p<0.01 versus oligo (n=6); (D) The cells were cultured in 10% FBS / DMEM medium for 6 days. Silencing circNIgn enhanced cell proliferation. **p<0.01 versus vector (n=6); (E) Left, Cell cycle analysis showed that silencing circNIgn with siRNAs promoted PDF cell cycle entry. **p<0.01 versus vector (n=6). Right, Representative images showed that silencing circNIgn promoted PDF cell cycle entry; and (F) Left, Cell cycle analysis showed that silencing circNIgn promoted HaCat and NIH3T3 cell cycle entry. **p<0.01 versus vector (n=6). Right, Representative images of HaCat cell cycle entry.

[0059] Figure 44 Silencing circNIgn enhanced PDF viability and decreased apoptosis:(A) The cells were cultured in serum-free DMEM medium for 6 days. Silencing circNIgn enhanced cell survival. **p<0.01 versus vector (n=6); (B) Left, The transfected PDFs were cultured in basal medium with H2O2 for 24 h. Silencing circNIgn with siRNAs enhanced PDF cell survival. Right, The cells were cultured in basal medium with 600 pM H2O2 for 24 h. Silencing circNIgn enhanced cell survival. **p<0.01 versus vector (n=6); (C) Left, The transfected PDFs were cultured in serum-free DMEM medium for 3 days, and subjected to Annexin V staining followed by flow cytometry analysis. Representative images showed that silencing circNIgn repressed cell apoptosis. Right, Flow cytometry analysis showed that silencing circNIgn repressed PDF cell apoptosis after cultured in serum-free medium for 3 days or in 500 pM H2O2 with basal medium for 12 h. **p<0.01 versus vector (n=6); and (D) Left, The cells were cultured in 500 pM H2O2 with basal medium for 12 h, and subjected to Annexin V staining followed by flow cytometry analysis. Silencing circNIgn repressed HaCat and NIH3T3 cell apoptosis. **p<0.01 versus vector (n=6). Right, Representative images of cell apoptosis.

[0060] Figure 45 Inhibition of circNIgn translation enhanced cell viability: (A) PDFs were transfected with control oligo or circNIgn mixmer, and subjected to RT-PCR. Transfection with circNIgn mixmer did not change circNIgn and Nlgn mRNA levels. **p<0.01 versus oligo (n=6); (B) Left, Cell cycle analysis showed that transfection with circNIgn mixmer promoted PDF cell cycle entry. **p<0.01 versus vector (n=6). Right, Representative images showed that transfection of circNIgn mixmer promoted PDF cell cycle entry; (C) The transfected PDFs were cultured in basal medium with H2O2 for 24 h. Transfection with circNIgn mixmer enhanced cell survival. **p<0.01 versus vector (n=6); and (D) Left, The transfected PDFs were cultured in serum-free DMEM medium for 3 days or in 500 pM H2O2 with basal medium for 12 h, and subjected to Annexin V staining followed by flow cytometry analysis. Transfection with circNIgn mixmer decreased apoptosis. **p<0.01 versus vector (n=6). Right, Representative images showed that transfection of circNIgn mixmer repressed cell apoptosis.

[0061] Figure 46 Association of circNIgn expression with epithelial-mesenchymal transition (EMT): (A) PDFs isolated from WT, circN Ign(-) and circNlgn(+) mice were cultured on 6-well culture dishes for 24 h. Representative images showed the morphology of the cells. The circNlgn(+) PDFs lost typically elongated mesenchymal shape, and displayed cuboidal epithelial structure; (B) The cells were subjected to RT-PCR. circNlgn(+) PDFs expressed higher levels of E-cadherin, but lower levels of N-cadherin and vimentin than the controls. **p<0.01 versus WT (n=6); (C) The cells were also subjected to Western blot. circNlgn(+) PDFs expressed higher levels of Nlgnl73 and E-cadherin, but lower levels of N-cadherin and vimentin than the controls. Subcellular fractionation showed that circNlgn(+) PDFs expressed higher levels of Nlgnl73 in nuclei than the controls; (D) PDFs were transiently transfected with oligo or circNIgn siRNAs and cultured for 24 h. Representative images showed that circNIgn siRNA-transfected cells displayed elongated mesenchymal shape; (E) The cells were subjected to RT-PCR. Silencing circNIgn repressed E-cadherin, but increased N-cadherin and vimentin expression. **p<0.01 versus oligo (n=6); (F) The cells were cultured in medium containing 50 pM H2O2 and 100 ng NE followed by Western blot. Silencing circNIgn decreased Nlgnl73 and E-cadherin, but increased N-cadherin and vimentin expression. Silencing circNIgn decreased Nlgnl73 in nuclei; (G) PDFs were transiently transfected with oligo or circNIgn mixmer and cultured for 48 h. Representative imagesshowed that mixmer-transfected cells displayed elongated mesenchymal shape; and (H) The cells were subjected to RT-PCR, showing that transfection of the mixmer repressed E- cadherin, and increased N-cadherin and vimentin expression levels. **p<0.01 versus oligo (n=6).

[0062] Figure 47 Inhibition of circNIgn translation modulated cell EMT: (A) HaCat cells were transfected with circNIgn and subjected to RT-PCR. Expression of circNIgn increased E- cadherin, but decreased N-cadherin and vimentin levels. **p<0.01 versus oligo (n=6); (B) HaCat and NIH3T3 cells were transfected with control vector and circNIgn, and subjected to Western blot. Expression of circNIgn repressed E-cadherin, but enhanced N-cadherin and vimentin expression; (C) Representative images of HaCat cells transfected with circNIgn siRNAs. Silencing circNIgn lost typical cuboidal epithelial morphology; (D) HaCat cells were transfected with circNIgn siRNAs, and subjected to RT-PCR. Silencing circNIgn decreased E- cadherin, but increased N-cadherin and vimentin expression. **p<0.01 versus oligo (n=6); and (E) HaCat and NIH3T3 cells were transfected with control oligo and circNIgn siRNAs. After cultured in serum-free DMEM with 100 pg NE for 24 h, the cells were lysated and subjected to Western blot. Silencing circNIgn increased E-cadherin, but decreased N- cadherin and vimentin levels.

[0063] Figure 48 Ectopic expression of circNIgn suppressed EMT in wound healing: (A) Representative IHC staining shows that circNlgn(+) mice exhibited increased E-cadherin, but decreased N-cadherin and vimentin in the wound tissues on Day 9; (B) Representative immunofluorescence staining demonstrates that circNlgn(+) mice exhibited increased E- cadherin, but decreased N-cadherin and vimentin in the wound on Day 9; (C) ImageJ analysis of the immunofluorescence staining reveals that circNlgn(+) mice exhibited increased E- cadherin, but decreased N-cadherin and vimentin levels in the wound tissues. **p<0.01 versus WT (n=6); (D) Upper, Representative images show chamber migration assays of circNlgn(+) PDFs after cells migrated for 5 h. Lower, circNlgn(+) PDFs showed repressed cell migration in chamber migration assays. **p<0.01 versus WT (n=6); and (E) circNlgn(+) PDFs displayed repressed cell migration in wound healing assays. **p<0.01 versus WT (n=6).

[0064] Figure 49 Expression of circNIgn repressed cell migration: (A) Cell migration was performed in wound healing assays. Representative images illustrate wound healing assaysof circNlgn(+) PDFs at indicated time points; (B) Upper, HaCat and NIH3T3 cells were transfected with control vector or circNIgn and subjected to chamber migration assays for 5 h. Representative images of cell migration are shown. Lower, Cell migration was also quantified. Expression of circNIgn repressed cell migration. **p<0.01 versus vector (n=6); (C) Upper, NIH3T3 fibroblasts were transfected with control vector or circNIgn, and subjected to wound healing assays. Expression of circNIgn repressed cell migration. **p<0.01 versus vector (n=6). Lower, Representative images of cell migration; and (D) Upper, HaCat cells were transfected with control vector or circNIgn, and subjected to wound healing assays. Expression of circNIgn repressed cell migration. **p<0.01 versus vector (n=6). Lower, Representative images of cell migration.

[0065] Figure 50 Silencing circNIgn promoted EMT in wound healing: (A) Representative IHC staining reveals that delivery of circNIgn siRNAs and mixmer repressed E-cadherin, but enhanced N-cadherin and vimentin expression in the wound tissues on Day 6; (B) - (D) Representative immunofluorescence staining demonstrates that delivery of circNIgn siRNAs and mixmer repressed E-cadherin (B), but increased N-cadherin (C) and vimentin (D) expression in the wounds on Day 6; and (E) ImageJ analysis of the immunofluorescence staining indicates that delivery of circNIgn siRNAs and mixmer repressed E-cadherin, but increased N-cadherin and vimentin expression in the wounds on Day 6. **p<0.01 versus WT (n=6).

[0066] Figure 51 Silencing circNIgn enhanced PDF migration: (A) Left, PDFs were transfected with control oligo or circNIgn siRNAs, and subjected to chamber migration assays. Silencing of circNIgn with siRNAs enhanced PDF migration. **p<0.01 versus oligo (n=6). Right, Representative images show cell migration of transfected cells; (B) Left, PDFs were transfected with control oligo or circNIgn mixmer and subjected to chamber migration assays. Transfection with mixmer enhanced PDF migration. **p<0.01 versus oligo (n=6). Right, Representative images of cell migration; (C) Left, PDFs were transfected with control oligo or circNIgn siRNAs, and subjected to wound healing assays. Silencing of circNIgn with siRNAs enhanced PDF migration. **p<0.01 versus oligo (n=6). Right, Representative images show cell migration of transfected cells; and (D) Left, The cells were also subjected to wound healing migration assays. Transfection with circNIgn mixmer enhanced PDF migration.**p<0.01 versus oligo (n=6). Right, Representative images of chamber cell migration.

[0067] Figure 52 Silencing circNIgn enhanced PDF migration: (A) Left, NIH3T3 and HaCat cells were transfected with control oligo or circNIgn siRNAs and subjected to chamber migration assays. Silencing circNIgn enhanced cell migration. **p<0.01 versus oligo (n=6). Right, Representative images of chamber cell migration; (B) Left, HaCat cells were transfected with control oligo or circNIgn siRNAs and subjected to wound healing assays. Silencing of circNIgn with siRNAs enhanced cell migration. **p<0.01 versus oligo (n=6). Right, Representative images of cell migration; and (C) Left, NIH3T3 cells were transfected with control oligo or circNIgn siRNAs and subjected to wound healing assays. Silencing of circNIgn with siRNAs enhanced cell migration. **p<0.01 versus oligo (n=6). Right, Representative images of cell migration

[0068] Figure 53 Expression of circNIgn repressed nuclear actin polymerization in wound healing: (A) PDFs isolated from WT and circNlgn(+) mice were subjected to subcellular fractionation and actin polymerization assays. Nuclear extracts from circNlgn(+) PDFs repressed actin polymerization; (B) PDFs were transfected with oligo or circNIgn siRNAs, and subjected to subcellular fractionation and actin polymerization assays. The nuclear extracts from circNIgn siRNA-transfected PDFs enhanced actin polymerization; (C) The cells from (A) above were subjected to subcellular fractionation and G / F-actin isolation. The circNlgn(+) PDFs expressed decreased F-actin in nuclei; (D) The cells from (B) above were subjected to G / F-actin fractionation. Silencing circNIgn increased F-actin in nuclei; (E) Representative immunofluorescence images show that circNlgn(+) mice exhibited decreased F-actin (red) but increased G-actin (green) in nuclei of the wound sections (epidermis) on Day 9; (F) ImageJ analysis detected no significant difference in expression of actin in the wound sections between WT and circNlgn(+) mice. (n=6); (G) ImageJ analysis showed that circNlgn(+) epidermis cells exhibited decreased F-actin but increased G-actin in nuclei of the wound sections. **p<0.01 versus WT (n=6); and (H) ImageJ analysis showed that circNlgn(+) dermis cells exhibited decreased F-actin but increased G-actin in nuclei of the wound sections. **p<0.01 versus WT (n=6).

[0069] Figure 54 circNIgn modulated nuclear actin polymerization in wound healing: (A) Representative immunofluorescence images show that circNlgn(+) mice exhibited decreased F-actin (red) but increased G-actin (green) in nuclei of the wound sections (dermis) on Day 9; and (B) Representative immunofluorescence staining showed that delivery of circNIgnsiRNAs or mixmer increased F-actin, but decreased G-actin levels in the nuclei of wound sections (dermis) on Day 6.

[0070] Figure 55 Silencing circNIgn enhanced nuclear actin polymerization in wound healing. (A) Representative immunofluorescence staining showed that delivery of circNIgn siRNAs or LNA Mixmer increased F-actin, but decreased G-actin levels in the nuclei of wound sections (epidermis) on Day 6. (B) ImageJ analysis showed that delivery of circNIgn siRNAs or LNA Mixmer did not change total F / G-actin levels in the wound sections. (n=6). (C) ImageJ analysis showed that delivery of circNIgn siRNAs or LNA Mixmer increased F-actin, but decreased G-actin levels in the nuclei of epidermis cells from the wound tissues. **p<0.01 versus oligo (n=6). (D) ImageJ analysis showed that delivery of circNIgn siRNAs or LNA Mixmer increased F-actin, but decreased G-actin levels in the nuclei of dermis cells from the wound tissues. **p<0.01 versus oligo (n=6). (E) Western blot showing decreased nuclear localization of |3-catenin and SMAD2 / 3 in the cardiac tissues of the circNIgn transgenic mice. (F) Western blot showing increased nuclear localization of Mybbpla, NKRF, and Mypop in the cardiac tissues of the circNIgn transgenic mice. (G) circNIgn decreased nuclear actin polymerization, with decreased levels of |3-catenin and SMAD2 / 3, and increased levels of Mybbpla, NKRF, and Mypop in the nuclei of wound tissues. Targeting circNIgn with siRNAs or LNA increased N-cadherin, and vimentin, but decreased E-cadherin in wound healing tissue.

[0071] Figure 56 Expression of circNIgn in prostate cancer. (A) High invasive prostate cancer patients express higher levels of circNIgn than low invasive patients. n=4, ** p<0.01. (B) Human prostate cancer cell lines (LNCaP, Dul45, and PC3) express higher levels of circNIgn than the normal prostate cell line BPHL. n=4, ** p<0.01.

[0072] Figure 57 Treatment with circNIgn decreases expression of the tumor suppressor PIAS3. Prostate cancer cells (PC3) were transfected with circNIgn construct and a control vector. Transfection with circNIgn increased circNIgn levels (A), but did not affect parental Nlgn mRNA levels (B) relative to the transfection with vector and the un-transfected cells. Transfection with circNIgn decreased the levels of the tumor suppressor PIAS3 (C). n=6, ** p<0.01.

[0073] Figure 58 M ix me r treatment increases expression of the tumor suppressor PIAS3. Prostate cancer cells (PC3) were transfected with LNA Mixmer and siRNAs targeting circNIgn, or a control oligo. Transfection with siRNAs decreased circNIgn levels as expected (A). Transfection with LNA Mixmer did not affect levels of circNIgn (A) and Nlgn (B), suggesting no off-target effect. Transfection with Mixmer and siRNAs decreased levels of the tumor suppressor PIAS3 (C). n=6, ** p<0.01.

[0074] Figure 59 Mixmer treatment decreases prostate cancer cell invasion. Prostate cancer cells (PC3 and Dul45) were transfected with circNIgn (A) and siRNAs or LNA Mixmer targeting circNIgn (B). Transfection with circNIgn increased cell invasion activity (A).Transfection with siRNA and LNA Mixmer decreased cell invasion activity (B). n=6, ** p<0.01. Representative images of cell invasion are shown for PC3 cells (C) and Dul45 cells (D).

[0075] Figure 60 Mixmer treatment decreases prostate cancer cell proliferation and sphere formation. Prostate cancer cells (PC3 and Dul45) were transfected with circNIgn and siRNAs or LNA Mixmer targeting circNIgn. The transfected cells were subjected to cell proliferation assay (A-B) and sphere formation assay (C-F), mimicking tumor formation. Transfection with circNIgn promoted cell proliferation (A) and sphere formation (C and E), increasing the number of cells per sphere. Transfection with siRNA and LNA Mixmer decreased cell proliferation (B) and sphere formation (D and F). n=6, ** p<0.01. Typical images of spheres are shown for circNIgn (E) and siRNAs and LNA mixmer assays (F).DETAILED DESCRIPTION

[0076] Definitions

[0077] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0078] As used in the specification and claims, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise.

[0079] The term "comprising," which is synonymous with "including," "containing," or "characterized by," is open-ended and is used herein to mean that the list following is non- exhaustive and may or may not include any other additional suitable items or method steps, for example one or more further feature(s), component(s), step(s) and / or ingredient(s), as appropriate.

[0080] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

[0081] Reference throughout this specification to "one embodiment," "an embodiment," "another embodiment," "a particular embodiment," "a related embodiment," "a certain embodiment," "an additional embodiment," or "a further embodiment" or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics of each embodiment may be combined in any suitable manner in one or more embodiments.

[0082] The term "and / or" as used in a phrase such as "X and / or Y" herein is intended to include "X and Y", "X or Y", "X", and "Y".

[0083] The term "subject" as used herein includes all members of the animal kingdom including mammals, and suitably refers to humans.

[0084] The term "treating" or "treatment" as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectableor undetectable. "Treating" and "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. "Treating" and "treatment" as used herein also include prophylactic treatment. Treatment methods comprise administering to a subject a therapeutically effective amount of one or more compounds described in the application and optionally consists of a single administration, or alternatively comprises a series of applications. For example, the compounds described herein may be administered at least once a week, about one time per week to about once daily for a given treatment or the compound may be administered one, two, three or four times daily, for example twice daily. The length of the treatment period depends on a variety of factors, such as the severity of the disease, the age of the patient, the concentration, the activity of the compounds described herein, and / or a combination thereof. It will also be appreciated that the effective dosage of the compound used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. Changes in dosage may result and become apparent by standard diagnostic assays known in the art. In some instances, chronic administration may be required.

[0085] Circular RNAs (CircRNAs) have recently emerged as key regulators in disease development. Circular neuroligin RNA (circNIgn) is formed by back-splicing of the neuroligin gene. Translation of circNIgn produces a circular RNA-derived peptide (Nlgnl73) with a 9- amino-acid nuclear localization motif corresponding to translation of the junction sequence formed as a result of the back-splicing. The 9-amino-acid nuclear localization motif has the sequence of GYRPAANWI (SEQ ID NO:1), which corresponds to coding sequence adjacent to the junction within circNIgn, as illustrated in Figure 1.

[0086] This 9-amino acid motif binds to the structural protein LaminBl, which facilitates nuclear localization of Nlgnl73. Since the 9-amino acid motif is formed from the back- splicing and adjacent to the junction sequence of the circRNA, it is not found in the full- length neuroligin produced from the parent mRNA.

[0087] As described herein, circNIgn plays a crucial role in cardiac functioning, colitis development, and skin wound healing process by encoding the protein Nlgnl73.

[0088] The present application provides compounds, compositions and methods for inhibiting the translation of circNIgn, for example, for the treatment or prevention of conditions associated with increased expression of the circNIgn and / or presence of Nlgnl73. In some embodiments, these compounds, compositions and methods for inhibiting translation of circNIgn are for treatment or prevention of cardiac diseases or disorder, treatment or prevention of colitis, or for treating wounds and / or minimizing scar formation during wound healing.

[0089] Methods for inhibiting the expression of genes are known in the art and include, for example, antisense, RNAi and siRNA mediated approaches for targeting nucleic acids and thereby inhibiting expression. Such methods typically involve blocking translation of mRNAs. However, as noted above, a difficulty associated with using such methods for inhibiting translation of circRNAs is the potential for also inhibiting translation of parent mRNAs, with the resulting potential for off-target effects during therapy.

[0090] The present inventors have determined that targeting the junction sequence of circNIgn, acugaggauggauauagacc (SEQ ID NO:2), provides inhibition of circNIgn expression.

[0091] The present application further provides mixed base pair oligonucleotides ("mixmers") targeting the junction sequence of circNIgn that are effective in inhibiting translation of circNIgn. A mixmer is a type of antisense oligonucleotide comprising a mixture of RNA and DNA nucleotides. In some embodiments, the mixmer comprises a sequence of RNA or LNA (locked nucleic acid) and DNA nucleotides that is at least 80% complimentary with at least 10, at least 12, or from 12 to 14 consecutive nucleotides of SEQ ID NO:2. In some embodiments, the mixmer is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to at least at least 10, at least 12, or from 12 to 14 consecutive nucleotides of SEQ ID NO:2.

[0092] Complementary, as the term is used in the art, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a target nucleic acid (e.g., an RNA transcript, DNA strand), then the oligonucleotide and the target nucleic acid are considered to be complementary to each other at that position. Theoligonucleotide and the target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, "complementary" is a term which is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and its target nucleic acid. For example, if a base at one position of an oligonucleotide is capable of hydrogen bonding with a base at the corresponding position of a target nucleic acid, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.

[0093] The mixmer of the present application may be at least 80% complementary to (optionally one of at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid. In some embodiments the oligonucleotide may contain 1, 2 or 3 base mismatches compared to the portion of the consecutive nucleotides of a target nucleic acid. In some embodiments the oligonucleotide may have up to 3 mismatches over 15 bases, or up to 2 mismatches over 10 bases.

[0094] It is understood in the art that a complementary nucleotide sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or specific for a target nucleic acid. In some embodiments, a complementary nucleic acid sequence for purposes of the present disclosure is specifically hybridizable or specific for the target nucleic when binding of the sequence to the target nucleic acid (i.e., circNIgn) results in increased expression of a target gene and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target sequences under conditions in which avoidance of non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency.

[0095] In some embodiments, the mixmer is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In a preferred embodiment, the oligonucleotide is 10 to 20, or 10 to 15 nucleotides in length.

[0096] Base pairings may include both canonical Watson-Crick base pairing and non- Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U or T.

[0097] In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) or uridine (U) nucleotides (or a modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be replaced with any other nucleotide suitable for base pairing (e.g., via a Watson-Crick base pair) with an adenosine nucleotide. In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) or uridine (U) nucleotides (or a modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be suitably replaced with a different pyrimidine nucleotide or vice versa. In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be suitably replaced with a uridine (U) nucleotide (or a modified nucleotide thereof) or vice versa.

[0098] In some embodiments, GC content of the oligonucleotide is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs may not be preferable in some embodiments. Accordingly, in some embodiments, the oligonucleotide does not comprise a stretch of three or more guanosine nucleotides.

[0099] In a particular embodiment, the mixmer comprises or consists of a sequence of GT+CTA+TA+TCCAT+C (SEQ ID NO:3), where the nucleotides noted with a preceding "+" are LNA, and the remainder are DNA. However, there can be variation in the position of the LNA nucleotides within the mixmer. Also provided herein are mixmers that comprise or consist of a sequence that is at least 85%, 90%, 95%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:3.

[0100] In some embodiments, it has been found that mixmers disclosed herein may decrease translation of circNIgn by at least about 40%, or by at least about 45%, 50%, 55%, 60%, 65%, 70%, or 75% or any range between any of the foregoing numbers.

[0101] The mixmers described herein may be modified, e.g., comprise a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and / or combinations thereof. In addition, the mixmers may exhibit one or more of the following properties: are not immune stimulatory; are nuclease resistant; have improved cell uptake compared to conventional antisense oligonucleotides or siRNAs; are not toxic or have minimal toxicity to cells or mammals; or have improved endosomal exit.

[0102] Any of the mixmers disclosed herein may be linked to one or more other oligonucleotides disclosed herein by a linker, e.g., a cleavable linker.

[0103] Methods of Treatment

[0104] The present application further provides methods of treatment or prevention of a condition associated with increased levels of circNIgn and / or Nlgnl73, said method comprising administration of one or more mixmer targeting circNIgn to a subject in need thereof. Conditions associated with increased levels of circNIgn and / or Nlgnl73 include, but are not limited to, cancers, colitis and cardiovascular diseases and disorders.

[0105] In some embodiments, the method comprises administration of one or more mixmer, as described herein, to a subject for treatment or prevention of a cancer, where the expression of circNlgn / Nlgnl73 is upregulated in the cancer to be treated. An example of such a cancer that can be treated by the present method is prostate cancer, as described herein.

[0106] In some embodiments, the method comprises administration of one or more mixmer, as described herein, to a subject for improving cardiac function or for treatment or prevention of a cardiovascular disease or disorder. Examples of cardiovascular disorders treatable or preventable according to this method include, but are not limited to, cardiac hypertrophy, remodeling, cardiomyopathy, artery diseases, and myocardial infarction.

[0107] In some embodiments, the method comprises administration of one or more mixmer, as described herein, to a subject for treatment or prevention of colitis, for example, ulcerative colitis or acute ulcerative colitis.

[0108] In some embodiments, the method comprises administration of one or more mixmer, as described herein, to a subject for treatment of a wound and / or minimizing scar formation during wound healing.

[0109] In some embodiments, the method comprises administration of one or more mixmer, as described herein, (together or separately) in combination with one or more additional therapeutic agent.

[0110] Formulation

[0111] The mixmers described herein can be formulated in a composition for administration to a subject for treating a condition associated with increased levels of circNIgn and / or Nlgnl73. In some embodiments, one or more mixmer, as described herein, is formulated for administration to a subject for the treatment or prevention of a cardiac disease or disorder, treatment or prevention of colitis, or for treatment of a wound and / or minimizing scar formation during wound healing.

[0112] It should be understood that the formulations, compositions and methods can be practiced with any of the mixmers disclosed herein, or with an alternative antisense oligonucleotide or siRNA targeting the junction region of circNIgn, as described above.

[0113] The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., a mixmer as described herein) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g. tumor regression.

[0114] Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc. Such formulations can contain sweetening agents, flavoring agents, coloring agents and preserving agents.

[0115] A formulated oligonucleotide or mixmer composition can assume a variety of states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and / or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water). In another example, the mixmer or oligonucleotide is in an aqueous phase, e.g., in a solution that includes water. The aqueous phase or the crystalline compositions can, e.g., be incorporated into a delivery vehicle, e.g., an exosome, a liposome (particularly for the aqueous phase) or a particle (e.g., a nanoparticle or a microparticle) or conjugated to a particle (e.g., pegylated gold nanoparticles). Generally, the oligonucleotide or mixmer composition is formulated in a manner that is compatible with the intended method of administration.

[0116] In some embodiments, the composition is prepared by at least one of the following methods: spray drying, lyophilization, vacuum drying, evaporation, fluid bed drying, or a combination of these techniques; or sonication with a lipid, freeze-drying, condensation and other self-assembly.

[0117] A oligonucleotide or mixmer preparation can be formulated or administered (together or separately) in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide or mixmer, e.g., a protein that complexes with the oligonucleotide. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg2+), salts, RNAse inhibitors (e.g., a broad specificity RNAse inhibitor such as RNAsin) and so forth.

[0118] In some embodiments, the oligonucleotide or mixmer preparation is formulated or administered (together or separately) in combination with one or more additionaltherapeutic agent. In some embodiments, the oligonucleotide or mixmer preparation is formulated or administered (together or separately) in combination with one or more cardiac drugs for treatment or prevention of a cardiovascular disease or disorder. In some embodiments the one or more cardiac drug is a 0-blocker, such as, but not limited to carvedilol, bisoprolol, propranolol, metoprolol, and atenolol.

[0119] Route of Delivery

[0120] A composition that includes a mixmer or oligonucleotide can be delivered to a subject by a variety of routes. Exemplary routes include: intrathecal, intraneural, intracerebral, intramuscular, oral, intravenous, intradermal, topical, rectal, parenteral, anal, intravaginal, intranasal, pulmonary, or ocular. The term "therapeutically effective amount" is the amount of mixmer or oligonucleotide present in the composition that is needed to provide the desired level of inhibition of circNIgn translation in the subject to be treated to give the anticipated physiological response. The term "physiologically effective amount" is that amount delivered to a subject to give the desired palliative or curative effect. The term "pharmaceutically acceptable carrier" means that the carrier can be administered to a subject with no significant adverse toxicological effects to the subject.

[0121] The oligonucleotide molecules of the invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more species of oligonucleotide and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0122] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal,intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration. The route and site of administration may be chosen to enhance targeting.

[0123] In some embodiments, the mixmer or oligonucleotide is prepared in a pharmaceutical composition at a concentration of less than 5 mg / ml. In some embodiments, the oligonucleotide is prepared in a pharmaceutical composition at a concentration of greater than 50 mg / ml. In some embodiments, the oligonucleotide is prepared in a pharmaceutical composition at a concentration in a range of greater than 50 mg / ml to 500 mg / ml or more.

[0124] Kits

[0125] In certain aspects of the invention, kits are provided, comprising a container housing a composition comprising a mixmer or oligonucleotide as described herein. In some embodiments, the composition is a pharmaceutical composition comprising a mixmer or oligonucleotide and a pharmaceutically acceptable carrier. In some embodiments, the individual components of the pharmaceutical composition can be provided in one container. Alternatively, it can be desirable to provide the components of the pharmaceutical composition separately in two or more containers, e.g., one container for mixmers or oligonucleotides, and at least another for a carrier compound. The kit can be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.

[0126] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.EXAMPLES

[0127] EXAMPLE 1:

[0128] Abnormal expression of circRNAs has been found in cardiovascular disorders [2-4], This includes circRNAs that are commonly expressed in different tissues and circRNAs that are specifically expressed in the heart [5-8], Many cardio-specific circRNAs have been demonstrated to play crucial roles in cardiovascular disorders, including cardiac hypertrophy, remodeling, cardiomyopathy, artery diseases, and myocardial infarction [9- 11], As noted above, circRNAs that are highly differentially expressed, have high abundance in the tissue, and exert potent functions in disease development may serve as biomarkers for disease diagnosis and potential therapeutic targets for management of cardiovascular diseases [1,12,13],

[0129] It has been previously reported by the present inventors that transgenic expression of the cardiac specific circular RNA (circRNA) circNIgn promoted cardiac remodeling and fibrosis by upregulation of SGK3 and ING4 expression through a Nlgn isoform Nlgnl73 that was translated by circNIgn

[0017] , In the present Example, the inventors have created a Mixmer that specifically binds to the junction sequence of circNIgn to block its translation. Normally, pressure overload induces circNIgn expression, Nlgnl73 translation and nuclear localization. Treatment with the circNIgn Mixmer decreased Nlgnl73 translation, resulting in enhanced cardiac function, decreased expression of SGK3 and ING4, and reduced cardiac remodeling and fibrosis. These results are similar to what has been observed using siRNAs targeting SGK3 and ING4, which also resulted in enhanced cardiac function and decreased cardiac remodeling and fibrosis.

[0130] In this example, circNIgn translation and its biogenesis was targeted as a method for treatment of cardiovascular disorders.

[0131] Materials and Methods

[0132] Materials and Methods

[0133] Materials

[0134] Polyclonal antibody was raised in rabbits against junction peptide (GYRPAANWI) of Nlgnl73 by GenScript, and purified. The monoclonal antibodies against Nlgn (N-terminal, SC-365111) / cirNlgl73, ING4, SGK3 and p-S9-G K30 were obtained from Santa Cruz. The monoclonal antibodies against connexin 43, Ki67 and vimentin were obtained from Cell signaling. Horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse IgG, RNA RT and PCR kits were from Bio-Rad. Masson's Trichrome stain kit was from American MasterTech. RNA and DNA extraction kits were obtained from Geneaid. Western blot detection kit was from MilliporeSigma. Norepinephrine (NE), prazosin, metoprolol, ICI 118,511, dobutamine and clenbuterol were purchased from Sigma.

[0135] Constructs, siRNAs and primers

[0136] The plasmid containing full length human Nlgnl gene was obtained from Addgene. The plasmid used in this study contains a Bluescript backbone, one CMV promoter driving green fluorescent protein (GFP) expression, and another CMV promoter driving the circular RNA-forming fragments or a non-related sequence serving as a mock control. All the primers and siRNA sequences used are listed in Table 1 and Table 2.Table 1: Primer sequencesTable 2: siRNA sequences

[0137] Cell proliferation

[0138] Cells were cultured in 10% FBS basal medium on 12-well culture dishes (2xl04cells / well) at 37 °C and harvested daily or at indicated time points. The harvested cells were stained with Trypan Blue, and cell number was counted by a Coulter Counter under the inverted microscope. The cells were also cultured in basal medium containing 10% FBS in 96 wells (lxlO3cells / well) for indicated time, and cell viability was analyzed by MTT kit. Briefly, an equal amount of MTT solution was added to each well and incubated at 37°C for 3 h. 100 pL of MTT solvent was added to each well to dissolve the MTT formazan, and the plateswere read with spectrophotometer at OD=590 nm. A BrdU Cell Proliferation ELISA Kit (colorimetric, Roche) was also used to analyze cell proliferation as the product information sheet described.

[0139] Cell survival assays

[0140] Cells were cultured in 10% FBS basal medium in 12-well culture dishes (5xl04cells / we II) and maintained at 37 °C for 16 h. The medium was replaced with serum-free DMEM or 10% FBS basal medium containing H2O2. Cells were harvested daily or at indicated time points. The harvested cells were stained with Trypan Blue, and cell number was counted by a Coulter Counter under the inverted microscope.

[0141] Cells were also cultured in 96 wells (5xl04cells / well) with serum-free medium or 10% FBS basal medium containing FhC for indicated time points, and cell viability was analyzed by MTT kit as described above.

[0142] Annexin-V assays

[0143] Cells were cultured in basal medium and maintained at 37 °C for 24 h. After cell attachment, the medium was replaced with serum-free DMEM or 10% FBS basal medium containing H2O2 or indicated chemicals. Cells were harvested at specific time points, and subjected to the cell apoptosis analysis detected by Annexin V-APC apoptosis detection kit (Cat# 88-8007-72, Thermo Fisher Scientific). Briefly, cells were harvested and resuspended in binding buffer, incubated in Annexin V-APC and propidium iodide solutions for 30 min. Annexin V-APC binding cells were analyzed by flow cytometry.

[0144] Cell cycle analysis

[0145] Cells were harvested, resuspended, and incubated in ice-cold 70% ethanol for 2 h. After washed in PBS, the resuspended cells were incubated in propidium iodide (PI) master mix (20 mg / ml) at 37 °C for 30 min. The percentage of S and G2 population cells was analyzed with flow cytometry.

[0146] Western blotting

[0147] Cells or tissues were lysed and processed to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) containing 7-12% acrylamide. Transblotting was processed onto a nitrocellulose membrane in lxTris / glycine buffer containing 20% methanol at 60-V at 4°C for 2-4 h. The membrane was blocked in a buffer containing 10 mM Tris-CI, pH 8.0, 150 mM NaCI, 0.05% Tween-20, and 5% non-fat dry milk powder for 0.5 h, and then incubated with primary antibodies at 4°C overnight. The membranes were washed with the above buffer 3x30 min and then incubated with secondary antibodies for 1.5 h. After extensive washing, the bound antibodies were visualized with an ECL detection kit.

[0148] Immunofluorescence staining

[0149] Cells cultured on BD culture slides were fixed for 20 min in 3.7 % formaldehyde solution, blocked with 10% goat serum, and then incubated with primary antibody in PBS containing 10% goat serum overnight. The slides were washed and incubated with Alexa Fluor™ 488, 555 or 647 secondary antibodies at room temperature for 2 h. DAPI (4',6- diamidino-2-phenylindole) was used to stain DNA. Images of the staining samples were performed using Zeiss Z1 Axio™ confocal laser scanning microscopy.

[0150] Fluorescence in situ Hybridization (FISH)

[0151] In the in-situ hybridization (FISH), Alexa Fluor™ 488 or 555 labeled DNA oligo probes against circNIgn were generated by fluorescence PCR labeling kit from Biolynx. The labeled probes were heated at 95°C for 2 min and chilled on ice before using. A scrambled sequence labeled with the fluorescent dye was used as a negative control. The fixed samples were dehydrated by washing for 1 min in 60% ethanol, 95% ethanol and 100% ethanol, and then pretreated with hybridization solution at 55 °C for 30 min. Slides were incubated with 100 nM fluorescently labeled DNA oligo probes in hybridization buffer at 55 °C for 4 h followed by serial washes with saline-sodium citrate (SSC) buffers.

[0152] Cardiac fibrosis staining

[0153] Masson's Trichrome stain was performed with Masson's Trichrome stain kit from American MasterTech.

[0154] In Sirius red staining, the heart sections were de-waxed with xylene and hydrated with ethanol, and stained with Weigert's hematoxylin for 5 minutes. After washed with running tap water for 30 mins, the slides were stained in 0.1% picrosirius red for 1 h and washed with 0.1% acetic acid.

[0155] Immunohistochemistry staining (IHC)

[0156] Heart sections were de-paraffinized with xylene and hydrated with ethanol, and then boiled in a pressure cooker. After extensive wash with Tris-Buffered-Saline (TBS) containing 0.01% Triton X-100, the sections were incubated with 10% goat serum and then with the primary antibody dissolved in TBS containing 10% goat serum overnight. The slides were washed extensively and labeled with biotinylated secondary antibody, followed by avidin conjugated horseradish peroxidase provided by the VECTASTAIN™ ABC kit, and DAB (3,3'- diaminobenzidine). Mayer's Hematoxylin was used for counter staining.

[0157] RT-PCR and real-time PCR

[0158] Tissues or cells were harvested, and total RNA was extracted with the RNA mini kit (Cat# GZXD200, Geneaid). Real-time PCR was performed with SYBR Green PCR Kit (Cat# 1725120, Bio-Rad) using 2 pl cDNA as a template with two appropriate primers.Thermocycler conditions were 35 cycles of denaturation at 95 °C for 15 seconds, annealing at 56 °C for 10 seconds and extension step of 72 °C for 5 seconds. The AACT method was used to quantify all the relative mRNA levels using small nuclear RNA U6 as the reference and internal control.

[0159] Isolation of primary mouse cardiomyocytes (PCMs) and cardiac fibroblasts (PCFs)

[0160] Isolation of PCMs and PCFs from neonatal and adult mice was performed as described [52,53], Briefly, mice were heparinized, anaesthetized and sacrificed. After washing in the PBS with 20 mM BDM, the mouse heart was transferred into a drop of HEPES-buffered Tyrode's solution containing (mM): 130 NaCI; 5.4 KCI; 1 CaCL; 1 MgCL; 0.33 NazHPOzi; 10 HEPES; 5.5 glucose (pH 7.4) and minced into small pieces. The fragments were incubated in 25 ml Tyrode's solution (containing 0.012 g Collagenase D, 0.009 g Collagenase B, and 0.001 g Protease XIV from Streptomyces griseus) at 37 °C for 20 min. The digestedproducts were centrifuged at 600 rpm for 5 mins. Cell pellet was resuspended in DMEM / F12 medium with 10% FBS and incubated in cell culture dish for 2 h. This pre-plating step isolated PCFs, and the non-adherent cells were transferred to a cell culture dish coated with 1% gelatin solution to isolate PCMs.

[0161] Animal model

[0162] All the animal experiments were performed in accordance with the guidelines and regulations approved by the Animal Care Committee of Sunnybrook Research Institute. The circNIgn-transgenic mouse model was generated by the Toronto Centre for Phenogenomics (TCP) with pronuclear microinjection of circNIgn containing DNA fragment into C57BL / 6J.

[0163] Pressure-overload (PO) heart model was performed by modified transverse aortic constriction (TAC) in mice as previously described. Successful operation of TAC in the mice was confirmed by measuring the carotid artery flow velocities by Doppler, and those with a right carotid (RC) / left carotid (LC) flow ratio within a certain range (>5) were included for further experiments. The sham group mice underwent surgery at the same time points with the similar process of anesthesia and other operation except aortic banding.

[0164] 8-week-old C57BL6 mice were processed to TAC, and injected intraperitoneally with the plasmids of control oligo, circNIgn Mixmers (50 pg / each) or SGK3 and ING4 siRNAs (5 pg / each) for 12 weeks. The oligo, Mixmers or siRNAs were conjugated with PEG and AU NP that formed complexes before injection. Synthesis of the delivery complexes (plasmid-PEG- Au NP) was performed as previously described

[0054] , 12 weeks after injection, all the mice were sacrificed following cardiac function assessment. Heart samples were harvested, half kept frozen for PCR or processed to obtain frozen sections, and the other half were fixed with 10% buffered formalin and embedded in paraffin.

[0165] Cardiac function assessment

[0166] Mice were anesthetized with 2% isoflurane inhalation prior to undergoing transthoracic echocardiography. Transthoracic echocardiography was conducted and analyzed in a double-blinded manner, using a Vevo 2000 high-resolution imaging system equipped with a 40-MHz transducer to measure left ventricular end systolic diameter(LVESD), left ventricular end diastolic diameter (LVEDD), left ventricular fractional shortening (LVFS), left ventricular ejection fraction (LVEF), and dp / dt.

[0167] Statistical analysis

[0168] Data were presented as mean with standard deviation (SD, whisker). For multiple group analyses, a one-way ANOVA followed by a Bonferroni post hoc test for one independent variable, and a two-way ANOVA followed by a Bonferroni correction for two independent variables were performed. A two-tailed unpaired Student's t test was performed to assess the difference between the two groups with a single independent factor. All the in vitro experiments were repeated at least three times, except otherwise described. Prism 8 (GraphPad Software: La Jolla, CA) was used for the statistical analyses and the differences were considered statistically significant when nominal p<0.05 or adjusted p<0.05 in case of multiple testing.

[0169] Results

[0170] Targeting circNIgn represses cardiac functions and fibrosis

[0171] A previous study by the present inventors showed that circNIgn played roles in the development of cardiac fibrosis in the circNIgn transgenic mice

[0017] , In the present Example, the inventors aimed to develop strategies to improve cardiac function by reducing cardiac remodeling and fibrosis in normal mice. C57BL6 mice of 8-week-old were subjected to pressure overload (PO) by transverse aortic constriction (TAG) surgery. Over time, this lead to decreased cardiac functions and remodeling. It was confirmed that circNIgn was upregulated in the heart tissues of PO mice, and the translated protein Nlgnl73 was mainly detected in the nuclei (Figure 2A, full panel of the staining is provided in Figure 3). Colocalization of Nlgnl73 with Connexin 43, a marker of cardiomyocytes, and vimentin, a marker of cardiac fibroblasts, was also detected (Figure 2B).

[0172] The TAC mouse model was used to target circNIgn by delivering circNIgn siRNAs. While PO mice displayed increased levels of circNIgn and its translated protein Nlgnl73, the delivery of circNIgn siRNAs prevented the increased levels of circNIgn and Nglnl73 induced in PO mice (Figure 2C). The heart tissues were subjected to Western blotting. Whileexpression of Nlgnl73, SGK3, and ING4 increased in the PO mouse heart, silencing circNIgn abolished the expression of these molecules (Figure 2D).

[0173] To test the effect of endogenous circNIgn on remodeling and fibrosis, the TAG mice were injected intraperitoneally with circNIgn Mixmer twice per week to inhibit circNIgn translation. Echocardiographic analysis of the mouse heart showed increased left ventricular chamber in the PO mice that was decreased in the mice treated with the Mixmer (Figure 4A). HE staining confirmed this observation (Figure 4A).

[0174] RT-PCR measurement showed significant increase in circNIgn expression that was not affected by the Mixmer treatment (Figure 4B). Functional analysis by echocardiography showed that the PO mice displayed decreased left ventricular pressure (dp / dt), which could be prevented by delivery of the circNIgn Mixmer (Figure 4C). The PO mice showed increased left ventricular end-systolic diameter (LVESD) and left ventricular end-diastolic diameter (LVEDD), resulting in decreased LVEDD-LVESD in echocardiography, which could be prevented by delivery of a circNIgn Mixmer (Figure 4D). A significant decrease in left ventricular fractional shortening (LVFS) and left ventricular ejection fraction (LVEF) was also detected in the PO hearts, and such reductions were prevented by the delivery of the circNIgn Mixmer (Figure 4E).

[0175] Nuclear translocation of the circNIgn translated peptide Nlgnl73 has been previously detected

[0017] , The nuclear Nlgnl73 activates the expression of SGK3 and ING4. The effect of the circNIgn Mixmer on SGK3 and ING4 expression tested. Real-time PCR showed increased SGK3 and ING4 levels in the PO mice which could be prevented by the delivery of a circNIgn Mixmer (Figure 4F).

[0176] Cardiac fibrosis was then examined. The mouse hearts were subjected to Masson's trichrome and Sirius red staining to observe cardiac fibrosis (Figure 4G), followed by quantitation (Figure 4H). While PO mice displayed increased staining intensity, delivery of the circNIgn Mixmers prevented the increased staining induced in PO mice, which was indicative of a role of the circNIgn Mixmers in preventing cardiac fibrosis. The tissues were also subjected to real-time PCR. The PO mice showed increased levels of collagen-l and collagen-ll I, which could be prevented by delivery of the circNIgn Mixmer (Figure 41).

[0177] Decreased cardiac fibrosis by siRNAs targeting SGK3, ING4, and LaminBl

[0178] In the circNIgn-transgenic mice, upregulation of SGK3 and ING4 associated with enhanced cardiac remodeling and fibrosis was detected in the transgenic mice relative to the wildtype mice

[0017] , In the current Example, targeting SGK3 and ING4 was examined as an approach to improve cardiac function by reducing cardiac remodeling and fibrosis in the normal mice that had been subjected to pressure overload (PO). The mouse strain C57BL6 were subjected to PO at the age of 8-week, followed by intraperitoneal injection with control oligo and siRNAs targeting SGK3 or / and ING4 (5 pg / each, twice / week) for 12 weeks. The mice underwent echocardiography, and the whole hearts were used for H&E (Hematoxylin and Eosin) staining. While pressure overload caused hypertrophy, silencing SGK3 and ING4 relieved the effect of PO (Figure 5A). Echocardiography analysis showed decrease in left ventricular pressure (dp / dt) in the PO mice: silencing SGK3 and ING4 increased dp / dt significantly compared with the oligo control (Figure 5B). Increased left ventricular end-systolic diameter (LVESD), increased left ventricular end-diastolic diameter (LVEDD), and decreased LVEDD-LVESD were detected in the PO mice, while silencing SGK3 and ING4 produced opposite effects (Figure SC). Also observed was a significant decrease in left ventricular ejection fraction (LVEF, Figure 5D) and left ventricular fractional shortening (LVFS, Figure 5E) in the PO mice compared to the oligo control. The decrease was partially reversed by silencing SGK3 and ING4. The effects of SGK3 and ING4 siRNAs were confirmed by measuring the mRNA levels of SGK3 and ING4: treatment with SGK3 and ING4 siRNAs decreased SGK3 and ING4 levels significantly (Figure 5F), but had no effect on circNIgn levels (Figure 5G). The heart tissues were then stained with Sirius red and Masson's trichrome to examine tissue fibrosis. While PO enhanced Sirius red and Masson's trichrome, delivery of the siRNAs targeting SGK3 and ING4 abolished the PO effect (Figure 5H), significantly (Figure 51). Consistent with these results were the observations that PO increased collagen-l and collage n-l 11 levels significantly that was abolished by treatment with the siRNAs targeting SGK3 and ING4 (Figure 5J).

[0179] Since cardiac fibroblasts play crucial roles in cardiac fibrosis, primary cardiac fibroblasts (PCF) were isolated from circNIgn transgenic and wildtype mice. A previous study by the inventors showed that the circNIgn translated protein Nlgnl73 translocation into the nuclei was mediated by LaminBl

[0017] , The PCF were treated with siRNAs targeting LaminBl.While silencing LaminBl had no effect on Nlgnl73 levels (Figure 6A, upper), Nlgnl73 levels decreased in nuclei (Figure 6A, middle) but increased in cytosol (Figure 6A, lower). Silencing LaminBl also decreased expression levels of ING4, SGK3, and p-s9-GSK30. Primary cardiac fibroblasts were isolated from the normal mice with or without PO and these cells were treated with siRNAs targeting LaminBl. While silencing LaminBl had no effect on circNIgn expression (Figure 6B), it decreased the levels of collagen-l and collagen-ill (Figure 6C), SGK3 and ING4 (Figure 6D). This resulted in enhanced cell proliferation (Figure 6E) and decreased expression of fibrosis markers including fibronectin and vimentin (Figure 6F).

[0180] Beta-blockers prevent fibrotic effect of circNIgn induced by norepinephrine (NE).

[0181] Norepinephrine (NE) functions as a hormone and a neurotransmitter. It can increase heart rate, blood pressure, and blood flow to the body. The effect of NE on circNIgn expression and function was tested. To test the relationship between circNIgn and NE, endogenous circNIgn was silenced in the cells treated with NE. PCFs were cultured in serum- free medium with or without 10 pM NE for 3 days. It was found that treatment with NE increased circNIgn and Nlgn pre-mRNA levels, but had little effect on Nlgn mature mRNA expression (Figure 7A).

[0182] PCFs cultured in basal medium treated with NE displayed enhanced cell proliferation and cell cycle progression relative to the untreated cells (Figure 7B). We also isolated primary cardiomyocytes (PCM) and treated the cells with NE in serum-free medium. In contrast to PCF, PCM treated with NE displayed decreased cell survival and increased apoptosis (Figure 7C, Figure 8A). Cell lysates were harvested from PCMs and PCFs cultured in the medium treated 10 pM NE and subjected to immunoblotting. NE treated cells showed increased Nlgnl73, SGK3, p-S9-GSK3|3 and ING4 in both the cell types (Figure 7D).

[0183] PCF were transfected with circNIgn siRNAs, and cultured in basal medium treated with NE. After confirming the silencing of circNIgn with siRNAs (Figure 8B), decreased proliferation (Figure 7E) and cell cycle progression (Figure 8C-D) of PCF was detected in the siRNA-transfected cells. The cells also showed decreased expression of fibrotic markers including collagen-l, collagen-l 11, fibronectin, and vimentin (Figure 7F), and decreased expression of Nlgnl73 (Figure 9A). On the other hand, PCM whose expression of circNIgnwas also promoted by NE (Figure 9B), displayed enhanced survival when transfected with circNIgn siRNAs and cultured in serum-free medium (Figure 9C). Both PCMs and PCFs transfected with circNIgn siRNAs were subjected to RT-PCR that showed decreased expression of SGK3 and ING4 (Figure 9D).

[0184] The effects of 0-blockers in mediating circNIgn function was also tested. PCFs were cultured in basal medium supplemented with NE, a-blocker Prazosin, 01 blocker Metoprolol, 02 blocker ICI118551, 01 agonist Dobutamine, and 02 agonist Clenbuterol for 24 h. RT-PCR showed that both NE and 01 agonist promoted circNIgn expression in the PCFs. Delivery of 0 blockers prevented NE-enhanced expression of circNIgn (Figure 7G) and increased cell viability (Figure 7H). PCFs treated with 0-blockers displayed decreased cell cycle progression (Figure 10A), cell proliferation (Figure 10B), and expression of fibrosis markers (Figure 10C).

[0185] Since stress such as pressure overload induces circNIgn expression and decreased cardiac functions, it was tested whether 0-blockers were able to relieve the effects of stress. In cell models, it was confirmed that when PCFs were cultured in serum-free medium, or treated with H2O2, Doxorubicin, and Ceramide, the expression of circNIgn was increased but the levels of mature Nlgn were not affected (Figure 11A). NE and H2O2 showed additive effect on expression of circNIgn and Nlgnl73 in PCFs (Figure 11B-D) and PCMs (Figure 12A). This resulted in increased cell survival (Figure 12B) and decreased cell apoptosis (Figure 12C- D). The additive effect of both NE and H2O2 appeared to be upstream of circNIgn expression, since treatment with siRNAs targeting circNIgn significantly decreased circNIgn levels but had no effect on linear Nlgn mRNA expression (Figure 12E). In the next study it was tested whether 0-blockers were able to override the effect of NE and H2O2. PCFs and PCMs were cultured with or without H2O2 and NE treatment, in the presence or absence of 0-blockers. While both PCFs and PCMs displayed increased expression of circNIgn, SGK3, and ING4 upon treatment with NE and H2O2, inclusion of the 0-blockers completely abolished the effects of NE and H2O2 (Figure 13A-B). As a consequence, the addition of 0-blockers prevented the effects of NE and H2O2 on cell survival and apoptosis (Figure 13C-D).

[0186] Next the effect of NE in vivo was examined. Eight-week-old C57BL6 mice were intraperitoneally injected with 1.5 mg / kg NE in ascorbic acid saline twice daily. The mice alsounderwent oral administration of 0-blockers carvedilol and bisoprolol (10 mg / kg) daily for 15 days. Echocardiographic analysis of the mouse hearts detected increased hypertrophy in the mice injected with NE, but oral administration of the blockers decreased NE's effect (Figure 14A). H&E staining showed cardiac hypertrophy in the NE-injected mice, which was prevented by 0 -blocker carvedilol and bisoprolol. Echocardiography showed that injection of NE did not significantly change the levels of LVEDD-LVESD, LVEF, and LVFS in the mouse hearts treated with NE and 0-blockers (Figure 14B). However, injection of NE increased mouse heart interventricular septum (IVS, Figure 14C), and left ventricle posterior wall (LVPW, Figure 14D) which was prevented by oral administration of carvedilol and bisoprolol. Interestingly, carvedilol was found to have a significantly stronger effect of than bisoprolol in reducing the levels of IVS (Figure 14C). The heart tissues were lysed and subjected to RT- PCR. Injection of NE promoted circNIgn expression in the heart tissues, which was prevented by oral administration of carvedilol and bisoprolol (Figure 14E). Again, carvedilol provided a significantly stronger effect than bisoprolol in reducing the levels of circNIgn. There appeared a strong correlation between circNIgn expression and IVS.

[0187] Beta-blocker prevented PO-induced circNIgn expression, decreased cardiac function and fibrosis.

[0188] The pressure overload mouse model was employed to test the effect of 0-blockers on mediating circNIgn function. Regular C57BL6 mice were subjected to PO followed by oral administration of 0 -blockers carvedilol and bisoprolol daily, or intraperitoneally injected with circNIgn conjugated with PEG and AuNP for 8 weeks. At the end of the study, echocardiography images showed that the PO-induced cardiac hypertrophy, which was significantly reversed by treating the mice with b-blockers carvedilol and bisoprolol (Figure 15A). While delivery of the 0 -blockers prevented PO-induced decreased dp / dt, carvedilol appeared to function significantly better than bisoprolol (Figure 15B). Interestingly, ectopic delivery of circNIgn overrode the effect of carvedilol. In the measurement of LVEDD and LVESD, it was also found that the 0-blockers carvedilol and bisoprolol reversed the effect of PO, and carvedilol exerted stronger effect than bisoprolol, which was completely abolished by ectopic delivery of circNIgn (Figure 15C). Carvedilol also functioned significantly better than bisoprolol in improving cardiac functional parameters LVEF and LVFS, which were again abolished by the delivery of circNIgn (Figure 15D). circNIgn expression was measured and itwas found that carvedilol showed significantly stronger effect on decreasing circNIgn expression in the PO mice than bisoprolol (Figure 15E).

[0189] The heart sections were subjected to H&E staining, Sirius red and Masson's trichrome staining. It was confirmed that delivery of carvedilol and bisoprolol prevented heart hypertrophy and fibrosis induced in the PO mice (Figure 16A). Quantitation of fibrosis stained by Sirius red and Masson's trichrome showed significant decreases in the carvedilol delivered mice relative to the mice delivered with bisoprolol (Figure 16B). Delivery with carvedilol and circNIgn completely abolished carvedilol's effect. In the measurement of levels of collagen-l and collagen-ill mRNAs, delivery with carvedilol and bisoprolol decreased PO-induced increase in the expression of collagen-l and collagen-ill mRNAs (Figure 16C), in which carvedilol showed significant decrease in the fibrotic markers relative to bisoprolol. Combination of carvedilol with circNIgn abolished carvedilol's effect completely, suggesting downstream signal of circNIgn compared with carvedilol. To test different effects of carvedilol and bisoprolol, MCF cells were treated with NE combined with carvedilol or bisoprolol. While carvedilol affected levels of Nlgn pre-mRNA and circNIgn, bisoprolol only affected circNIgn levels (Figure 16D). This suggests that carvedilol affected transcription and circularization, while bisoprolol only affected circNIgn circularization. These effects of 0- blockers resulted in decreased levels of circNIgn and Nlgnl73, thus enhancing cardiac function by reducing cardiac remodeling and fibrosis (Figure 16E).

[0190] Discussion

[0191] Dysregulation of circular RNA expression has been reported in myocardial development and diseases [17,28,29], Differential expression of circRNAs is correlated with cardiovascular diseases, and may serve as target for therapeutics [9,30-32], For the down regulated circRNAs, it is possible to deliver nanoparticle-conjugated circRNA expression vectors such as plasmids and adeno-associated viruses (AAV) to compensate for the functions of the circRNAs [5,29,33], Conjugation with gold nanoparticles has been shown to successfully deliver the expression constructs in cardiovascular mice model and mice bearing tumors [34-36], For the upregulated circRNAs, it has been reported to knockdown the circRNAs by RNAi including siRNAs and shRNAs [10,37,38], CRISPR-Casl3 system and circular antisense circRNA can also effectively suppress the functions ofcircRNAs [29,39]- Recent studies have shown that RNA therapy is a rapidly advancing field that holds great promise to treat different diseases including cardiovascular diseases and genetic disorders [2,27,40-42],

[0192] The present study shows successful delivery of siRNAs targeting circNIgn, siRNAs targeting SGK3 and ING4 in the pressure overload mouse model. Significantly improved heart functions were obtained in the siRNA model mice. Consistent with these results was the decrease in cardiac hypertrophy and fibrosis in the normal mouse models. These models can serve as tools in pre-clinical application for therapeutic potential in RNA therapy.

[0193] Unlike linear RNAs, circRNAs were initially thought to be non-translatable because they lack a 5' cap structure for translation initiation and a poly(A) tail for translation termination. Recent studies have shown that some circRNAs can encode proteins through cap-independent translation by using internal ribosome entry sites (IRESs) or other non- canonical mechanisms [16,19,43], There are a limited number of circRNAs that can be translated. Translation of a circRNA depends on the abundance of the circRNA and its specific elements that regulate translation initiation. Some circRNA-encoded proteins are present at relatively high levels and the encoded proteins can be detected endogenously without ectopic overexpression of the circRNAs

[0016] , The circRNA circNIgn is expressed at high abundance in cardiac tissue upon pressure overload, whereas the linear full-length Nlgn mRNA is undetectable. Consistently, the encoded protein Nlgnl73 is detected at high levels in the nucleus. This has allowed the targeting of circNIgn translation by Mixmers to improve cardiac function and decrease cardiac remodeling and fibrosis. As the Mixmer is highly specific and efficient, it can be useful in therapeutic applications for reducing heart rate and blood pressure to improve cardiac function and reduce cardiac fibrosis.

[0194] Norepinephrine (NE) is a hormone produced by the adrenal glands and neurons serving as a neurotransmitter. NE has a wide range of functions in physiological processes

[0044] , It plays a key role in modulating cardiovascular function, including blood flow, heart rate, and blood pressure

[0045] , When NE is released, it binds to adrenergic receptors on cardiac muscle cells. This will increase conduction velocity leading to increased contractility and heart rate, and increased cardiac output. NE also functions in the smooth muscle cells in blood vessels, leading to narrowing of the blood vessels (vasoconstriction) and increasingblood pressure

[0046] , Although this effect appears similar to pressure overload, the increase in NE levels only transiently enhances circNIgn expression, and it would not cause development of cardiac disease. On the other hand, the present example showed that pressure overload consistently causes increased expression of circNIgn, leading to cardiac remodeling, impaired cardiac function and fibrosis. This appears to be similar to patients with long-team high blood pressure and increased heart rate. Thus, targeting circNIgn is relevant to clinical conditions. The present results showed that P-blockers were able to reduce the levels of circNIgn.

[0195] Beta-blockers are medications that are commonly used to treat variety of heart conditions

[0047] , They work by blocking the effects of the hormone adrenaline and regulating the effect of NE on the 0-adrenergic receptors in the heart. In general, P-blockers enhance cardiac function by reducing oxygen demand in the heart, decreasing the heart rate, lowering blood pressure, improving left ventricular function, and avoiding arrhythmias [48,49], There are numerous P-blockers that have been approved for clinical use, and many new P-blockers have been developed, and are being developed, and studied. The commonly used P-blockers include carvedilol, bisoprolol, propranolol, metoprolol, and atenolol. Amongst these P-blockers, carvedilol and bisoprolol have been successfully used in animal models to mimic patient conditions.

[0196] Carvedilol is one of the non-selective P-blockers that inhibits the activities of P-1, P- 2, and a-1 adrenergic receptors

[0050] , This results in decreased blood pressure, heart rate, and cardiac output, making it an effective intervention for hypertension and heart failure. Carvedilol has antioxidant properties and protects the heart from oxidative stress. In contrast, bisoprolol is a selective P-1 blocker in the heart

[0051] , Although it can reduce heart rate and cardiac output, it has less effect on blood pressure than carvedilol. In addition, bisoprolol does not have alpha-blocking activity or antioxidant properties. The results in this example showed that carvedilol was significantly more effective in decreasing circNIgn expression than bisoprolol in the PO model. Thus, carvedilol showed significantly higher activity in improving cardiac function, reducing cardiac remodeling and fibrosis than bisoprolol. These results appear to be due to the non-specific effect of carvedilol. Indeed, it was found that carvedilol functioned in both transcription of Nlgn pre-mRNA and splicing ofcircNIgn, while bisoprolol only functioned in the regulation of splicing / circularization step producing circNIgn.

[0197] EXAMPLE 2: Nlgnl73aa encoded by circNIgn promotes ulcerative colitis via suppressing nuclear actin polymerization

[0198] Colitis is a chronic bowel disease that predominantly affects the colon and rectum, characterized by inflammation that leads to damage in the intestinal lining. This complex ailment results from a confluence of factors, including genetic predisposition, environmental influences, the composition of the intestinal microbiota, and aberrant immune responses. Despite substantial knowledge about these contributing elements, the precise etiology of colitis remains elusive. A vital element in maintaining the integrity of the intestinal barrier is the single cell layer that separates the gut lumen from the underlying tissue [58,59], Alterations in the function and structure of these epithelial cells are strongly implicated in the development of colitis. Actin, a highly conserved molecule, serves as a major component of the cytoskeleton and plays a pivotal role in regulating the dynamics of epithelial cells [60- 62], Actin dynamics encompass both polymerization and depolymerization processes in the cytoplasm and nucleus.

[0199] While actin dynamics are most commonly associated with its cytoplasmic functions, it also exerts crucial control in the nucleus, influencing gene expression and chromatin remodeling. This influence is mediated by interactions between actin and various nuclear proteins, including transcription factors and chromatin modifiers [63-65], Polymerization of actin in the nucleus results in the binding of actin to actin-binding protein 2 / 3 (Arp2 / 3 complex), consequently enhancing processes such as gene transcription

[0066] , DNA repair

[0067] , and chromatin remodeling [69,70], Arp2 / 3 complex controls actin nucleation and branching filament assembly in actin polymerization. Increased nuclear F-actin levels promote overall transcription levels

[0071] , whereas reduced levels suppress the expression of specific genes

[0072] , Nuclear actin polymerization is a key regulator of various cellular processes, including tissue repair and regeneration. Upon injury or tissue damage, nuclear actin is activated to polymerize, initiating gene expression, structural remodeling, cellproliferation, migration, and differentiation, ultimately leading to tissue repair and regeneration. However, the precise mechanisms that govern the initiation of nuclear actin polymerization remain enigmatic.

[0200] In this Example the inventors have shown that circular RNA circNIgn plays roles in the modulation of nuclear actin polymerization. The present study involved the profiling of circRNA expression in human colitis samples, with circNIgn emerging as one of the most significantly up-regulated circRNAs. Building on the inventor's prior research, which demonstrated the translation of circNIgn and the translocation of the encoded protein Nlgnl73 into cell nuclei, further details have now been found regarding the role of Nlgnl73 in decreasing nuclear actin polymerization and impairing epithelial renewal.

[0201] Transgenic mice expressing circNIgn exhibited heightened susceptibility to colitis development and progression, primarily attributed to the presence of the protein isoform Nlgnl73 encoded by circNIgn. Nlgnl73 undergoes translocation into cell nuclei, where it interacts with actin, impeding the binding of Actin-Related Protein 2 and 3 (Arp2 / 3) complex to actin molecules. Consequently, this leads to a reduction in actin polymerization. Mechanistically, Nlgnl73 enhances tyrosine-53-phosphorylation of nuclear actin, diminishing its capacity to interact with the Arp2 / 3 complex and causing a decrease in F- actin levels. These alterations in actin dynamics result in inhibited cell cycle progression, increased apoptosis, and decreased proliferation of colon epithelial cells, thereby exacerbating colitis development and progression. In contrast, the silencing of circNIgn or the targeted inhibition of Nlgnl73 translation and nuclear translocation leads to the promotion of nuclear actin polymerization, enhanced cell survival, reduced apoptosis, and ultimately improves the outcome of colitis in vivo. Interestingly, nuclear actin polymerization is highly related with expression of PIAS3, which modulates STAT3 and NF-kB activity in colitis. Strategies such as circNIgn knockdown, targeting nuclear actin polymerization of the colonic epithelium can provide an avenue for acute ulcerative colitis (A-UC) clinical intervention.

[0202] Materials and Methods

[0203] Materials and methods for Subcellular fractionation, Immunoprecipitation assays, Solid phase microplate protein binding assay, Actin polymerization assay, Western blotting, RT-PCR and real-time PCR, Immunohistochemistry staining (IHC), Fluorescence in situ hybridization (FISH), Immunofluorescence staining, Enzyme-linked immunosorbent assay (ELISA), Delivery plasmids, siRNAs or mixmer with nanoparticles were performed as previously described [9,17,18,29,77],

[0204] Human Colon Specimens

[0205] The study was conducted in accordance with The Ethics Code of the World Medical Association (Declaration of Helsinki). All patients included in this study provided formal informed consent before enrollment. Colon samples were obtained from 30 patients with acute ulcerative colitis (UC) and 30 individuals with records of recessive-stage UC. Normal colons without detectable colitis were collected from 30 individuals who did not have UC. All samples were obtained from colon biopsies or surgeries.

[0206] At the time of surgery or biopsy, colonic mucosa tissue was removed, divided into portions, and processed as follows: the first fragment was fixed in 4% formaldehyde for 2 to 3 days and then embedded in wax. The second part was collected in cryovials, snap-frozen in liquid nitrogen, stored at -80°C, and used for RNA or protein isolation. The remaining fragment was embedded for frozen sections.

[0207] Constructs, siRNAs and primers

[0208] Plasmids for circNIgn was generated by Gene Universal. The vector plasmid contains a Bluescript backbone, with one CMV promoter driving green fluorescent protein (GFP) expression, and another CMV promoter driving the circular RNA-forming fragments or a non-related sequence serving as a mock control. The plasmid containing full length human Nlgn gene was obtained from Addgene. Primers and siRNA sequences used are listed in Table 3 and Table 4, respectively.Table 3: Primer SequencesTable 4: siRNA sequences

[0209] F-actin / G-actin fractionation

[0210] A F-actin / G-actin in vivo assay kit (BK037) was used to isolate F-actin and G-actin fraction. Briefly, cultured cells or isolated nuclei were lysed with F-actin stabilization buffer 2 (LAS2), homogenized with 25 G syringe 20 times, and incubated at 37°C for 10 min. After centrifuged at 2000 rpm for 5 min to pellet the unbroken cells, the supernatant was centrifuged at 100,000xg at 37°C for 1 h. After centrifugation, the pellet contained F-actin and its binding proteins, while the supernatant contained G-actin.

[0211] Identification of actin binding proteins

[0212] An actin binding protein biochem kit (BK001) was used to identify actin binding proteins. Briefly, 40 pl of G-actin and F-actin were prepared as the manual described. 10 pl (2 pM) tested protein was added to the mixture of F / G-actin, and incubated at room temperature for 30 min. After centrifugation for 150,000 x g for 1.5 h at 24 °C, the pellet contained F-actin and its binding proteins, while the supernatant contained G-actin, which could be detected by Western blot analysis. Whether the supernatant contained protein bound to G-actin or not should be confirmed by following actin precipitation assay in "Identification of G-actin binding proteins"

[0213] Identification of G-actin binding proteins

[0214] G-actin binding proteins were identified by immunoprecipitating G-actin with a monoclonal antibody against actin. To elaborate, 100 pl magnetic beads were washed in PBS-T and incubated with 5 pg antibody against actin at room temperature for 10 min. The antibody conjugated beads were washed with PBS-T for 3 times and incubated with LAS2 lysed G-actin extracts for 1 h. The magnetic beads were washed 3 times with PBS-T and resuspended in 2x Laemmli buffer (0.125 M Tris-HCI, 4% SDS, 20% glycerol, 10% 2- mercaptoethanol, 0.004% bromophenol blue, pH 6.8), followed by Western blot analysis.

[0215] Identification of F-actin binding proteins

[0216] F-actin binding proteins were confirmed through the immunoprecipitation of F-actin with a monoclonal antibody against actin. In this process, the actin antibody conjugatedmagnetic beads were incubated with LAS2 lysed F-actin extracts for 1 h, washed 3 times with PBS-T and resuspended in 2x Laemmli buffer, followed by Western blot analysis.

[0217] F-actin and its binding proteins were also immunoprecipitated with Pha lloidin. Briefly, cells or tissues were resuspended in 500 pl LAS2, and incubated with 20 pl biotin- Phalloidin (B7474) at 37 °C for 1 h. Then, 50 pl Dynabeads MyOne™ Streptavidin Cl (65002) was added to the mixture and incubated at 37 °C for 30 min. The beads were washed with LAS2, and the binding proteins in the pull-down products were analyzed by Western blotting.

[0218] Analysis of nuclear F / G-actin in colonic mucosa

[0219] Colon sections were de-paraffin ized with xylene and ethanol, washed with Tris- Buffered-Saline (TBS) containing 0.025% Triton X-100. The sections were blocked with 10% goat serum and incubated with 1:3000 Alexa Fluor 488 conjugated Deoxyribonuclease I (D12371) in TBS containing 10% goat serum at 4 °C overnight. After washed with TBS, the sections were incubated with 1:100 Alexa Fluor™ 555 Phalloidin (A34055) and DAPI for 30 min.

[0220] The Images of the staining sections were performed using Nikon N-SIM S confocal laser scanning microscopy. Five single cells were randomly selected from each image. The intensity of Phalloidin (F-actin) / Deoxyribonuclease I staining (G-actin) within the cell nucleus (DAPI staining) was analyzed by ImageJ. Phalloidin / Deoxyribonuclease I staining areas that overlapped with DAPI were defined as nuclear F-actin / G-actin stained. The average intensity value of five cells from each image represented F-actin / G-actin intensity of the sample image. However, the Phalloidin / Deoxyribonuclease I staining around the edge of nucleus was excluded, and only the staining away from the nuclear edge was counted as nuclear F- actin / G-actin positive staining.

[0221] circNIgn transgenic mice

[0222] All animal experiments were performed in accordance with relevant guidelines and regulations approved by the Animal Care Committee of Sunnybrook Research Institute. The circNIgn-transgenic mouse model was generated by pronuclear microinjection of circNIgncontaining DNA fragment C57BL / 6J, performed by the Toronto Centre for Phenogenomics (TCP). All transgenic mice were ear tagged and processed to genotyping after weaning. The genotyping primer sequences were as listed in Table 3.

[0223] Induction of acute colitis model

[0224] Dextran sodium sulfate (DSS) colitis was induced in mice by administering DSS (1.5 % - 3 %, MW: 36,000-50,000, MP Biomedicals, Solon, OH, USA) for 7 days followed by a return to DSS free water for 3 days. 2,4,6-trinitrobenzene sulfonic acid (TNBS; Sigma-Aldrich, St. Louis, MO, USA) colitis was induced by a single colonic enema (2.0 % - 2.5 % in 100 pl 50% ethanol).

[0225] Isolation of primary mouse colon epithelial cell

[0226] Primary mouse colonic epithelial cells (mCECs) were isolated as previously described

[0101] , Briefly, Mouse colonic mucosa was dissected, cut into 3 pieces of 2 cm long and washed with Hank's Balanced Salt Solution (HBSS) containing penicillin and streptomycin. The washed tissues were suspended in 40 ml HBSS, inverted vigorously 15 times, and allowed to settle for 2 min. The supernatant was removed and the settled contents were washed an additional 5 times. The settled contents were minced and suspended in 40 ml of the HBSS. The suspension was passed over a 1000 pm2mesh filter. Remaining tissue was digested in 40 ml of a Dulbecco's Modified Eagle Medium (DMEM) with 4.5 g / l glucose and L-glutamine, without sodium pyruvate (DMEM) containing 75 U / ml collagenase type XI, 20 pg / I dispase neutral protease II, 0.5 mM DTT, and 0.5 % FBS. The digestion mixture was shaken at 180 rpm 37 °C for 2 h, and passed over a 1000 pm2filter. The tissue fragments atop the filter were washed with 25 ml DMEM growth media (DMEM, 8.5 g / l sodium pyruvate, 2.5 % FBS, 0.25 U / ml insulin, 100 U penicillin, 100 pg / ml streptomycin, 5 pg / ml transferrin, and 10 ng / ml epidermal growth factor) containing 2% D-sorbitol (S-DMEM). The effluent containing proliferative crypt structures was centrifuged at 200xg for 5 min at 4 °C. The remaining pellet was suspended in S-DMEM. This process was repeated four times. After washing, the crypts were suspended in DMEM growth media, plated at 2 % gelatin coated culture dish and incubated at 37 °C.

[0227] Histological damage score

[0228] Hematoxylin and eosin stained colon sections were used for histological assessment of colitis. Two slides for each experimental group were scored by three observers blinded to the treatment groups, using previously described criteria

[0102] : 0, no signs of inflammation;1, very low level of leukocyte infiltration; 2, low level of leukocyte infiltration; 3, high level of leukocyte infiltration, high vascular density, thickening of the colon wall; 4, transmural infiltration, loss of goblet cells, high vascular density, thickening of the colon wall.

[0229] Epithelial permeability assay

[0230] On euthanizing day after DSS or TNBS treatment, mice were orally gavaged with FITC-dextran (600 mg / kg body). Four hours following gavage, mice were anesthetized, the blood was collected via cardiac puncture, and allowed to be kept in room temperature for lh. After centrifuged at 3000 RPM for 10 min at 4°C, the collected supernatant was read on a spectrophotometer at 485 / 535 nm.

[0231] Colonic mucosa culture

[0232] Freshly obtained colonic mucosa (2 cm in length) was washed with HBSS containing penicillin and streptomycin, and cultured in 1 mL DMEM medium containing 10% at 37°C with 5% CO2 for 24 h. The cultured medium was then harvested, followed by ELISA to detect cytokine levels secreted by colonic mucosa.

[0233] Disease activity index

[0234] The mice were checked each day for morbidity, and colitis severity was monitored using the disease activity index (DAI), which includes evaluation of weight loss, stool consistency, and presence of fecal blood. DAI was calculated for each mouse daily based on body weight loss, bleeding and stool consistency. A score of 1-4 was given for each parameter, with a maximum DAI score of 12. Score 0: no weight loss, normal stool, no blood; score 1: 1-3% weight loss; score 2: 3-6% weight loss, loose stool, blood visible in stool; score 3: 6-9% weight loss; score 4: 49% weight loss, diarrhea, gross bleeding. Gross bleeding was defined as fresh blood on fur around the anus or with extensive blood in the stool. Loose stool was defined as the formation of a stool that readily becomes paste, and diarrhea was defined as no stool formation.

[0235] Statistical analysis

[0236] Data were presented as mean (bar) with standard deviation (SD, whisker). For multiple group analyses, a one-way ANOVA was conducted, followed by a Bonferroni post hoc test for one independent variable, and a two-way ANOVA followed by a Bonferroni correction for two independent variables. A two-tailed unpaired Student's t test was performed to assess the differences between two groups with a single independent factor. All in vitro experiments were repeated at least three times, unless otherwise specified. Kaplan-Meier survival test was used to analyze the survival difference among groups. Prism 8 (GraphPad Software: La Jolla, CA) was used for the statistical analyses, with differences considered statistically significant when the nominalized p-value was less than 0.05.

[0237] Results

[0238] Expression of circNIgn in acute ulcerative colitis

[0239] High-throughput circRNA sequencing was conducted on colon samples obtained from patients diagnosed with colitis. In total, 26,251 circRNAs were identified in these samples, with each circRNA supported by at least two reads spanning a head-to-tail splice junction in every sample. When compared to control tissues, 232 circRNAs exhibited significant differential expression, exceeding a 2-fold threshold, while 104 circRNAs exceeded a 10-fold threshold. Notably, the circRNAs displaying the most pronounced up- and down-regulation are presented in Figure 17A lower. Among these, circNIgn emerged as one of the most prominently up-regulated circRNAs. In a previous study, we elucidated that circNIgn is translated into an encoded protein, Nlgnl73, which is translocated to cell nuclei, contributing to cardiac remodeling and fibrosis

[0017] ,

[0240] Next, circNIgn levels were assessed in human colitis samples through immunohistochemistry. Acute ulcerative colitis (A-UC) samples revealed significantly higher levels of Nlgnl73 compared to recessive ulcerative colitis (R-UC) and normal colon samples (Figure 17B). In situ hybridization immunofluorescence staining showed that both circNIgn and Nlgnl73 levels were markedly elevated in A-UC compared to R-UC and normal colon (Figure 17C, full panel provided in Figure 18). RT-PCR analysis showed that the increased expression was specific to circNIgn, but not the Nlgn mRNA (Figure 17D). In a pairwiseanalysis, the inflamed areas of A-UC displayed higher levels of circNIgn compared to the unaffected A-UC regions (Figure 17E).

[0241] To investigate the impact of circNIgn on colitis development, a mouse colitis model was utilized, which was made by administering dextran sulfate sodium (DSS) to C57BL / 6J mice. Colon tissue staining showed that the histological damage score was significantly increased in the DSS-treated mice, while Ki67 levels increased at lower concentration but declined at higher concentration of DSS (Figure 19A). This was due to large number of cell apoptosis at the higher concentration of DSS (Figure 19B). In situ hybridization indicated a substantial upregulation of both circNIgn and the translated protein Nlgnl73 in response to DSS treatment (Figure 17F, Figure 19C). Additionally, the mice were subjected to 2,4,6-Trinitrobenzenesulfonic acid (TNBS) treatment, where elevated levels of circNIgn were observed through RT-PCR and elevated levels of Nlgnl73 were observed via Western blotting in the colonic mucosa of chemically treated mice relative to the control group (Figure 17G).

[0242] Impact of circNIgn in Transgenic Mice on Colitis Susceptibility

[0243] Given the pivotal role of circNIgn in regulating cellular activities, transgenic mouse lines expressing circNIgn

[0017] were developed and used to investigate the influence of circNIgn on colitis development. Studies were performed involving treatment with DSS and TNBS, which revealed several noteworthy observations. In comparison to wild-type (WT) mice, circNIgn transgenic mice exhibited reduced body weight, higher bleeding scores, elevated stool scores, and increased disease activity index (DAI) (Figure 20A). Furthermore, in mice administered with FITC-dextran, the circNIgn-transgenic mice displayed higher levels of FITC-dextran in their serum compared to controls (Figure 20B). Consequently, the circNIgn-transgenic mice demonstrated decreased survival rates relative to the controls (Figure 20C). Upon dissection, it became evident that the transgenic mice had shorter colon lengths compared to the controls (Figure 20D).

[0244] Colon tissues were subjected to RT-PCR (Figure 21A) and in situ hybridization (Figure 21B-C) to confirm increased expression of circNIgn and Nlgnl73. H&E staining showed that the circNIgn transgenic mice displayed higher histological damage score than WT mice(Figure 22A). Decreased Ki67 staining was observed in the colitis tissues (Figure 20E, Figure 22B) that also showed increased cell apoptosis (Figure 22C-D). The colonic mucosa was collected to measure cytokine expression. It showed increased levels of cytokines in the colitis tissues compared with the controls (Figure 20F, Figure 22E).

[0245] To confirm the effect of circNIgn, two siRNAs targeting the junction sequence of circNIgn and a mixmer targeting translation of circNIgn were administered to the DSS- treated mice. Increased body weight, lower bleeding score, lower stool score (Figure 23A), and lower disease activity index (DAI, Figure 24A) were observed, relative to the oligo control. In mice fed with FITC-dextran, the siRNA- and mixmer-treated mice showed lower amounts of FITC-dextran in the serum than the controls (Figure 24B). As a consequence, these mice showed increased survival rates relative to the controls (Figure 24C). Shortened colon length was observed in the siRNA- and mixmer-treated mice compared with the control (Figure 24D, Figure 23B). H&E staining of mouse colon sections displayed lower histological damage score in the siRNA- and mixmer-treated mice than in the control mice (Figure 24E, Figure 25A). Ki67 staining detected increased number of positive cells (Figure 24F, Figure 25B), consistent with decreased TUNEL positive cells (Figure 24G, Figure 25C), in the siRNA- and mixmer-treated mice compared with the controls. RT-PCR confirmed the silencing of circNIgn by both siRNAs used (Figure 26A). In situ hybridization showed that the mixmer significantly inhibited translation of Nlgnl73, while it had no effect on circNIgn levels (Figure 24H, Figure 26B-C). Cytokine expression was inhibited by the siRNAs and mixmer (Figure 241, Figure 267D).

[0246] Expression of circNIgn suppressed mCEC nuclear actin polymerization in colitis models

[0247] To explore the role of Nlgnl73 in promoting colitis development, an immunoprecipitation assay was conducted using primary mouse colon epithelial cells (mCECs) isolated from circNIgn-transgenic and wildtype mice. An antibody against Nlgnl73 was utilized, followed by mass spectrometry analysis, to identify Nlgnl73-binding proteins. The results yielded a list of Nlgnl73-binding partners (Figure 27A). Notably, among several proteins essential for the nuclear translocation of Nlgnl73

[0017] , actin emerged as the most significant binding partner. It was noted that the read-count of actin was much greater thanNlgnl73, even though Nlgnl73 was the direct target of the antibody and actin was indirectly pulled down by Nlgnl73. The result suggested that one antibody molecule might bind one Nlgnl73 and pulled down many actin molecules in the complex: F-actin rather than G-actin might be involved. The nuclear extract was then subjected to actin antibody precipitation. In this way, actin became the direct target of the antibody and large number of read-counts were expected for actin (Figure 27B).

[0248] In light of the increased expression of Nlgnl73 in colitis, lysates were prepared from the colonic mucosa of the mice with and without colitis induced by DSS and TNBS. An actin polymerization assay was conducted, which revealed that lysates from colitis-affected mucosa exhibited reduced actin polymerization in comparison to controls (Figure 27C). Computational algorithm predicted the interaction of Nlgnl73 and actin (Figure 27D). The lysates were also subjected to subcellular fractionation. The nuclear extracts from the colitis showed decreased actin polymerization (Figure 27E).

[0249] Nuclear extracts of colonic mucosa were also prepared from the circNIgn-transgenic and wildtype mice with colitis induced by DSS and TNBS. Transgenic expression of Nlgnl73 decreased actin polymerization (Figure 27F). Primary mCECs were isolated from the circNIgn-transgenic and wildtype mice with colitis induced by DSS. Increased expression of Nlgnl73 decreased actin polymerization (Figure 28A), while silencing circNIgn increased actin polymerization (Figure 28B). Ectopic expression of circNIgn in cell lines also decreased actin polymerization (Figure 28C).

[0250] Without wishing to be bound by theory, the results provided above indicated that expression of circNIgn suppressed nuclear actin polymerization. A previous study by the present inventors demonstrated that circNIgn encoded a protein isoform Nlgnl73, which was mainly expressed in the nuclei and translocated to nuclei by binding to LaminBl. Thus, silencing Lamin Bl prevented Nlgnl73 nuclear translocation and accumulation of Nlgnl73 was found in cytosol

[0017] , To observe the effect of the nuclear protein Nlgnl73 on actin polymerization, the circNIgn-positive mCECs were transfected with siRNAs targeting LaminBl, followed by subcellular actin fractionation. Actin polymerization assays showed that the nuclear extract from the cells transfected with LaminBl siRNAs promoted actinpolymerization, but the cytosolic extract repressed actin polymerization, confirming the inhibitive effect of Nlgnl73 on actin polymerization (Figure 28D-E).

[0251] Next, the effects of Nlgnl73 on colitis development in the mouse colitis model were examined. Colon tissues treated with DSS or TNBS were sectioned and subjected to G-actin and F-actin immunostaining. Image J analysis showed that the colon tissues from the circNIgn-transgenic mice expressed higher levels of G-actin but lower levels of F-actin in the nuclei relative to WT (Figure 27G). The total levels of G-actin and F-actin were not affected in either of the DSS and TNBS colitis models (Figure 29). Silencing circNIgn by circNIgn siRNAs and blocking its translation by mixmer prevented nuclear actin polymerization, resulting in decreased G-actin but increased F-actin in the nuclei compared to the oligo controls in the DSS model (Figure 27H, Figure 30A), while the total levels of G-actin and F- actin were similar (Figure 30B). Human colon samples were also subjected to G-actin and F- actin immunostaining. Human A-UC samples revealed higher levels of nuclear G-actin and lower levels of F-actin compared to normal colon samples (Figure 31).

[0252] Nlgnl73 Inhibits Arp2 / 3 Complex Binding to Actin and Represses Actin Polymerization

[0253] While pulldown of Nlgnl73 was detected in the circNIgn-transgenic mice, Actin- related protein 2 and 3 (ARP2 / 3), two molecules essential for driving actin polymerization [73-75], were not detected. To validate the role of Nlgnl73 in actin polymerization, Nlgnl73 was purified from the circNIgn-transfected 293T cells (Figure 32A, left). The purified Nlgnl73 inhibited actin polymerization (Figure 32A, right). The inhibition of actin polymerization by Nlgnl73 was dose dependent and required inclusion of Arp2 / 3 (Figure 33A-B). Solid phase microplate protein binding assay was used to confirm the interaction between F-actin and Arp2 / 3. Addition of the purified Nlgnl73 repressed Arp2 / 3 binding to F-actin (Figure 32B).

[0254] The interaction among Arp2 / 3, F-actin, and Nlgnl73 was further validated through a direct binding assay, using an Actin binding protein biochemistry kit (Cat#BK001). Western blot analysis following the separation of F-actin and G-actin binding partners confirmed that the presence of Nlgnl73 inhibited the interaction between Arp2 / 3 and F- actin (Figure 32C). Immunoprecipitation with an antibody against actin showed that bothArp2 / 3 and Nlgnl73 bound F-actin. The binding of Arp2 / 3 to F-actin decreased in the presence of Nlgnl73.

[0255] To test the interaction in cells, mCECs were isolated from circNIgn-transgenic mice followed by subcellular fractionation and Western blot. Nlgnl73 was primarily detected in the nuclei, where the levels of actin and Arp2 / 3 were lower relative to the levels in the cytosol (Figure 32D). Direct interaction was performed using immunoprecipitation and Western blot. Precipitation of Nlgnl73 co-precipitated actin in the nuclei. Actin immunoprecipitation pulled down Arp2 / 3 and Nlgnl73 in the nuclei. Ectopic expression of Nlgnl73 decreased Arp2 / 3 binding to actin. Arp2 / 3 precipitation pulled down actin in the nuclei. Expression of Nlgnl73 decreased actin binding to Arp2 / 3.

[0256] The role of endogenous Nlgnl73 in mediating the interaction was studied by delivery of circNIgn siRNAs into mCECs and confirmed silencing and nuclear localization of Nlgnl73 (Figure 33C). Immunoprecipitation of Nlgnl73 pulled down actin in the nuclei (Figure 33D), and precipitation of actin pulled down Arp2 / 3 and Nlgnl73, where silencing Nlgnl73 increased Arp2 / 3 binding to actin (Figure 32E). Arp2 / 3 precipitation pulled down actin in the nuclei, where silencing Nlgnl73 increased actin binding to Arp2 / 3 (Figure 32E). Lamin Bl was also silenced to inhibit Nlgnl73 nuclear translocation (Figure 33E). Immunoprecipitation of Nlgnl73 co-precipitated actin in the nuclei, which was inhibited by silencing Lamin Bl (Figure 33F). Actin precipitation pulled down Arp2 / 3 and Nlgnl73. Arp2 / 3 precipitation pulled down actin that was promoted by silencing Lamin Bl. Silencing Lamin Bl increased Arp2 / 3 binding to actin, but decreased its binding to actin in the cytosol.

[0257] This interaction was then studied in the colitis model. Primary mCECs were isolated from circNIgn-transgenic mice, in which colitis was induced with 1.5% DSS and 2% TNBS. Western blot confirmed increased expression and nuclear translocation of Nlgnl73 (Figure 34A). Immunoprecipitation of Nlgnl73 pulled down actin in the nuclei; actin precipitation pulled down Arp2 / 3 and Nlgnl73; Arp2 / 3 precipitation pulled down actin (Figure 34B). Increased expression of Nlgnl73 decreased actin binding to Arp2 / 3. Decreased expression and nuclear translocation were observed by treatment with circNIgn siRNAs and mixmer (Figure 34C). Nlgnl73 precipitation pulled down actin in the nuclei, while actin precipitation pulled down Nlgnl73 and Arp2 / 3; Arp2 / 3 precipitation pulled down actin inthe nuclei (Figure 34D). Decreased expression of Nlgnl73 enhanced the interaction between actin and Arp2 / 3.

[0258] Expression of circNIgn Enhances Nuclear F-Actin Tyrosine-53-Phosphorylation

[0259] It has been reported that tyrosine-53-phosphorylation is involved in actin polymerization

[0076] , The affect of expression of circNIgn on actin phosphorylation was studied using mCECs isolated from circNIgn-transgenic, the litter-matched negative and WT mice. Transgenic expression of circNIgn decreased nuclear F-actin levels but increased F- actin phosphorylation at tyrosine (Figure 35A). With comparable quantities of F-actin, the circNIgn group displayed increased F-Actin phosphorylation of tyrosine but not threonine and serine, resulting in decreased pull-down of Arp2 / 3 (Figure 35B). Precipitation of F-actin by pha Hold in pulled down more Nlgnl73 and p-Tyr-53, but less Arp2 / 3 in mCECs expressing circNIgn (Figure 35C). Silencing circNIgn increased F-actin levels in the nuclei (Figure 35D). At equal amounts of F-actin, actin precipitation pulled down decreased levels of phosphotyrosine, but more Arp2 / 3, in mCECs treated with circNIgn siRNAs, while phosphorylation of threonine and serine was not affected (Figure 35E). F-actin precipitation by phalloidin pulled down less Nlgnl73 and p-Tyr-53, but more Arp2 / 3 in mCECs transfected with circNIgn siRNAs (Figure 35F).

[0260] In the colitis model, phalloidin precipitated decreased levels of F-actin in the nuclei of circNIgn-transgenic mice, which was promoted by colitis development (Figure 35G). At equal amounts of F-actin, increased p-Tyr-53 levels but decreased Arp2 / 3 were observed in the circNIgn-transgenic mice, which was promoted by colitis development. Delivery of circNIgn siRNAs and mixmer increased F-actin in the nuclei, which was promoted by DSS treatment (Figure 35H). At equal amounts of F-actin, precipitation of F-actin pulled down less Nlgnl73 and p-Tyr-53, but more Arp2 / 3.

[0261] Nlgnl73 decreased PIAS3 expression but activated STAT3 and NF-kEJ

[0262] To uncover the mechanism by which Nlgnl73 inhibited actin polymerization further, expression of genes associated with colitis development was examined. Mouse colon mucus obtained from circNIgn-transgenic and litter-matched negative mice was lysed and subjected to RT-PCR to analyze levels of 17 currently reported colitis-related genes. Severalgenes were found to be differentially expressed, in which PIAS3 was the most differentially expressed (Figure 36A, left). Human colon mucus from A-UC and R-UC was then lysed and subjected to RT-PCR. Both A-UC and R-UC mucus expressed lower levels of PIAS3 than the normal tissues (Figure 36A, right).

[0263] To observe whether expression of PIAS3 was related with nuclear actin polymerization, mCECs were cultured with jasplakinolide (Jasp, enhancing actin polymerization), latrunculin B (LatB, decreasing actin polymerization) and cytochalasin-D (CytD, decreasing actin polymerization), followed by RT-PCR. The cells showed increased PIAS3 levels when treated with Jasp, but decreased PIAS3 levels when treated with LatB and CytD (Figure 36C, left, Figure 37A). It seemed that expression of PIAS3 was related with actin polymerization. The mCECs were also transfected with XPO6 or IPO9 siRNAs to regulate actin nuclear translocation, followed by RT-PCR. Silencing XPO6, which could enhance actin nuclear translocation, up-regulated PIAS3 expression, while silencing IPO9, which repressed actin nuclear translocation, down-regulated PIAS3 expression (Figure 36B). PIAS3 expression levels also seemed to be related with nuclear actin levels.

[0264] A cell model was previously generated to study nuclear F-actin function with minimal effect on the actin dynamics in cytosol, by using actin polymerization stabilizers and XPO6 / IPO9 siRNAs

[0077] , The mCECs transfected with XPO6 and IPO9 siRNAs were cultured in Jasp or co-transfected with mDia2, followed by subcellular and actin fractionation. Western blot showed silencing XPO6 increased nuclear F-actin compared to control oligo after cultured in Jasp or co-transfected with mDia2; silencing IPO9 decreased nuclear F-actin compared to control oligo; both did not significantly change actin dynamics in total cell lysate (QI, Q2). RT-PCR showed that silencing XPO6 up-regulated, while silencing IPO9 down-regulated expression of PIAS3 (Figure 36C, right). We further confirmed the effect of nuclear actin polymerization on PIAS3 expression by introducing a number of actin-mod ified constructs into the mCECs including YFP-NLS-P-actin (NLS-P-actin), YFP-NLS-P-actin S14C (SMC), YFP-NLS-p-actin G13R (G13R) and NLS-p-actin R62D (R62D) mCherry, in which NLS-p- actin and SMC can increase nuclear actin polymerization

[0077] , Expression of NLS-P-actin and S14C increased PIAS3 levels (Figure 36D).

[0265] Thus, nuclear actin polymerization was confirmed to play roles in moderating colitis- related gene PIAS3 expression. Subsequently, the downstream signaling molecules of PIAS3, including STAT3 and NF-kB

[0078] , were investigated using the circNIgn-transgenic mouse model. The mCECs isolated from cicNIgn transgenic mice displayed decreased PIAS3 expression at mRNA levels (Figure 36E, left), and increased phosphorylation of STAT3 and NF-kB in cell nuclei (Figure 36E, right).

[0266] Decreased expression of PIAS3 and activation of STAT3 and NF-kB were confirmed in circNIgn-transgenic mice treated with DSS and TNBS (Figure 36F, Figure 37B). Silencing circNIgn and inhibiting circNIgn translation increased PIAS3 expression but decreased activation of STAT3 and NF-kB (Figure 38). In human colonic mucosa, decreased expression of PIAS3 and increased activation of STAT3 and NF-kB were also detected in A-UC (Figure 36G-H).

[0267] Discussion

[0268] Nuclear actin was first observed in the late 1970s, but its function remained poorly understood until recently [67,79], It is now known that nuclear actin plays essential roles in regulating gene expression, DNA repair, and nuclear structural organization. One of the most well-studied functions of nuclear actin is its regulation of gene expression. Nuclear actin is known to associate with chromatin and play a role in modulating the accessibility of DNA to transcription factors and other regulatory factors [80-83], This results in changing gene expression, positively or negatively. The results provided in this example support this role, demonstrating that the expression of circNIgn leads to altered levels of nuclear F-actin, resulting in the up- and down-regulation of inflammatory factors associated with colitis development.

[0269] Nuclear actin is also involved in DNA repair, where it is accumulated at sites of DNA damage. It helps to recruit DNA repair factors and stabilize the repair complexes [84-87], Disruption of nuclear F-actin impairs the repair process of DNA damage. Thus, nuclear actin, by forming nuclear F-actin and regulating nuclear organization, plays crucial roles in maintaining genome stability. This study showed that the newly identified nuclear protein Nlgnl73 encoded by the circular RNA circNIgn inhibited the formation of F-actin in thenuclei. This resulted in enhancement of colitis development and progression. Silencing circNlgn / Nlgnl73 expression reversed the processes. Since circNlgn / Nlgnl73 was highly up- regulated in the mouse colitis model and in patients with colitis, targeting circNlgn / Nlgnl73 is of therapeutic use for treatment and / or prevention of the disease.

[0270] Similar to its presence in the cytoplasm, there are two forms of nuclear actin, namely G-actin and F-actin. Nuclear actin polymerization refers to the process by which G-actin forms F-actin or filamentous actin. This process plays important roles in tissue repair by regulating gene expression involved in various cellular processes including cell migration, proliferation, differentiation, and tissue repair. A recent study by the inventors showed that nuclear actin polymerization regulated cellular EMT

[0077] , The present example showed that the protein Nlgnl73 encoded by circNIgn interacted with actin and inhibited the formation of F-actin. The binding of Nlgnl73 to actin blocked the accessibility of Arp2 / 3 leading to inhibition of actin polymerization.

[0271] Arp2 / 3 complex is one of the key players in actin polymerization, which binds to the sides of pre-existing actin filaments and nucleates the formation of new filaments

[0088] , The activated Arp2 / 3 complex can also bind G-actin to initiate the formation of filament branches. It is known that the activity of the complex can be modulated by various factors, including actin-binding proteins, molecules in the related signaling pathways, and post- translational modifications such as phosphorylation [73,89„90], Phosphorylation is a crucial post-translational modification that plays a critical role in regulating many cellular processes including actin polymerization [91,92], Phosphorylation of actin can regulate the stability of actin filaments, enhancing the overall structure and organization of the actin cytoskeleton. In our study, we found that Nlgnl73 regulated actin Tyr-53 phosphorylation and repressed actin binding to the Arp2 / 3 complex. Tyr-53 phosphorylation could inhibit nucleation and actin filament elongation

[0076] , This is in agreement with other reports that phosphorylation of profilin, a protein that enhances actin filament involving interaction with the Arp2 / 3 complex, can also influence actin polymerization [93,41], Phosphorylation of the actin- binding proteins can modify their interactions with actin, leading to alterations in actin filament assembly. It was found herein that increased levels of Nlgnl73 promoted actin phosphorylation and silencing Nlgnl73 expression decreased actin phosphorylation.

[0272] Another important aspect of nuclear actin polymerization is its impact on inflammation. Some studies report that nuclear F-actin plays roles in regulating expression of inflammation-associated genes. This could be due to the involvement of F-actin in regulating chromatin structure and gene expression through binding to various chromatin binding proteins, transcription factors, and RNA polymerases. It is reported that disruption of F-actin assembly in the nuclei decreased expression of pro-inflammatory cytokines such as IL-6 and TNF-a, suggesting that nuclear F-actin may promote inflammation

[0095] , However, other studies showed that nuclear F-actin may have anti-inflammatory effects: increasing nuclear F-actin levels decreased the expression of pro-inflammatory cytokines and adhesion molecules, suggesting decreased inflammation by nuclear F-actin [96-98], Nevertheless, the exact effect of nuclear actin polymerization on pro-inflammatory gene expression associated with colitis development is not well understood. It may vary depending on the specific context of colitis.

[0273] Colitis is a chronic inflammatory disease that affects the colon and rectum. While the exact causes of colitis are not fully understood, it is believed to result from an abnormal immune response. Abnormal immune response can affect both acute ulcerative colitis (A- UC) and recessive ulcerative colitis (R-UC), but its impact on A-UC and R-UC may be different. In A-UC, the primary goal is to reduce inflammation and promote healing of the intestinal lining by inducing remission and alleviating symptoms. In R-UC, the disease often flares up after a period of remission, and management of the disease involves maintenance medications to prevent relapses that keep R-UC in remission. Thus, the effects of different factors on colitis progression may be different at the cellular and molecular levels. For instance, cell proliferation may be an essential step in A-UC recovery but may not be necessary in R-UC. EMT may help in the recovery of A-UC but not in R-UC. The present study discovered that decreased nuclear actin polymerization promoted A-UC progression but had less effect on R-UC. Without wishing to be bound by theory, this suggests that nuclear actin polymerization and its associated inflammatory molecules are helpful in recovery of A-UC colitis, but not in R-UC. This is in agreement with previous studies showing that disruption of nuclear actin polymerization can lead to an increase in the expression of pro-inflammatory genes that contributes to the development of colitis [59,99,100], Additionally, nuclear actin polymerization may serve as an intestinal barrier for the maintenance of intestinal structure,preventing harmful substances entering the body. Decrease nuclear actin polymerization in A-UC patients and in the mouse colitis model disrupted the intestinal homeostasis and lead to increased intestinal permeability and repressed intestinal mucous repairing in A-UC. Strategies such as circNIgn knockdown targeting nuclear actin polymerization of colonic epithelium provides a new means for A-UC clinical intervention.

[0274] EXAMPLE 3: Enhancing skin wound healing by targeting circNIgn and its protein coding activity

[0275] Skin wound healing stands as a pivotal biological process characterized by its intricate and multifaceted nature, involving a cascade of cellular and molecular events

[0103] , This intricate process unfolds through distinct stages, encompassing tissue hemostasis, inflammation, cell proliferation, migration, extracellular matrix production, and remodeling [104-106], However, despite the body's remarkable ability to regenerate and repair damaged tissue, the post-repair phase can give rise to scars, attributed to an excess of collagen synthesis and deposition. The formation of scars, while a natural part of the healing response, can pose significant challenges, impacting both functionality and aesthetics and affecting the overall quality of life for the patient. Researchers have earnestly sought ways to mitigate scarring, yet such efforts often introduce a delicate balance between minimizing scarring and impeding the healing process. Slowing down the healing process can result in chronic wounds, leaves the wounds vulnerable to infection and increased risk of significant morbidity and mortality. Conversely, the accelerated promotion of the wound healing process frequently culminates in heightened collagen synthesis and deposition, ultimately contributing to scar formation.

[0276] Recent studies have highlighted the pivotal role of circular RNAs (circRNAs) in skin wound healing, elucidating their influence on gene expression, molecular signaling pathways, cell proliferation, and migration [107-109], As a diverse group of non-coding RNAs, circRNAs have garnered recognition as significant regulators of both gene expression and molecular signaling [1,27,110], contributing substantially to the orchestration of cellular physiology and disease development [29,35,111], In the context of wound repair, application of exosome isolated from adipose-derived mesenchymal stem cells (ADSCs) promoted skin wound repair in full-thickness diabetic rats

[0108] , The therapeutic effect ofexosome was mediated through circRNA mmu_circ_0000250 that promoted SIRT1 expression by sponging miR-128-3p. In a full-thickness skin wound healing model in diabetic mice, it was observed that circ-Gcapl4 downregulation decreased the therapeutic effects of ADSCs isolated from BALB / C mice adipose samples

[0112] , Conversely, the overexpression of circ-Gcapl4 heightened the efficacy of ADSCs by upregulating the expression of angiogenic growth factors and modulating the downstream miR-18a-5p / HIF-lalpha pathway.

[0277] Building upon the present inventors' previous investigation, where a transgenic mouse line expressing circNIgn was developed and the impact of circNIgn expression on cardiac function was observed

[0017] , the present Example investigated the functional implications of circNIgn in the wound healing process using the transgenic mouse model expressing circNIgn. The results revealed that transgenic mice overexpressing circNIgn manifested impaired wound healing, accompanied by diminished cell proliferation and survival. Targeted interventions, such as siRNA-mediated circNIgn silencing and translational inhibition using a mixmer, demonstrated notable enhancements in wound healing, cell proliferation, and survival. The augmented wound healing response was correlated with an induction of epithelial-mesenchymal transition (EMT), characterized by reduced E-cadherin expression coupled with elevated N-cadherin and vimentin expression. This EMT enhancement facilitated increased cell migration. Mechanistic investigation revealed that circNIgn encodes the protein Nlgnl73 that is translocated to nuclei where it regulates nuclear actin polymerization. Reduced nuclear actin polymerization in circNIgn-transgenic mice correlated with heightened collagen synthesis and deposition, resulting in scar formation. Conversely, silencing circNIgn and inhibiting circNIgn translation led to increased nuclear actin polymerization, decreased collagen synthesis and deposition, and reduced scarring. These results help to elucidate the intricate involvement of circNIgn in skin wound repair, emphasizing its relevance in therapeutic strategies aimed at enhancing wound healing efficacy while mitigating scar formation and in optimizing skin repair outcomes.

[0278] Materials and Methods

[0279] Materials

[0280] Polyclonal antibodies were generated in rabbits against junction peptide (GYRPAANWI) of Nlgnl73 by Genscript (Piscataway, NJ, USA) and purified with histidine- tagged Nlgnl73 bound Ni-NTA resins in the inventors' laboratory. Monoclonal antibodies against Nlgn (N-terminal, SC-365111) / Nlgnl73 were from Santa Cruz (Santa Cruz, CA, USA). The monoclonal antibodies against E-cadherin, N-cadherin, vimentin, P-actin and were from Cell signaling (Danvers, MS, USA). Horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse IgG, RNA RT and PCR kits were from Bio-Rad (Hercules, CA, USA). RNA and DNA extraction kits were obtained from Geneaid (Taipei, Taiwan, China). Alexa Fluor 488 Deoxyribonuclease I, Alexa Fluor™ 555 Pha Hold in and Western blot detection kit were from Millipore (Burlington, MS, USA). Actin polymerization biochem kit (BK003) was obtained from Cytoskeleton (Denver, CO, USA).

[0281] Constructs, siRNAs and primers

[0282] The plasmid employed in this study features a Bluescript backbone, one CMV promoter driving green fluorescent protein (GFP) expression, and another CMV promoter driving the circular RNA-forming fragments or a non-related sequence serving as a mock control. All primers, siRNA and mixmer sequences used are listed in Table 5and Table 6.Table 5: Primer sequencesTable 6: siRNA and Mixmer sequences

[0283] Cell proliferation

[0284] Cells were cultured in 10% FBS basal medium in 12-well culture dishes (2xl04cells / well) at 37 °C and harvested at indicated time points. The harvested cells were stainedwith Trypan Blue, and cell number was counted by a Coulter Counter under the inverted microscope.

[0285] Cell survival assay

[0286] Cells were cultured in 10% FBS basal medium in 12-well culture dishes (5xl04cells / well) and maintained at 37 °C for 16 h. The culture medium was replaced with serum- free or 10% FBS basal medium containing H2O2. Cells were harvested at indicated time points, stained with Trypan Blue, and counted by a Coulter Counter under the inverted microscope.

[0287] Annexin-V assay

[0288] Cells were cultured in basal medium and maintained at 37 °C for 16 hours. Following attachment, culture cells were replaced with serum-free DMEM or 10% FBS basal medium containing H2O2 or indicated chemicals. Cells were harvested at specific time points, and subjected to the cell apoptosis analysis detected by Annexin V-APC apoptosis detection kit (ThemoFisher Scientific, Waltham, MS, USA). Briefly, cells were harvested and resuspended in Annexin V-APC binding buffer, incubated with Annexin V-APC and propidium iodide solutions for 30 min. The Annexin V-APC binding cells were analyzed by flow cytometry.

[0289] Cell cycle analysis

[0290] Cells were harvested, resuspended, and incubated in ice-cold 70% ethanol for 2 h. After washing in PBS, the resuspended cells were incubated in 20 pg / ml propidium iodide (PI) at 37 °C for 30 min. The percentage of S and G2 population cells was analyzed with flow cytometry.

[0291] Wound healing assays

[0292] Cells were seeded overnight in six-well plates at a density of l-5xl06cells / well. To minimize the impact of proliferation, the cells were pre-treated with Mitomycin C at 2-10 pg / ml for 6 h. The cultured cells were scraped linearly with a 200 pl micropipette tip. Cell locomotion patterns were recorded by an inverted light microscope at different time points, and the migration distance was measured and quantified.

[0293] Chamber migration assays

[0294] To assess cell motility in a three-dimensional way, PET track-membrane (Coster, Sigma-Aldrich) were placed in 24-well tissue culture plates and l-5xl05cells in 200 pl serum-free medium was loaded into the upper of the chamber membrane. The lower chamber of the wells was filled with 800 pl DMEM containing 10% FBS. After cultured at 37 °C for different time points, non-migrated cells were removed with a cotton swab and the migration cells were fixed by 100% methanol for 10 min, followed by staining with Coomassie blue for 5 min. The images of stained cells were taken under an inverted light microscope for quantitation.

[0295] Western blotting

[0296] Cells or tissues were lysed and underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Transblotting was processed onto a nitrocellulose membrane in Tris / glycine buffer containing 20% methanol at 80-V at 4°C for 2 h. The membrane was blocked in a buffer TBST washing buffer (10 mM Tris-CI, pH 8.0, 150 mM NaCI, 0.05% Tween- 20) and 5% non-fat dry milk powder for 0.5 h, and then incubated with 1:2000 primary antibodies at 4°C overnight. The membranes were washed with above washing buffer 3x20 mins and then incubated with secondary antibodies for 1 h. After washing, the bound antibodies were visualized with an ECL detection kit.

[0297] Immunofluorescence staining

[0298] Tissue sections were de-paraffinized with xylene, and hydrated with ethanol. Following a wash with Tris-Buffered-Saline (TBS) buffer containing 0.01% Triton X-100, the slides were blocked with 10% goat serum, and then incubated with primary antibody in PBS containing 10% goat serum overnight. The slides were washed and incubated with Alexa Fluor 488, 555 or 647 second antibodies at room temperature for 2 h. DAPI was used to stain DNA. Images of the staining samples were performed using Zeiss Z1 Axio™ confocal laser scanning microscopy.

[0299] Analysis of nuclear F / G-actin in wound healing samples

[0300] Tissue sections were de-paraffinized with xylene and ethanol, washed with Tris- Buffered-Saline (TBS) containing 0.025% Triton X-100. The sections were blocked with 10% goat serum and incubated with 1:3000 Alexa Fluor 488 conjugated Deoxyribonuclease I in TBS containing 10% goat serum at 4 °C overnight. After washed with TBS, the sections were incubated with 1:100 Alexa Fluor™ 555 Pha Hold in and DAPI for 30 min. The images of wound healing skins were randomly selected from central wound healing areas (epidermis and dermis). The Images of the staining samples were performed using Nikon N-SIM S confocal laser scanning microscopy. Five single cells were randomly selected from each image. The intensity of Pha Hold in (F-actin) / Deoxyribonuclease I staining (G-actin) within the cell nucleus (DAPI staining) was analyzed by ImageJ. Phalloidin / Deoxyribonuclease I staining overlapped with DAPI were defined as nuclear F / G-actin staining. The average intensity value of five cells from each image represented F / G-actin intensity of the sample image. However, the Phalloidin / Deoxyribonuclease I staining around the edge of nucleus was excluded, and only the staining away from the nuclear edge was counted as nuclear F / G- actin positive staining.

[0301] Actin Polymerization Assay

[0302] Actin polymerization was conducted using the Actin polymerization biochem kit (BK 003). Pyrene actin was dissolved in G-buffer containing ATP at 0.4 mg / mL and incubated on ice for 1 hour. After centrifugation at 14,000 rpm at 4°C for 30 min, the supernatant was transferred to a 96-well plate with 200 pL / well. Simultaneously, the test cells or tissues were lysed in 20 mM HEPES with 20 mM NaCI. The mixture was subjected to centrifugation at 150,000 x g at 4°C for 1 h. 20 pL of the supernatant was added in each well containing G- actin stock. Actin polymerization buffer was added in the wells to start the reaction. Multiscan Spectrum (BioTek Synergy I) was used to detect actin polymerization for 120 cycles with a 60-second interval.

[0303] Fluorescence in situ Hybridization (FISH)

[0304] An Alexa Fluor™ 488 or 555 labeled DNA oligo probe against circNIgn were generated by fluorescence PCR labeling kit from Biolynx (Brockville, ON, Canada). Thelabeled probes were heated at 95°C for 2 min and chilled on ice before use. The fixed samples were dehydrated by washing for 1 min in 75%, 95% and 100% ethanol, and then pretreated with hybridization solution in 55 °C for 30 mins. Slides were incubated with 80 nM fluorescence labeled DNA oligo probes in hybridization buffer at 55 °C for 2-4 h followed by washes with saline-sodium citrate (SSC) buffers.

[0305] Immunohistochemistry staining (IHC)

[0306] Tissue sections were de-paraffinized with xylene and hydrated with ethanol, and then boiled in a pressure cooker. After washing with Tris-Buffered-Saline (TBS), the sections were blocked with 10% goat serum and incubated with primary antibody overnight. The slides were washed and labeled with biotinylated secondary antibody, followed by avidin conjugated horseradish peroxidase (Vectastain ABC kit, Vector, Burlingame. CA, USA) and DAB staining. Mayer's Hematoxylin was used for counterstaining.

[0307] RT-PCR and real-time PCR

[0308] Cells or tissues were harvested, and total RNA was extracted with the RNA mini kit (Geneaid). Real-time PCR was performed with SYBR Green PCR Kit (Bio-Rad) using 2 pl cDNA as a template with two appropriate primers. Thermocycler conditions were 35 cycles of denaturation at 95 °C for 15 seconds, annealing 55 °C for 10 seconds and extension step of 72 °C for 5 seconds. The AACT method was used to quantify all relative mRNA levels using small nuclear RNA U6 as the reference and internal control.

[0309] Isolation of primary mouse dermal fibroblasts

[0310] Primary mouse dermal fibroblasts were isolated from the skin of 1- to 3-day-old pups from WT and circNIgn transgenic C57BL / 6J mice with outgrowth methods as previously (Rittie L., et al. Methods Mol Med, 2005). Briefly, 10 fragments of small skin biopsies (2 mm) were collected in 10 % FBS / DMEM medium and transferred to 10 cm-culture plates with dermis contacted with the bottom of the dish. After incubated at room temperature for 1 h to allow good adhesion of the dermis onto the dish. 6 ml medium 10 % FBS / DMEM medium was added to the dish, making sure the epidermis exposed to the air, and cultured in the 5% CO2 incubator at 37°C. Culture medium was changed every 2 days. Fibroblast migration outof tissue fragments was monitored using an inverted microscope. Fibroblasts were subcultured when they occupied most of the dish surface between explants two weeks after start of the culture.

[0311] Cell nuclear extraction

[0312] Cells were harvested and resuspended in 500 pl fractionation buffer (25 OmM sucrose, 20 mM HEPES pH 7.4, 10 mM KCI, 2 mM MgCI2, 1 mM EDTA, 1 mM EGTA, and lx Roche protease inhibitor cocktail), and homogenized by 8 passages through a 25 G needle. Centrifugated at 720 x g for 10 min, the pellet contained nuclear fraction. The nuclear pellet was resuspended in 500 pl fractionation buffer and followed by centrifugated at 720 x g for 5 min. After washed 3 times, the extracted nuclear pellet was used for experiment.

[0313] In vivo stented excisional wound model

[0314] All animal experiments were performed in accordance with guidelines and regulations approved by the Animal Care Committee of Sunnybrook Research Institute. The circNIgn-transgenic mouse model was generated by the Toronto Centre for Phenogenomics (TCP) with pronuclear microinjection of circNIgn containing DNA fragment into C57BL / 6J.

[0315] Splinted full-thickness excisional wounds were created as previous described. (1. Dunn, L., et al, 2013. 2. Wang X., et al, 2013) Briefly, Two or four full-thickness dermal wounds of 4 mm diameter were created on the dorsum of each C57BL / 6J mouse using biopsy punches (Miltex, York, PA, USA). A silicone ring was fixed to the dorsal skin around each wound using a Tegaderm transparent waterproof dressing (3M, Saint Paul, MN, USA). The ring was further reinforced using 3 interrupted 3-0 silk sutures placed around the outer edge of the ring to prevent wound contraction. The silicone rings are used to stent the skin and prevent the contraction of panniculus carnosus muscle underneath the dermis after injury. At the end of the study, the wounds were harvested, half kept frozen for PCR and protein analysis or processed to obtain frozen sections, and the other half fixed with 10% buffered formalin and embedded in paraffin for histological evaluation.

[0316] Wound area analysis

[0317] Digital photographs of the wounds were captured at the time of surgery and every day thereafter until the end of the study. For each wound, the wound edges were traced and the area of the wound was analyzed with ImageJ. The calibrated wound sizes evaluated with diameter of the stenting silicone rings with a standard 4 mm hole. Each wound area was normalized to the corresponding initial wound area at postoperative Day zero.

[0318] siRNA-PEG-Au NP synthesis and delivery

[0319] For synthesis of circNIgn siRNA or mixmer-PEG conjugate, 20 nmol thiol modified circNIgn siRNA or mixmer (GenePharma, Shanghai, China) were dissolved in 800 pL of RNase-free water. The mPEG-SH (PGl-TH-2k, Nanocs, New York, NY) were mixed with circNIgn siRNA or mixmer at a 1:20 molar ratio. 10 nm gold nanoparticles (Cytodiagnostics, Burlington, Ontario, Canada) were mixed with above siRNA or mixmer-PEG conjugate at weight ratio of 1:1 for conjugation. The mixture was gently shaken at 60 °C for 30 minutes and transferred into a syringe. The siRNA or mixmer-PEG-Au NP conjugate or blank control were administered intradermally in a volume of 100 pl under the wound as previously described.

[0320] Statistical analysis

[0321] Data were presented as mean (bar) with standard deviation (SD, whisker). A two- tailed unpaired Student's t test was performed to assess the difference between two groups with a single independent factor. For multiple group analyses, a one-way ANOVA followed by a Bonferroni post hoc test for one independent variable, and a two-way ANOVA followed by a Bonferroni correction for two independent variables were performed. Prism 8 (GraphPad Software: La Jolla, CA) was used for above statistical analyses and differences considered statistically significant when p<0.05.

[0322] Results

[0323] Effects of circNIgn on wound repair

[0324] In line with the inventors' prior investigations demonstrating the involvement of circular RNAs in skin wound repair

[0107] , and consistent with findings from other research groups highlighting the regulatory role of circRNAs in tissue repair [108,109], the present study leveraged the inventors' recently established transgenic mice expressing circNIgn to scrutinize its specific impact on skin wound healing

[0017] , Transgenic mice expressing circNIgn and wildtype counterparts underwent splinted full-thickness excisional wounds on the dorsum. Notably, circNlgn(+) mice exhibited a discernible delay in the healing process compared to wildtype mice (Figure 39A). By Day 12, wildtype mice had completely recovered from the skin wound, while wounds in the circNlgn(+) mice persisted on the skin surface (Figure 39B). Histological examination through H&E staining revealed complete wound healing in wildtype mice by Day 9, contrasting with the presence of typical skin wounds in the circNIgn transgenic mice (Figure 39C). Further characterization through in situ hybridization and immunohistochemical staining confirmed a significant upregulation of circNIgn and the circNIgn-encoding protein, Nlgnl73, on Day 9 (Figure 39D-E). Tracking the expression curve of circNIgn in wildtype mice revealed a substantial increase in circNIgn levels during the early stages of the healing process, peaking around five days (Figure 39F). This temporal pattern suggests a dynamic influence of circNIgn on wound repair. Interestingly, the subsequent normalization of circNIgn levels in wildtype mice indicated that a downregulation of circNIgn is essential for the completion of the wound healing process.

[0325] To assess the impact of circNIgn on wound healing, primary dermal fibroblasts (PDFs) were isolated from wildtype (WT), circNlgn(-), and circN lgn(+) mice. Confirming the hypothesis, the isolated PDFs from circN Ign (+) mice exhibited significantly elevated levels of circNIgn, while linear Nlgn mRNA levels remained unchanged (Figure 39G). Exploring the functional consequences, the proliferation rates of these isolated cells was investigated. Notably, heightened expression of circNIgn was associated with a reduction in cell proliferation (Figure 39H) and a deceleration in cell cycle progression (Figure 40A). Expanding our investigation, we extended our analysis to human keratinocyte cell line HaCatand mouse fibroblast cell line NIH3T3. Transfection of both cell lines with a circNIgn expression construct or a control vector confirmed the specific expression of circNIgn, while linear Nlgn mRNA remained unaffected (Figure 40B). Ectopic expression of circNIgn in both HaCat and NIH3T3 cells mirrored the observations from isolated PDFs, resulting in decreased cell proliferation (Figure 40C) and impeded cell cycle progression (Figure 40D). In cell survival assays, PDFs from circNlgn(+) mice exhibited reduced cell survival under serum- free conditions or H2O2 treatment (Figure 391) and an increased incidence of cell apoptosis (Figure 41A). Similarly, both circNIgn-transfected HaCat and NIH3T3 cells displayed diminished cell survival under serum-free conditions (Figure 41B) and increased susceptibility to H2O2-induced apoptosis (Figure 41C), further supporting the notion that circNIgn plays a role in modulating cell survival and apoptosis (Figure 41D).

[0326] The roles of endogenous circNlgn / Nlgnl73 in wound repair were investigated using a full-thickness wound excision model in normal C57BL / 6J mice. siRNAs targeting circNIgn and a mixmer inhibiting the translation of circNIgn, both conjugated with gold nanoparticles as previously described

[0017] , were delivered following the wound induction. Wound progression was monitored, and photographic documentation was captured (Figure 42A). On Day 8, a noticeable enhancement in wound repair was observed upon delivery of circNIgn siRNAs and mixmer, reaching statistically significant levels on Day 5 and 8 (Figure 42B, Figure 42C). Histological analysis using H&E staining of the wounds on Day 5 further confirmed the promotion of wound healing with the delivery of circNIgn mixmer and siRNAs (Figure 42D). Subsequent examination through in situ hybridization and immunofluorescence staining revealed an augmented expression of circNIgn and Nlgnl73 protein, corroborating their role in enhancing wound healing (Figure 42E, Figure 43A).

[0327] PDFs, HaCat and NIH3T3 cells were transfected with circNIgn siRNAs, resulting in decreased expression of circNIgn in PDFs (Figure 43B), HaCat and NIH3T3 cells (Figure 43C). Silencing circNIgn increased proliferation of PDFs (Figure 42F), HaCat and NIH3T3 cells Figure 43D), as well as cell cycle progression (Figure 43E-F). Thus, silencing circNIgn enhanced survival of PDFs (Figure 42G), HaCat and NIH3T3 cells when the cells were cultured in serum- free medium (Figure 44A), or treated with H2O2 (Figure 44B). Consistently, silencing circNIgn decreased apoptosis of PDFs (Figure 44C), HaCat and NIH3T3 cells when the cells were treated with H2O2 (Fig S4D).

[0328] The cells were treated with mixmer to inhibit circNIgn translation. Treatment with mixmer did not change circNIgn and Nlgn mRNA levels of PDFs (Figure 45A), but it potently increased proliferation and survival of PDFs when the cells were cultured in serum-free medium (Figure 42H). It also enhanced cell cycle progression (Figure 45B), survival (Figure 45C), when the cells were treated with H2O2. Cultured in serum-free medium or cultured with H2O2, PDFs displayed decreased apoptosis (Figure 45D). These results verified the potential therapeutics by inhibiting circNIgn translation.

[0329] Effects of circNIgn on EMT in vitro

[0330] PDFs isolated from WT, circNlgn(-) and circNlgn(+) mice were examined and distinct alterations in cell morphology were observed. PDFs isolated from circNlgn(+) mice displayed cuboidal epithelial morphology, while PDFs isolated from WT and circNlgn(-) mice appeared fibroblast morphology (Figure 46A). To test whether the change in cell morphology was indicative of epithelial-mesenchymal transition (EMT), levels of EMT associated molecules were measured by real-time PCR and an increase in E-cadherin levels but decrease in N- cadherin and vimentin levels was observed in PDFs isolated from circNlgn(+) mice (Figure 46B). Western blot analysis also detected an increase in Nlgnl73 and E-cadherin levels but a decrease in N-cadherin and vimentin levels in PDFs isolated from circNlgn(+) mice (Figure 46C). The cells were subjected to subcellular fractionation. PDFs isolated from circNlgn(+) mice showed nuclear translocation of Nlgnl73. HaCat cells transfected with circNIgn expression construct also displayed increased E-cadherin but decreased N-cadherin and vimentin levels, measured by real-time PCR (Figure 47A). HaCat and NIH3T3 cells transfected with circNIgn expression construct confirmed increased expression of Nlgnl73 and E-cadherin but decreased levels of N-cadherin and vimentin, measured by Western blot (Figure 47B).

[0331] The effect of endogenous circNIgn was then testd by transfecting mouse primary PDFs with siRNAs targeting mouse circNIgn. Silencing endogenous circNIgn enhanced PDF elongation (Figure 46D), repressed E-cadherin, but increased N-cadherin and vimentin expression (Figure 46E). Western blot showed that silencing circNIgn decrease in Nlgnl73 and E-cadherin levels but increase in N-cadherin and vimentin expression (Figure 46F). Transfection with siRNAs targeting human circNIgn in HaCat cells showed increased cellelongation (Figure 47C), decreased E-cadherin, but increased N-cadherin and vimentin expression, measured by real-time PCR (Figure 47D). HaCat and NIH3T3 cells transfected with siRNAs targeting human and mouse circNIgn, respectively, confirmed decreased levels of Nlgnl73 and E-cadherin, but increased N-cadherin and vimentin expression, measured by Western blot (Figure 47E).

[0332] To confirm the role of Nlgnl73, PDFs were transfected with a mixmer targeting circNIgn translation. Inhibition of circNIgn translation increased cell elongation (Figure 46G), consisting with decrease in E-cadherin expression but increase in N-cadherin and vimentin expression (Figure 46H).

[0333] Impact of circNIgn on EMT associated with wound healing process

[0334] Next the influence of circNIgn expression on wound healing associated with EMT was studied. The wound tissues from WT and circNlgn(+) mice on Day 9 were subjected to IHC staining. Increased E-cadherin, but decreased N-cadherin and vimentin expression was detected in the wound tissues (Figure 48A). Consistent findings were obtained through immunofluorescence staining (Figure 48B), and the fluorescence intensities were quantified using ImageJ analysis to affirm the statistical significance of the differences (Figure 48C). Since changes in cell morphology would alter cell migration, PDFs isolated from these mice were subjected to camber cell migration assay. The assay showed that increased expression of circNIgn inhibited cell migration (Figure 48D-E). PDFs were also subjected to wound healing migration assay, and it showed that increased expression of circNIgn inhibited cell migration (Figure 48F, Figure 49A). NIH3T3 and HaCat cells transfected with control vector or circNIgn were subjected to camber migration assay (Figure 49B) and wound healing migration assay (Figure 49C-D). Consistently, overexpression of circNIgn decreased cell migration.

[0335] Subsequently the effect of endogenous circNlgn / Nlgnl73 on wound healing process was examined. The wounds were treated every other day with control oligo, circNIgn siRNAs to silence endogenous circNIgn, and mixmer to inhibit circNIgn translation. Wound tissues were harvested on Day 6 and subjected to immunohistochemical staining. We observed decreased E-cadherin, but increased N-cadherin and vimentin expression in the woundtissues treated with circNIgn siRNA and mixmer (Figure 50A). The tissues were also subjected to immunofluorescence staining. Clear decrease in E-cadherin (Figure 50B), but increase in N-cadherin (Figure 50C) and vimentin (Figure 50D) expression were detected in the wounds treated with circNIgn siRNA and mixmer. Quantitation analysis with ImageJ showed significant decrease in E-cadherin, but increase in N-cadherin and vimentin expression in the wounds treated with circNIgn siRNA and mixmer (Figure 50E).

[0336] To validate and extend these findings, circNIgn siRNAs (Figure 51A) and mixmer (Figure 51B) were delivered to primary PDFs and camber migration assay was performed. Transfection with circNIgn siRNAs and mixmer enhanced PDF migration. The cells were also subjected to a wound healing migration assay. Transfection with circNIgn siRNAs (Figure 51C) and mixmer (Figure 51D) enhanced PDF migration. Similar experiments were performed in NIH3T3 and HaCat cells. Silencing circNIgn increased migration of cells in camber migration assay (Figure 52A) and wound healing assay (Figure 52B-C).

[0337] Influence of circNIgn on wound repair by regulating nuclear actin polymerization

[0338] Building upon the inventor's recent findings indicating that ectopic expressed circNIgn is translocated to nucleic where it modulates gene transcription

[0017] , and that nuclear actin polymerization plays essential role in EMT by regulating transcription of a number of genes

[0024] , it was herein examined whether circNlgn / Nlgnl73 affected wound repair was associated with nuclear actin polymerization. PDFs were isolated from WT and circNlgn(+) mice and subjected to subcellular fractionation. The cytoplasmic and nuclear fractions were used for actin polymerization assays. We found that nuclear extracts from circNlgn(+) PDFs repressed actin polymerization (Figure 53A). Primary PDFs were transfected with oligo or circNIgn siRNAs and subjected to subcellular fractionation and actin polymerization assays. The nuclear extracts from circNIgn siRNA-transfected PDFs enhanced actin polymerization (Fig 7B).

[0339] To further validate the involvement of circNIgn in actin polymerization, F-actin and G-actin in the total cell lysate and nuclear fraction were separated by high-speed centrifugation, followed by Western blotting. In the PDFs isolated from the transgenic mice, we detected decreased levels of nuclear actin compared to that isolated from WT andcircN Ign(-) mice (Figure 53C). However, silencing circNIgn in the primary PDFs increased nuclear F-actin levels (Figure 53D).

[0340] Immunofluorescence staining was performed to examine nuclear actin in the wound tissues directly by confocal microscopy. The images showed that the levels of F-actin in the circNlgn(+) mice decreased compared to the controls but the levels of nuclear G-actin increased in nuclei of the circNlgn(+) mice compared to the controls in the epidermis (Figure 53E) and dermis (Figure 54A). ImageJ was used to analyze the intensities of F-actin and G- actin. While the total actin intensities were not affected by transgenic expression of circNIgn (Figure 53F), circNlgn(+) epidermis cells exhibited decreased F-actin but increased G-actin in the nuclei of the wound sections compared to the controls (Figure 53G). Similarly, circNlgn(+) dermis cells exhibited decreased F-actin but increased G-actin in the nuclei of the wound sections (Figure 53H). The tissues from the wounds delivered with circNIgn siRNAs and mixmer were subjected to immunofluorescence staining to examine nuclear F-actin and G-actin expression. Delivery of circNIgn siRNAs and mixmer increased nuclear F-actin, but decreased nuclear G-actin levels in the wound sections compared to the oligo control in the epidermis (Figure 55A) and dermis (Figure 54B).

[0341] Delivery of circNIgn siRNAs and LNA Mixmer increased nuclear F-actin but decreased nuclear G-actin levels in the wound sections compared to the oligo control in the epidermis (Figure 55A). ImageJ analysis showed that delivery of circNIgn siRNAs and LNA Mixmer did not affect total F / G-actin levels in the wound sections (Figure 55B). However, the levels of nuclear F-actin were significantly increased and the levels of nuclear G-actin were significantly decreased in the wounds delivered with circNIgn siRNAs and LNA Mixmer, compared to the wounds to which the control oligo was delivered, in both epidermis (Figure 55C) and dermis (Figure 55D). These findings provide compelling evidence that circNIgn modulated nuclear actin dynamics during the wound healing process.

[0342] To corroborate these findings with the results showing that increased nuclear actin polymerization can enhance levels of |3-catenin, SMAD2, and SMAD3, we analyzed expression of these molecules in the circNIgn transgenic mice was analyzed. Decreased expression of |3-catenin, SMAD2, and SMAD3 was detected in the nuclei, but not in the total lysate, of the circNIgn transgenic mice compared to the wt and circNIgn negative mice(Figure 55E). Previous studies found actin depolymerization increased expression of Mybbpla, NKRF, and Mypop resulting in decreased EMT

[0121] , In the Example, the inventors have shown that decreased actin polymerization in the nuclei of the transgenic mice resulted in increased expression of Mybbpla, NKRF, and Mypop, consistent with increased circNIgn expression (Figure 55F). Taken together, the present Example demonstrates that targeting circNIgn can provide a therapeutic approach to promote nuclear actin polymerization and wound repair (Figure 55G).

[0343] Discussion

[0344] Collagen deposition plays a crucial role in skin wound healing as it provides the structural integrity necessary for the formation of new tissue. In the initial phases of wound healing, collagen deposition serves as a constructive force, propelling the healing cascade forward. However, excessive collagen synthesis and deposition lead to hypertrophic scarring and impaired wound healing. In the late stages of wound healing, reducing collagen deposition is an important aspect of the healing process. Strikingly, the results provided in the present example revealed the role of circNIgn in this intricate process, uncovering its potential as a regulator of collagen dynamics and scar formation. Controlling collagen deposition emerges as a dual-edged sword. Studies have explored diverse strategies to modulate this essential aspect of wound healing. For example, Cho et al. reported that collagen synthesis and deposition can be downregulated by silibinin treatment

[0113] , Yagishita et al. showed that topical application of collagenase reduced scarring and improved wound healing in Yorkshire pigs

[0114] , Notably, interventions aiming to expedite wound closure often inadvertently escalate collagen deposition. For instance, silencing maternal embryonic leucine zipper kinase (MELK) by siRNA leads to significantly faster wound healing process and increased collagen deposition

[0115] ,

[0345] The current study focused on an approach centered on circNIgn modulation, demonstrating its substantial impact on skin wound healing. Silencing circNIgn through siRNAs or impeding its translation via a circNIgn-targeting mixmer not only expeditiously advanced the wound healing process but critically curtailed collagen synthesis and deposition, mitigating scar formation. This dual effect positions the present findings as not only clinically relevant but also distinctive in their value for therapeutic translation. Byelucidating the regulatory role of circNIgn in the delicate balance of collagen dynamics during wound repair, these results demonstrates the usefulness of targeting circNIgn in therapeutic interventions aimed at optimizing skin wound healing outcomes.

[0346] During the wound healing process, cell activities are crucial including cell proliferation and migration. In normal skin, epithelial cells possess cell-cell adhesion that displays contact inhibition of cell proliferation and migration. To facilitate proliferation and migration, the cells undergo epithelial-mesenchymal transition (EMT), by which epithelial cells lose their cell-cell adhesion and polarity and acquire mesenchymal-like property. There are three types of EMT. Type-1 EMT occurs in embryogenesis and tissue development. Type- 2 EMT plays roles in tissue regeneration, wound healing, and tissue fibrosis. Type-3 EMT is involved in cancer progression linked to genetic and epigenetic alterations. Type-2 EMT occurs as a repair-associated event when the epithelial cells differentiate into fibroblast-like cells

[0116] , Type-2 EMT intends to rebuild tissues following tissue injury and damage. It is terminated once inflammation is reduced and the repair is completed. During Type-2 EMT, cells proliferate and migrate to the wound sites to close the wounds. Previous studies have shown that EMT is critical in skin wound healing. It has been reported that epithelial cells in the wound margins and deep epithelial ridges acquired mesenchymal characteristics such as increased vimentin expression

[0117] , The present results showed that expression of circNIgn decreased EMT, while silencing circNIgn and inhibiting circNIgn translation promoted EMT leading to increased cell proliferation, survival, migration, and wound healing process. Importantly, silencing circNIgn or inhibiting circNIgn translation decreased collagen synthesis, demonstrating that targeting circNIgn can be used for decreasing scarring.

[0347] Concomitant with the augmented epithelial-mesenchymal transition (EMT) observed in this study, a discernible shift in the expression levels of key EMT markers was observed. Specifically, there was a downregulation of E-cadherin coupled with an elevation in N-cadherin and vimentin expression. In epithelial cells, E-cadherin plays a crucial role in maintaining the cell-cell adhesion and tissue integrity

[0118] , E-cadherin is a calciumdependent transmembrane glycoprotein expressed in various cell types especially in epithelial cells. To facilitate cell proliferation and migration, E-cadherin is down regulated in the early stages of wound healing process. Previous studies have demonstrated the importance of E-cadherin expression in skin wound healing [118,119], N-cadherin is anothercalcium-dependent cell adhesion molecule that plays a crucial role in modulating various biological processes including cell migration and wound repair

[0120] , In the early stages of wound healing, N-cadherin expression is upregulated in fibroblasts and keratinocytes. This contributes to the formation of granulation tissue promoting wound repair. N-cadherin also promotes the migration of fibroblasts and keratinocytes in the wound bed. Previous studies have demonstrated that N-cadherin played essential role in cell migration [121,125], Vimentin is an intermediate filament protein that plays an essential role in coordinating fibroblast proliferation and keratinocyte differentiation during wound repair [123,124], The present results showed that circNIgn regulated EMT by modulating levels of E-cadherin, N- cadherin, and vimentin, which is consistent with their roles reported in the literature.

[0348] While not intending to be bound by theory, mechanistically, circNIgn modulating EMT and wound repair appears to occur through nuclear actin polymerization. Nuclear actin polymerization plays a critical role in gene expression and chromatin remodeling [86,125, 126], It is a process for monomeric actin (G-actin) to polymerize into filamentous actin (F- actin) in the nucleus. Example 2, above showed that silencing circNIgn promoted nuclear actin polymerization, decreased inflammation, and mitigated colitis. This Example has shown for the first time that silencing circNIgn increased nuclear actin polymerization and enhanced wound healing process. In the wound tissues of the circNIgn transgenic mice, nuclear G-actin levels increased, but F-actin levels decreased, although the total levels of G- actin and F-actin were similar. On the other hand, silencing endogenous circNIgn or inhibiting circNIgn translation in the wound decreased nuclear G-actin but increased F-actin in the nuclei, leading to enhanced would healing and decreased collagen synthesis. This is of clinical implication and demonstrates that circNIgn siRNAs or mixmers targeting circNIgn translation can function as therapeutic agents to treat wound tissues and optimize wound healing outcomes.

[0349] EXAMPLE 4: Treatment of Prostate Cancer by targeting circNIgn

[0350] The present inventors have now determined that circNIgn is significantly upregulated in human invasive prostate cancer (Figure 55A). Human prostate cancer cell lines expressed significantly higher levels of circNIgn relative to a non-tumorigenic prostate epithelial cellline (Figure 55B). Further forced expression of circNIgn downregulated PIAS3 expression (Figure 56).

[0351] PIAS3 is a known tumor suppressor in prostate cancer [127,128], PIAS3 is a downstream effector of nuclear actin polymerization, highlighting their convergence within nuclear signaling pathways. This is in agreement with previous findings, described herein, that Nlgnl73 localizes to the nucleus, where it interacts with nuclear actin and competitively inhibits the Arp2 / 3 complex.

[0352] The present study demonstrates the effect of targeting circNIgn in treatment of prostate cancer.

[0353] Materials and Methods

[0354] Real-time PCR

[0355] Tissues or cells were harvested, and total RNA was extracted with the RNA mini kit (Geneaid). Real-time PCR was performed with SYBR Green PCR Kit (Bio-Rad). Two pl cDNAs were used as templates with two appropriate primers for cDNA amplification. Thermocycler conditions allowing cDNA being synthesized were 35 cycles of denaturation at 95°C for 15 seconds, annealing at 56°C for 10 seconds, and extension step of 72°C for 5 seconds. The AACT method was used to quantify all the relative mRNA levels using small nuclear RNA U6 as the internal reference and control.

[0356] Mammosphere formation assay

[0357] There were two sets of mammosphere formation assays. The prostate cancer cells that express relatively lower levels of circNIgn (e.g. PC3 cells) were transfected with circNIgn expression constructs or a control vector. The prostate cancer cells that express relatively higher levels of circNIgn (e.g. DU145 cells) were transfected with the LNA mixmer, two siRNAs targeting circNIgn (serving as positive controls) and control oligos (serving as negative control). The cells were mechanically and enzymatically dissociated in 0.05% Trypsin-EDTA at 37°C for 10 minutes, followed by resuspension in serum-free culture medium. Single cell suspensions were plated in 60-mm Petri dishes at 1000 cells / well. Afterculturing for additional 4 days, the images of sphere cells were captured and cell numbers in each sphere were counted.

[0358] Cell invasion assay

[0359] There were two sets of invasion assays. The prostate cancer cells that express relatively lower levels of circNIgn (e.g. PC3 cells) were transfected with circNIgn expression constructs or a control vector. The prostate cancer cells that express relatively higher levels of circNIgn (e.g. DU145 cells) were transfected with the LNA mixmer, two siRNAs targeting circNIgn (serving as positive controls) and control oligos (serving as negative control). The cells (lxlO5per well) were suspended in serum-free medium and loaded into transwell membrane inserts that were pre-coated with 50 ml of 10% Matrigel. The inserts were placed in 24-well plates containing medium supplemented with 10% FBS. Cells were incubated at 37 °C and allowed to invade through the Matrigel and the membrane pores in the inserts. The upper Matrigel layer and cells were removed 48 h after cell inoculation. The cells that invaded to the lower side of the membrane were fixed with methanol and stained with Coomassie brilliant blue. Cells on the lower surface were counted from representative areas for quantification and representative images were captured.

[0360] Results

[0361] Expression of circNIgn in prostate cancer.

[0362] Levels of expressed circNIgn were measured in prostate cancer patients. As illustrated in Figure 56A, high invasive prostate cancer patients, i.e., those having a Gleason Score of 8 or higher, were found to express higher levels of circNIgn than low invasive patients, i.e., those having a Gleason Score of 6 or less. Further studies using human prostate cancer cell lines (LNCaP, Dul45, and PC3) and a normal prostate cancer cell line (BPHL) also demonstrated that prostate cancer cells express higher levels of circNIgn than the normal prostate cells (Figure 56B).

[0363] To study the effect of circNIgn on prostate cancer cells (PC3), prostate cancer cells were transfected with circNIgn construct and a control vector. Transfection with circNIgn increased circNIgn levels (Figure 57A), but did not affect parental Nlgn mRNA levels (Figure57B) relative to the transfection with vector and the un-transfected cells. Interestingly, transfection with circNIgn decreased the levels of the tumor suppressor PIAS3 (Figure 57C).

[0364] Targeting circNIgn

[0365] Targeting circNIgn using a mixmer as described herein was found to increase expression of the tumor suppressor PIAS3. Prostate cancer cells (PC3) were transfected with LNA Mixmer and siRNAs targeting circNIgn, or a control oligo. Transfection with siRNAs decreased circNIgn levels as expected (Figure 58A). Transfection with LNA Mixmer did not affect levels of circNIgn (Figure 58A) and Nlgn (Figure 58B), indicative of no off-target effect. Transfection with the LNA Mixmer and siRNAs decreased levels of the tumor suppressor PIAS3 (Figure 58C).

[0366] Mixmer treatment was also found to decrease prostate cancer cell invasion. Prostate cancer cells (PC3 and Dul45) were transfected with circNIgn (Figure 59A) and siRNAs or LNA Mixmer targeting circNIgn (Figure 59B). Transfection with circNIgn increased cell invasion activity (Figure 59A). Transfection with siRNA and LNA Mixmer decreased cell invasion activity (Figure 59B). n=6, ** p<0.01. Representative images of cell invasion are shown for PC3 cells (Figure 59C) and Dul45 cells (Figure 59D).

[0367] Mixmer treatment was also found to decreases prostate cancer cell proliferation and sphere formation. Prostate cancer cells (PC3 and Dul45) were transfected with circNIgn and siRNAs or LNA Mixmer targeting circNIgn. The transfected cells were subjected to cell proliferation assay (Figure 60A-B) and sphere formation assay (Figure 60C-F), to mimick tumor formation. Transfection with circNIgn promoted cell proliferation (Figure 60A) and sphere formation (Figure 60C and E), increasing the number of cells per sphere. Transfection with siRNA and LNA Mixmer decreased cell proliferation (Figure 60B) and sphere formation (Figure 60 D and F). Typical images of spheres are shown for circNIgn in Figure 60E and for siRNAs and LNA mixmer assays in Figure 60F.

[0368] Discussion

[0369] As described elsewhere herein, translation of circNIgn yields an additional nine amino acids spanning the back-splice junction, which significantly modulate Nlgnl73function. As also demonstrated elsewhere herein, mixmers targeting circNIgn can effectively suppress translation of circNIgn into Nlgnl73 and can be used as a targeted therapeutic approach to inhibit cancer development / progression if a cancer expresses increased levels of circNlgn / Nlgnl73.

[0370] In the present Example, transfection of DU145 prostate cancer cells with the LNA mixmer led to a significant reduction in Nlgnl73 levels. Treatment with circNIgn decreased expression of the tumor suppressor PIAS3 (Figure 57). In contrast, treatment with the mixmer targeting circNIgn did not affect circNIgn levels, but did increase expression of the tumor suppressor PIAS3 (Figure 57), decrease cell invasion (Figure 58), and inhibit cancer cell proliferation and tumor sphere formation (Figure 59). Thus, the LNA mixmer functioned similar to circNIgn siRNA, but with specific targeting of circNIgn translation. These findings establish a strong basis for the use of LNA mixmers to inhibit circNIgn translation to treat or prevent prostate cancer by suppressing prostate cancer progression.

[0371] References1. Misir, S, Wu, N, and Yang, BB (2022). Specific expression and functions of circular RNAs. Cell death and differentiation 29: 481-491.2. Zhang, C, Huo, ST, Wu, Z, Chen, L, Wen, C, Chen, H, Du, WW, Wu, N, Guan, D, Lian, S, et al. (2020). Rapid Development of Targeting circRNAs in Cardiovascular Diseases. Molecular therapy Nucleic acids 21: 568-576.3. Schulte, C, Barwari, T, Joshi, A, Theofilatos, K, Zampetaki, A, Barallobre-Barreiro, J, Singh, B, Sorensen, NA, Neumann, JT, Zeller, T, et al. (2019). Comparative Analysis of Circulating Noncoding RNAs Versus Protein Biomarkers in the Detection of Myocardial Injury. Circulation research 125: 328-340.4. Gupta, SK, Garg, A, Bar, C, Chatterjee, S, Foinquinos, A, Milting, H, Streckfuss- Bomeke, K, Fiedler, J, and Thum, T (2018). Quaking Inhibits Doxorubicin-Mediated Cardiotoxicity Through Regulation of Cardiac Circular RNA Expression. Circulation research 122: 246-254.5. Wu, N, Xu, J, Du, WW, Li, X, Awan, FM, Li, F, Misir, S, Eshaghi, E, Lyu, J, Zhou, L, et al. (2021). YAP Circular RNA, circYap, Attenuates Cardiac Fibrosis via Binding withT ropomyosin-4 and Gamma-Actin Decreasing Actin Polymerization. Mol Ther 29: 1138- 1150.6. Lu, D, Chatterjee, S, Xiao, K, Riedel, I, Huang, CK, Costa, A, Cushman, S, Neufeldt, D, Rode, L, Schmidt, A, et al. (2022). A circular RNA derived from the insulin receptor locus protects against doxorubicin-induced cardiotoxicity. European heart journal 43: 4496- 4511.7. Tan, WL, Lim, BT, Anene-Nzelu, CG, Ackers-Johnson, M, Dashi, A, See, K, Tiang, Z, Lee, DP, Chua, WW, Luu, TD, et al. (2017). A landscape of circular RNA expression in the human heart. Cardiovascular research 113: 298-309.8. Lim, TB, Aliwarga, E, Luu, TDA, Li, YP, Ng, SL, Annadoray, L, Sian, S, Ackers-Johnson, MA, and Foo, RS (2019). Targeting the highly abundant circular RNA circSlc8al in cardiomyocytes attenuates pressure overload induced hypertrophy. Cardiovascular research 115: 1998-2007.9. Du, WW, Yang, W, Chen, Y, Wu, ZK, Foster, FS, Yang, Z, Li, X, and Yang, BB (2017). Foxo3 circular RNA promotes cardiac senescence by modulating multiple factors associated with stress and senescence responses. Eur Heart J 38: 1402-1412.10. Huang, S, Li, X, Zheng, H, Si, X, Li, B, Wei, G, Li, C, Chen, Y, Liao, W, Liao, Y, et al. (2019). Loss of Super-Enhancer-Regulated circRNA Nfix Induces Cardiac Regeneration After Myocardial Infarction in Adult Mice. Circulation 139: 2857-2876.11. Shan, K, Liu, C, Liu, BH, Chen, X, Dong, R, Liu, X, Zhang, YY, Liu, B, Zhang, SJ, Wang, JJ, et al. (2017). Circular Noncoding RNA HIPK3 Mediates Retinal Vascular Dysfunction in Diabetes Mellitus. Circulation 136: 1629-1642.12. Bei, Y, Yang, T, Wang, L, Holvoet, P, Das, S, Sluijter, JPG, Monteiro, MC, Liu, Y, Zhou, Q, and Xiao, J (2018). Circular RNAs as Potential Theranostics in the Cardiovascular System. Molecular therapy Nucleic acids 13: 407-418.13. Yang, L, Han, B, Zhang, Z, Wang, S, Bai, Y, Zhang, Y, Tang, Y, Du, L, Xu, L, Wu, F, et al. (2020). Extracellular Vesicle-Mediated Delivery of Circular RNA SCMH1 Promotes Functional Recovery in Rodent and Nonhuman Primate Ischemic Stroke Models. Circulation 142: 556-574.14. Yang, W, Du, WW, Li, X, Yee, AJ, and Yang, BB (2016). Foxo3 activity promoted by non-coding effects of circular RNA and Foxo3 pseudogene in the inhibition of tumor growth and angiogenesis. Oncogene 35: 3919-3931.15. Du, WW, Yang, W, Liu, E, Yang, Z, Dhaliwal, P, and Yang, BB (2016). Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2.-2858.16. Wen, SY, Qadir, J, and Yang, BB (2022). Circular RNA translation: novel protein isoforms and clinical significance. Trends in molecular medicine 28: 405-420.17. Du, WW, Xu, J, Yang, W, Wu, N, Li, F, Zhou, L, Wang, S, Li, X, He, AT, Du, KY, et al. (2021). A Neuroligin Isoform Translated by circNIgn Contributes to Cardiac Remodeling. Circulation research 129: 568-582.18. Xu, J, Du, WW, Wu, N, Li, F, Li, X, Xie, Y, Wang, S, and Yang, BB (2022). The circular RNA circNIgnmediates doxorubicin-inducedcardiac remodeling and fibrosis. Molecular therapy Nucleic acids 28: 175-189.19. Zhang, M, Zhao, K, Xu, X, Yang, Y, Yan, S, Wei, P, Liu, H, Xu, J, Xiao, F, Zhou, H, et al. (2018). A peptide encoded by circular form of LINC-PINT suppresses oncogenic transcriptional elongation in glioblastoma. Nature communications 9: 4475.20. Gao, X, Xia, X, Li, F, Zhang, M, Zhou, H, Wu, X, Zhong, J, Zhao, Z, Zhao, K, Liu, D, et al. (2021). Circular RNA-encoded oncogenic E-cadherin variant promotes glioblastoma tumorigenicity through activation of EGFR-STAT3 signalling. Nature cell biology 23: 278- 291.21. Legnini, I, Di Timoteo, G, Rossi, F, Morlando, M, Briganti, F, Sthandier, O, Fatica, A, Santini, T, Andronache, A, Wade, M, et al. (2017). Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular cell 66: 22-37 e29.22. Huang, CK, Kafert-Kasting, S, and Thum, T (2020). Preclinical and Clinical Development of Noncoding RNA Therapeutics for Cardiovascular Disease. Circulation research 126: 663-678.23. Yla-Herttuala, S, and Baker, AH (2017). Cardiovascular Gene Therapy: Past, Present, and Future. Molecular therapy : the journal of the American Society of Gene Therapy 25: 1095-1106.24. Memczak, S, Jens, M, Elefsinioti, A, Torti, F, Krueger, J, Rybak, A, Maier, L, Mackowiak, SD, Gregersen, LH, Munschauer, M, et al. (2013). Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495: 333-338.25. Chen, S, Huang, V, Xu, X, Livingstone, J, Soares, F, Jeon, J, Zeng, Y, Hua, JT, Petricca, J, Guo, H, et al. (2019). Widespread and Functional RNA Circularization in Localized Prostate Cancer. Cell 176: 831-843 e822.26. Pamudurti, NR, Patop, IL, Krishnamoorthy, A, Ashwal-Fluss, R, Bartok, O, and Kadener, S (2020). An in vivo strategy for knockdown of circular RNAs. Cell Discov 6: 52.27. Wu, N, Qadir, J, and Yang, BB (2022). CircRNA perspective: new strategies for RNA therapy. Trends in molecular medicine 28: 343-344.28. Jakobi, T, Czaja-Hasse, LF, Reinhardt, R, and Dieterich, C (2016). Profiling and Validation of the Circular RNA Repertoire in Adult Murine Hearts. Genomics, proteomics & bioinformatics 14: 216-223.29. Wu, N, Li, F, Yang, W, Du, WW, Awan, FM, Zhang, C, Lyu, J, Misir, S, Zeng, K, Eshaghi, E, et al. (2023). Silencing mouse circular RNA circSlc8al by circular antisense cA- circSlc8al induces cardiac hepatopathy. Molecular therapy : the journal of the American Society of Gene Therapy 31: 1688-1704.30. Aufiero, S, Reckman, YJ, Pinto, YM, and Creemers, EE (2019). Circular RNAs open a new chapter in cardiovascular biology. Nat Rev Cardiol 16: 503-514.31. Garikipati, VNS, Verma, SK, Cheng, Z, Liang, D, Truongcao, MM, Cimini, M, Yue, Y, Huang, G, Wang, C, Benedict, C, et al. (2020). Author Correction: Circular RNA CircFndc3b modulates cardiac repair after myocardial infarction via FUS / VEGF-A axis. Nature communications 11: 2234.32. Zeng, Y, Du, WW, Wu, Y, Yang, Z, Awan, FM, Li, X, Yang, W, Zhang, C, Yang, Q, Yee, A, et al. (2017). A Circular RNA Binds To and Activates AKT Phosphorylation and Nuclear Localization Reducing Apoptosis and Enhancing Cardiac Repair. Theranostics 7: 3842- 3855.33. Meganck, RM, Borchardt, EK, Castellanos Rivera, RM, Scalabrino, ML, Wilusz, JE, Marzluff, WF, and Asokan, A (2018). Tissue-Dependent Expression and Translation of Circular RNAs with Recombinant AAV Vectors In Vivo. Mol Ther Nucleic Acids 13: 89-98.34. Ma, J, Du, WW, Zeng, K, Wu, N, Fang, L, Lyu, J, Yee, AJ, and Yang, BB (2021). An antisense circular RNA circSCRIB enhances cancer progression by suppressing parental gene splicing and translation. Molecular therapy : the journal of the American Society of Gene Therapy 29: 2754-2768.35. Du, WW, Li, X, Ma, J, Fang, L, Wu, N, Li, F, Dhaliwal, P, Yang, W, Yee, AJ, and Yang, BB (2022). Promotion of tumor progression by exosome transmission of circular RNA circSKA3. Molecular therapy Nucleic acids 27: 276-292.36. Fang, L, Du, WW, Lyu, J, Dong, J, Zhang, C, Yang, W, He, A, Kwok, YSS, Ma, J, Wu, N, et al. (2018). Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnbl. Cell death and differentiation 25: 2195-2208.37. Piwecka, M, Glazar, P, Hernandez-Miranda, LR, Memczak, S, Wolf, SA, Rybak-Wolf, A, Filipchyk, A, Klironomos, F, Cerda Jara, CA, Fenske, P, et al. (2017). Loss of a mammalian circular RNA locus causes miRNA deregulation and affects brain function. Science 357.38. Zhang, Y, Nguyen, TM, Zhang, XO, Wang, L, Phan, T, Clohessy, JG, and Pandolfi, PP (2021). Optimized RNA-targeting CRISPR / Casl3d technology outperforms shRNA in identifying functional circRNAs. Genome Biol 22: 41.39. Li, S, Li, X, Xue, W, Zhang, L, Yang, LZ, Cao, SM, Lei, YN, Liu, CX, Guo, SK, Shan, L, et al. (2021). Screening for functional circular RNAs using the CRISPR-Casl3 system. Nature methods 18: 51-59.40. McKinsey, TA, Foo, R, Anene-Nzelu, CG, Travers, JG, Vagnozzi, RJ, Weber, N, and Thum, T (2023). Emerging epigenetic therapies of cardiac fibrosis and remodelling in heart failure: from basic mechanisms to early clinical development. Cardiovascular research 118: 3482-3498.41. He, AT, Liu, J, Li, F, and Yang, BB (2021). Targeting circular RNAs as a therapeutic approach: current strategies and challenges. Signal transduction and targeted therapy 6: 185.42. Li, F, Yang, Q, He, AT, and Yang, BB (2021). Circular RNAs in cancer: Limitations in functional studies and diagnostic potential. Seminars in cancer biology 75: 49-61.43. Zhang, M, Huang, N, Yang, X, Luo, J, Yan, S, Xiao, F, Chen, W, Gao, X, Zhao, K, Zhou, H, et al. (2018). A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis. Oncogene 37: 1805-1814.44. Berridge, CW, and Waterhouse, BD (2003). The locus coeruleus-noradrenergic system: modulation of behavioral state and state-dependent cognitive processes. Brain research Brain research reviews 42: 33-84.45. Baker, JG (2010). The selectivity of beta-adrenoceptor agonists at human betal-, beta2- and beta3-adrenoceptors. British journal of pharmacology 160: 1048-1061.46. Yuan, YW, Wang, L, Lu, ZY, Long, Y, Jiao, YF, Xia, Q, Wen, DX, and Yu, WF (2016). Overexcited MaxiK and K(ATP) channels underlie obstructive jaundice-induced vasoconstrictor hyporeactivity of arterial smooth muscle. Scientific reports 6: 39246.47. Cleland, JGF, Bunting, KV, Flather, MD, Altman, DG, Holmes, J, Coats, AJS, Manzano, L, McMurray, JJV, Ruschitzka, F, van Veldhuisen, DJ, et al. (2018). Beta-blockers for heart failure with reduced, mid-range, and preserved ejection fraction: an individual patientlevel analysis of double-blind randomized trials. European heart journal 39: 26-35.48. Harada, D, Asanoi, H, Noto, T, and Takagawa, J (2020). The impact of right ventricular dysfunction on the effectiveness of beta-blockers in heart failure with preserved ejection fraction. Journal of cardiology 76: 325-334.49. Bavishi, C, Chatterjee, S, Ather, S, Patel, D, and Messerli, FH (2015). Beta-blockers in heart failure with preserved ejection fraction: a meta-analysis. Heart failure reviews 20: 193-201.50. Briasoulis, A, Pa I la, M, and Afonso, L (2015). Meta-analysis of the effects of carvedilol versus metoprolol on all-cause mortality and hospitalizations in patients with heart failure. The American journal of cardiology 115: 1111-1115.51. Kishi, T, and Fujii, E (2019). Carvedilol and bisoprolol as initial therapy for adult hypertension without compelling indications. Hypertension research : official journal of the Japanese Society of Hypertension 42: 496-503.52. Ehler, E, Moore-Morris, T, and Lange, S (2013). Isolation and culture of neonatal mouse cardiomyocytes. Journal of visualized experiments : JoVE.53. Graham, EL, Balia, C, Franchino, H, Melman, Y, del Monte, F, and Das, S (2013). Isolation, culture, and functional characterization of adult mouse cardiomyoctyes. Journal of visualized experiments :JoVE: e50289.54. Fang, L, Du, WW, Lyu, J, Dong, J, Zhang, C, Yang, W, He, A, Kwok, YSS, Ma, J, Wu, N, et al. (2018). Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnbl. Cell death and differentiation.55. Ray, K. Inflammation: Colitis, microbiota and malnutrition. Nature reviews. Gastroenterology & hepatology 9, 490 (2012).56. Lima, S.F. et al. Transferable Immunoglobulin A-Coated Odoribacter splanchnicus in Responders to Fecal Microbiota Transplantation for Ulcerative Colitis Limits Colonic Inflammation. Gastroenterology 162, 166-178 (2022).57. Davrandi, M., Harris, S., Smith, P.J., Murray, C.D. & Lowe, D.M. The Relationship Between Mucosal Microbiota, Colitis, and Systemic Inflammation in Chronic Granulomatous Disorder. Journal of clinical immunology 42, 312-324 (2022).58. Tang, X. et al. Gut microbiota-mediated lysophosphatidylcholine generation promotes colitis in intestinal epithelium-specific Fut2 deficiency. Journal of biomedical science 28, 20 (2021).59. Lechuga, S. et al. Loss of beta-Cytoplasmic Actin in the Intestinal Epithelium Increases Gut Barrier Permeability in vivo and Exaggerates the Severity of Experimental Colitis. Frontiers in cell and developmental biology 8, 588836 (2020).60. Rodriguez-Boulan, E. & Macara, LG. Organization and execution of the epithelial polarity programme. Nature reviews. Molecular cell biology 15, 225-242 (2014).61. Pollard, T.D. & Cooper, J. A. Actin, a central player in cell shape and movement. Science 326, 1208-1212 (2009).62. Geiger, B., Spatz, J.P. & Bershadsky, A.D. Environmental sensing through focal adhesions. Nature reviews. Molecular cell biology 10, 21-33 (2009).63. Kapoor, P. & Shen, X. Mechanisms of nuclear actin in chromatin-remodeling complexes. Trends in cell biology 2 , 238-246 (2014).64. Posern, G., Sotiropoulos, A. & Treisman, R. Mutant actins demonstrate a role for unpolymerized actin in control of transcription by serum response factor. Molecular biology of the cell 13, 4167-4178 (2002).65. Chen, M. & Shen, X. Nuclear actin and actin-related proteins in chromatin dynamics. Current opinion in cell biology 19, 326-330 (2007).66. Sokolova, M. et al. Nuclear Actin Is Required for Transcription during Drosophila Oogenesis. iScience 9, 63-70 (2018).67. Caridi, C.P. et al. Nuclear F-actin and myosins drive relocalization of heterochromatic breaks. Nature 559, 54-60 (2018).68. Schrank, B.R. et al. Nuclear ARP2 / 3 drives DNA break clustering for homology- directed repair. Nature 559, 61-66 (2018).69. Plessner, M. & Grosse, R. Dynamizing nuclear actin filaments. Current opinion in cell biology 56, 1-6 (2019).70. Viita, T. et al. Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. Journal of cell science 132 (2019).71. Le, H.Q. et al. Mechanical regulation of transcription controls Polycomb-mediated gene silencing during lineage commitment. Nat Cell Biol 18, 864-875 (2016).72. Figard, L. et al. Cofilin-Mediated Actin Stress Response Is Maladaptive in Heat- Stressed Embryos. Cell Rep 26, 3493-3501 e3494 (2019).73. Rocca, D.L., Martin, S., Jenkins, E.L. & Hanley, J.G. Inhibition of Arp2 / 3-mediated actin polymerization by PICK1 regulates neuronal morphology and AMPA receptor endocytosis. Nature cell biology 10, 259-271 (2008).74. Thiam, H.R. et al. Perinuclear Arp2 / 3-driven actin polymerization enables nuclear deformation to facilitate cell migration through complex environments. Nature communications 7, 10997 (2016).75. Chen, X. et al. Polymerization force-regulated actin filament-Arp2 / 3 complex interaction dominates self-adaptive cell migrations. Proceedings of the National Academy of Sciences of the United States of America 120, e2306512120 (2023).76. Liu, X., Shu, S., Hong, M.S., Levine, R.L. & Korn, E.D. Phosphorylation of actin Tyr-53 inhibits filament nucleation and elongation and destabilizes filaments. Proc Natl Acad Sci USA 103, 13694-13699 (2006).77. Du, W.W. et al. Nuclear Actin Polymerization Regulates Cell Epithelial-Mesenchymal Transition. Adv Sci (Weinh) 10, e2300425 (2023).78. Ma, J. et al. PIAS3-mediated feedback loops promote chronic colitis-associated malignant transformation. Theranostics 8, 3022-3037 (2018).79. Goldstein, L., Ko, C. & Errick, J. Nuclear actin: an apparent association with condensed chromatin. Cell biology international reports 1, 511-515 (1977).80. Wang, Y. et al. GPCR-induced calcium transients trigger nuclear actin assembly for chromatin dynamics. Nature communications 10, 5271 (2019).81. Knoll, K.R. et al. The nuclear actin-containing Arp8 module is a linker DNA sensor driving INO80 chromatin remodeling. Nature structural & molecular biology 25, 823-832 (2018).82. Baarlink, C. et al. A transient pool of nuclear F-actin at mitotic exit controls chromatin organization. Nature cell biology 19, 1389-1399 (2017).83. Szerlong, H. et al. The HSA domain binds nuclear actin-related proteins to regulate chromatin-remodeling ATPases. Nature structural & molecular biology 15, 469-476 (2008).84. Szerlong, H., Saha, A. & Cairns, B.R. The nuclear actin-related proteins Arp7 and Arp9: a dimeric module that cooperates with architectural proteins for chromatin remodeling. The EMBO journal 22, 3175-3187 (2003).85. Stanczyk, P. et al. DNA Damage and Nuclear Morphological Changes in Cardiac Hypertrophy Are Mediated by SNRK Through Actin Depolymerization. Circulation (2023).86. Zagelbaum, J. et al. Multiscale reorganization of the genome following DNA damage facilitates chromosome translocations via nuclear actin polymerization. Nature structural & molecular biology 30, 99-106 (2023).87. Hurst, V., Shimada, K. & Gasser, S.M. Nuclear Actin and Actin-Binding Proteins in DNA Repair. Trends in cell biology 29, 462-476 (2019).88. To, C., Shilton, B.H. & Di Guglielmo, G.M. Synthetic triterpenoids target the Arp2 / 3 complex and inhibit branched actin polymerization. The Journal of biological chemistry 285, 27944-27957 (2010).89. Bogucka-Janczi, K. et al. ERK3 / MAPK6 dictates CDC42 / RAC1 activity and ARP2 / 3- dependent actin polymerization. eLife 12 (2023).90. Zhao, K. et al. WDR63 inhibits Arp2 / 3-dependent actin polymerization and mediates the function of p53 in suppressing metastasis. EMBO reports 21, e49269 (2020).91. Kim, Y. et al. Phosphorylation of WAVEl regulates actin polymerization and dendritic spine morphology. Nature 442, 814-817 (2006).92. Eiseler, T., Hausser, A., De Kimpe, L., Van Lint, J. & Pfizenmaier, K. Protein kinase D controls actin polymerization and cell motility through phosphorylation of cortactin. The Journal of biological chemistry 285, 18672-18683 (2010).93. Yu, M. et al. Effects of Mechanical Stimuli on Profilin- and Formin-Mediated Actin Polymerization. Nano letters 18, 5239-5247 (2018).94. Liu, X. et al. Profilin Regulates Apical Actin Polymerization to Control Polarized Pollen Tube Growth. Molecular plants, 1694-1709 (2015).95. Phusuntornsakul, P., Jitpukdeebodintra, S., Pavasant, P. & Leethanakul, C. Vibration activates the actin / NF-kappaB axis and upregulates IL-6 and IL-8 expression in human periodontal ligament cells. Cell biology international 44, 661-670 (2020).96. Tonsawan, P., Dylewski, J., Lewis, L. & Blaine, J. Knockout of the neonatal Fc receptor in cultured podocytes alters IL-6 signaling and the actin cytoskeleton. American journal of physiology. Cell physiology 317, C1048-C1060 (2019).97. Liang, H., Yu, F., Tong, Z., Yuan, B. & Wang, C. Effect of ischemia post-conditioning on skeletal muscle oxidative injury, mTOR, Bax, Bcl-2 proteins expression, and HIF- lalpha / beta-actin mRNA, IL-6 / beta-actin mRNA and caveolin-3 / beta-actin mRNA expression in ischemia-reperfusion rabbits. Molecular biology reports A0, 507-514 (2013).98. Georgieva, E., Leber, S.L., Wex, C. & Garbers, C. Perturbation of the Actin Cytoskeleton in Human Hepatoma Cells Influences lnterleukin-6 (IL-6) Signaling, but Not Soluble IL-6 Receptor Generation or NF-kappaB Activation. International journal of molecular sciences 22 (2021).99. Ma, Y. et al. ACF7 regulates inflammatory colitis and intestinal wound response by orchestrating tight junction dynamics. Nature communications 8, 15375 (2017).100. Zhang, C. et al. Fibrinogen / AKT / Microfilament Axis Promotes Colitis by Enhancing Vascular Permeability. Cellular and molecular gastroenterology and hepatology 11, 683-696 (2021).101. Thomson, P.J., Soames, J.V., Booth, C. & O'Shea, J. A. Epithelial cell proliferative activity and oral cancer progression. Cell Prolif 35 Suppl 1, 110-120 (2002).102. Wang, H. et al. Pro-inflammatory miR-223 mediates the cross-talk between the IL23 pathway and the intestinal barrier in inflammatory bowel disease. Genome biology 17, 58 (2016)103. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453:314-321104. Akita S. Wound repair and regeneration: Mechanisms, signaling. IntJ Mol Sci. 2019; 20105. Bando T, Yokoyama H, Nakamura H. Wound repair, remodeling, and regeneration. Dev Growth Differ. 2018;60:303-305106. Eming SA, Martin P, Tomic-Canic M. Wound repair and regeneration: Mechanisms, signaling, and translation. Sci Transl Med. 2014;6:265sr266107. Yang ZG, Awan FM, Du WW, Zeng Y, Lyu J, Wu D, Gupta S, Yang W, Yang BB. The circular RNA interacts with STAT3, increasing its nuclear translocation and wound repair by modulating dnmt3a and mir-17 function. Molecular therapy : the journal of the American Society of Gene Therapy. 2017;25:2062-2074108. Shi R, Jin Y, Hu W, Lian W, Cao C, Han S, Zhao S, Yuan H, Yang X, Shi J, Zhao H. Exosomes derived from mmu_circ_0000250-modified adipose-derived mesenchymal stem cells promote wound healing in diabetic mice by inducing mir-128-3p / sirtl- mediated autophagy. American journal of physiology. Cell physiology. 2020;318:C848- C856109. Han D, Liu W, Li G, Liu L. Circ_prkdc knockdown promotes skin wound healing by enhancing keratinocyte migration via mir-31 / fbnl axis. Journal of molecular histology. 2021;52:681-691110. Qadir J, Wen SY, Yuan H, Yang BB. Circrnas regulate the crosstalk between inflammation and tumorigenesis: The bilateral association and molecular mechanisms. Molecular therapy : the journal of the American Society of Gene Therapy. 2022111. Yang Q, Li F, He AT, Yang BB. Circular rnas: Expression, localization, and therapeutic potentials. Molecular therapy : the journal of the American Society of Gene Therapy. 2021;29:1683-1702112. Wang Z, Feng C, Liu H, Meng T, Huang W, Long X, Wang X. Hypoxic pretreatment of adipose-derived stem cells accelerates diabetic wound healing via circ- gcapl4 and hif-lalpha / vegf mediated angiopoiesis. International journal of stem cells. 2021;14:447-454113. Cho JW, II KJ, Lee KS. Downregulation of type i collagen expression in silibin intreated human skin fibroblasts by blocking the activation of smad2 / 3-dependent signaling pathways: Potential therapeutic use in the chemoprevention of keloids. IntJ Mol Med. 2013;31:1148-1152114. Yagishita D, Ajijola OA, Vaseghi M, Nsair A, Zhou W, Yamakawa K, Tung R, Mahajan A, Shivkumar K. Electrical homogenization of ventricular scar by application of collagenase: A novel strategy for arrhythmia therapy. Circ Arrhythm Electrophysiol. 2013;6:776-783115. Szymanski L, Lewicki S, Markiewicz T, Cierniak S, Tassan JP, Kubiak JZ. Sirna- mediated melk knockdown induces accelerated wound healing with increased collagen deposition. International journal of molecular sciences. 2023;24116. Marconi GD, Fonticoli L, Rajan TS, Pierdomenico SD, Trubiani O, Pizzicannella J, Diomede F. Epithelial-mesenchymal transition (emt): The type-2 emt in wound healing, tissue regeneration and organ fibrosis. Cells. 2021;10117. Yan C, Grimm WA, Garner WL, Qin L, Travis T, Tan N, Han YP. Epithelial to mesenchymal transition in human skin wound healing is induced by tumor necrosis factor-alpha through bone morphogenic protein-2. The American journal of pathology. 2010;176:2247-2258118. Rao MV, Zaidel-Bar R. Formin-mediated actin polymerization at cell-cell junctions stabilizes e-cadherin and maintains monolayer integrity during wound repair. Molecular biology of the cell. 2016;27:2844-2856119. Kuwahara M, Hatoko M, Tada H, Tanaka A. E-cadherin expression in wound healing of mouse skin. Journal of cutaneous pathology. 2001;28:191-199120. Diaz A, Martin-Jimenez C, Xu Y, Merino P, Woo Y, Torre E, Yepes M. Urokinase-type plasminogen activator-mediated crosstalk between n-cadherin and beta- catenin promotes wound healing. Journal of cell science. 2021;134121. Kim NH, Choi SH, Lee TR, Lee CH, Lee AY. Cadherin 11, a mir-675 target, induces n-cadherin expression and epithelial-mesenchymal transition in melasma. The Journal of investigative dermatology. 2014;134:2967-2976122. Deramaudt TB, Takaoka M, Upadhyay R, Bowser MJ, Porter J, Lee A, Rhoades B, Johnstone CN, Weissleder R, Hingorani SR, Mahmood U, Rustgi AK. N-cadherin and keratinocyte growth factor receptor mediate the functional interplay between ki- rasgl2v and p53vl43a in promoting pancreatic cell migration, invasion, and tissue architecture disruption. Molecular and cellular biology. 2006;26:4185-4200123. Velez-delValle C, Marsch-Moreno M, Castro-Munozledo F, Galvan-Mendoza IJ, Kuri-Harcuch W. Epithelial cell migration requires the interaction between the vimentin and keratin intermediate filaments. Scientific reports. 2016;6:24389124. Cheng F, Shen Y, Mohanasundaram P, Lindstrom M, Ivaska J, Ny T, Eriksson JE. Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via tgf-beta-slug signaling. Proceedings of the National Academy of Sciences of the United States of America. 2016;113:E4320-4327125. Miyamoto K, Pasque V, Jullien J, Gurdon JB. Nuclear actin polymerization is required for transcriptional reprogramming of oct4 by oocytes. Genes & development. 2011;25:946-958126. Plessner M, Grosse R. Extracellular signaling cues for nuclear actin polymerization. European journal of cell biology. 2015;94:359-362.127. Junicho A, Matsuda T, Yamamoto T, Kishi H, Korkmaz K, Saatcioglu F, Fuse H, Muraguchi A. Protein inhibitor of activated stat3 regulates androgen receptor signaling in prostate carcinoma cells. Biochemical and biophysical research communications. 2000;278:9-13.128. Tseng JC, Huang SH, Lin CY, Wang BJ, Huang SF, Shen YY, Chuu CP. Ror2 suppresses metastasis of prostate cancer via regulation of mir-199a-5p-pias3-akt2 signaling axis. Cell death & disease. 2020;ll:376.

[0372] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those skilled in the art to which this invention pertains andare herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference.

[0373] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A single stranded, mixed base pair oligonucleotide comprising a combination of ribonucleobases and deoxyribonucleobases, wherein the oligonucleotide comprises a sequence that is at least 80% complimentary with at least 10, at least 11, or from 11 to 15 consecutive nucleotides of the junction region of circular neuroligin RNA (circNIgn).

2. The oligonucleotide according to claim 1, wherein the sequence of the junction region of circNIgn is the sequence of SEQ ID NO:2.

3. The oligonucleotide according to claim 2, wherein the oligonucleotide comprises a sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to at least at least 10, at least 11 or from 11 to 15 consecutive nucleotides of SEQ ID NO:2.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is at least 10, or at least 11 nucleotides in length.

5. The oligonucleotide according to claim 4, wherein the oligonucleotide is 10 to 30, or 10 to 20 nucleotides in length.

6. The oligonucleotide according to any one of claims 1 to 5, wherein the oligonucleotide is incorporated into a delivery vehicle or a particle or is conjugated to a particle.

7. The oligonucleotide according to claim 6, wherein the oligonucleotide is conjugated to a pegylated gold nanoparticle.

8. The oligonucleotide according to any one of claims 1 to 7, for use as a medicine.

9. The oligonucleotide for use according to claim 8, wherein the medicine is for treatment or prevention of a condition associated with increased levels of circNIgn and / or Nlgnl73.

10. The oligonucleotide for use according to claim 8 or 9, wherein the medicine is for: improving cardiac function; for treatment or prevention of a cardiovascular disease or disorder, such as cardiac hypertrophy, remodeling, cardiomyopathy, artery diseases, and myocardial infarction; for treatment or prevention of colitis, for example, ulcerative colitis or acute ulcerative colitis; for treatment of cancers, for example, prostate cancer; for treatment of a wound; or for minimizing scar formation during wound healing.

11. The oligonucleotide for use according to any one of claims 8 to 10, wherein the oligonucleotide is for use in combination with another therapeutic agent.

12. A pharmaceutical composition comprising the oligonucleotide according to any one of claims 1 to 7 and one or more pharmaceutically acceptable excipients.

13. The pharmaceutical composition according to claim 12, further comprising another therapeutic agent, such as a 0-blocker.

14. A method for treatment or prevention of a condition associated with increased levels of circNIgn and / or Nlgnl73 comprising administering the oligonucleotide according to any one of claims 1 to 7 to a subject diagnosed with or at risk of developing the condition associated with increased levels of circNIgn and / or Nlgnl73.

15. The method according to claim 14, wherein the condition is a cardiovascular disease or disorder, such as cardiac hypertrophy, remodeling, cardiomyopathy, artery diseases, and myocardial infarction.

16. The method according to claim 14, wherein the condition is colitis, for example, ulcerative colitis or acute ulcerative colitis.

17. The method according to claim 14, wherein the condition is cancers, for example, prostate cancer.

18. The method according to claim 14, wherein the condition is a wound.

19. The method according to claim 18, wherein the oligonucleotide is administered in an amount effective to provide wound healing and / or minimize scar formation during wound healing in the subject.

20. A method for treatment or prevention of colitis, such as ulcerative colitis or acute ulcerative colitis, comprising administering a compound that inhibits expression of circNIgn to a subject diagnosed with or suspected of having colitis or at risk of developing colitis.

21. A method for treatment or prevention of cancers, such as prostate cancer, comprising administering a compound that inhibits expression of circNIgn to a subject diagnosed with or suspected of having cancer or at risk of developing cancer.

22. A method for treatment of a wound in a subject, comprising administering a compound that inhibits expression of circNIgn to the subject.

23. The method according to claim 20, wherein the compound is administered to the subject at an amount effective to provide wound healing and / or minimize scar formation during wound healing in the subject.

Citation Information

Patent Citations

  • Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage

    WO2019122282A1