Immunogenic composition against avian influenza virus h7 subtype

A vaccine using a baculovirus-expressed AIV H7 HA protein with specific amino acid residues provides complete protection against AIV H7 infections in chickens, addressing the limitations of existing vaccines by preventing mortality, morbidity, and virus shedding with improved safety and efficacy.

WO2026007883A1PCT designated stage Publication Date: 2026-01-08BOEHRINGER INGELHEIM VETMEDICA CHINA CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/105423
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-01
Filing Date
2025-06-30
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Existing vaccines for avian influenza virus H7 subtype (AIV H7) do not provide effective protection against virus shedding and have limitations in preventing mortality and morbidity in vaccinated chickens.

Method used

An immunogenic composition comprising a hemagglutinin protein of AIV H7 subtype, specifically designed with amino acid residues T14, R22, P112, F115, E164, and G320, produced using a baculovirus-based expression system, is used to create a vaccine that includes a whole cell culture suspension treated with an inactivation agent and optionally adjuvanted, providing full protection against AIV H7 infection.

Benefits of technology

The immunogenic composition achieves 100% protection in chickens by preventing mortality, morbidity, and virus shedding, including oral and cloacal shedding, even at peak virus levels, with biosafety level 1 requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025105423-FTAPPB-I100001
    Figure PCTCN2025105423-FTAPPB-I100001
  • Figure PCTCN2025105423-FTAPPB-I100002
    Figure PCTCN2025105423-FTAPPB-I100002
  • Figure PCTCN2025105423-FTAPPB-I100003
    Figure PCTCN2025105423-FTAPPB-I100003
Patent Text Reader

Abstract

The invention relates to the field of veterinary medicine, in particular to an immunogenic composition against avian influenza virus H7 subtype. The immunogenic composition comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) which comprises or consists of an amino acid sequence having at least 95%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3.
Need to check novelty before this filing date? Find Prior Art

Description

IMMUNOGENIC COMPOSITION AGAINST AVIAN INFLUENZA VIRUS H7 SUBTYPECROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the priority of PCT / CN2024 / 102868 filed on July 01, 2024 entitled by “Immunogenic Composition Against Avian Influenza Virus H7 Subtype” , the entirety of which is incorporated by reference herein.FIELD OF THE INVENTION

[0002] The invention relates to the field of veterinary medicine, in particular to an immunogenic composition against avian influenza virus H7 subtype.BACKGROUND OF THE INVENTION

[0003] Avian influenza virus (AIV) infection has long been a serious epidemic disease throughout the world, and it threats the health of birds including domestic poultry. In recent years, AIV H7 subtype (AIV H7) was classified as a highly pathogenic avian influenza virus, so effective vaccines for AIV H7 are urgently needed.

[0004] There are various forms of AIV vaccines including inactivated / killed vaccines, live vectored vaccines, subunit vaccines, polypeptide vaccines, DNA vaccines, etc. For example, CN112143714A discloses a method of preparing an AIV H7 killed vaccine which involves using a special dilution solution and special chicken embryos with a few maternal antibodies. Wenming Jiang, et al, 2020 discloses a vectored vaccine rFQ2 which comprises a reverse genetic recombinant backbone carrying two different AIV antigenic genes (HA and NA genes) with internal gene segments of PR8 (Emerging Infectious Diseases, Vol. 26, No. 2, 2020) . CN109731100A and CN106421771A discloses a subunit vaccine comprising a baculovirus-expressed H7H9 HA protein, respectively, which however did not show an effective prevention of virus shedding in vaccinated chickens.

[0005] There is a still a need in the art to develop an AIV H7 vaccine which can provide superior protection on AIV H7 infections.SUMMARY OF THE INVENTION

[0006] In one aspect, the present invention provides an immunogenic composition or a vaccine comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) , wherein

[0007] (i) the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3; and / or

[0008] (ii) the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3.

[0009] In some embodiments, the AIV H7 HA protein is a recombinant hemagglutinin protein. In some embodiments, the recombinant AIV H7 HA protein is produced by a baculovirus-based system. In some embodiments, the recombinant AIV H7 HA protein is produced by a baculovirus-based expression system using a Sel promoter.

[0010] In some embodiments, the AIV H7 HA protein is the only avian influenza antigen component contained in the immunogenic composition; or wherein the immunogenic composition does not comprise other AIV H7 proteins than the AIV H7 HA protein.

[0011] In one aspect, the present invention provides a method for preparing an immunogenic composition, comprising the following steps: (i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein; (ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension; (iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus; and (iv) optionally, emulsifying and adding an adjuvant into the whole cell culture suspension.

[0012] In one aspect, the present invention provides use of the immunogenic composition of the invention, or the immunogenic composition prepared by the method of the invention in preparation of a kit for prevention and / or treatment of infections in an animal caused by an avian influenza virus H7 subtype, or for reducing clinical signs in an animal caused by infections of an avian influenza virus H7 subtype, or for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an avian influenza virus H7 subtype.

[0013] The immunogenic composition of the invention provides a full protection on chickens in terms of mortality, morbidity and virus shedding caused by AIV H7 infection.DETAILED DESCRIPTION OF THE INVENTION

[0014] Before the aspects of the present invention are described, it must be noted that as used herein and in the appended claims, the singular forms "a" , "an" , and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to the "virus" is a reference to one or more viruses and equivalents thereof known to those skilled in the art, and so forth. The term “and / or” is intended to encompass any combinations of the items connected by this term, equivalent to listing all the combinations individually. For example, “A, B and / or C” encompasses “A” , “B” , “C” , “A and B” , “A and C” , “B and C” , and “A and B and C” . Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the virus strains, the cell lines, vectors, and methodologies as reported in the publications which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0015] Immunogenic composition of the invention

[0016] The present invention is directed to an immunogenic composition comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) .

[0017] In one aspect, the invention provides an immunogenic composition or a vaccine comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) , wherein

[0018] (i) the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3; and / or

[0019] (ii) the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3.

[0020] As used herein, the term “immunogenic composition” , also called as “vaccine” , refers to a composition that comprises one antigen which elicits an immune response in a host. The host will display therapeutic and / or protective immune response such that resistance to new infections will be enhanced and / or the severity of clinical signs is reduced.

[0021] Avian influenza virus (AIV) belongs to the type of influenza A virus, and is classified into subtypes on the basis of two proteins on the surface of the virus: hemagglutinin (HA) and neuraminidase (NA) . There are 18 known HA subtypes and 11 known NA subtypes. Many different combinations of HA and NA proteins are possible. As used herein, the term “H7N9 virus” means that the AIV has a subtype 7 HA and a subtype 9 NA. In some embodiments, the AIV is AIV H7 subtype. In some embodiments, the AIV H7 subtype is the AIV H7N9.

[0022] HA protein is the receptor-binding and membrane fusion glycoprotein of influenza A virus. As used herein, the terms “hemagglutinin protein of avian influenza virus H7 subtype” , “AIV H7 HA protein” and “H7 HA protein” are interchangeable. The immunogenic composition of the invention only uses an HA protein to exert an immune protection on AIV infections. Thus, in some embodiments, the AIV H7 HA protein is the only avian influenza antigen component contained in the immunogenic composition of the invention. In some embodiments, the immunogenic composition of the invention does not comprise other AIV H7 proteins than the AIV H7 HA protein.

[0023] As used herein, the term “protein” is intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced. Thus, the AIV H7 HA protein of the invention can be a recombinantly or synthetically produced protein or naturally occurring protein. The amino acid sequence of the AIV H7 HA protein can be designed through a series of H7 HA amino acid sequence alignments, followed by generation of consensus amino acid sequences and analysis of the most common residue at each position. In some embodiments, the AIV H7 HA protein is a recombinant hemagglutinin protein, which for example can be produced by a baculovirus-based system.

[0024] As used herein, SEQ ID NO: 3 represents the amino acid sequence of the HA protein of strain Influenza A virus A / chicken / Jiangxi / JX4 / 2017 (H7N9) . SEQ ID NO: 3 is used in the invention as a standard amino acid sequence of the H7 HA protein for determining the amino acid position of the H7 HA protein of the invention. SEQ ID NO: 3 is also the amino acid sequence of the H7 HA protein of the invention which is called H7Con2.

[0025] The numbering of the amino acid positions of H7 HA protein as used herein refers to the amino acid position as set forth in SEQ ID NO: 3. For example, the designation “E164 or K164” , means E or K at a position corresponding to position 164 of SEQ ID NO: 3. The “G320 or R320” means G or R at a position corresponding to position 320 of SEQ ID NO: 3. “T14 or I14” means T or I at a position corresponding to position 14 of SEQ ID NO: 3. “R22 or K22” means R or K at a position corresponding to position 22 of SEQ ID NO: 3. “P112 or S112” means P or S at a position corresponding to position 112 of SEQ ID NO: 3. “F115 or L115” means F or L at a position corresponding to position 115 of SEQ ID NO: 3. The methods for the determining the positions of amino acids are known in the art, including but not limited to amino acid alignment performed by using BLAST Program.

[0026] In some embodiments, the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3.

[0027] As used herein, “sequence identity” between two polypeptide sequences indicates the percentage of amino acids that are identical between the sequences. Methods for evaluating the level of sequence identity between amino acid or nucleotide sequences are known in the art. For example, sequence analysis softwares are often used to determine the identity of amino acid sequences. For example, sequence identity can be determined by using the BLAST program at NCBI database.

[0028] In some embodiments, the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3. In one embodiment of the immunogenic composition of the invention, the H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3, and wherein the H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3. In some embodiments, the AIV H7 HA protein comprises or consists the amino acid sequence as set forth in SEQ ID NO: 3.

[0029] The AIV H7 HA protein of the invention can be prepared by expressing a nucleic acid molecule encoding the AIV H7 HA protein in a suitable expression system such as a baculovirus-insect cell system. In some embodiments, the nucleic acid molecule encoding the AIV H7 HA protein of the invention is codon-optimized for expression in insect cells. Codon optimization does not alter the amino acid sequence of the coded protein. SEQ ID NO: 8 also shows a nucleotide sequence encoding the AIV H7 HA protein of the invention, which comprises first 54 nucleotides encoding a signal peptide which located at N-terminus of the AIV H7 HA protein of the invention. In some embodiments, the signal peptide comprises or consist of the amino acid sequence as set forth in SEQ ID NO: 15. In some embodiments, the nucleic acid molecule encoding the AIV H7 HA protein comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 8. The signal peptide encoded by the first 54 nucleotides of SEQ ID NO: 8 will be cleaved after expression.

[0030] The expression of a nucleic acid molecule encoding the AIV H7 HA protein can be driven by using a promoter. In some embodiments, the AIV H7 HA protein of the invention is a recombinant hemagglutinin protein, which is produced by a baculovirus-based expression system using the Sel promoter (Martinez-Solis et al. (2016) , A novel baculovirus-derived promoter with high activity in the baculovirus expression system. PeerJ 4: e2183; DOI 10.7717 / peerj. 2183) . The Sel promoter may comprise or consist of a nucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 11. In some preferred embodiments, the Sel promoter comprises or consists of a nucleotide sequence as set forth in SEQ ID NO: 11. In some embodiments, the expression of the nucleic acid molecule encoding the AIV H7 HA protein is driven by the Sel promoter which is as set forth in SEQ ID NO: 11.

[0031] SEQ ID NO: 12 shows the nucleic acid molecule encoding the AIV H7 HA protein of the invention which is linked with the Sel promoter. Thus, in some embodiments, the nucleic acid molecule encoding the AIV H7 HA protein comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 12. It was surprisingly found in the example 2 that the Sel promoter can significantly increase the expression and the hemagglutinin assay unit (HAU) of the AIV H7 HA protein in a baculovirus expression system.

[0032] The expression of a nucleic acid molecule encoding the AIV H7 HA protein can be achieved by using an expression vector known in the art, such as a virus, plasmid, cosmid and phage. In some embodiments, the expression vector of the invention is a virus, preferably a baculovirus, such as a commercial baculovirus sold under BaculoGold (BD Biosciences Pharmingen, San Diego, Calif. ) or SapphireTM Baculovirus (Allele Biotechnology) . In some embodiments, the expression vector is a recombinant baculovirus, which comprises the nucleic acid molecule encoding the AIV H7 HA protein of the invention. In some embodiments, the recombinant baculovirus comprises the nucleic acid molecule as set forth in SEQ ID NO: 8 or SEQ ID NO: 12.

[0033] The expression vector of the invention can be transformed into a host cell known in the art. In some embodiments, the host cell is an insect cell, such as a SF+ cell, e.g. a commercial product sold by Protein Sciences Corporation (Meriden, CT) .

[0034] For expression of the AIV H7 HA protein of the invention, the cells can be cultured under the condition suitable for the expression of the AIV H7 HA protein. In some embodiments, the insect cells are cultured under the condition suitable for the expression of the AIV H7 HA protein. In some embodiments, the insect cells are incubated over a period of up to ten days, preferably from about two days to about ten days, more preferably from about four days to about nine days, and even more preferably from about five days to about eight days. In some embodiments, the condition suitable for culturing the insect cell comprises a temperature between about 22-32℃, preferably from about 24-30℃, more preferably from about 25-29℃, even more preferably from about 26-28℃, and most preferably about 27℃.

[0035] In some embodiments, the culture medium for culturing the cells of the invention will be determined by those of skill in the art. In some embodiments, the culture medium is a serum-free insect cell medium, such as a commercial culture medium sold under Ex-CELL 420 ( 420 serum-free medium for insect cells, Sigma-Aldrich, Cat. 14420C) .

[0036] The AIV H7 HA protein of the invention can be in a form of non-purified protein. The term “non-purified H7 HA protein” refers to such a protein that has not been substantially separated or purified away from other components of a culturing system containing cell culture medium, cultured cells, cell debris, etc. In some embodiments, the immunogenic composition of the invention comprises a non-purified H7 HA protein which is contained in a whole cell culture suspension, for example, a whole cell culture suspension of a baculovirus-insect cell system. The term “whole cell culture suspension” means that the cell culture suspension comprises all components contained in a culturing system, including cultured cells and a culture medium. That is, it is the whole cell culture suspension of a baculovirus-based system that is directly harvested for further preparing the immunogenic composition of the invention, instead of purifying the AIV H7 HA protein or isolating and harvesting only cultured cells containing an H7 HA protein for preparing immunogenic composition of the invention. Thus, in some embodiments, the whole cell culture suspension is directly harvested from a cell culturing process, including the whole components contained in the culturing system, including cultured cells and a culture medium. In some embodiments, the whole cell culture suspension of a baculovirus-based system is subject to an inactivation process, by for example being treated with an inactivation agent to inactivate the baculovirus.

[0037] The AIV H7 HA protein of the invention can also be in a form of purified protein. In some embodiments, the immunogenic composition of the invention comprises a purified AIV H7 HA protein. As used herein, the term “purified H7 HA protein” refers to such a protein that has been substantially separated or purified away from other components of a culturing system containing such as cell culture medium, cultured cells, cell debris, etc. Methods of purifying a protein are well known in the art.

[0038] Any conventional inactivation method can be used for purposes of the invention, including but not limited to chemical and / or physical treatments. In some embodiments, the inactivation step comprises the addition of cyclized binary ethylenimine (BEI) , preferably in a concentration of about 1 to about 20 mM, preferably of about 2 to about 10 mM, more preferably of about 5 mM or 10 mM. In some embodiments, the inactivation step comprises the addition of a solution of 2-bromoethyleneamine hydrobromide which will be cyclized to form BEI in NaOH. In some embodiments, the inactivation step comprises the addition of formaldehyde, preferably in a concentration of about 0.15%to about 0.3%, preferably of about 0.15%-0.2%. In some embodiments, the inactivation step is performed between 20-37℃, preferably between 25-30℃, more preferably between 25-27℃. In some embodiments, the inactivation step is performed with pH range 6.5-7.4, preferably between 6.8-7.2, more preferably between 6.9-7.1. In some embodiments, the inactivation step is performed for 24-72 h, preferably for 30-72 h, more preferably 48-72 h. In general, the inactivation step is performed until no replication of the viral vector is detectable.

[0039] A step of a neutralization step can be introduced after the inactivation step. In some embodiments, a step of a neutralization step is introduced after the inactivation step. The neutralization step comprises adding of an equivalent amount of an agent that neutralizes the inactivation agent within the solution. In some embodiments, when the inactivation agent is BEI, an equivalent amount of sodium thiosulfate will be added. In some embodiments, when the inactivation agent is formaldehyde, an equivalent amount of sodium thiosulfate will be added. For example, in the event BEI is added to a final concentration of 5mM, a 1.0M sodium thiosulfate solution is added to give a final minimum concentration of 5 mM to neutralize any residual BEI. In the event formaldehyde is added to a final concentration of 5 mM, a 1.0 M sodium thiosulfate solution is added to give a final minimum concentration of 5 mM to neutralize any residual formaldehyde.

[0040] In some embodiments, the neutralization agent is added after the inactivation step is completed, which means that no replication of the viral vector replication can be detected. In some embodiments, the neutralization agent is added after the inactivation step is performed for 24 h, 30 h, 48 h or 72 h.

[0041] The immunogenic composition of the invention may further comprise an adjuvant. Thus, in some embodiments, the immunogenic composition of the invention comprises an adjuvant. “Adjuvant” as used herein, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA) , GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL) , water-in-oil-in-water emulsion, oil-in-water emulsion, water-in-oil emulsion, e.g., MONTANIDETM ISA 71R VG (Manufactured by Seppic Inc, Cat no: 365187) . The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopea type) ; isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate / caprate) , glyceryl tri- (caprylate / caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g., anhydromannitol oleate) , of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D. E. S. ) , JohnWiley and Sons, NY, pp51-94 (1995) and Todd et al., Vaccine 15: 564-570 (1997) .

[0042] The whole cell culture suspension of the invention can be used as the active antigenic ingredient to be used for the next emulsification procedure with adjuvants. In some embodiments, the immunogenic composition of the invention is formulated into a water-in-oil emulsion, an oil-in-water emulsion, or water-in-oil-in-water emulsion with a suitable adjuvant. The adjuvant can comprise oils and surfactants. In some embodiments, the adjuvant is MONTANIDETM ISA 71R VG (Manufactured by Seppic Inc, Cat no: 365187) . The amount of the adjuvant to added can be determined by using any conventional methods known in the art or by referring to the related instruction manual, for example by referring the manual of MONTANIDETM ISA 71R VG, e.g. using about 3 parts of the inactivated supernatant as aqueous phase and about 7 parts of MONTANIDETM ISA 71R VG as oil phase.

[0043] The amount of the AIV H7 HA protein contained in the immunogenic composition of the invention can be quantitated by using any conventional methods known in the art, for example the Haemagglutination Assay (see OIE Terrestrial Manual 2015, Chapter 2.3.1 &2.3.2, Avian Influenza (infection with avian influenza viruses) ) . In some embodiments, the amount of the H7 HA protein contained in the immunogenic composition of the invention is determined by haemagglutination test with chicken red blood cells, and the amount of the H7 HA protein can be expressed as hemagglutinin assay unit (HAU) .

[0044] The term “HAU” refers to a unit of the activity for agglutinating red blood cells (RBC) , and 1 HAU of hemagglutinin protein refers to the minimum unit that causes agglutination when the hemagglutinin is mixed with RBC. HAU can be assessed by a haemagglutination titer assay. In the assay, a sample containing a hemagglutinin protein is subjected to a two-fold serial dilution in a 96-well plate, and RBC solution is added to the wells. The value of HAU is the greatest dilution fold of the sample resulting in complete agglutination of the RBC. For example, if the greatest dilution fold of a 25μl sample is 256, the amount of the hemagglutinin protein contained in the sample is 256 HAU per 25μl.

[0045] To elicit an effective immune response, the immunogenic composition of the invention may comprise at least 32 HAU per dose of the H7 HA protein of the invention. The skilled person in the art can determine the upper limit of the amount of H7 HA protein just by routine testing. In general, the upper limit used by a skilled person will be in the range of about 1024 HAU per dose, but could also be higher. In some embodiments, the immunogenic composition of the invention comprises at least 32 to 1024 HAU, at least 64 to 1024 HAU, at least 128 to 1024 HAU, or at least 256 to 1024 HAU per dose of the H7 HA protein of the invention. In some embodiments, the immunogenic composition of the invention comprises about 32 HAU, 64 HAU, 128 HAU, 256 HAU, 512 HAU, or 1024 HAU per dose of the H7 HA protein of the invention.

[0046] Compared to the conventional whole virus inactivated vaccines that are required to be produced in Biosafety Level 2 or 3 (BSL-2, BSL-3) , the above manufacture method for producing the H7 HA protein has been categorized to biosafety level 1 requirements.

[0047] It was surprisingly found that the AIV H7 HA protein of the invention can result in superior immune protection effect against AIV infection, especially for the H7Con2 shown by SEQ ID NO: 3. Moreover, although the immunogenic composition of the invention comprises only AIV H7 HA protein as the sole antigen component, the vaccinated chickens showed to be fully protected from AIV infection, without any mortality, morbidity and virus shedding. In addition, it was surprisingly found that the immunogenic composition of the invention which comprises an H7 HA protein-containing whole cell culture suspension can prevent the vaccinated chickens from both oral and cloacal virus shedding, even on 5 days post challenge when the peak amount of AIV virus shedding usually occurs in chickens.

[0048] Method of preparing the immunogenic composition of the invention

[0049] The present invention is also directed to a method of preparing an immunogenic composition of the invention.

[0050] In one aspect, the present invention also provides a method of for preparing an immunogenic composition of the invention, comprising the following steps:

[0051] (i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein;

[0052] (ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension;

[0053] (iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus; and

[0054] (iv) optionally, emulsifying and adding an adjuvant into the whole cell culture suspension.

[0055] In some embodiments, the AIV H7 HA protein is the only avian influenza antigen component contained in the immunogenic composition of the invention. In some embodiments, the immunogenic composition of the invention does not comprise other AIV H7 proteins than the AIV H7 HA protein.

[0056] In some embodiments, the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3. In some embodiments, the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments, the H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3, and wherein the H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3. In some embodiments, the AIV H7 HA protein comprises or consists the amino acid sequence as set forth in SEQ ID NO: 3.

[0057] In some embodiments, the nucleic acid molecule encoding the AIV H7 HA protein comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 8 or SEQ ID NO: 12. In some embodiments, the recombinant baculovirus comprises the nucleic acid molecule as set forth in SEQ ID NO: 8 or SEQ ID NO: 12.

[0058] In some embodiments, the baculovirus is a commercial baculovirus sold under BaculoGold (BD Biosciences Pharmingen, San Diego, Calif. ) or SapphireTM Baculovirus (Allele Biotechnology) . In some embodiments, the inset cell is SF+ cell, such as a commercial SF+ cell product sold by Protein Sciences Corporation (Meriden, CT) . In some embodiments, the culture medium is a serum-free insect cell medium, such as Ex-CELL 420 ( 420 serum-free medium for insect cells, Sigma-Aldrich, Cat. 14420C) .

[0059] In some embodiments, the insect cells are cultured under the condition suitable for the expression of the H7 HA protein. In some embodiments, the insect cells are incubated over a period of up to ten days, preferably from about two days to about ten days, more preferably from about four days to about nine days, and even more preferably from about five days to about eight days. In some embodiments, the condition suitable for culturing the insect cell comprises a temperature between about 22 -32℃, preferably from about 24 -30℃, more preferably from about 25 -29℃, even more preferably from about 26 -28℃, and most preferably about 27℃. The conditions for culturing the insect cells for the expression of the H7 HA protein can be referred to the manual instructions of the product or are known in the art.

[0060] In some embodiments, the inactivation agent is formaldehyde, preferably in a concentration of about 0.15%to about 0.3%, preferably of about 0.15%-0.2%, or the inactivation agent is binary ethylenimine, preferably in a concentration of about 1 to about 20 mM, preferably of about 2 to about 10 mM, more preferably of about 5 mM or 10 mM. In general, the inactivation step is performed until no replication of the viral vector is detectable.

[0061] In some embodiments, after the step (iv) , the method further comprises a step of adding a neutralization agent. In some embodiments, the neutralization agent is sodium thiosulfate. In some embodiments, the neutralization step comprises adding of a sodium thiosulfate solution to a final concentration of 1 to 20 mM, preferably of 2 to 10 mM, more preferably of 5 mM or 10 mM, when the inactivation agent is BEI. In some embodiments, the neutralization step comprises adding of a sodium thiosulfate solution to a final concentration of 1 to 20 mM, preferably of 2 to 10 mM, more preferably of 5 mM or 10 mM, when the inactivation agent is formaldehyde.

[0062] In the method of the present invention, the whole cell culture suspension is directly used for preparing an H7 HA protein-containing immunogenic composition. Furthermore, without wishing to be bound by any one theory, it is believed that the whole cell culture suspension is beneficial to the protection effects of the immunogenic composition of the invention, especially for virus shedding protection effects of the immunogenic composition. It is surprisingly shown in the examples that chickens vaccinated by the immunogenic composition of the invention showed not only no mortality and morbidity but also no oral and cloacal virus shedding on 5 days post challenge by a highly pathogenic AIV.

[0063] Method and use for preventing and / or treating AIV infection

[0064] In another aspect, the present invention provides a method for prevention and / or treatment of infections in an animal caused by an AIV H7 subtype, comprising administering the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention to the animal. In another aspect, the present invention also provides a method for reducing clinical signs in an animal caused by infections of an AIV H7 subtype, comprising administering the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention to the animal. In another aspect, the present invention also provides a method for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype, comprising administering the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention to the animal.

[0065] In another aspect, the present invention provides the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, for use in the prevention and / or treatment of infections in an animal caused by an AIV H7 subtype. In another aspect, the present invention provides the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, for use in reducing clinical signs in an animal caused by infections of an AIV H7 subtype. In another aspect, the present invention provides the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, for use in reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype.

[0066] In another aspect, the present invention provides use of the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention in preparation of a kit for prevention and / or treatment of infections in an animal caused by an AIV H7 subtype. In another aspect, the present invention provides use of the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention in preparation of a kit for reducing clinical signs in an animal caused by infections of an AIV H7 subtype. In another aspect, the present invention provides use of the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention in preparation of a kit for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype.

[0067] In one embodiment, the method of the invention, the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, or the use of the invention, in each case, is used for the prevention and / or treatment of infections in an animal caused by an AIV H7 subtype. In one embodiment, the method of the invention, the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, or the use of the invention, in each case, is used for reducing clinical signs in an animal caused by infections of an AIV H7 subtype. In one embodiment, the method of the invention, the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, or the use of the invention, in each case, is used for reducing mortality in an animal caused by infections of an avian influenza virus H7 subtype. In one embodiment, the method of the invention, the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, or the use of the invention, in each case, is used for reducing morbidity in an animal caused by infections of an avian influenza virus H7 subtype. In one embodiment, the method of the invention, the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention, or the use of the invention, in each case, is used for reducing virus shedding in an animal caused by infections of an avian influenza virus H7 subtype.

[0068] As used herein, the term “prevention” refers to the reduction in the incidence of or severity of clinical signs of influenza infection up to an including the complete prevention of such clinical signs. The prevention protection efficacy or protection effect of the immunogenic composition can be evaluated based on the mortality, morbidity and virus shedding of the vaccinated subject against a same or different AIV strain. The terms “protection efficacy” and “protection effect” are interchangeable. The protection efficacy of the immunogenic composition of the invention for example can be determined by a virus challenge trial, such as the virus challenge trial specifically described in Example 3 of the invention. The immunogenic composition of the invention achieves a protection efficacy fulfilling the following criteria:

[0069] 1) 0%mortality;

[0070] 2) 0%morbidity; and

[0071] 3) 0%virus shedding (oral and cloacal)

[0072] in the animals administered with the immunogenic composition of the invention or the immunogenic composition prepared by the method of the invention in a virus challenge trial.

[0073] In some embodiments, the AIV H7 subtype is selected from H7Nx, wherein “x” represent any neuraminidase subtype of AIV, H7N1, H7N2, H7N3, H7N4, H7N5, H7N6, H7N7, H7N8, and H7N9. In one preferred embodiment, the AIV is H7N9.

[0074] In some embodiments, the subject in need thereof can be poultry, even more preferably bird, chicken, duck, goose, pigeon, turkey the like. In some embodiments, the subject is chicken or duck. In some embodiments, the subject is chicken.

[0075] In some embodiments, the immunogenic composition of the invention can be administrated via subcutaneous (S.C. ) or intramuscular (I.M. ) administration. In one preferred embodiment, the immunogenic composition of the invention is administrated via subcutaneous administration. As used herein, the terms “administration  / administrating  / administrated” and “vaccination  / vaccinating  / vaccinated” are interchangeable.

[0076] The times of administration of the immunogenic composition of the invention can be determined by a person skilled in the art according to practical requirements. For example, the immunogenic composition of the invention can be administrated in a single dose only. This for example can be done for white broilers whose life span is about 40-50 days. The immunogenic composition of the invention can also be administrated in two doses. This for example can be done for yellow broilers whose life span is about 70 days. The immunogenic composition of the invention can be administrated in multiple doses. This can be done for example for the chicken such as breeders whose life span is more than one year or longer. Thus, in some embodiments, the immunogenic composition of the invention is administrated in a single dose administration. In some embodiments, the immunogenic composition of the invention is administrated in a two or multiple dose administration, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 dose administration. In some embodiments, the interval between two doses is about 4-6 weeks, such as 4 weeks, 5 weeks or 6 weeks.

[0077] A person skilled in the art can determine when the first dose of administration is given according to practical requirements. For example, when chickens are vaccinated, the immunogenic composition of the invention can be firstly administrated at day 1 of age or later, at day 7 of age or later, at day 10 of age or later, at day 15 of age or later, or at day 21 of age or later. In some embodiments, the immunogenic composition of the invention is administrated at day 1 of age or later, at day 7 of age or later, at day 10 of age or later, at day 15 of age or later, or at day 21 of age or later. In some embodiments, the immunogenic composition of the invention is administrated from day 1 of age, from day 7 of age, from day 10 of age, from day 15 of age, or from day 21 of age in a single-administration.

[0078] It is understood that the immunogenic composition when administered according to any of the administration regimen as described above, is efficacious in the prevention and / or treatment of infections caused by an AIV H7 subtype. Thus, in some embodiments, the immunogenic composition of the invention is administrated in a single dose administration and is efficacious by such single dose administration e.g., in the prevention and / or treatment of infections caused by an AIV H7 subtype. In some embodiments, the immunogenic composition of the invention is administrated in a two or multiple dose administration and is efficacious by such two or multiple dose administration, e.g., in the prevention and / or treatment of infections caused by an AIV H7 subtype.

[0079] The administrated volume of the immunogenic composition of the invention can be determined by a person skilled in the art according to practical requirements. In some embodiments, the administrated volume of the immunogenic composition of the invention is a range from about 0.01 ml to about 0.5 ml, about 0.05 ml to about 0.5 ml, about 0.1 ml to about 0.5 ml, about 0.2 ml to about 0.5 ml, or about 0.3 ml to about 0.5 ml. In one preferred embodiment, the administrated volume of the immunogenic composition of the invention is 0.5 ml.

[0080] In one preferred embodiment, the subject is chicken at about day 21 of age, and the chicken is subcutaneously administered with one dose (0.5 ml) of immunogenic composition of the invention.

[0081] The immunogenic composition of the invention can provide protection on chicken with different days of age, even from newborns, i.e., day one of life. The immunogenic composition of the invention is convenient for administration and it does not have to be limited to a certain route of administration, and the protection efficacy of the immunogenic composition of the invention is not affected by different routes of administration. It was shown in the example 4 that after one-dose administration, chickens at about day 21 of age showed no mortality, morbidity and oral and cloacal virus shedding against the AIV infection.

[0082] In a preferred embodiment of any of the methods and uses described herein, the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3. In some embodiments, the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments, the H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3, and wherein the H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3. In some embodiments, the AIV H7 HA protein comprises or consists the amino acid sequence as set forth in SEQ ID NO: 3.

[0083] In some embodiments, the nucleic acid molecule encoding the AIV H7 HA protein comprises or consists of the nucleotide sequence as set forth in SEQ ID NO: 8 or SEQ ID NO: 12. In some embodiments, the recombinant baculovirus comprises the nucleic acid molecule as set forth in SEQ ID NO: 8 or SEQ ID NO: 12.

[0084] Differentiation of naturally infected animals from vaccinated animals

[0085] In another aspect, the invention also provides a method of differentiating animals naturally infected with an AIV H7 subtype from animals vaccinated with the immunogenic composition of the invention, or use of the immunogenic composition of the invention in preparation of an agent for differentiating between animals naturally infected with an AIV H7 subtype and the vaccinated animals.

[0086] In some embodiments, the method comprises: a) analyzing a sample of an animal in an immuno test and / or genomic analytical test for the presence of an avian influenza marker which is not present in the immunogenic composition but present in the naturally infected animal, wherein the immuno test is an enzyme immunoassay or enzyme linked immunosorbent assay, or an agar gel precipitation assay, or a western blot assay b) determining whether the sample is positive or negative for the avian influenza marker, and c) correlating the test results with the status of the tested animal, wherein an animal that is positive for the avian influenza marker is a naturally infected animal and the animal that is negative for the avian influenza marker is an animal that is vaccinated with the immunogenic composition of the invention.

[0087] In some embodiments, the method comprises: a) analyzing a sample of an animal in an immuno test and / or genomic analytical test for the presence of an avian influenza marker which is specific for the immunogenic composition but not present in the naturally infected animal, wherein the immuno test is an enzyme immunoassay or enzyme linked immunosorbent assay, b) determining whether the sample is positive or negative for the avian influenza marker, and c) correlating the test results with the status of the tested animal, wherein an animal that is positive for the avian influenza marker is an animal that is vaccinated with the immunogenic composition of the invention.

[0088] In some embodiments, the animal can be poultry, even more preferably bird, chicken, duck, turkey and the like. In some embodiments, the animal is chicken or duck. In some embodiments, the animal is chicken.

[0089] In some embodiments, the AIV H7 subtype is selected from H7 Nx, wherein “x” represents any neuraminidase subtype of AIV, H7N1, H7N2, H7N3, H7N4, H7N5, H7N6, H7N7, H7N8, and H7N9. In one preferred embodiment, the AIV is H7N9.

[0090] Animals vaccinated with the immunogenic composition comprising the H7 HA protein of the invention will only have antibody response against this specific antigen of an AIV H7 subtype, while negative response to other viral components of an AIV H7 subtype. Thus, a further advantage of the invention is that it benefits a DIVA (differentiation between infected and vaccinated animals) concept with specific ELISA for differentiating between AIV infected animals and vaccinated animals.

[0091] Kit

[0092] In another aspect, the invention also provides a kit, comprising an immunogenic composition comprising the AIV H7 HA protein of the invention, optionally an instruction manual showing the administration regimen.

[0093] In some embodiments, the kit is used for prevention and / or treatment of infections in an animal caused by an AIV H7 subtype, or for reducing clinical signs in an animal caused by infections of an AIV H7 subtype, or for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype. In some embodiments, the avian influenza virus H7 subtype is the AIV H7N9. In some embodiments, the animal is chicken or duck.

[0094] Clauses

[0095] The subsequent clauses are part of the disclosure and shall further illustrate the invention.

[0096] Clause 1. An immunogenic composition or a vaccine comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) , wherein (i) the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3; and / or (ii) the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3.

[0097] Clause 2. The immunogenic composition of clause 1, wherein the avian influenza virus H7 subtype is the avian influenza virus H7N9.

[0098] Clause 3. The immunogenic composition of clause 1 or 2, wherein the AIV H7 HA protein is the only avian influenza antigen component contained in the immunogenic composition; or wherein the immunogenic composition does not comprise other AIV H7 proteins than the AIV H7 HA protein.

[0099] Clause 4. The immunogenic composition of any one of clauses 1-3, wherein the hemagglutinin protein is a recombinant hemagglutinin protein.

[0100] Clause 5. The immunogenic composition of clause 4, wherein the recombinant hemagglutinin protein is produced by a baculovirus-based expression system.

[0101] Clause 6. The immunogenic composition of clause 5, wherein the recombinant hemagglutinin protein is produced by a baculovirus-based expression system using a Sel promoter.

[0102] Clause 7. The immunogenic composition of clause 6, wherein the Sel promoter comprises or consists of a nucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 11.

[0103] Clause 8. The immunogenic composition of any one of clauses 1-6, wherein the AIV H7 HA protein is contained in a whole cell culture suspension which is obtainable or obtained by a method comprising the following steps: (i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein; (ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension; and (iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus.

[0104] Clause 9. The immunogenic composition of clause 8, wherein the nucleic acid molecule encoding the AIV H7 HA protein is as set forth in SEQ ID NO: 8.

[0105] Clause 10. The immunogenic composition of any one of clauses 1-9, wherein the immunogenic composition further comprises an adjuvant; preferably, wherein the immunogenic composition is formulated into a water-in-oil emulsion with an adjuvant, such as MONTANIDETM ISA 71R VG.

[0106] Clause 11. A method for preparing an immunogenic composition of any one of clauses 1 to 10, comprising the following steps: (i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein; (ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension; (iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus; and (iv) optionally, emulsifying and adding an adjuvant into the whole cell culture suspension.

[0107] Clause 12. A recombinant baculovirus, comprises the nucleic acid molecule as set forth in SEQ ID NO: 8 or SEQ ID NO: 12.

[0108] Clause 13. A host cell or transformed with the recombinant baculovirus of clause 12, preferably, the host cell is an inset cell.

[0109] Clause 14. A method for prevention and / or treatment of infections in an animal caused by an avian influenza virus H7 subtype, or for reducing clinical signs in an animal caused by infections of an avian influenza virus H7 subtype, or for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an avian influenza virus H7 subtype, comprising administering the immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11 to the animal; preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.

[0110] Clause 15. The immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11, for use in the prevention and / or treatment of infections in an animal caused by AIV H7 subtype, or for use in reducing clinical signs in an animal caused by infections of an AIV H7 subtype, or for use in reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype; preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.

[0111] Clause 16. Use of the immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11 in preparation of a kit for prevention and / or treatment of infections in an animal caused by an AIV H7 subtype, or in preparation of a kit for reducing clinical signs in an animal caused by infections of an AIV H7 subtype, or in preparation of a kit for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an AIV H7 subtype; preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.

[0112] Clause 17. The method of clause 14, or the immunogenic composition of clause 15, or the use of clause 16, wherein the animal is subjected to single, two or multiple dose of administration of the immunogenic composition in a range from about 0.01 ml to about 0.5 ml; and / or

[0113] wherein the animal is at day 1 of age or later, at day 7 of age or later, at day 10 of age or later, at day 15 of age or later, or at day 21 of age or later; and / or

[0114] wherein the animal is administrated via a subcutaneous route; and / or

[0115] wherein the animal is poultry; preferably the animal is selected from a group consisting of bird, chicken, duck, goose, pigeon, and turkey;

[0116] preferably, chicken at about day 21 of age is subcutaneously administered with one dose (0.5 ml) of immunogenic composition.

[0117] Clause 18. A method of differentiating animals naturally infected with AIV H7 from animals vaccinated with the immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11, comprising: a) analyzing a sample of an animal in an immuno test and / or genomic analytical test for the presence of an avian influenza marker which is not present in the immunogenic composition but present in the naturally infected animal, wherein the immuno test is an enzyme immunoassay or enzyme linked immunosorbent assay, or an agar gel precipitation assay, or a western blot assay b) determining whether the sample is positive or negative for the avian influenza marker, and c) correlating the test results with the status of the tested animal, wherein an animal that is positive for the avian influenza marker is a naturally infected animal and the animal that is negative for the avian influenza marker is an animal that is vaccinated with the immunogenic composition of the invention.

[0118] Clause 19. A method of differentiating animals naturally infected with AIV H7 from animals vaccinated with the immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11, comprising: a) analyzing a sample of an animal in an immuno test and / or genomic analytical test for the presence of an avian influenza marker which is specific for the immunogenic composition but not present in the naturally infected animal, wherein the immuno test is an enzyme immunoassay or enzyme linked immunosorbent assay, b) determining whether the sample is positive or negative for the avian influenza marker, and c) correlating the test results with the status of the tested animal, wherein an animal that is positive for the avian influenza marker is an animal that is vaccinated with the immunogenic composition of the invention.

[0119] Clause 20. A kit, comprising the immunogenic composition of any one of clauses 1-10 or the immunogenic composition prepared by the method of clause 11, optionally an instruction manual showing the administration regimen.

[0120] Examples

[0121] The following examples are included to further illustrate the invention described herein and to demonstrate embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result which are within the spirit and scope of the invention.

[0122] Example 1. Generation of the H7 HA amino acid sequences

[0123] 1.1 Generation of the H7 HA consensus amino acid sequence 1 (H7Con1)

[0124] To generate H7N9 influenza HA consensus amino acid sequence 1 (H7Con1) , 259 Avian H7N9 influenza HA amino acid sequences isolated in China from year 2013 to year 2018 were collected and analyzed. The final consensus sequence was generated by aligning and analyzing 259 amino acid sequences with Geneious software. This final consensus amino acid sequence was designated as H7Con1 (SEQ ID NO: 1) .

[0125] 1.2 Generation of the H7 HA consensus amino acid sequence 1b (H7Con1b)

[0126] To generate H7N9 influenza HA consensus amino acid sequence 1b (H7Con1b) , H7Con1 sequence was used for blasting in NCBI. Blasting result found one highest homologous HA sequence of field stain Influenza A virus A / chicken / Jiangsu / W1-8 / 2015 (H7N9) , which had only one amino acid difference compared to H7con1 (467Asn for H7con1b, 467Asp for H7con1) . The number is assigned according to SEQ ID NO: 3. The sequence of field stain Influenza A virus A / chicken / Jiangsu / W1-8 / 2015 (H7N9) was designated as H7Con1b (SEQ ID NO: 2) .

[0127] 1.3 Generation of the H7 HA consensus amino acid sequence 2 (H7Con2)

[0128] To generate H7N9 influenza HA consensus amino acid sequence 2 (H7Con2) , 50 Avian H7N9 influenza HA amino acid sequences isolated in China from year 2017 to year 2019 were collected and analyzed. The final consensus sequence was generated by aligning and analyzing 50 amino acid sequences with Geneious software. This final consensus amino acid sequence was designated as H7Con2 (SEQ ID NO: 3) .

[0129] H7Con2 sequence was used for blasting in NCBI. Blasting result found one highest homologous HA sequence of field stain Influenza A virus A / chicken / Jiangxi / JX4 / 2017 (H7N9) , which had the same amino acid sequence compared to H7Con2. H7Con2 shows about 97%identity with H7Con1b.

[0130] 1.4 Generation of the H7 HA amino acid sequence CS (H7CS)

[0131] To generate H7N9 influenza HA consensus amino acid sequence CS (H7CS) , a secondgeneration sequencing for Influenza A virus A / Chicken / Huizhou / HZ-3 / 2016 (H7N9 Re1 series challenge virus) was performed. The obtained amino acid sequence from sequencing was designated as H7CS (SEQ ID NO: 4) . H7Con2 and H7CS differed in E164K and G320R.

[0132] Position 164 is on the RBD site and the difference of E (H7Con2) to K (H7CS) is opposite charge, which is quite big. This may give H7Con2 a different immunogenicity compared to H7CS. As to position 320, it is on the multiple basic AAs cleavage site of HA0, the difference of G and R may affect the final structure of HA.

[0133] 1.5 Generation of the H7HA amino acid sequence WT (H7WT)

[0134] To generate H7N9 influenza HA consensus amino acid sequence WT (H7WT) , the amino acid sequence of Influenza A virus (A / chicken / Shaoxing / 5201 / 2013 (H7N9) , which is a low pathogenic avian influenza virus strain, was selected. The obtained amino acid sequence was designated as H7WT (SEQ ID NO: 5) .

[0135] Example 2. Expression of H7 HA proteins

[0136] 2.1 Optimization of the H7 HA nucleic acid sequences

[0137] To optimize for better expression, each of amino acid sequence of H7Con1, H7Con1b, H7Con2, H7CS, and HAWT as described above was reversely deduced into the corresponding nucleic acid sequence by Geneious software and optimized for expression in insect cells of Baculovirus Expression System (Allele Biotechnology, CAT ABP-BVP-10002) . The optimized nucleic acid sequences of H7Con1, H7Con1b, H7Con2, H7CS, and HAWT were synthesized by GenScript (GenScript, NJ, USA) . The optimized nucleic acid sequences of H7Con1, H7Con1b, H7Con2, H7CS, and HAWT were shown by SEQ ID NOs: 6-10, respectively.

[0138] 2.2. Generation of the H7 HA nucleic acid sequences Con2pSeL, CSpSeL and WTpSeL

[0139] To generate H7N9 influenza HA nucleic acid sequences H7Con2pSeL, H7CSpSeL, and H7WTpSeL, a nucleic acid sequence pSeL (SEQ ID NO: 11) was inserted before the nucleic acid sequence of Con2, CS or WT. The final nucleic acid sequences were designated as H7Con2pSeL, H7CSpSeL, and H7WTpSeL. The nucleic acid sequences of H7Con2pSeL, H7CSpSeL, and H7WTpSeL were shown by SEQ ID NOs: 12-14, respectively.

[0140] 2.3. Construction of recombinant baculovirus expression systems

[0141] The optimized nucleic acid sequences of H7Con1, H7Con1b, H7Con2, H7WT, H7Con2pSeL, H7CSpSeL, and H7WTpSeL as prepared above was inserted into the Baculovirus expression system transfer vector pVL1393 which was included in the SapphireTM Baculovirus DNA and Transfection Kit (Allele Biotechnology, CAT ABP-BVD-10002) , so as to generate the transfer plasmids, designated as pVL1393-H7Con1, pVL1393-H7Con1b, pVL1393-H7Con2, pVL1393-H7WT, pVL1393-H7Con2pSeL, pVL1393-H7CSpSeL, pVL1393-H7WTpSeL, respectively.

[0142] Each of pVL1393-H7Con1, pVL1393-H7Con1b, pVL1393-H7Con2, pVL1393-H7WT, pVL1393-H7Con2pSeL, pVL1393-H7CSpSeL, and pVL1393-H7WTpSeL was then co-transfected with linearized wild type SapphireTM Baculovirus DNA (SapphireTM Baculovirus DNA and Transfection Kit; Allele Biotechnology, CAT ABP-BVD-10002) into the sf9 insect cells (Invitrogen, Cat #B825-01, Lot #1030672) , so as to obtain rescued recombinant baculoviruses. The recombinant baculoviruses containing the optimized nucleic acid sequences of H7Con1, H7Con1b, H7Con2, H7WT, H7Con2pSeL, H7CSpSeL, H7WTpSeL were designated as rBacH7Con1, rBacH7Con1b, rBacH7Con2, rBacH7WT, rBacH7Con2pSeL, rBacH7CSpSeL, and rBacH7WTpSeL, respectively, and the transfected sf9 cells containing each of recombinant baculoviruses were obtained according to the manufacturer’s manual.

[0143] The transfected sf9 cells as prepared above were cultured at 27℃ incubator for four days, and the supernatant of the cell culture was harvested. To get pure recombinant virus, the harvested supernatant was then subjected to plaque purification. Three rounds of plaque purifications were conducted, and the virus plaques containing rBacH7Con1, rBacH7Con1b, rBacH7Con2pSeL and rBacH7CSpSeL respectively were picked up after the third round of plaque purification, to obtain purified rBacH7Con1, rBacH7Con1b, rBacH7Con2, rBacH7WT, rBacH7Con2pSeL, rBacH7CSpSeL, and rBacH7WTpSeL.

[0144] 2.4. Expression of H7 HA proteins in insect cells

[0145] Each of the above purified rBacH7Con1, rBacH7Con1b, rBacH7Con2, rBacH7WT, rBacH7Con2pSeL, rBacH7CSpSeL and rBacH7WTpSeL was further propagated in a suspension cultured insect cell line SF+ cells ( 420 serum-free medium for insect cells, Sigma-Aldrich, Cat. 14420C) in shaking flasks. In brief, the SF+ cells (Protein Sciences Corporation, Meriden, CT) was seeded into a shaking flask at the density of 106 cells / ml, and each of the above purified rBacH7Con1, rBacH7Con1b, rBacH7Con2, rBacH7WT, rBacH7Con2pSeL, rBacH7CSpSeL rBacH7WTpSeL was inoculated into SF+cells (Protein Sciences, Inc., Meriden, CT) with MOI=0.01 to MOI=1. The inoculated SF+ cells were cultured at EX-CELL 420 medium at 27℃, with the shaking speed of 80-120 rpm / min for 3-7 days, and the cell culture suspensions containing the expressed H7Con1, H7Con1b, H7Con2, H7WT, H7Con2pSeL, H7CSpSeL, H7WTpSeL respectively were harvested later for the next step. The harvested cell culture suspensions comprised a cell count between 0.5-1.5 x 106 cells / ml.

[0146] The HAU of the cell culture suspensions containing H7Con1, H7Con1b, H7Con2, H7WT, H7Con2pSeL, H7CSpSeL, H7WTpSeL respectively was tested by Haemagglutination Assay (See OIE Terrestrial Manual 2015, Chapter 2.3.1 &2.3.2, Avian Influenza (infection with avian influenza viruses) ) with a two-fold serial dilution method. The results showed that the HAU of the cell culture suspensions of H7Con1, H7Con1b, H7Con2, H7WT, H7Con2pSeL, H7CSpSeL, H7WTpSeL was greater than 27 (7log2) HAU / 25ul.

[0147] 2.5. Effect of pSeL sequence on HAU

[0148] H7HAWT, H7WTpSeL, H7HACon2, H7Con2pSeL were expressed as described above. HAU of H7HAwt, H7wtpSeL, H7HACon2, H7HACon2pSeL were measured as described above and the results were shown in below Table 1. Results showed that pSeL increased HAU of HAWT and HACon2 to 1.5-2 fold.

[0149] Table 1. Effect of pSeL sequence on HAU

[0150] Example 3. Preparation of immunogenic compositions

[0151] H7Con1b, H7Con2pSeL, and H7CSpSeL clones were selected as candidates for preparation of immunogenic compositions based on their HAU. H7Con1b, H7Con2pSeL, and H7CSpSeL were expressed as described above. The harvested cell culture suspensions were further subjected to a Formaldehyde (FA) -treatment by adding 0.3%BEI solution at 27℃ for 48 hours, so as to inactivate the infectivity of Baculovirus. After the inactivation, the inactivated cell culture suspensions were directly used as the active antigenic ingredient to be used for the next emulsification procedure with adjuvants.

[0152] The immunogenic compositions of H7Con1b, H7Con2pSeL, and H7CSpSeL were prepared into water-in-oil emulsions. In brief, water-in-oil emulsions are two phase systems consisting of a continuous oil phase and a dispersed aqueous phase whereby the aqueous phase is dispersed as small droplets in the oil phase. The oil phase used to prepare the immunogenic composition was the commercially available adjuvant MONTANIDETM ISA 71R VG (Manufactured by Seppic Inc, Cat no: 365187) , while the aqueous phase contained each of the inactivated cell culture suspensions of H7Con1b, H7Con2pSeL, and H7CSpSeL. For each dose (0.5 ml) of the immunogenic composition, about 3 parts of aqueous phase (90 ul) were added to about 7 parts of oil phase (210 ul) to prepare the water-in-oil emulsions. For each of the immunogenic compositions of H7Con1b, H7Con2pSeL, and H7CSpSeL, the amount of H7Con1b, H7Con2pSeL, and H7CSpSeL was at least 256 HAU / dose.

[0153] Example 4. Virus challenge and protection efficacy tests

[0154] The protection efficacy of H7Con1b, H7Con2pSeL, and H7CSpSeL were further tested in this example. Stock of Highly Pathogenic Avian Influenza (HPAI) virus strain A / Chicken / Huizhou / HZ-3 / 2016 were prepared and used for challenge trials.

[0155] SPF chicken embryonated eggs were purchased from SPAFAS Jinan. After hatch, SPF chickens were randomly picked and kept in designated isolators. SPF chickens were vaccinated via subcutaneous route at 10-day of age with one dose (0.5 ml) of immunogenic compositions comprising H7Con1b, H7Con2pSeL, and H7CSpSeL, each with a comparable HAU of at least 512 / dose respectively. The vaccinated chickens were kept in ABSL3 (Animal Biological Safety Level 3) facilities.

[0156] Three weeks (21 days) after vaccination, chickens were challenged by nasal drop with RE1 H7N9 challenge virus. The challenge dose for each chicken was 5Log10 EID50 (EID50 = 50%of Embryo Infective doses, which means the amount of infectious virus that causes infection in the 50%of inoculated embryonated eggs) . Chickens were monitored for two weeks post challenge, and mortality and morbidity of the chickens were recorded daily. Cotton swabs of tracheal and cloacal from each chicken were collected at 3, 5, and 7 days post challenge. Virus shedding was tested with the cotton swabs samples via chicken embryos virus isolation.

[0157] The evaluation of protection efficacy against each of the challenge virus was based on the following criteria: 1) whether 100%vaccinated chickens will survive during the two weeks of monitoring period (0%mortality) . 2) whether 100%vaccinated chickens will have no detectable clinical symptoms during the two weeks of monitoring period (0%morbidity) . The clinical symptoms of HAPI include insufficient spirits, rough feathers, significantly reduced appetite, coughing, secretions from the nose and eyes, swelling of the face, cyanosis, diarrhea, neurological symptoms. The appearance of at least these clinical symptoms was used for the calculation of morbidity. 3) whether 100%vaccinated chickens will have no virus shedding (both oral and cloacal) by testing the 5 days post challenge cotton swab samples.

[0158] The vaccination and challenge animal trials were conducted and Tables 2 and 3 below show the protection efficacy of H7Con1b, H7Con2pSeL, and H7CSpSeL. Interestingly, H7Con2 has merely two amino acid difference (E164K, G320R) with H7CS (from the challenge virus A / Chicken / Huizhou / HZ-3 / 2016) and has 97.16%identity with H7Con1b (from field strain A virus A / chicken / Jiangsu / W1-8 / 2015) , but shows better efficacy than H7CS and H7Con1b, i.e., no virus shedding on 5 dpc. In both animal trials H7Con2pSeL provided 100%protection on mortality, morbidity and virus shedding.

[0159] Table 2 Animal Trial Results

[0160] Table 3 Animal Trial Results SEQUENCE INFORMATION

[0161] SEQ ID NO: 1 the amino acid sequence of H7Con1

[0162] DKICLGHHAVSNGTKVNTLTERGVEVVNATETVERTNIPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERREGSDVCYPGKFVNEEALRQILRESGGIDKEAMGFTYSGIRTNGATSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRKSPAIIVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGLSGRIDFHWLMLNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEIPKGRGLFGAIAGFIENGWEGLIDGWYGFRHQNAQGEGTAADYKSTQSAIDQITGKLNRLIEKTNQQFELIDNEFNEVEKQIGNVINWTRDSITEVWSYNAELLVAMENQHTIDLADSEMDKLYERVKRQLRENAEEDGTGCFEIFHKCDDDCMASIRNNTYDHSKYREEAMQNRIQIDPVKLSSGYKDVILWFSFGASCFILLAIVMGLVFICVKNGNMRCTICI

[0163] SEQ ID NO: 2 the amino acid sequence of H7Con1b

[0164] DKICLGHHAVSNGTKVNTLTERGVEVVNATETVERTNIPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERREGSDVCYPGKFVNEEALRQILRESGGIDKEAMGFTYSGIRTNGATSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRKSPAIIVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGLSGRIDFHWLMLNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEIPKGRGLFGAIAGFIENGWEGLIDGWYGFRHQNAQGEGTAADYKSTQSAIDQITGKLNRLIEKTNQQFELIDNEFNEVEKQIGNVINWTRDSITEVWSYNAELLVAMENQHTIDLADSEMDKLYERVKRQLRENAEEDGTGCFEIFHKCDNDCMASIRNNTYDHSKYREEAMQNRIQIDPVKLSSGYKDVILWFSFGASCFILLAIVMGLVFICVKNGNMRCTICI

[0165] SEQ ID NO: 3 the amino acid sequence of H7Con2 (the shadowed amino acid residues correspond to the amino acid residues T14, R22, P112, F115, E164 and G320 contained in H7Con2)

[0166] DKICLGHHAVSNGTKVNTLTERGVEVVNATETVERTNTPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERREGSDVCYPGKFVNEEALRQILRESGGIDKEPMGFTYNGIRTNGVTSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRESPAIIVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGQSGRIDFHWLILNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEVPKGKRTARGLFGAIAGFIENGWEGLIDGWYGFRHQNAQGEGTAADYKSTQSAIDQITGKLNRLIAKTNQQFKLIDNEFNEVEKQIGNVINWTRDSITEVWSYNAELLVAMENQHTIDLADSEMDKLYERVKRQLRENAEEDGTGCFEIFHKCDDDCMASIRNNTYDHRKYREEAMQNRIQIDPVKLSSGYKDVILWFSFGASCFILLAIVMGLVFICVKNGNMRCTICI

[0167] SEQ ID NO: 4 the amino acid sequence of H7CS

[0168] DKICLGHHAVSNGTKVNTLTERGVEVVNATETVERTNTPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERREGSDVCYPGKFVNEEALRQILRESGGIDKEPMGFTYNGIRTNGVTSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRKSPAIIVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGQSGRIDFHWLILNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEVPKRKRTARGLFGAIAGFIENGWEGLIDGWYGFRHQNAQGEGTAADYKSTQSAIDQITGKLNRLIAKTNQQFKLIDNEFNEVEKQIGNVINWTRDSITEVWSYNAELLVAMENQHTIDLADSEMDKLYERVKRQLRENAEEDGTGCFEIFHKCDDDCMASIRNNTYDHRKYREEAMQNRIQIDPVKLSSGYKDVILWFSFGASCFILLAIVMGLVFICVKNGNMRCTICI

[0169] SEQ ID NO: 5 the amino acid sequence of H7WT

[0170] DKICLGHHAVSNGTKVNTLTERGVEVVNATETVERTNIPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERREGSDVCYPGKFVNEEALRQILRESGGIDKEAMGFTYSGIRTNGATSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRKSPALIVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGLSGRIDFHWLMLNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEIPKGRGLFGAIAGFIENGWEGLIDGWYGFRHQNAQGEGTAADYKSTQSAIDQITGKLNRLIEKTNQQFELIDNEFNEVEKQIGNVINWTRDSITELWSYNAELLVAMENQHTIDLADSEMDKLYERVKRQLRENAEEDGTGCFEIFHKCDDDCMASIRNNTYDHSKYREEAMQNRIQIDPVKLSSGYKDVILWFSFGASCFILLAIVMGLVFICVKNGNMRCTICI

[0171] SEQ ID NO: 6 H7Con1 optimized coding sequence

[0172] atgaacacccagatcctggttttcgctctgatcgccatcatccccactaacgctgataagatctgcctgggccaccacgccgtgagcaacggcacaaaggtgaacaccctgaccgagcgtggagtcgaggtggtgaacgccactgaaacagtggaacgcactaacatccctcgcatctgcagcaagggcaagcgcactgtcgacctgggtcagtgcggtctgctgggcaccatcaccggtcctcctcagtgtgaccagttcctggagttcagcgctgacctgatcatcgaacgccgcgagggctctgacgtctgctaccctggcaagttcgtgaacgaagaggctctgcgccagatcctgagggaatcaggcggaatcgataaggaggctatgggtttcacatactccggtatccgcacaaacggtgctacaagcgcctgccgtcgctccggatctagcttctacgccgaaatgaagtggctgttgtctaacactgacaacgctgctttcccacagatgaccaagtcctacaagaacacacgtaagtccccagctatcatcgtgtggggcatccaccacagcgtttccaccgctgagcaaactaagctgtacggctctggtaacaagttggtcactgtcggcagctctaactaccagcaaagcttcgtgccttcccctggcgcccgtccacaggtgaacggtctcagcggtcgcatcgacttccactggctgatgctgaaccctaacgacacagtgaccttctcattcaacggcgctttcatcgctcctgaccgcgcctccttcctgcgcggaaagtcaatgggtatccagtccggtgttcaggtggacgctaactgtgagggtgactgctaccacagcggcggtaccatcatctctaacctgcccttccagaacatcgacagccgcgccgtgggcaagtgtccacgttacgtgaagcagcgcagcctgctcctcgccaccggtatgaagaacgtgcctgagatccctaagggtcgtggcctgttcggtgccatcgccggtttcatcgagaacggctgggagggtctcatcgacggttggtacggcttccgtcaccagaacgcccagggagagggtaccgctgccgactacaagagcactcagagcgccatcgaccaaatcacaggaaagctgaaccgcctgatcgagaagactaaccaacagttcgaactcatcgacaacgaatttaacgaagtggaaaagcaaatcggtaacgttatcaactggacacgcgacagcatcaccgaagtgtggagctacaacgccgagctcctggtcgctatggagaaccagcacaccatcgacctggccgacagcgaaatggacaagctctacgaacgcgtcaagcgccagctgcgtgaaaacgctgaagaggacggcaccggatgtttcgaaatcttccacaagtgcgacgacgactgtatggcctcaatccgtaacaacacctacgaccactccaagtaccgtgaggaagccatgcagaaccgcatccaaatcgaccccgtgaagctgagctccggttacaaggacgtgatcctgtggttcagcttcggcgccagctgtttcatcctgctggctatcgtgatgggcctcgtgttcatctgcgtgaagaacggtaacatgcgttgtaccatctgcatctaa

[0173] SEQ ID NO: 7 H7Con1b optimized coding sequence

[0174] atgaacacacagatcctggtgttcgctctgatcgccatcatccctacaaacgctgacaagatctgtctcggtcaccacgccgtgagcaacggtactaaggttaacaccctcactgaacgtggtgtggaggtcgtgaacgccaccgagaccgtggaacgcacaaacatcccccgtatctgcagcaagggaaagcgtacagtcgacctcggtcagtgtggcctgctgggcactatcaccggtccaccacagtgcgaccagttcctggagttctccgctgacctgatcatcgaacgtcgtgaaggtagcgacgtgtgctacccaggcaagttcgtgaacgaagaagctctgcgccagatcctgcgcgagtccggcggtatcgacaaggaagctatgggattcacatacagcggtatccgtaccaacggtgctacttccgcctgtcgtcgcagcggatctagcttctacgccgaaatgaagtggctgctgtccaacaccgacaacgccgctttccctcagatgactaagtcctacaagaacacacgtaagtcccccgccatcatcgtctggggcatccaccacagcgttagcaccgctgaacagaccaagctgtacggcagcggtaacaagctggtgaccgtgggttcctccaactaccagcagagcttcgtgcctagccctggtgcccgtcctcaggttaacggactcagcggtaggatcgacttccactggctgatgctgaaccctaacgacacagtgaccttctccttcaacggcgctttcatcgccccagaccgtgcctctttcctgcgtggcaagtctatgggcatccagagcggcgtgcaggttgatgctaactgcgaaggcgactgctaccactctggtggcactatcatctccaacctccctttccagaacatcgactcacgtgccgtgggcaagtgtcccaggtacgtgaagcagcgtagcctgctcctggctaccggtatgaagaacgtgcccgaaatccccaagggtcgcggtctcttcggtgccatcgctggattcatcgagaacggctgggaaggcctgatcgacggttggtacggcttccgccaccagaacgcccaaggcgaaggcactgctgctgactacaagtccacccagagcgccatcgaccagatcacaggaaagctgaaccgcctcatcgaaaagactaaccagcagttcgagctgatcgataacgagttcaacgaggtggagaagcaaatcggtaacgtcatcaactggactcgcgactccatcaccgaggtttggtcctacaacgccgagctgctcgtggccatggaaaaccaacacactatcgacctggctgactctgagatggacaagctgtacgagcgcgtcaagcgtcagctgcgcgaaaacgctgaggaggacggcaccggatgtttcgagatcttccacaagtgcgacaacgactgtatggctagcatccgcaacaacacctacgaccactccaagtaccgcgaagaagctatgcagaaccgtatccagatcgaccccgttaagctgtccagcggctacaaggacgtgatcctgtggttcagcttcggtgctagctgtttcatcctgctcgccatcgttatgggtctcgtcttcatctgtgtgaagaacggcaacatgcgctgcaccatctgcatctaa

[0175] SEQ ID NO: 8 H7Con2 optimized coding sequence

[0176] atgaacacccagatcctggtgttcgctctgatcgccatcatccctaccaacgctgacaagatctgtctgggccaccacgccgtgtccaacggcactaaggtgaacactctgacagaacgtggtgttgaggtggtgaacgctactgagacagtggagcgtactaacaccccacgcatctgctccaagggaaagcgtaccgttgacctcggacagtgcggtctgctgggtacaatcaccggtcctccccagtgtgaccagttcctggagttctccgccgacctgatcatcgaaaggcgtgagggtagcgacgtctgctaccctggcaagttcgtgaacgaagaagctctccgccagatcctccgtgagtctggtggcatcgacaaggaacccatgggtttcacttacaacggcatccgcaccaacggagtcacatccgcttgtcgccgcagcggttcaagcttctacgccgagatgaagtggctcctgtccaacactgacaacgccgctttccctcagatgaccaagtcatacaagaacacccgtgaatccccagctatcatcgtgtggggtatccaccactcagtcagcacagctgaacagaccaagctgtacggcagcggtaacaagctggtgactgtgggtagctctaactaccaacagagcttcgtcccatcccccggtgcccgccctcaggtgaacggtcagagcggtcgcatcgacttccactggctgatcctcaaccctaacgacaccgtcactttcagcttcaacggtgctttcatcgctccagaccgtgcctcattcctgcgcggcaagtccatgggtatccagtcaggcgttcaggtggacgccaactgtgagggcgactgttaccacagcggtggaacaatcatcagcaacctgcccttccagaacatcgacagccgcgccgtgggcaagtgccctcgttacgttaagcagcgttccctgctcctcgctacaggtatgaagaacgtgcctgaggtgcctaagggaaagcgtactgcccgcggtctgttcggtgctatcgccggtttcatcgaaaacggctgggagggcctgatcgacggttggtacggcttccgtcaccagaacgcccagggcgaaggtaccgccgccgactacaagtccactcagtccgctatcgaccagatcactggcaagctgaaccgcctgatcgctaagaccaaccagcagttcaagctgatcgacaacgagttcaacgaggtcgaaaagcagatcggcaacgtgatcaactggacccgcgactccatcactgaagtttggtcctacaacgctgagctcctcgtggctatggaaaaccagcacaccatcgacctcgccgacagcgagatggacaagctgtacgaacgcgtgaagcgccagctgagggaaaacgctgaagaggacggcaccggatgcttcgaaatcttccacaagtgtgacgacgactgcatggctagcatccgtaacaacacatacgatcaccgtaagtaccgcgaggaggccatgcagaaccgcatccagatcgaccccgtgaagctgtccagcggatacaaggacgtgatcctgtggttcagcttcggcgcctcctgtttcatcctgctggccatcgtgatgggcctggttttcatctgtgtgaagaacggtaacatgcgttgcacaatctgcatctaa

[0177] SEQ ID NO: 9 H7CS optimized coding sequence

[0178] atgaacacccagatcctggtgttcgccctgatcgccatcatccctacaaacgccgacaagatctgcctcggacaccacgctgtgtccaacggtactaaggtcaacaccctgacagaacgtggtgtggaggtggtgaacgccactgagaccgttgaacgcactaacacaccccgtatctgctccaagggcaagcgcacagtggacctgggtcagtgcggcctcctcggtacaatcaccggccctccacagtgtgaccagttcctggagttctccgctgacctgatcatcgaacgtcgcgaaggctcagacgtgtgctaccctggcaagttcgtgaacgaagaggctctccgccagatcctccgcgaatcaggcggtatcgacaaggagccaatgggattcacatacaacggtatccgcactaacggtgtgacatccgcctgtcgtcgctctggtagctctttctacgctgagatgaagtggctgctcagcaacaccgacaacgctgccttccctcagatgactaagtcctacaagaacacaaggaagtcccctgctatcatcgtttggggaatccaccacagcgtttcaaccgccgaacagaccaagctgtacggttccggtaacaagctggtgaccgtgggttcctccaactaccagcaatccttcgtcccaagcccaggcgctcgcccacaggtgaacggacagtccggccgtatcgacttccactggctgatcctgaaccccaacgacaccgtgactttctcattcaacggcgccttcatcgcccccgaccgcgcctctttcctcaggggcaagtcaatgggcatccagagcggtgtgcaggttgacgccaactgtgagggtgactgttaccactccggtggtacaatcatctccaacctgccattccagaacatcgactcccgtgctgtcggcaagtgtcctcgctacgtgaagcagcgctccctgctgctcgctaccggcatgaagaacgtccctgaagtccccaagcgtaagcgtaccgcccgtggactcttcggtgctatcgctggtttcatcgagaacggttgggagggcctgatcgacggctggtacggcttccgtcaccaaaacgcccagggcgagggtaccgccgctgactacaagtccacccagagcgctatcgaccagatcaccggaaagctgaaccgtctgatcgccaagactaaccagcagttcaagctcatcgataacgagttcaacgaggtcgaaaagcagatcggtaacgttatcaactggactcgcgactcaatcaccgaagtctggagctacaacgctgaactgctcgtcgctatggaaaaccagcacaccatcgacctggccgactccgagatggacaagctctacgaacgcgtgaagcgccagctgcgtgaaaacgctgaagaggacggcacaggatgcttcgagatcttccacaagtgtgacgacgactgcatggctagcatccgtaacaacacttacgaccaccgtaagtaccgcgaagaagctatgcagaaccgtatccagatcgaccccgtgaagctgtcctctggctacaaggacgtgatcctgtggttctccttcggtgcctcctgcttcatcctgctggccatcgtcatgggtctggtgttcatctgcgttaagaacggtaacatgcgttgcaccatctgcatctaa

[0179] SEQ ID NO: 10 H7WT optimized coding sequence

[0180] atgaacacccagatcctggtcttcgctctgatcgccatcatccctactaacgctgacaagatctgcctgggacaccacgccgtctccaacggtaccaaggtgaacaccctgactgagagaggcgtcgaagtggtcaacgctaccgagactgtggaacgtaccaacatccccaggatctgcagcaagggaaagcgcactgtggacctgggacagtgcggcctgctgggaaccatcactggtcctccccagtgcgaccagttcctggagttctctgccgacctgatcatcgagcgccgtgaaggctcagacgtctgctaccctggaaagttcgtgaacgaggaagctctgagacagatcctgcgcgagtctggtggcatcgacaaggaagccatgggattcacctactcaggtatccgtaccaacggcgctacttctgcctgcaggagatcaggttccagcttctacgctgagatgaagtggctgctgtctaacactgacaacgctgccttccctcagatgaccaagtcttacaagaacactaggaagtcacccgctctgatcgtctggggtatccaccactctgtgtcaaccgccgaacagactaagctgtacggctctggaaacaagctggtgaccgtcggctcttcaaactaccagcagtctttcgtcccatcacctggagctcgtcctcaggtgaacggtctgtcaggcaggatcgacttccactggctgatgctgaaccccaacgacaccgtcactttctccttcaacggtgctttcatcgccccagacagagctagcttcctgcgcggcaagtccatgggcatccagagcggagtgcaggtcgacgccaactgcgagggcgactgctaccactctggaggtaccatcatctcaaacctgccattccagaacatcgactccagggctgtgggcaagtgccctcgttacgtgaagcagaggagcctgctgctggccactggcatgaagaacgtgcccgaaatcccaaagggtcgtggcctgttcggtgctatcgccggcttcatcgagaacggatgggaaggtctgatcgacggctggtacggattcaggcaccagaacgctcagggagagggtaccgctgccgactacaagtccactcagagcgccatcgaccagatcaccggcaagctgaacagactgatcgaaaagactaaccagcagttcgagctgatcgacaacgagttcaacgaggtcgaaaagcagatcggaaacgtgatcaactggacccgcgactccatcactgagctgtggagctacaacgctgagctgctggtcgccatggaaaaccagcacaccatcgacctggctgactccgagatggacaagctgtacgaacgcgtgaagcgtcagctgagggagaacgccgaggaagacggcaccggatgcttcgaaatcttccacaagtgcgacgacgactgcatggcttccatccgcaacaacacttacgaccacagcaagtacagagaggaagccatgcagaaccgcatccagatcgaccctgtcaagctgtccagcggatacaaggacgtgatcctgtggttctccttcggtgctagctgcttcatcctgctggccatcgtgatgggtctggtcttcatctgcgtgaagaacggcaacatgcgttgcactatctgcatctaa

[0181] SEQ ID NO: 11 SeL promoter sequence

[0182] gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata

[0183] SEQ ID NO: 12 nucleic acid sequences of H7Con2pSeL

[0184] gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataGCCACCatgaacacacagatcctggttttcgccctgatcgccatcatccctactaacgctgataagatctgcctgggccaccacgccgtgagcaacggcaccaaggtgaacactctgaccgagcgtggagtcgaggtggtgaacgccaccgaaacagtcgaacgcactaacacccctcgcatctgtagcaagggtaaacgcacagttgacctgggccagtgtggtctgctcggcaccatcacaggtcccccacagtgtgaccagttcctggaatttagcgccgacctcatcatcgagcgccgtgagggaagcgacgtctgttaccctggcaagttcgtgaacgaagaagccctgcgccagatcctgcgcgaaagcggtggaatcgacaaggaacctatgggtttcacctacaacggtatccgtaccaacggagttaccagcgcctgtcgccgtagcggtagctccttctacgctgaaatgaagtggctcctcagcaacaccgacaacgctgccttcccccagatgaccaagtcctacaagaacacacgcgaatccccagctatcatcgtctggggcatccaccacagcgtgagcacagctgagcagacaaagctgtacggctccggtaacaagctggtcaccgtgggttctagcaactaccaacagtccttcgtccctagccccggtgcccgcccacaggtcaacggccagtcaggccgcatcgacttccactggctgatcctcaacccaaacgacaccgttaccttctcattcaacggcgctttcatcgctccagaccgcgcttctttcctccgtggaaagtccatgggtatccagagcggcgtgcaggtcgacgccaactgtgaaggtgactgctaccacagcggcggtaccatcatcagcaacctcccattccaaaacatcgactcccgtgctgtgggcaagtgcccccgttacgtgaagcagcgctccctgctgctggctacaggcatgaagaacgtgcctgaagttcctaagggtaaacgcaccgctcgtggtctgttcggcgctatcgccggcttcatcgagaacggttgggagggtctgatcgacggctggtacggtttccgtcaccagaacgcccagggcgagggtacagctgctgactacaagtccacccagtccgctatcgaccagatcaccggcaagctgaaccgcctcatcgccaagaccaaccagcagttcaagctgatcgacaacgagttcaacgaagtggaaaagcagatcggcaacgtgatcaactggactcgtgactccatcaccgaggtgtggtcctacaacgccgagctcctggtggccatggaaaaccaacacactatcgacctggctgactccgagatggacaagctctacgagcgcgtgaagcgtcagctgcgtgaaaacgccgaggaggacggtactggatgcttcgaaatcttccacaagtgtgacgacgactgcatggccagcatccgcaacaacacttacgaccaccgtaagtaccgtgaggaagctatgcagaaccgcatccagatcgaccctgtgaagctctccagcggctacaaggacgtgatcctgtggttcagcttcggtgcctcttgcttcatcctgctcgccatcgttatgggcctggtgttcatctgtgttaagaacggtaacatgcgttgcaccatctgtatctaa

[0185] SEQ ID NO: 13 nucleic acid sequences of H7CSpSeL

[0186] gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataGCCACCatgaacacacagatcctggttttcgccctgatcgccatcatccctactaacgctgataagatctgcctgggccaccacgccgtgagcaacggcaccaaggtgaacactctgaccgagcgtggagtcgaggtggtgaacgccaccgaaacagtcgaacgcactaacacccctcgcatctgtagcaagggtaaacgcacagttgacctgggccagtgtggtctgctcggcaccatcacaggtcccccacagtgtgaccagttcctggaatttagcgccgacctcatcatcgagcgccgtgagggaagcgacgtctgttaccctggcaagttcgtgaacgaagaagccctgcgccagatcctgcgcgaaagcggtggaatcgacaaggaacctatgggtttcacctacaacggtatccgtaccaacggagttaccagcgcctgtcgccgtagcggtagctccttctacgctgaaatgaagtggctcctcagcaacaccgacaacgctgccttcccccagatgaccaagtcctacaagaacacacgcgaatccccagctatcatcgtctggggcatccaccacagcgtgagcacagctgagcagacaaagctgtacggctccggtaacaagctggtcaccgtgggttctagcaactaccaacagtccttcgtccctagccccggtgcccgcccacaggtcaacggccagtcaggccgcatcgacttccactggctgatcctcaacccaaacgacaccgttaccttctcattcaacggcgctttcatcgctccagaccgcgcttctttcctccgtggaaagtccatgggtatccagagcggcgtgcaggtcgacgccaactgtgaaggtgactgctaccacagcggcggtaccatcatcagcaacctcccattccaaaacatcgactcccgtgctgtgggcaagtgcccccgttacgtgaagcagcgctccctgctgctggctacaggcatgaagaacgtgcctgaagttcctaagggtaaacgcaccgctcgtggtctgttcggcgctatcgccggcttcatcgagaacggttgggagggtctgatcgacggctggtacggtttccgtcaccagaacgcccagggcgagggtacagctgctgactacaagtccacccagtccgctatcgaccagatcaccggcaagctgaaccgcctcatcgccaagaccaaccagcagttcaagctgatcgacaacgagttcaacgaagtggaaaagcagatcggcaacgtgatcaactggactcgtgactccatcaccgaggtgtggtcctacaacgccgagctcctggtggccatggaaaaccaacacactatcgacctggctgactccgagatggacaagctctacgagcgcgtgaagcgtcagctgcgtgaaaacgccgaggaggacggtactggatgcttcgaaatcttccacaagtgtgacgacgactgcatggccagcatccgcaacaacacttacgaccaccgtaagtaccgtgaggaagctatgcagaaccgcatccagatcgaccctgtgaagctctccagcggctacaaggacgtgatcctgtggttcagcttcggtgcctcttgcttcatcctgctcgccatcgttatgggcctggtgttcatctgtgttaagaacggtaacatgcgttgcaccatctgtatctaa

[0187] SEQ ID NO: 14 nucleic acid sequences of H7WTpSeL

[0188] gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataGCCACCatgaacacccagatcctggtcttcgctctgatcgccatcatccctactaacgctgacaagatctgcctgggacaccacgccgtctccaacggtaccaaggtgaacaccctgactgagagaggcgtcgaagtggtcaacgctaccgagactgtggaacgtaccaacatccccaggatctgcagcaagggaaagcgcactgtggacctgggacagtgcggcctgctgggaaccatcactggtcctccccagtgcgaccagttcctggagttctctgccgacctgatcatcgagcgccgtgaaggctcagacgtctgctaccctggaaagttcgtgaacgaggaagctctgagacagatcctgcgcgagtctggtggcatcgacaaggaagccatgggattcacctactcaggtatccgtaccaacggcgctacttctgcctgcaggagatcaggttccagcttctacgctgagatgaagtggctgctgtctaacactgacaacgctgccttccctcagatgaccaagtcttacaagaacactaggaagtcacccgctctgatcgtctggggtatccaccactctgtgtcaaccgccgaacagactaagctgtacggctctggaaacaagctggtgaccgtcggctcttcaaactaccagcagtctttcgtcccatcacctggagctcgtcctcaggtgaacggtctgtcaggcaggatcgacttccactggctgatgctgaaccccaacgacaccgtcactttctccttcaacggtgctttcatcgccccagacagagctagcttcctgcgcggcaagtccatgggcatccagagcggagtgcaggtcgacgccaactgcgagggcgactgctaccactctggaggtaccatcatctcaaacctgccattccagaacatcgactccagggctgtgggcaagtgccctcgttacgtgaagcagaggagcctgctgctggccactggcatgaagaacgtgcccgaaatcccaaagggtcgtggcctgttcggtgctatcgccggcttcatcgagaacggatgggaaggtctgatcgacggctggtacggattcaggcaccagaacgctcagggagagggtaccgctgccgactacaagtccactcagagcgccatcgaccagatcaccggcaagctgaacagactgatcgaaaagactaaccagcagttcgagctgatcgacaacgagttcaacgaggtcgaaaagcagatcggaaacgtgatcaactggacccgcgactccatcactgagctgtggagctacaacgctgagctgctggtcgccatggaaaaccagcacaccatcgacctggctgactccgagatggacaagctgtacgaacgcgtgaagcgtcagctgagggagaacgccgaggaagacggcaccggatgcttcgaaatcttccacaagtgcgacgacgactgcatggcttccatccgcaacaacacttacgaccacagcaagtacagagaggaagccatgcagaaccgcatccagatcgaccctgtcaagctgtccagcggatacaaggacgtgatcctgtggttctccttcggtgctagctgcttcatcctgctggccatcgtgatgggtctggtcttcatctgcgtgaagaacggcaacatgcgttgcactatctgcatctaa

[0189] SEQ ID NO: 15 amino acid sequence of the signal peptide for H7 HA

[0190] MNTQILVFALIAIIPTNA

Claims

1.An immunogenic composition or a vaccine comprising a hemagglutinin protein of avian influenza virus H7 subtype (AIV H7 HA protein) , wherein(i) the AIV H7 HA protein comprises amino acid residues T14, R22, P112, F115, E164, and G320, with numbering with reference to amino acid residues as set forth in SEQ ID NO: 3; and / or(ii) the AIV H7 HA protein comprises or consists of an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the amino acid sequence as set forth in SEQ ID NO: 3.2.The immunogenic composition of claim 1, wherein the avian influenza virus H7 subtype is the avian influenza virus H7N9.3.The immunogenic composition of claim 1 or 2, wherein the AIV H7 HA protein is the only avian influenza antigen component contained in the immunogenic composition; or wherein the immunogenic composition does not comprise other AIV H7 proteins than the AIV H7 HA protein.4.The immunogenic composition of any one of claims 1-3, wherein the hemagglutinin protein is a recombinant hemagglutinin protein.5.The immunogenic composition of claim 4, wherein the recombinant hemagglutinin protein is produced by a baculovirus-based expression system.6.The immunogenic composition of claim 5, wherein the recombinant hemagglutinin protein is produced by a baculovirus-based expression system using a Sel promoter.7.The immunogenic composition of claim 6, wherein the Sel promoter comprises or consists of a nucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100%sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 11.8.The immunogenic composition of any one of claims 1-6, wherein the AIV H7 HA protein is contained in a whole cell culture suspension which is obtainable or obtained by a method comprising the following steps:(i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein;(ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension; and(iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus.9.The immunogenic composition of claim 8, wherein the nucleic acid molecule encoding the AIV H7 HA protein is as set forth in SEQ ID NO: 8.10.The immunogenic composition of any one of claims 1-9, wherein the immunogenic composition further comprises an adjuvant; preferably, wherein the immunogenic composition is formulated into a water-in-oil emulsion with an adjuvant, such as MONTANIDETM ISA 71R VG.11.A method for preparing an immunogenic composition of any one of claims 1 to 10, comprising the following steps:(i) infecting insect cells with a recombinant baculovirus comprising a nucleic acid molecule encoding the AIV H7 HA protein;(ii) culturing the insect cells in a culture medium, and harvesting a whole cell culture suspension;(iii) treating the whole cell culture suspension with an inactivation agent to inactivate the baculovirus; and(iv) optionally, emulsifying and adding an adjuvant into the whole cell culture suspension.12.Use of the immunogenic composition of any one of claims 1 to 10, or the immunogenic composition prepared by the method of claim 11 in preparation of a kit for prevention and / or treatment of infections in an animal caused by an avian influenza virus H7 subtype, or for reducing clinical signs in an animal caused by infections of an avian influenza virus H7 subtype, or for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an avian influenza virus H7 subtype;preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.13.A method for prevention and / or treatment of infections in an animal caused by an avian influenza virus H7 subtype, or for reducing clinical signs in an animal caused by infections of an avian influenza virus H7 subtype, or for reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an avian influenza virus H7 subtype, comprising administering the immunogenic composition of any one of claims 1-10 or the immunogenic composition prepared by the method of claim 11 to the animal; preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.14.The immunogenic composition of any one of claims 1 to 10, or the immunogenic composition prepared by the method of claim 11 for use in the prevention and / or treatment of infections in an animal caused by an avian influenza virus H7 subtype, or for use in reducing clinical signs in an animal caused by infections of an avian influenza virus H7 subtype, or for use in reducing mortality, morbidity and / or virus shedding in an animal caused by infections of an avian influenza virus H7 subtype; preferably, the avian influenza virus H7 subtype is H7N9 avian influenza virus.15.The use of claim 12, the method of claim 13, or the immunogenic composition of claim 14, wherein the animal is subjected to single, two or multiple dose of administration of the immunogenic composition in a range from about 0.01 ml to about 0.5 ml; and / orwherein the animal is at day 1 of age or later, at day 7 of age or later, at day 10 of age or later, at day 15 of age or later, or at day 21 of age or later; and / orwherein the animal is administrated via a subcutaneous route; and / orwherein the animal is poultry; preferably the animal is selected from a group consisting of bird, chicken, duck, goose, pigeon, and turkey;preferably, chicken at about day 21 of age is subcutaneously administered with the 0.5 ml of immunogenic composition.

Citation Information

Patent Citations

  • H7N9 subtype avian influenza genetic engineering vaccine taking baculovirus as carrier as well as preparation method and application of vaccine

    CN106421771A

  • Avian influenza vaccine based on MultiBac baculovirus expression system and preparation and application

    CN109731100A

  • Method for producing H7 subtype avian influenza virus inactivated vaccine by using low-immunity chick embryo

    CN112143714A

  • Heat-stability-enhanced H7N9 avian influenza virus HA protein as well as preparation method and application thereof

    CN114031674A

  • New promoters derived from baculoviruses with high activity in baculovirus-based expression system.

    ES2554561A1