Methods for treating and monitoring treatment of DYT1 dystonia

WO2026010996A3PCT designated stage Publication Date: 2026-03-12THE GENERAL HOSPITAL CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/036143
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-01
Filing Date
2025-07-01
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Current treatments for DYT1 dystonia, such as deep brain stimulation and small molecule drugs, face challenges with suboptimal responses and difficulties in achieving therapeutic drug concentrations in the CNS, while genome editing techniques using larger Cas9 variants are incompatible with single AAV-mediated delivery and suffer from reduced efficiency in vivo.

Method used

Utilize a smaller Cas9 ortholog, SaCas9-KKH, delivered via AAV vector to target and disrupt the TOR1A DYT1 allele, and monitor editing outcomes through extracellular RNA (exRNA) in EVs, allowing non-invasive assessment of gene editing in brain tissues.

Benefits of technology

Achieves efficient and uniform gene editing in DYT1 dystonia models, with exRNA serving as a reliable biomarker for therapeutic monitoring, potentially reducing dystonia symptoms and enabling early intervention.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Provided herein are gene editing approaches that selectively target the dGAG mutation in the TOR1A DYT1 allele while safeguarding the wild-type (WT) TOR1A allele. Also provided are non-invasive monitoring methods using extracellular RNA (exRNA), e.g., to assess therapeutic gene editing outcomes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS FOR TREATING AND MONITORING TREATMENT OF DYT1 DYSTONIA

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 666,330, filed on July 1, 2024. The entire contents of the foregoing are incorporated herein by reference.

[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with Government support under Grant No. CA282019 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] Provided herein are gene editing approaches that selectively target the dGAG mutation in the TOR1A DYT1 allele while safeguarding the wild-type (WT) TOR1A allele. Also provided are non-invasive monitoring methods using extracellular RNA (exRNA) to assess therapeutic gene editing outcomes.

[0008] BACKGROUND

[0009] DYT1 dystonia is a neurological disorder that manifests in childhood or adolescence, characterized by involuntary muscle contractions leading to abnormal movements and postures, and remains a challenging condition to treat effectively1. To enhance patients' motor function and overall quality of life, ongoing efforts include the continuous optimization of surgical therapies such as deep brain stimulation (DBS)2,3and the exploration of small molecule drugs like ritonavir4However, suboptimal responses or secondary' exacerbations following DBS treatment3persist, alongside difficulties in attaining therapeutic drug concentrations within the central nervous system (CNS)6, impeding patients' full recovery or sustained comfort.

[0010] SUMMARY

[0011] Described herein are symptomatic dystonia treatments with a genome editing strategy using smaller Cas9 orthologs that can be delivered by one single AAV vector. Utilizing the AAV9-compatible Cas9 ortholog from Staphylococcus aureus (SaCas9- KKH) editor13, we disrupted the TOR1A DYT1 allele in a xenograft mouse model. The preclinical DYT1 model was generated by implanting DYT1 patient-derived human neural progenitor cells (hNPCs) in mouse brains14,15, allowing for the examination of human genetics and brain transduction after AAV treatment. DYT1 is a chronic disease, and gene editing is typically undertaken preemptively before symptom onset or during the early stages of mild symptoms.

[0012] To maximize translational applicability, confirmation of successful therapeutic intervention may be desirable before observing improvements in symptoms. However, while detecting gene editing activity at the genomic level is straightforward, genome analysis necessitates cell lysis, which poses challenges for brain tissue. A potential solution to this issue could involve analyzing the secretions from gene-edited brain tissue that enter the periphery, which can be analyzed following blood collection. Several studies have explored extracellular vesicles (EVs) released from the brain into the bloodstream, as they carry biomarkers for brain diseases16,17. Here, we demonstrate that extracellular RNA (exRNA) contained in EVs carries gene editing information, and we show that these EVs can be used to assess brain cell editing through their leakage into the blood. Plasma collected from intracranially treated hNPC-implanted mice was used to evaluate the effectiveness of the AAV-Cas9-based editing approach on the TORI A DYT1 allele and to monitor the status of the TOR1A allele lacking dGAG, without the need for invasive brain biopsy.

[0013] Provided herein are compositions comprising a nucleic acid encoding a Staphylococcus aureus Cas9 protein comprising E782K / N968K / R1015H mutations (SaCas9-KKH), and a nucleic acid encoding a guide RNA targeting DYT1, wherein the guide RNA comprises a sequence selected from the group consisting of:

[0014] In some embodiments, the SaCas9-KKH is at least 85%, 90%, 95%, 97, or 99% identical to SEQ ID NO:7, comprising the KKH mutations.

[0015] In some embodiments, the composition comprises a viral vector comprising the sequence encoding SaCas9-KKH and the sequence encoding the guide RNA, and one or more promoter sequences operably linked to the Cas9 and / or gRNA. In some embodiments, the composition further comprising one or more enhancer sequences; a polyadenylation site; and / or insulator sequences, operably linked to the Cas9 and / or gRNA.

[0016] In some embodiments, the enhancer sequence is a woodchuck hepatitis virus posttranscriptional response element (WPRE).

[0017] In some embodiments, the promoter is a brain tissue specific promoter or a pan-cell type promoter.

[0018] In some embodiments, the promoter is a human choline acetyltransferase (ChAT), cytomegalovirus (CMV), or chicken -actin (CBA) promoter.

[0019] In some embodiments, the viral vector is an adeno-associated viral (AAV) vector comprising a pair of inverted terminal repeats (ITRs) flanking a cassette comprising one or more promoters and the sequence encoding SaCas9-KKH and the sequence encoding the guide RNA. Preferably the AAV has CNS / neuronal tropism. In some embodiments, the AAV is AAV1, 2, 5, 6, 8, 9, rh8, or rhlO, or comprises modifications of capsid structure, including chimeric capsids and incorporation of peptides into the capsid can increase neuronal tropism (e.g. AAV2G9, AAV-D1, AAVPHP.B, AAV-DB-3).

[0020] In some embodiments, the composition comprises a first promoter operably linked to the sequence encoding SaCas9-KKH and a second promoter operably linked to the sequence encoding the guide RNA, optionally wherein the second promoter is a polymerase III promoter, such as a human U6 promoter, Hl promoter, 7sk promoter, or tRNA promoter.

[0021] In some embodiments, the composition comprises a promoter, a sequence encoding SaCas9-KKH, a 2A sequence, and the sequence encoding the guide RNA, wherein the promoter drives expression of the SaCas9-KKH and the guide RNA.

[0022] In some embodiments, the promoter or the first promoter is a brain tissue specific promoter or a pan-cell type promoter.

[0023] In some embodiments, wherein the promoter is a cytomegalovirus (CMV) or chicken P-actin (CBA) promoter.

[0024] Also provided herein are compositions comprising SaCas9-KKH protein, and a guide RNA targeting DYT1, wherein the guide RNA comprises a sequence selected from the group consisting of:

[0025] In some embodiments, the SaCas9-KKH is at least 85%, 90%, 95%, 97, or 99% identical to SEQ ID NO:7, comprising the KKH mutations.

[0026] In some embodiments, the SaCas9-KKH and guide RNA are present in ribonucleoprotein (RNP) complexes.

[0027] In some embodiments, the composition further comprises one or more carriers, preferably a nanoparticle. In some embodiments, the nanoparticle is a lipid nanoparticle (LNP).

[0028] Also provided herein are methods of treating a subject who has DYT1 dystonia, the method comprising administering to the subject a therapeutically effective amount of a composition as described herein, and the use of the compositions described herein in methods of treating a subject who has DYT1 dystonia. In some embodiments, the composition is administered systemically or by stereotactic injection into the brain.

[0029] Also provided herein are methods, e.g., methods for detecting genome editing in a tissue of a living subject. The methods comprise obtaining or providing a sample obtaining a sample comprising extracellular vesicles (EVs). preferably a sample comprising a biofluid or tissue, from a living subject who has undergone a treatment comprising genome editing; isolating the EVs from the sample; and detecting the presence of edited sequences in the EVs.

[0030] In some embodiments, the biofluid is serum, saliva, cerebrospinal fluid (CSF), urine, semen, sweat, or tears.

[0031] In some embodiments, the methods further comprise: converting mRNA transcripts in the isolated EVs to cDNA; pre-amplifying one or more target sequences in the cDNA to provide a population of target amplicons; and detecting the presence of edited sequences in the target amplicons.

[0032] In some embodiments, detecting the presence of edited sequences comprises using RT-PCR or qRT-PCR, or using sequencing, preferably next generation sequencing.

[0033] In some embodiments, detecting the presence of edited sequences in the amplicons comprises performing amplification in the presence of a population of fluorescent probes comprising a first set of probes that bind to the target sequence on one allele and a set of second probes that bind to the target sequence on a second allele, wherein the first and second probes are labeled wi th fluorescent reporters with non-overlapping emission spectra, and detecting fluorescence signals corresponding to each probe set during amplification, optionally wherein the differences between the alleles are due to a disease-associated (pathogenic) mutation or due to gene editing.

[0034] In some embodiments, the subject has DYT1 dystonia and has been treated with a genome editing treatment that disrupts a 3 bp deletion (c.907_909dGAG) in exon 5 of TORI A.

[0035] In some embodiments, the genome editing treatment comprises administering to the subject a therapeutically effective amount of a composition as described herein.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0037] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0038] DESCRIPTION OF DRAWINGS

[0039] FIGs. 1A-G. TOR1A DYT1 allele disruption by SaCas9-KKH nuclease activity in DYT1 hNPCs. a. gRNA designed to target the GAG deletion (dGAG) signature in DYT1 dystonia. The genomic sequence of the TOR1A WT and TOR1A DYT1 alleles in DYT1 dystonia patients. The 3-nucleotide (nt) difference between both alleles is indicated with a dotted line. The TOR1A DYT1 allele encodes a target site for gRNAl to gRNA4 and a protospacer-adjacent motif (PAM) for SaCas9-KKH. The gRNAs differ in length by the nucleotides upstream of the dGAG region, w hich are indicated in purple. Shown are SEQ ID NOs: 1-6. b. Screening of gRNAs in DYT1 hNPCs. This cartoon illustrates our screening process, where gRNA and SaCas9-KKH expression plasmids were electroporated into DYT1 hNPCs. Based on eGFP fluorescence encoded in the SaCas9-KKH plasmid, potentially gene-edited cells were isolated through FACS sorting. The non-eGFP- expressing hNPCs were used as control. dGAG disruption was confirmed by analysis of next-generation sequencing. c. Isolation of SaCas9-KKH expressing DYT1 hNPCs. FACS gating strategy for selecting single live hNPC events (DAPINEGeGFPpos). Post-electroporation, 9- 15% of the single live hNPC events are eGFPpos. Images of SaCas9-KKH and eGFP expressing hNPCs were taken using a confocal microscope. Scale bar represents 200uM. d. Gene editing of DYT1 allele in hNPCs with gRNAl-4 and SaCas9-KKH. Bar graph illustrating the percentage of editing of the TOR1A DYT1 allele based on next-generation sequencing analysis. gRNAs 1-4 targeted dGAG compared to hNPCs that did not express SaCas9-KKH (control). Statistical analysis was performed using a one-way ANOVA and GraphPad Prism 10.2.1 software. *p< 0.05. e. Types of genetic modifications introduced into the target DNA after gene editing of the TOR1A DYT1 allele in hNPCs. A pie chart generated by CRISPResso2 analysis illustrates the percentage of TORI A DYT1 allele disruptions (i.e., premature stop codon), other mutations (i.e., insertions or deletions that did not result in a TORI A DYT1 allele disruption or premature stop codon), and unedited alleles for gRNAs 1-4, with gRNA3 showing the highest level (37.3%) of premature stop codons. f. In CRISPResso analysis of sorted cells post nucleofection. The mutant allele has significantly more edits than the wild-type (WT) allele after CRISPR / Cas. Label colors represent the different gRNAs used. g. Premature stop codons in DYT1 allele. A visual representation of the percentage of insertions and deletions leading to premature stop codons. FIGs. 2A-B. TaqMan probe assay for rapid detection of the dGAG signature in DYT1 dystonia.

[0040] A. dGAG specific-TaqMan probe assay. Outline of genomic and transcript analysis of DYT1 and WT samples using GAG or dGAG-targeting TaqMan probes labeled with either VIC or dGAG-FAM fluorophores, respectively.

[0041] B. hNPC analysis using a dGAG-specific TaqMan probe assay. The assay was evaluated with both gDNA (right) and cDNA (left) extracted from three DYT1 hNPCs and three WT control hNPCs. To validate the assay, gBlocks encoding exon 5 of the TOR1A allele with and without the dGAG mutation were used. A no-sample control was included (black dot).

[0042] FIGs. 3A-D. Extracellular vesicles carry the dGAG signature when secreted from DYT1 hNPCs and are present in DYT1 patient plasma.

[0043] A. Screening for dGAG in extracellular vesicles (EVs) derived from DYT1 patients. Cartoon illustrating our setup for isolating exRNA from hNPCs-derived EVs in conditioned culture media, as well as EVs from patient plasma. Following exRNA isolation and cDNA conversion, we performed preamplification of the dGAG region, which was subsequently analyzed using a dGAG-specific TaqMan probe assay.

[0044] B. The dGAG region preamplicon is exclusively found in EV-derived exRNA. We evaluated the presence of the dGAG region in fractions containing EVs and ribonucleoprotein (RNPs) following size exclusion chromatography of conditioned hNPCs culture media. Our data, represented by preamplification PCR results loaded on agarose gel, show ed bands in the EVs fractions for both WT and DYT1 samples, while no bands were observed in the RNP fractions.

[0045] C. dGAG-specific TaqMan probe assay as a screening tool to detect dGAG in EVs derived from DYT1 hNPCs. A 2D plot distinguishes exRNA from three DYT1 hNPCs and three WT control hNPCs. The assay involved performing preamplification PCR on cDNA-transformed exRNA to ensure the detection of the GAG-VIC and dGAG-FAM probes, specifically within hNPC-derived EVs. gBlocks controls with and without the dGAG mutation were used. A no-sample control was included (black dot).

[0046] D. dGAG in plasma from DYT1 patients. A 2D plot distinguishes exRNA from plasma samples collected from 8 patients using a dGAG-specific TaqMan probe assay. The colors and controls correspond to those in panel C. P and NP denote DYT1 patients presenting with or without symptoms, respectively.

[0047] FIGs. 4A-F. Extracellular vesicles as non-invasive biomarkers for mutant allele disruption by SaCas9-KKH nuclease activity in DYT1 hNPCs.

[0048] A. dGAG signature in DYT1 hNPCs. Next-generation sequence analysis of gDNA and cDNA-converted transcript isolates. Shown are SEQ ID NOs:29 and 30.

[0049] B. dGAG signature in extracellular vesicles (EVs) derived from DYT1 hNPCs. Next-generation sequence analysis of cDNA-converted exRNA. Shown are SEQ ID NOs:29 and 30.

[0050] C. exRNA as a biomarker for gene editing of the dGAG region in the DYT1 allele. Representative next-generation sequencing result revealing indels in exRNA- converted cDNA from DYT1 hNPCs expressing gRNA 3 and SaCas9-KKH. Shown are SEQ ID NOs:29-44.

[0051] D. Underreporting of DYT1 allele editing by EVs compared to donor Cells. A comparison of indels from next-generation sequencing analysis of DYT1 hNPCs electroporated with SaCas9-KKH and gRNA 3 and their corresponding EVs.

[0052] E. Gene editing reporting in EVs vs. Cells. Schematic of data in Figure F. DYT1 hNPCs were electroporated with SaCas9-KKH and gRNAs 1-3, followed by FACS sorting of eGFP-positive (DAPIX, <1eGFPpos) and eGFP-negative (DAPIX, <1eGFPNEG) cells. These sorted hNPCs were cultured and analyzed using the dGAG- specific TaqMan probe assay, as well as their exRNA in the conditioned media.

[0053] F. Changes in dGAG levels in DYT1 hNPCs following CRISPR / Cas activity are mirrored in their EVs. A 2D plot displays dGAG-FAM levels in cDNA from cell transcripts and EV exRNA from edited and non-edited cells. These levels were normalized to the GAG-VIC probe to establish a correlation between hNPCs and their EVs. The drop along the dotted line in the cluster after gene editing indicates that DYT1 allele targeting can be detected in both EVs and cells. Label colors represent the different gRNAs used.

[0054] FIGs. 5A-F. AAV-mediated transgene-delivery to hNPCs engrafted in a mouse brain.

[0055] A. CRE-reporter to detect CRE activity. A schematic of a lentiviral vector (LVV) encoding a CRE-reporter (Addgene #62732) is shown. The reporter includes a floxed dsRED cassette followed by eGFP, Nanoluciferase (Nluc). and puromycin transgenes. CRE activity is monitored by blocking eGFP expression downstream of dsRED with a stop codon (OFF STATE). Upon CRE delivery, dsRED is excised, enabling eGFP expression (ON STATE). The expression of Nluc and puromycin remains unaffected by the floxing status due to the preceding IRES site. Nluc is used to select brain sections with implanted hNPCs, while puromycin is used to select hNPCs containing the reporter.

[0056] B. CRE-reporter hNPCs. A cartoon illustrating CRE reporting in hNPCs to track AAV transduction events. The reporter is introduced into hNPCs via LVV transduction followed by puromycin selection. Following AAV delivery, CRE activity causes the CRE-reporter hNPCs to transition from red to green fluorescence, visually indicating the successful excision of the reporter.

[0057] C. In vitro transduction of CRE reporter-hNPCs with AAV9-CBA-CRE. Three days post-exposure of ~2xlO10gc AAV to Cre reporter-hNPCs, >60% of hNPCs exhibit eGFP expression, while nontransduced hNPCs maintain dsRED fluorescence. The scalebar represents 100 pm.

[0058] D. hNPC implantation mouse model. A cartoon illustrates the intracranial (i.c.) injection of CRE reporter-hNPCs and AAV9-CBA-CRE in mice. The black square highlights the specific brain region with implanted hNPCs, as shown in panel F and quantified in panel E. The timeline on the bottom shows the timeline of the experimental interventions.

[0059] E. CRE activity post-AAV9-CBA-CRE administration in the hNPC implantation mouse model. Red (OFF STATE) and green (ON STATE) fluorescent hNPCs were quantified in brain sections. Statistical analysis was conducted using Student's t-test. with *** indicating p < 0.001.

[0060] F. AAV transduction of hNPCs in the mouse brain. The top panel shows the expression pattern of CRE reporter-hNPCs with AAV9-Null (empty vector) administration, where dsRED fluorescence is observed. Following an i.c. injection of approximately 2x1010gc / kg AAV, green fluorescence in the bottom panel indicates AAV9-CBA-CRE transduction of hNPCs after brain implantation. This is a representative image, with multiple samples analyzed and quantified in panel E. Scale bar represents 100 pm. FIGs. 6A-C. In vivo targeting of dGAG with AAV9-CRISPR.

[0061] A. hNPC implantation mouse model to test gene therapy for treating dGAG in the brain. A schematic illustrates the intracranial (i.c.) injection of DYT1 hNPCs treated with either AAV9-CRISPR or AAV9-Null. After 21 days, cardiac blood and brain tissues were collected, followed by the isolation of exRNA from the plasma and gDNA from brain sections with hNPCs, and subsequent next-generation sequencing analysis. The AAV9-CRISPR construct is illustrated at the top.

[0062] B. Detection of dGAG edits in the brain. CRISPResso2 analysis reveals a higher percentage of DYT1 allele edits in injected hNPCs from AAV9-CRISPR samples compared to AAV9-Null samples (grey). Statistical analysis was conducted using Student's t-test, with * indicating p < 0.05.

[0063] C. Detection of dGAG edits in plasma. CRISPResso2 analysis of exRNA- converted cDNA isolated from the plasma of injected mice shows edits in the mutant allele of the released TORI A transcript in AAV9-CRISPR samples, but not in AAV9- Null samples. Statistical analysis was conducted using Student's t-test, with * indicating p < 0.05.

[0064] FIGs. 7A-C.

[0065] A. dGAG specific-TaqMan probe assay controls. A 2D plot featuring gBlocks encoding WT and DYT1 sequences analyzed using the dGAG-specific TaqMan probe assay.

[0066] B. dGAG-FAM and GAG-VIC -TaqMan probes in DYT1 and WT hNPCs. Bar graphs displaying ARn values for the DYT1 allele and WT TOR1A allele are plotted and analyzed in gDNA and transcript-converted cDNA from WT and DYT1 hNPCs. Statistical analysis was conducted using Student's t-test. with ** indicating p < 0.01 and **** indicating p < 0.0001.

[0067] C. dGAG specific-TaqMan probe assay with patient-derived fibroblasts. Identification of gDNA from WT (n=3) and DYT1 (n=3) patient-derived fibroblasts using the dGAG specific-TaqMan probe assay.

[0068] FIGs. 8A-E.

[0069] A. A dGAG-specific TaqMan probe assay was performed on exRNA- converted cDNA. The assay evaluated EVs derived from hNPCs of DYT1 (n=3) and wild-ty pe (WT, n=3) controls. The GAG-VIC and dGAG-FAM signals of the DYT1- TaqMan probes in EV samples showed no significant difference from the no sample negative control. This indicates that WT and mutant TOR1A transcript levels were below the detection limit in EVs. gBlocks containing exon 5 of the TORI A allele with and without the dGAG mutation were utilized.

[0070] B. Preamplification step before assessing exRNA using the dGAG-specific TaqMan probe assay. A schematic of the TOR1A gene displaying its exons in red. We designed forward (Fw) and reverse (Rev) primers spanning exons 4 and 5 of TORI A to preamplify TOR1A cDNA.

[0071] C. gDNA exclusion through preamplification step. Agarose gel analysis confirms the specificity of cDNA preamplification primers, demonstrating no binding to gDNA in both DYT1 and WT hNPC samples.

[0072] D. Next-generation sequencing of WT hNPCs. CRISPResso2 analysis of gDNA and transcript-converted cDNA from WT hNPCs confirms WT allele presence and dGAG mutation absence. Shown is SEQ ID NO:30.

[0073] E. Next-generation sequencing of exRNA from non-edited DYT1 hNPCs. CRISPResso2 analysis of exRNA-converted cDNA from SaCas9-KKH / GFP-negative samples post-FACS confirms no edits in the mutant allele. Only amplification errors are observed. Shown are SEQ ID NOs:29, 30, 45, and 46.

[0074] FIGs. 9A-B

[0075] A. Experimental setup. Schematic of in vivo CRISPR experiments and samples (brain sections or plasma) harvested for next-generation sequencing.

[0076] B. Brain section analysis. Representative CRISPResso2 results of injected hNPCs from mouse brain tissue, comparing AAV9-CRISPR with AAV9-Null. Modified DYT1 alleles induced by CRISPR are visible in the AAV9-CRISPR sample. Amplification errors have been observed. Shown are SEQ ID NOs:29, 30, 37, 47-49, 31, 42, 50, 36, 51, and 52.

[0077] FIGs. 10A-C. Detecting DYT1 dystonia signature using a dGAG specific-

[0078] TaqMan probe assay. Flowchart showing steps of an exemplary' method as descried herein for non-invasive monitoring using extracellular RNA (exRNA), e.g., to assess therapeutic gene editing outcomes; in this example, the presence of editing of the DYT1 allele is shown.

[0079] DETAILED DESCRIPTION

[0080] DYT1 patients cany' a 3 bp deletion (c.907_909dGAG; FIG. 1A) in exon 5 of one TOR1A allele, known as the TOR1A DYT1 allele. This dGAG mutation results in the loss of a glutamic acid residue in the torsinA protein, which has been implicated in the pathogenesis of dystonia11. Genome editing with CRISPR-Cas enzymes is a promising approach for precisely targeting and disabling the TOR1A DYT1 allele. This approach aims to mitigate the disorder by addressing the dominant-negative effect, where a single copy of the allele with the dGAG mutation can cause DYT1 dystonia symptoms by impacting the function of the wild-type (WT) torsinA protein encoded by the TOR1A allele without the dGAG12. Described herein are gene editing methods to treat a hereditary neurological disease, as well as noninvasive methods using EVs as biomarkers to predict therapeutic outcomes.

[0081] Methods of Treating DYT1 Dystonia

[0082] Gene editing in the brain is promising for treating hereditary neurological diseases27. Previously, the potential of gene editing had been explored for DYT1 dystonia, selectively targeting the TOR1A DYT1 allele while safeguarding the TOR1A WT allele in patient-derived fibroblasts12. However, due to its -4.1 kb size, the strategy using the engineered Cas9 variant from Streptococcus pyogenes (SpCas9- VRQR) proved incompatible with single AAV -mediated gene editing. Therefore, we developed an alternative Cas-based approach to facilitate the translation of these promising gene-editing techniques to clinical applications. A more compact SaCas9- KKH editor13, ~3.2 kb in size, was utilized and tested on hNPCs, which more closely resemble the target cell type for DYT1 dystonia than fibroblasts. Despite the resilience of hNPCs to transfection, -30-40% editing w as achieved in the DYT1 allele with saCas9-KKH and gRNA-encoding plasmids. Notably, -75-90% of these edits resulted in the induction of a premature stop codon downstream of the mutation. However, when the gene editing machinery was delivered by AAV to hNPCs when implanted in the brains of mice, the efficiency of gene editing was reduced 10-fold compared to our in vitro results. This discrepancy may be attributed to the mosaicism present in vivo. In contrast, this issue was mitigated in vitro using FACS sorting to analyze only SaCas9-KKHP0Scells, ensuring a more uniform editing efficiency. Indeed, using the CRE reporter system, it was determined that the AAV9 capsid successfully targeted the majority of hNPCs in the brain, with -20% of the implanted hNPCs not being transduced. Additionally, while the powerful CBA promoter successfully drove SaCas9-KKH expression in vitro, its size constraints prevented it from fitting within an AAV vector. Consequently, we switched to a CMV promoter, which can be methylated in vivo, resulting in reduced effectiveness. Our technology offers the potential to address the DYT1 dystonia-associated mutation in the brain.

[0083] DYT1 dystonia is a chronic condition characterized by progressive involuntary muscle contractions that lead to repetitive or twisting movements and abnormal postures10 34. The muscle contractions often affect the leg or arm, often progressing to generalized involvement with severe disability. Symptoms of DYT1 dystonia generally start to manifest during childhood, typically with an average of 12 years33. Gene editing therapies present an opportunity for early intervention, potentially achieving comprehensive editing of target cells before disease progression complicates treatment strategies. Genome editing therapies for DYT1 dystonia could thus be envisioned as an approach to positively impact physiological processes affected by the TORI A DYT1 mutation.

[0084] Generally, the methods include administering a therapeutically effective amount of a genome editing system as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. A genome editing system useful in the present disclosure include at least two components adapted from naturally occurring CRISPR systems: a gRNA and an RNA-guided nuclease. These two components form a complex that is capable of associating with a specific nucleic acid sequence in a cell and editing the DNA in or around that nucleic acid sequence, for example by making one or more of a single-strand break (an SSB or nick), a double-strand break (a DSB) and / or a base substitution. The present disclosure uses the SaCas9-KKH, or a variant thereof, with a gRNA listed in Table A, preferably gRNA 3.

[0085] Table A. SaCas9-KKH gRNAs

[0086] Preferably, the SaCas9 protein used herein is SaCas9-KKH, comprising E782K / N968K / R1015H mutations, as described in Kleinstiver et al., Nat Biotechnol. 2015 Dec;33(12): 1293-1298. The SaCas9-KKH sequence (with E782K / N968K / R1015H in bold) is as follows:

[0087] MKRNYILGLD IGITSVGYGI IDYETRDVID AGVRLFKEAN VENNEGRRSK 50 RGARRLKRRR RHRIQRVKKL LFDYNLLTDH SELSGINPYE ARVKGLSQKL 100 SEEEFSAALL HLAKRRGVHN VNEVEEDTGN ELSTKEQI SR NSKALEEKYV 150 AELQLERLKK DGEVRGSINR FKTSDYVKEA KQLLKVQKAY HQLDQSFIDT 200 YIDLLETRRT YYEGPGEGSP FGWKDIKEWY EMLMGHCTYF PEELRSVKYA 250 YNADLYNALN DLNNLVITRD ENEKLEYYEK FQI IENVFKQ KKKPTLKQIA 300 KEILVNEEDI KGYRVTSTGK PEFTNLKVYH DIKDITARKE I IENAELLDQ 350 IAKILTIYQS SEDIQEELTN LNSELTQEEI EQI SNLKGYT GTHNLSLKAI 400 NLILDELWHT NDNQIAIFNR LKLVPKKVDL SQQKEIPTTL VDDFILSPW 450 KRSFIQSIKV INAI IKKYGL PNDI I IELAR EKNSKDAQKM INEMQKRNRQ 500 TNERIEEI IR TTGKENAKYL IEKIKLHDMQ EGKCLYSLEA IPLEDLLNNP 550 FNYEVDHI I P RSVSFDNSFN NKVLVKQEEN SKKGNRTPFQ YLSSSDSKI S 600 YETFKKHILN LAKGKGRISK TKKEYLLEER DINRFSVQKD FINRNLVDTR 650 YATRGLMNLL RSYFRVNNLD VKVKS INGGF TSFLRRKWKF KKERNKGYKH 700 HAEDALI IAN ADFI FKEWKK LDKAKKVMEN QMFEEKQAES MPEIETEQEY 750 KEI FITPHQI KHIKDFKDYK YSHRVDKKPN RKLINDTLYS TRKDDKGNTL 800 IVNNLNGLYD KDNDKLKKLI NKSPEKLLMY HHDPQTYQKL KLIMEQYGDE 850 KNPLYKYYEE TGNYLTKYSK KDNGPVIKKI KYYGNKLNAH LDITDDYPNS 900 RNKWKLSLK PYRFDVYLDN GVYKFVTVKN LDVIKKENYY EVNSKCYEEA 950 KKLKKISNQA EFIASFYKND LIKINGELYR VIGVNNDLLN RIEVNMIDIT 1000 YREYLENMND KRPPHI IKTI ASKTQSIKKY STDILGNLYE VKSKKHPQI I 1050 KKG ( SEQ ID NO : 7 )

[0088] Variants of the SaCas9 as described herein include a sequence that is at least 80% (e.g., at least 85%, 90%, 95%, or 99%) identical to the amino acid sequence of SEQ ID NO:7. The variants can comprise SEQ ID NO:7 with up to one, two, three, four, five, six, seven, eight, nine, or ten mutations.

[0089] The SaCas9-Cas9 variants described herein can thus include the amino acid sequence of SEQ ID NO:7, with mutations at one. two, three, four, five, or all six of the following positions: Y21 L W229, R245, T392, N419, and / or R654, e.g., comprising a sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO:7 with mutations at one, two, three, four five or six of the following positions: Y211, W229, R245, T392, N419, and / or R654.

[0090] In some embodiments, the variant SaCas9 proteins also comprise one or more of the following mutations: Y21 1 A; W229A; Y230A; R245A; T392A; N419A; L446A; Y651A; R654A; D786A; T787A; Y789A; T882A; K886A; N888A; A889A; L909A; N985A; N986A; R991A; R1015A; N44A; R45A; R51A; R55A; R59A; R60A; R116A; R165A; N169A; R208A; R209A; Y211A; T238A; Y239A; K248A; Y256A; R314A; N394A; Q414A; K57A; R61A; Hl HA; K114A; V164A; R165A; L788A; S790A; R792A; N804A; Y868A; K870A; K878A; K879A; K881A; Y897A;

[0091] R901A; K906A.

[0092] In some embodiments, variant SaCas9 proteins comprise one or more of the following additional mutations: Y211A. W229A, Y230A. R245A, T392A, N419A, L446A, Y651A, R654A, D786A, T787A, Y789A, T882A, K886A, N888A, A889A, L909A, N985A, N986A, R991A, R1015A, N44A, R45A, R51A, R55A, R59A;R60A, R116A, R165A, N169A, R208A. R209A, Y211A, T238A, Y239A, K248A. Y256A, R314A, N394A, Q414A, K57A, R61A, Hl HA, K114A, V164A, R165A, L788A, S790A, R792A, N804A, Y868A, K870A, K878A, K879A, K881A, Y897A, R901A, K906A.

[0093] In some embodiments, the variant SaCas9 proteins comprise multiple substitution mutations: R245 / T392 / N419 / R654 and Y221 / R245 / N419 / R654 (quadruple variant mutants); N419 / R654, R245 / R654, Y221 / R654, and Y221 / N419 (double mutants); R245 / N419 / R654, Y211 / N419 / R654, and T392 / N419 / R654 (triple mutants). In some embodiments the mutants contain alanine in place of the wild type amino acid.

[0094] As used in this context, to ‘'treat” means to ameliorate at least one symptom of DYT1 dystonia. A treatment comprising administration of a genome editing system as described herein can result in a reduction in dystonia (e.g., a reduction in frequency or severity of contractures); a reduction in the rate of progression of dystonia; and / or a return or approach to normal muscle tone.

[0095] The present methods can include delivery of nucleic acids, which can include naked mRNA or DNA, as well as expression constructs comprising sequences encoding the SaCas9-KKH and / or gRNA.

[0096] Expression constructs comprising sequences encoding SaCas9-KKH and / or gRNA can include viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Suitable expression constructs can include: a coding region; a promoter sequence, e.g., a promoter sequence that restricts expression to a selected cell type as described herein; an optional enhancer sequence; untranslated regulatory sequences, e.g. , a 5’untranslated region (UTR), a 3’UTR; a polyadenylation site; and / or an insulator sequence. Such sequences are known in the art, and the skilled artisan would be able to select suitable sequences. See, e.g., Current Protocols in Molecular Biology, Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9. 10-9. 14; Vancura (ed.), Transcriptional Regulation: Methods and Protocols (Methods in Molecular Biology7(Book 809)) Humana Press; 2012 edition (2011) and other standard laboratory manuals. In some embodiments, the expression construct is capable of directing expression of the SaCas9-KKH and / or gRNA nucleic acid preferentially in motor neurons.

[0097] The constructs can include, e.g, a viral delivery vector, e.g., preferably an adeno-associated virus (AAV) vector that comprises sequences encoding SaCas9- KKH and / or gRNA. Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka, N., Curr Top Microbiol Immunol, 1992. 158: p. 97-129. AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nat Rev Genet, 2011. 12(5): p. 341-55; Deyle and Russell, Curr Opin Mol Ther, 2009. 11(4): p. 442-7; Asokan et al., Mol Ther, 2012. 20(4): p. 699-708). AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression.

[0098] In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in WO 2015 / 054653; and a sequence encoding SaCas9-KKH and / or gRNA as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. Alternatively, AAV.CPP.21 or AAV.CPP.16 can be used, as described in Yao et al., Nat Biomed Eng. 2022 Nov;6(l 1): 1257-1271. AAV vector natural serotypes with known CNS tropism include AAV1, 2, 5, 6, 8, 9, rh8 and rhlO ((Wang and Xiao, Int J Mol Sci. 2025 Feb 28;26(5):2213). Further modifications of capsid structure, including chimeric capsids and incorporation of peptides into the capsid can increase neuronal tropism (e.g. AAV2G9, AAV -DI, AAVPHP.B, AAV-DB-3; Matuszek et al., Mol Ther. 2025 May 7;33(5): 1988-2014). In some embodiments, the AAV incorporates inverted terminal repeats (ITRs), e.g., derived from the AAV2 or AAV9 serotype. It should be noted, however, that numerous modified versions of the AAV2 or AAV9 ITRs are used in the field. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses are known in the art, e.g., can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology7, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. The use of AAV vectors to deliver constructs for expression in the brain has been described, e.g., in Iwata et al., Sci Rep. 2013;3: 1472; Hester et al., Curr Gene Ther. 2009;9(5):428-33; Doll et al., Gene Therapy 1996; 3(5):437-447; Foley et al., J Control Release. 2014;196:71-8; Liu et al., Metab Brain Dis. 2021 Jan;36(l):45-52; Ling et al., Nat Rev Drug Discov. 2023 Oct;22(10):789- 806; and Huang et al., Science. 2024 May 16; 384(6701): 1220-1227 (preprinted at Huang et al., bioRxiv. 2023 Dec 22:2023.12.20.572615).

[0099] Thus, in some embodiments, the SaCas9-KKH and / or gRNA encoding nucleic acid is present in a vector for gene therapy, such as an AAV vector. In some instances, the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3. AAV4. AAV5. AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrhlO, AAV1 L and AAV12. AAV1, 2, 5, 6, 8, 9, rh8, and rhlO have been shown to have strong affinity7for the nervous system. In some embodiments, AAV2, AAV9, or AAVrhlO are used. AAV9 vectors are highly effective for direct in-brain injections and are being evaluated for treating neurological disorders28.

[0100] A vector as described herein can be a pseudotyped or engineered vector. Pseudotyping provides a mechanism for modulating a vector’s target cell population. For instance, pseudotyped AAV vectors can be utilized in various methods described herein. Pseudotyped vectors are those that contain the genome of one vector, e.g., the genome of one AAV serotype, in the capsid of a second vector, e.g., a second AAV serotype. Methods of pseudotyping are well known in the art. For instance, a vector may be pseudoty ped with envelope glycoproteins derived from Rhabdovirus vesicular stomatitis virus (VSV) seroty pes (Indiana and Chandipura strains), rabies virus (e.g., various Evelyn-Rokitnicki-Abelseth ERA strains and challenge virus standard (CVS)), Lyssavirus Mokola virus, a rabies-related vims, vesicular stomatitis vims (VSV), Mokola virus (MV), lymphocytic choriomeningitis virus (LCMV), rabies vims glycoprotein (RV-G), gly coprotein B ty pe (FuG-B), a variant of FuG-B (FuG- B2) or Moloney murine leukemia vims (MuLV). A virus may be pseudotyped for transduction of one or more neurons or groups of cells. In addition, the capsid can be engineered, e.g., altered to include one or more peptides that increase expression in the CNS, see, e.g., Yao et al., Nat Biomed Eng. 2022 Oct 10; Chatterjee et al., Gene Ther. 2022 Jun;29(6):390-397; Meng et al., Mol Ther Methods Clin Dev. 2021 Feb 27;21:28-41; Zhang et al., Biomaterials. 2022 Feb;281: 121340; Gray, Cell Gene Ther. Insights 5, 1361-1368 (2019); Nonnenmacher et al., Mol. Ther. Methods Clin. Dev. 20, 366-378 (2021). Engineered vectors with capsids that have been altered to change their tropism can also be used. In some embodiments, the vector is enclosed in a AAV-BI-hTFRl capsid (Huang et al., Science. 2024 May 16; 384(6701): 1220-1227, preprinted at Huang et al., bioRxiv. 2023 Dec 22:2023.12.20.572615), or other capsids with affinity for the human transferrin receptor (TFRC), AAV-derived capsids or nanoparticles with affinity for components of the human blood-brain barrier, or otherwise have the capacity for crossing the human blood brain barrier, e.g., AAV.CPP.16 (Yao et al., Nat Biomed Eng. 2022 Nov;6(ll): 1257-1271) or variants of AAV9 (Wang et al. Mol. Ther. -Methods Clin. Dev. 9. 234-246 (2018)); using PB5-3 (Zhang et al.. Biomaterials. 2022 Feb:281 : 121340). See also Liu et al., Metab Brain Dis. 2021 Jan;36(l):45-52.

[0101] Without limitation, illustrative examples of pseudotyped or engineered vectors include recombinant AAV2 / 1, AAV2 / 2, AAV2 / 5, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV9. AAVrhlO, AAV11, AAV 12, and AAV-BI-hTFRl serotype or engineered vectors. It is known in the art that such vectors may be engineered to include a transgene encoding a protein or other transcript (e.g., the Cas9 and / or gRNA). For example, the present vectors can include a pseudotyped AAV9 or AAVrhlO viral vector including a nucleic acid as disclosed herein. See Viral Vectors for Gene Therapy: Methods and Protocols, ed. Machida, Humana Press, 2003.

[0102] In some instances, a particular AAV seroty pe vector may be selected based upon the intended use, e.g., based upon the intended route of administration.

[0103] Various methods for application of AAV vector constructs in gene therapy are known in the art. including methods of modification, purification, and preparation for administration to human subjects (see, e g.. Viral Vectors for Gene Therapy: Methods and Protocols, ed. Machida, Humana Press, 2003). In addition, AAV based gene therapy targeted to cells of the CNS has been described (see, e.g., U.S. patents 6,180,613 and 6,503,888). High titer AAV preparations can be produced using techniques known in the art, e.g., as described in U.S. Pat. No. 5,658,776.

[0104] Thus provided herein are AAV vectors encoding CRISPR / Cas9 genome editing systems, and the use of such vectors to treat DYT1 dystonia associated disease. Exemplary AAV vector genomes can include: inverted terminal repeats (ITRs), a gRNA sequence and promoter sequences to drive its expression, and a Cas9 coding sequence and another promoter to drive its expression. Cas9 expression is driven by a promoter know n in the art. Expression of the gRNA in the AAV vector is also driven by a promoter known in the art. In some embodiments, a polymerase III promoter, such as a human U6 promoter, Hl promoter, 7sk promoter, or tRNA promoter, is used. Alternatively, the AAV can include ITRs, a cas9 coding sequence, and a gRNA coding sequence, with a single promoter (e.g., a PolII promoter) to drive expression of both, with a 2A sequence between the cas9 and gRNA coding sequences (e.g., CMV-SaCas9KKH-P2A-HH-gRNA-HDV, wherein HH = hammerhead and Hepatitis Delta Virus (HDV) ribozymes). In this case, the Pol II promoter transcribes the entire sequence into a single mRNA.; The HH ribozyme at the 5' end self-cleaves to release the start of the gRNA.; The HDV ribozyme at the 3' end self-cleaves to cut off the tail.; result Cas9 protein + gRNA A single vector can be used to deliver a Cas9 and gRNA; alternatively, a plurality' of vectors are used, e.g., wherein one vector is used to deliver Cas9, and another vector or vectors is used to deliver a gRNA.

[0105] The vector can also include one or more sequences that promote expression of the Cas9 and / or gRNA, e.g., one or more promoter sequences; enhancer sequences, e.g., 5’ untranslated region (UTR) or a 3’ UTR; a poly adenylation site; and / or insulator sequences, operably linked to the Cas9 and / or gRNA. In some embodiments, the promoter is a brain tissue specific promoter, e.g., a neuron-specific or glia-specific promoter. In certain embodiments, the promoter is a promoter of a gene selected to from: human choline acetyltransferase (ChAT) promoter (Santoscoy et al., Molecular Therapy Methods & Clinical Development, 29:532 - 540; 2023); neuronal nuclei (NeuN), ionized calcium-binding adapter molecule 1 (lba-1), synapsin I (SYN), calcium / calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase and platelet-derived growth factor beta chain. In some embodiments, the promoter is a pan-cell type promoter, e.g., EF-lalpha, cytomegalovirus (CMV), CMV immediate enhancer / chicken P-actin hybrid (CAG), chicken -actin (CBA), beta glucuronidase (GUSB), ubiquitin C (UBC), or Rous sarcoma virus (RSV) promoter. The woodchuck hepatitis virus posttranscriptional response element (WPRE) can also be used.

[0106] In some embodiments, the AAV also has one or more additional mutations that increase delivery to the target tissue, e.g., the CNS, or that reduce off-tissue targeting, e.g., mutations that decrease liver delivery when CNS, heart, or muscle delivery is intended (e.g., as described in Pulicherla et al. (201 1) Mol Ther 19: 1070- 1078); or the addition of other targeting peptides, e.g., as described in Chen et al. (2008) Nat Med 15: 1215-1218 or Xu et al., (2005) Virology 341:203-214 or US9102949; US 9585971; and US20170166926. See also Gray and Samulski (2011) ■‘Vector design and considerations for CNS applications,” in Gene Vector Design and Application to Treat Nervous System Disorders ed. Glorioso J., editor. Washington, DC: Society for Neuroscience) 1-9, available at sfh.org / ~ / media / SfN / Documents / Short%20Courses / 2011%20Short%20Course%20I / 201 I SCI Gray.ashx.

[0107] Alternatively, non-viral carriers32can be used, e.g., encapsulated or associated with in a nanoparticle, e.g., a liposome, exosome, an extracellular vesicle, a polymer, a nanoparticle, a peptide, or a dendrimer. Preferably, the non-viral carrier is a lipid nanoparticle (LNP) (see, e.g., Farsani et al., Heliyon. 2024 Jan H;10(2):e24606; Tuma et al.. Biochemistry. 2023 Sep 20;62(24):3533-3547; Wei et al., Nature Communications 11 : 3232 (2020)). In some embodiments, mRNA encoding the SaCas9-KKH can be delivered with the gRNA, or ribonucleoprotein complexes comprising SaCas9-KKH protein complexed with the gRNA, can be delivered.

[0108] The SaCas9-KKH / gRNA can be delivered directly to the brain of a subject with DYT1 dystonia, e.g., using one or more stereotactic injections, e.g., in a single session. Alternative strategies can include systemic injections (e.g., intravenous administration); preferably systemic administration is done with liver-detargeted AAV capsid variants30,31, or AAV comprising one, two. or more miRNA target sequences, e.g., microRNA-122 (miR-122) and / or miR-1 target sequences, that reduce expression in liver and in heart and skeletal muscle, respectively. Non-Invasive Assays of Gene Editing in the Brain

[0109] Assessing successful gene editing in the brain is challenging, particularly without resorting to brain biopsy. Therefore, we tested whether EVs could be used in the context of dystonia to identify new biomarkers for DYT36. EVs are small membrane-bound structures released by cells into the extracellular milieu, that play a pivotal role in intercellular communication and are increasingly recognized as valuable indicators of neurological disease progression37. They encapsulate various molecules, including proteins and exRNA, reflecting the cellular state and genetic alterations38. The use of EVs has emerged as a promising vehicle for delivering gene editing components39 44. However, leveraging EVs to monitor gene editing outcomes represents a novel paradigm in the field, granting the ability to monitor changes in the nucleus without having to lyse the cell. Here, we first tested whether cell transcripts, which are essential for exRNA assessment, accurately reflect edits in the TORI A DYT1 allele at the genomic level, and we validated this using a dGAG-specific TaqMan probe assay and NGS sequencing. We then analyzed the exRNA from cultured DYT1 hNPCs and isolated it from plasma, confirming the presence of the TORI A DYT1 allele. Finally, we investigated the presence of EVs released from hNPCs implanted in the brain into the periphery, aiming to monitor the levels of in vivo SaCas9-KKH genome editing in hNPCs into a larger number of mouse brain cells. Our findings indicated edits in the TOR1A DYT1 region, along with the detection of truncated exRNA-derived fragments.

[0110] Thus, provided herein are noninvasive methods using EVs as biomarkers for monitoring genome editing, e.g., editing of TORI A DYT1 disruption in the brain, which is implicated as the underlying cause of DYT1 dystonia symptoms targeted by AAV -mediated gene editing intervention.

[0111] The methods include isolating EVs from a biofluid from a subject who has been or is about to be treated w ith a genome editing treatment, and detecting edited transcripts in the EVs. The methods can include converting mRNA transcripts to cDNA; pre-amplifying one or more target sequences in the cDNA to provide a population of target amplicons; and detecting the presence of edited sequences in the target amplicons.

[0112] EVs can be isolated from a biofluid using methods known in the art, including differential ultracentrifugation, concentration and high-resolution density -gradient fractionation, precipitation, ultrafiltration, immunoaffinity, and isolation size exclusion chromatography; see, e.g.. Brennan et al., Scientific Reports volume 10, Article number: 1039 (2020); Akbar et al.. Cells. 2022 Jan 6; 11 (2): 186; and Zhang et al., Nature Protocols volume 18, pages 1462- 1487 (2023). Commercial kits can also be used, e.g., qEV columns (Izon, size exclusion chromatography), ExoQuick and Total Exosome Isolation Reagent (which use polymer precipitation), or the exoEasy Maxi Kit (immunoaffinity).

[0113] Detecting the presence of edited sequences can include performing nextgeneration sequencing, qPCR, RT-PCR, qRT-PCR, or other high-sensitivity detection methods. In some embodiments, a TAQMAN-probe based PCT is used. A TAQMAN probe is a short, fluorescently labeled DNA probe used in real-time PCR to detect a specific DNA sequence. It has a reporter dye at one end and quencher at the other end. When intact, the quencher suppresses the reporter's fluorescence. During PCR, TAQ polymerase's 5’— >3’ exonuclease activity7cleaves the probe, separating the dye from the quencher and releasing fluorescence, which indicates DNA amplification.

[0114] In some embodiments, the methods include creating a set of amplicons comprising a target sequence, e g., a target sequence that includes an editing target sequence, or a target sequence that includes a pathogenic allele. The methods can then include detecting the presence of edited sequences in the amplicons by performing amplification on the amplicons in the presence of a population of fluorescent probes comprising a first set of probes that bind to the target sequence on one allele (e.g., a WT allele) and a set of second probes that bind to the target sequence on a second allele (e.g., a mutant allele), wherein the first and second probes are labeled with fluorescent reporters yvith non-overlapping emission spectra, and detecting fluorescence signals corresponding to each probe set during amplification. The differences between the alleles can be, e.g., due to the presence of a disease- associated (pathogenic) mutation or due to gene editing.

[0115] In some embodiments, the methods are used to detect editing of DYT1 in patients treated with a genome editing method described herein. The methods can include using the dGAG-specific TaqMan probe assay as described herein, optionally using a GAG-specific probe comprising the sequence GACATTGTAAGCAGAGTGGCTGAG[GAG / *]ATGACATTTTTCCCCAAAGAG GAG (SEQ ID NO:26), wherein the probe is labeled with a reporter that differs depending on whether GAG is present or absent, e.g., dGAG-F M and GAG-VIC, or dGAG-VIC and GAG-FAM.

[0116] The present methods can be performed on EVs isolated from any biofluid or tissue that contains EVs, obtained from a subject who has been treated with a genome editing treatment, e.g., a CRISPR-based treatment including the use of a nuclease, base editor, prime editor, and so on, or treatment with a TALEN, meganuclease, or other genome editor. Suitable biofluids can include serum, saliva, cerebrospinal fluid (CSF), urine, semen, sweat, or tears. See, e g., Bianchi et al.. Reproductive Toxicology7104 (2021) 44-51 (semen); Almeida et al., J Extracell Vesicles. 2022;l l:el2210 (urine); Saugstad et al., J Extracell Vesicles, 2017; 6, 1317577 (CSF); Bart et al. BMC Genomics (2021) 22:425 (sweat); Cross et al., Int. J. Mol. Sci. 2023, 24, 15390 (tears): and Boulestreau et al.. Scientific Reports 2024 14:31233 (saliva). The methods can be performed on the subject after (e.g., at least 2-3 days after, and optionally up to 21 days after) administration of a genome editing treatment, and optionally before treatment to establish a baseline. The methods can be used to detect editing of any gene that is expressed in the subject, and the biofluid can be selected based on the tissue that is edited; for example, EVs isolated from tears can be assayed after editing of an ocular tissue such as the retina, or the brain (see, e.g., Krol-Grzymala et al., Int J Mol Sci. 2022 Sep; 23(17): 10123. As shown herein, EVs isolated from serum can be assayed to detect editing of cells in the brain; EVs from CSF can also be used for this purpose. See, e.g., FIGs. 10A-C.

[0117] EXAMPLES

[0118] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0119] Materials and methods

[0120] The following materials and methods were used in the Examples below.

[0121] Cell culture

[0122] Coded Patient-derived fibroblasts from DYT1 patients (33115, 33217, 34866) and healthy controls (33114, 33362, 33113) were grown in culture plates with Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12 (DMEM / F12) (ThermoFisher Scientific, Waltham, MA, USA) supplemented with 20% fetal bovine serum (FBS) (GeminiBio #900-108, West Sacramento, CA. USA). Coded iPSC- derived hNPCs were generated from DYT1 patient fibroblasts (DYT1-1, 2551B, 30857C) and healthy controls (AK3, 33362C, 3311321), as previously described for X-linked dystonia-parkinsonism hNPCs45,46. NPCs were grown on Geltrex-coated (ThermoFisher Scientific, #A1413302) tissue culture ware in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 (DMEM / F12) (ThermoFisher Scientific) supplemented with 2% B27 (Gibco, #17504044, Grand Island, NY, USA), 20 ng / mL epidermal growth factor (EGF) (PeproTech # AF-100-15, Cranbury, NJ, USA), 20 ng / mL fibroblast growth factor (FGF) (Millipore Sigma. Burlington. MA, USA), 0.2% heparin (STEMCELL Technologies #07980, Cambridge, MA), and 1 % penicillin-streptomycin (Coming #30-002-C, Manassas, VA, USA). HEK293T cells from M. Calos, Stanford University, Stanford, CA were cultured using DMEM supplied with 10% FBS (Sigma-Aldrich, St. Louis, MO, USA) and 1% penicillinstreptomycin (Coming #30-002-C). Cells were routinely tested for mycoplasma contamination (Mycoplasma PC R Detection Kit, abm G238, Richmond, Canada) and found negative.

[0123] Participant recruitment and sample collection

[0124] Plasma samples and phenotype data were obtained from the Dystonia Partners Research Bank, which is a tissue and data bank approved by the Mass General Brigham Institutional Review Board. All participants provided written informed consent for their samples and data to be used for genetic and cellular analyses. Whole blood was collected into 10 ml EDTA tubes. Within 2 hours of collection, tubes were centrifuged at 1,100 x g at room temperature (RT) for 10 min to separate the plasma from cells. Plasma w as removed from the upper layer using a pipette, then filtered through 0.8 pm Millipore filters, and aliquoted into Cryovials in 0.5-1 ml volumes and stored at -80°C.

[0125] Phenotypic data

[0126] Samples 33115, 33217, 34866, 42375 and 40890 were collected from individuals affected with DYT1 dystonia. Four participants were male (33115, 33217, 42375 and 40890) and one was female (34866). For every affected participant, onset began in childhood and diagnosis was confirmed by clinical genetic testing. Samples were collected at the following ages: 33115 collected at 19 years old, 33217 collected at 22 years old, 34866 collected at 62 years old, 42375 collected at 22 years old and 40890 at 13 years old. Sample 42374 was collected from a non-manifesting, female carrier of the DYT 1 mutation who was examined and provided a sample at the age of 30.

[0127] Samples 33113, 33114, 33362, 37043, 39910 and 42376 were collected from neurologically normal individuals. Two participants were male (33114 and 33362) and four participants were female (33113, 42376, 37043 and 39910). Samples were collected, and the participants examined, at the following ages: 55 years old (33113), 46 years old (33114), 29 years old (33362), 62 years old (42376). 26 years old (37043) and 47 years old (39910). gRNA cloning gRNA entry' vector plasmid BPK2660 (Addgene plasmid #70709) was digested using the enzyme BsmSMBI-v2 (New England Biolabs #R0580, Ipswich, MA, USA). Oligos were annealed using T4 DNA Ligase buffer (New England Biolabs #M0202S) at a temperature of 95°C for 5 min and cooled to 10°C at a ramp rate of -5°C / min. The digested vector backbone and annealed gRNA oligo were ligated using T4 DNA ligase (New England Biolabs #M0202S), transformed into NEB Stable Competent E. coll (New England Biolabs #C3040H). and plated on LB plates with ampicillin. Colonies were screened with a high-fidelity amplification (Forward: TTTCCCCGAAAAGTGCCACCTGGTCGACATTGATTATTGATGTACAAAAA AGCAGGCT (SEQ ID NO: 8); Reverse: GCTATGAACTAATGACCCCGTAATTCATTACTATTAATAAAAAAAAAAAT CTCGCCAACAAGTTGACG (SEQ ID NO:9)) followed by a digest of the PCR product using BSMBl-v2 (New England Biolabs #R0580). Rapid plasmid sequencing was conducted on the plasmid to ensure correct sequence.

[0128] Nucleofection of plasmids encoding gRNAs and SaCas9-KKH

[0129] P4 Primary Cell 4D-Nucleofector™ X Kit L (LONZA, #V4XP-4024, Cologne, Germany) was used for the nucleofection of hNPCs. Falcon six well tissue culture plates (Life Sciences #353046, Coming, NY, USA) were coated with Geltrex (ThermoFisher Scientific #A1413302). A 50 mL aliquot of cell culture media was prewarmed. 800,000 cells were resuspended in 100 pL of RT 4D Nucleofector solution (80 pL of Nucleofector Solution and 20 pL of Nucleofector Supplement). Two pg of SaCas9-KKH plasmid and 2 pg of gRNA were added to the resuspended cells. The resuspension was transferred to a 100 pL single Nucleocuvette. Cells were nucleofected using a 4D-Nucleofector core unit. After nucleofection, 500 pL of prewarmed cell culture medium was immediately added and the cells were plated in a precoated 6-well plate with 3 mL of cell culture media. Cells were then spun at 70 x g for 3 min to ensure proper attachment. Media was changed after 72 hours. Five days post-nucleofection, the cells went through FACS where GFP -positive and GFP- negative cells were sorted. Both conditions were plated in a 48-well plate and cultured until confluent.

[0130] FACS sorting

[0131] Cells were detached using Accutase (Coming, #25-058-CI) and suspended in DMEM / F12. The cell suspension was centrifuged at 300 x g for 5 min to form a cell pellet. The cells were then resuspended in 500 pL of PBS + 1% P / S and passed through the filter of a sorting tube (Coming, #352235). Subsequently, 1 pL of DAPI was added. The tubes, now containing the labeled cells, were placed on ice and transported to the flow cytometry' core. Sorting was performed based on DAPI negativity and GFP positivity / negativity, and the sorted cells were collected into complete culture media. Following sorting, the cells were pelleted at 300 x g for 5 min and plated onto a 48-well plate coated with geltrex (ThermoFisher Scientific, #A1413302).

[0132] RNA / gDNA extraction for cDNA synthesis and CRISPR analysis

[0133] For RNA isolation, cultured NPCs and EVs from conditioned media were processed using the miRNeasy Micro Kit (Qiagen, #217084, Germantown, MD, USA). For the isolation of exRNA from conditioned media, as little as 500 pL from a confluent 48-well plate to 50 mLs from multiple T75 flasks can be used. Conditioned media should on the cells for 48 hours before isolation. Nanodrop (ThermoFischer Scientific) was employed for RNA sample quantification, followed by reverse transcription using the Superscript IV VILO (ThermoFisher Scientific, #11756050). gDNA extraction from cultured hNPCs utilized the remaining sample postremoval of the aqueous layer during RNA isolation. The protocol, adapted with modifications from the TRIzol™ Reagent Experimental protocol for DNA isolation (Invitrogen, 15596026, San Diego, CA, USA), involved the addition of 300 pL of 100% Isopropanol to the sample. After a 30-min incubation at RT, the sample underwent centrifugation for 5 min at 2000 x g at 4°C to pellet the DNA. The DNA pellet was resuspended in 1 mL of 0.1 M Sodium Citrate in 10% ethanol and incubated for 30 min and then spun at 2000 x g for 5 min at 4°C. This step was repeated once. The pellet was then resuspended in 1 mL of 75% ethanol and incubated for 10-20 min. Following a 5-min centrifugation at 2000 x g at 4°C, the pellet was air-dried and resuspended in 8 mM NaOH. pH adjustments were made as needed with HEPES. Analysis of gene editing outcomes from hNPCs

[0134] Isolated gDNA and cDNA were amplified for NGS analysis using the primers in Table 1. A portion of the PCR product was run on a gel to check for band size and appropriate amplification. PCR product was cleaned using the QIAquick PCR purification kit (Qiagen, #28106) and eluted in 35 pL of RNAase free water. Samples were sent for Next Generation sequencing (MGH CCIB DNA Core). After sequencing, the results were analyzed using CRISPResso2.

[0135] Table 1. Primers and oligos used

[0136] DYTl-TaqMan genotyping assay

[0137] A TaqMan SNP Genotyping Assay was custom designed by ThermoFisher Scientific using the sequence GACATTGTAAGCAGAGTGGCTGAG[GAG / *]ATGACATTTTTCCCCAAAGAG GAG (SEQ ID NO:26; Assay ID AN7D9YW). The VIC probe was specifically tailored to bind to the WT allele, while the FAM probe was designed to target the TOR1A DYT1 allele. The TaqMan Genotyping Master Mix (Applied Biosystems, #4371355) was then combined with the custom probes and DNA template before being run on the QuantStudio 3 machine. Subsequent analysis of the results was performed using the TaqMan Genotyper software.

[0138] EV Isolation from culture media and patient plasma

[0139] A) Size-exclusion chromatography (SEC)

[0140] Conditioned cell culture media was collected and centrifuged at 300 x g for 5 min to remove dead cells. The supernatant was filtered with syringe driven 0.8um filter units (Millipore Sigma, #SLAAR33SS) and subsequently concentrated using Amicon Ultra 15-100k filters (EMD Millipore, #UFC910024. Billerica. MA). Subsequently, 500 pL of the concentrated media was applied to IZON columns, specifically the qEVoriginal / 70nm Legacy Column (IZON, #ICO-70, Medford, MA, USA), and fractions 1-30 were collected. Fractions 6-11 and 15-20 were combined and utilized for the isolation of EVs and proteins, respectively.

[0141] B) exRNA isolation with ExoRNeasy Kit

[0142] Isolated plasma from patients was provided. 5 DYT1 patient, 4 symptompresenting and 1 non-presenting, and 3 WT patient plasma samples were analyzed. ExRNA was then isolated from both cell culture media and plasma following the instructions provided with the exoRNeasy Serum / Plasma Starter Kit (Qiagen, #77023). Preamplification of TOR1A for the DYT1 TaqMan genotyping assay from

[0143] EVs

[0144] EVs exRNA isolated from plasma and cell culture media underwent cDNA conversion and then were preamplified using the Phusion Hot Start Flex 2x Master Mix (New England Biolabs # MO536L) and the cDNA_preamplification primers indicated in Table 1. PCR cycles used were following manufacturer’s instructions with the annealing temperature set to be 64°C.

[0145] Cre reporter cloning and lentiviral vector (LVV) production

[0146] Cre reporter construct w as produced by doing a high-fidelity amplification of NanoLuc using NLuc primers listed in Table 1 from the ENoMi (NanoLuc outside and mCherry inside) construct15The NanoLuc amplicon was cloned into a backbone regulated by an EFl-a promoter (Addgene plasmid #62732, Watertown, MA, USA), using Gibson assembly (New England Biolabs #M5510A) for 1 hour at 50°C. Complete plasmid sequencing was carried out utilizing Next-Generation sequencing technology (MGH CCIB DNA Core) to check plasmid integrity.

[0147] Lentivirus vector Production and Transduction

[0148] LVVs encoding Cre reporter were produced in HEK293T cells. One x 106seeded cells w ere transfected with either of the constructs packaging plasmids and the transgene cassette was flanked by LVV long terminal repeats (LTRs). Twenty -four hours after transfection, cells were washed with lx phosphate buffer saline (PBS) (Boston BioProducts #BM-220, Ashland, MA, USA) and provided with a fresh medium. Seventy’ -tw o hours after transfection, the medium w as collected and filtered with 0.45 pm filters (ThermoFisher Scientific, #1 8-0045) followed by ultracentrifugation at 70.000 x g. The pellet was resuspended in 250 pl 1% bovine serum albumin (BSA) (Sigma #A8412) in optimem and stored at -80°C.

[0149] Assembling gRNA3 and SaCas9-KKH into an AAV9 vector

[0150] Addgene plasmid #61591 was digested with enzy me BSA1 and ligated with annealed gRNA3 oligos. The ligation product was transformed into SURE cells (Agilent, #200227, Santa Clara, CA, USA). The correct vector was sent for packaging using PackGene (Houston, Texas, USA).

[0151] Cell transduction

[0152] Stably transduced cell lines were generated by transducing hNPCs with Cre reporter lentivirus. Cells were incubated with lentivirus for 72 hours, after which transfection media was removed and fresh media was added containing 1 pg / mL puromycin (Invitrogen, #ant-pr-l) to select for Cre reporter transduced cells. After exposure to the appropriate selection antibiotics for a duration of 2 days, the cells that were stably transduced were cultured and expanded under standard conditions, with a limit of 20 passages.

[0153] Animal experiments

[0154] The Institutional Animal Care and Use Committee at Massachusetts General Hospital granted approval for all animal experimental procedures. NU / NU nude mice (Charles River Laboratories, Wilmington, MA, USA) were kept under a 12-hour light / dark cycle with unrestricted access to food and water. Male mice, aged between 8 and 10 weeks, were randomly allocated to different experimental groups.

[0155] Stereotaxic injection into the mouse brain

[0156] Adult mice were anesthetized with 2.5% isofl urane47delivered in 100% oxygen via a nose cone. Stereotaxic injections into the left striatum were performed in relation to the bregma, with the following coordinates: anteroposterior: +0.52 mm, medial-lateral: +2.00 mm, dorsal -ventral: -2.5 mm. Mice were categorized into three groups throughout the project: AAV9-CRE, AAV9-SaCas9-KKH, and "Null" empty AAV9. All groups of mice were concurrently implanted with Cre reporter-transduced hNPCs. Specifically, two hundred thousand hNPCs were resuspended in 2 pl AAV9- CRE (PackGene. C-8054 pAAV-CBA-Cre Clone 686.2), anti-DYTl AAV9-SaCas9- KKH, or AAV9-Null and were implanted at an infusion rate of 0.25 pL / min using a 10 pL 26s Gauge Hamilton syringe (Reno, NV, USA). After the infusion was completed, the needle was allowed to remain in place for an additional 3 min prior to complete removal from mouse brains, ensuring proper procedure completion.

[0157] Mouse brain tissue preparation for immunohistochemistry, DNA extraction, and NGS

[0158] Twenty -one days post-injection, mice were euthanized under deep anesthesia induced by a combination of xylazine and ketamine (10 mg / kg and 100 mg / kg, respectively) following the protocol previously outlined48. For immunohistochemistry, mice underwent cardiac perfusion with lx PBS, followed by 4% paraformaldehyde, and brains were harvested and cryopreserved at -80°C using Optimal Cutting Temperature (OCT) compound (Neg-50 #6502, Expredia, Kalamazoo MI, USA) for subsequent coronal sectioning onto glass slides. Coronal sections of mouse brains, each 16 m thick, were obtained using a freezing cryostat (Leica Microsystems, CM305 OS, Deer Park. IL. USA) and mounted on slides.

[0159] In the case of bioluminescence assays and gDNA extraction, mouse brains were promptly collected and flash-frozen with dry ice to preserve RNA integrity. Brain tissue around the injection site was coronally sectioned with a thickness of 100 pm using a freezing cryostat and collected in individual tubes as per the method described by Maalouf et al. 2023. Each 100 pm brain section was subsequently homogenized in 200 pl Nano-Gio® Luciferase assay buffer (Promega, Madison, WI, USA). Thirty pl of this homogenate was employed for bioluminescence measurement, while the remaining sample was utilized for gDNA extraction using the DNeasy Blood and Tissue Kit (Qiagen. #69504) and subsequent expression analysis. gDNA isolated from the mouse brain was amplified in a two-step process, first using primers binding to the human and mouse TORI A alleles (gDNA preamp, Table 1). This was followed by amplification with human-specific primers that did not bind to the mouse allele to ensure analysis of only our implanted cells (CRISP amp, Table 1). This 2- step process was crucial to ensure the detection of the implanted cells. exRNA isolation from mouse plasma and NGS preparation

[0160] Mouse blood was obtained from the heart and centrifuged at 1500 x g for 10 min. The resulting supernatant was centrifuged at 2500 x g for 15 min to collect plasma. This plasma was subsequently filtered using 0.8 pM filters. ExRNA was then isolated following the instructions provided with the exoRNeasy Serum / Plasma Starter Kit (Qiagen, #77023).

[0161] Immunohistochemistry

[0162] Brain sections underwent post-fixation with 4% paraformaldehyde for 20 min, followed by three washes with lx PBS and a 30-min incubation in blocking solution (PBS with 0.1% Triton X-100 (USB #22686, Cleveland, OH, USA)) containing 10% normal goat serum (Sigma). Subsequently, the sections were incubated overnight at 4°C in blocking solution with primary antibodies: rabbit anti-RFP (Abeam, abl24754, 1:400, Cambridge, MA, USA) and FITC anti-GFP (Abeam. ab6662, 1 :200). After PBS washing, the sections were incubated for 1 hour at RT with the appropriate secondary antibodies: goat anti-rabbit IgG (Invitrogen, A-21428, 1: 1000) diluted in blocking solution, or with secondary antibody alone. Following another w ash with lx PBS, the sections were mounted on glass slides using ProLong Diamond Antifade Mountant (Invitrogen, P36965). Immunofluorescence was observed and captured using aYokogawa CSU-Wl spinning disk coupled to a Nikon Eclipse Ti2 confocal microscope.

[0163] Quantification of RFP / GFP signal in hNPC Cre reporter implanted cells

[0164] Primary' segmentation of cells was done via Cellpose cell detector using the built-in cytoplasm model (estimated cell diameter 10-20 pm)49implemented in TrackMate plugin, a Fiji plugin50’51. Next, false positives and false negatives were corrected manually. In cases where cellpose segmentation failed, positive cells were manually segmented. The total number of eGFP-positive cells and DsRed-positive cells were measured. An automated approach was employed to quantify eGFP / DsRed expression in CRE-reporter implanted hNPCs injected with AAV9-CBA-CRE (n=4) or AAV9-null (n=3). Two to three images from each brain were capturing using a 20x / 0.75 Objective (Plan Apo X, Nikon), [proteinl] was excited using a 488 nm laser light and detected with a 535±40 nm emission filter while [protein2] was excited with 561 nm laser light and detected with a 603±53 emission filter, and subsequent maximal projections were generated for analysis. Fields of view covenng the implanted hNPCs were analyzed in coronal sections at 20x magnification. Leveraging deep learning techniques, Cellpose algorithm effectively performed robust cell segmentation, accurately identifying, and delineating individual cells or cell-like structures based on their distinct features39. This powerful capability was integrated with TrackMate, a Fiji plugin for precise cell tracking and analysis. Cells with mean whole-cell signal two standard deviations above background were considered for further analysis. Some images were quantified manually instead of with Cellpose since the cells exhibited varying morphologies as a result of differentiation. The total number of eGFP-positive and DsRed-positive CRE-reporter implanted hNPCs was calculated follow ed by their percentages in each image. The mean values of all eGFP- positive hNPCs per group was compared to the mean value of DsRed-positive hNPCs using a two-way ANOVA and Sidak’s multiple comparisons test.

[0165] Example 1. SaCas9-KKH-induced disruption of the TOR1A DYT1 allele in patient-derived neural progenitor cells

[0166] In the previous gene editing study by Cruz et al. 2020, the strategy' to target the TORI A DYT1 allele involved using the engineered Cas9 variant from Streptococcus pyogenes (SpCas9-VRQR), w hich has shown incompatibility with single AAV -mediated gene therapy12. Here, we explored whether SaCas9-KKH, suitable for AAV-based genome editing, could target the TORI A DYT1 allele. Four guide RNAs (gRNAl-4) spacer sequences targeting the TORI A DYT1 allele were designed (Figure la, Table A). Each spacer sequence contains a 5’ G to facilitate transcription initiated from the U6 promotor and targets a 20-23 sequence adjacent to the TGAGAT protospacer adjacent motif (PAM) of SaCas9-KKH exclusively observed in the TORI A DYT1 allele and not in the TORI A WT allele without the dGAG. To screen gRNAl -4’s efficiency of gene editing the TORI A DYT1 allele with SaCas9-KKH, we incorporated them into sgRNA-expression plasmids with a U6 promoter and electroporated them, along with a SaCas9-KKH-2A-EGFP plasmid driven by a cytomegalovirus (CMV) promoter, in DYT1 patient-derived hNPCs (Figure lb). After 5 days of culturing, SaCas9-KKH expressing hNPCs were sorted by flow cytometry based on viability (DAPINI) and eGFP fluorescence (EGFPpos). FACS sorting resulted in 10.5 ± 3.59% (Mean ± SD) of hNPCs expressing SaCas9- KKH (Figure 1c). The sorted hNPCs were cultured until confluent to extract genomic DNA (gDNA) and subsequently assess the status of the TORI A DYT1 allele. The genomic region of interest around the cleavage site was amplified (Table 1), and editing using gRNAs 1-4 was compared via next-generation CRISPR sequencing (NGS) and CRISPResso2 analysis18. All four gRNAs induced a significant percentage of edited NGS reads (33.2 ± 9.6%, mean difference ± SD) in the TOR1A DYT1 allele compared to the control condition without SaCas9-KKH (Figure Id). We also evaluated the NGS reads of the TOR1A WT allele post-SaCas9-KKH treatment, which had 29.4 ± 11.4% (mean difference ± SD) fewer edits than the observed on- target TOR1A DYT1 allele edits (Figure IF). SaCas9-KKH nuclease activity induced various edits around the cleavage site in the TORI A DYT1 allele, including deletions, substitutions, and insertions. Deletions and insertions predominantly caused a premature stop codon in the TORI A DYT1 allele (Figure 1G). Among the gRNA designs tested, gRNA 3 achieved the highest percentage of premature stop codons, with 37.3 ± 2.8% compared to 27.8 ± 4.8% (mean ± SD) for gRNA 1, gRNA 2, and gRNA 4 (Figure le). We also assessed 7 potential off-target sites, identified by the Cas-OFFinder tool, for our top candidate, gRNA 3. gDNA from cells with confirmed on-target editing on the TOR1A DYT1 allele induced by SaCas9-KKH and gRNA3, was analyzed using NGS. The NGS analysis detected minimal to no edits in the potential off-target sites. In conclusion, gRNA3 with SaCas9-KKH resulted in the highest editing efficiency and induced the most premature stop codons when targeting the TORI A DYT1 allele while safeguarding the TORI A allele without dGAG in hNPCs.

[0167] Example 2. Detecting DYT1 dystonia signature using a dGAG specific- TaqMan probe assay

[0168] Rapid detection of TOR1A DYT1 allele is essential for diagnostic purposes and to evaluate the therapeutic efficiency following gene editing intervention. The trinucleotide disparity (small difference between DYT1 and WT alleles between healthy and DYT1 dystonia individuals) and the heterogeneous nature (mixture of both DYT1 and WT alleles in DYT1 dystonia patients) complicates the detection of DYT1 dystonia by conventional PCR / RT-qPCR, necessitating genomic sequencing to determine the disease. We designed a dGAG-specific assay that distinguishes between TORI A WT (with GAG) and TORI A DYT1 (without GAG) alleles on gDNA and cDNA levels with VIC and FAM fluorophores labeled TaqMan probes, respectively (Figure 2a and Figures 10A-C). Our assay w as initially tested using two custom- synthesized synthetic DNA sequences: one encoding the sequence of DYT1 patients surrounding dGAG to mimic the TOR1A DYT1 allele (248 bp), and the other encoding the sequence of healthy individuals with GAG (251 bp), referred to by TORI A WT sequence (Table 2; region of alteration in bold).

[0169] Table 2: DYT1 and WT synthetic DNA sequences The two synthetic DNA sequences were distinguishable by the relative fluorescence levels (ARn) of each allele-specific TaqMan probe, with a ARn of 6.2 for the dGAG-FAM probe targeting the TOR1A DYT1 sequence and a ARn of 4.7 for the GAG-VIC probe targeting the TOR1A WT sequence (Figure 7a). In comparison. ARn for the dGAG-VIC probe for the TOR1A DYT1 sequence was 0.25, and ARn for the dGAG-FAM probe for the WT sequence was 0. 14. These ARn values could be visualized in a 2D plot identifying homozy gous TORI A DYT1 and homozygous WT sequences. Next, we assessed gDNA and transcript derived from healthy controls and DYT1 patients-derived hNPCs. In healthy control hNPCs, the ARn levels of the dGAG-FAM probe (0.21 ± 0.04 for gDNA and 0.02 ± 0.34 for transcript / cDNA, mean ± SD) were significantly lower than in our DYT1 hNPCs (2. 16 ± 0.82 for gDNA and 2.83 ± 0.30 for transcript / cDNA. mean ± SD) (p=0.003) (Figure 7b). The ARn levels of the GAG-VIC probe in the healthy control hNPCs (3.25 ± 0.29 for gDNA and 3. 19 ± 0.32 for transcript / cDNA, mean ± SD) were higher than in our DYT1 sample (2.12 ± 0.07 for gDNA / 2.23 + 0.16 for transcript, mean ± SD). A 2D graph of the ARn levels of the TaqMan probes from both gDNA and transcript isolations showed that healthy control hNPCs clustered in the same region as the synthetic DNA encoding the TOR1A WT sequence (Figure 2b). Conversely, the ARn levels of DYT1 hNPCs clustered between those of the synthetic DNA encoding the dGAG mutation and the synthetic DNA encoding the TOR1A WT sequence. This was expected since the DYT1 hNPCs used in our analysis contained a single dGAG allele. Our findings with the dGAG specific-TaqMan probe assay and hNPCs were confirmed in control and DYT1 patient-derived fibroblasts (Figure 7c). In conclusion, our dGAG-specific assay effectively distinguishes between healthy controls and DYT1 dystonia patients at both the genomic and transcriptional levels.

[0170] Example 3. Extracellular vesicles secreted by cells derived from DYT1 dystonia patients carry the dGAG signature

[0171] Cells spontaneously release exRNA in the extracellular milieu19. We investigated whether hNPCs release TOR1A exRNA at detectable levels (Figure 3a). exRNA was extracted from conditioned media derived from TOR1A DYT1 and healthy control hNPCs. Subsequently, cDNA was synthesized and pre-amplified using dGAG-flanking primers (Table 1) to prepare for dGAG or GAG (for TOR1A DYT1 and TORI A WT sequences, respectively) assessment with the dGAG-specific TaqMan probe assay. Without this pre-amplification step, TOR1A exRNA derived from hNPC-conditioned media could not be detected (Figure 8a). Additionally, the pre-amplification step helped exclude unwanted gDNA contamination by binding to exon 4 and exon 5 with the forward and reverse primers, respectively (Figure 8b), which we confirmed using an agarose gel and gDNA and cDNA derived from hNPCs (Figure 8c). exRNA can be found in the extracellular milieu through interaction with ribonucleoproteins (RNPs) or encapsulation into EVs20,21. To identify the carrier for TORI A exRNA, we separated hNPC-EVs from RNPs through size-exclusion chromatography (SEC), which resolves particles in conditioned cell media based on their size as they pass through a column of porous resin particles22. Pre-amplification of cDNA synthesized from TOR1A exRNA extracted from DYT1 and healthy control hNPC media samples detected the expected 297 bp amplicon in pooled SEC fractions representing EVs (F6-F11), but not in those representing RNPs (F15-F20) (Figure 3b). Our next step was to validate whether TORI A exRNA present in EVs could provide sufficient resolution to differentiate TORI A DYT1 carriers from healthy control individuals (Figure 3c). The dGAG-specific TaqMan probe assay was conducted on the TORI A exRNA pre-amplicon, showing a cluster pattern similar to the transcript analysis of our hNPCs, distinguishing DYT1 from healthy control samples. Synthetic DNA assay controls containing TOR1A DYT1 or TOR1A WT sequences were included in our assessment of the TORI A exRNA pre-amplicon.

[0172] Considering the enhanced resilience and stability of exRNA within EVs in contrast to freely circulating exRNA20, we postulated that TOR1A exRNA containing dGAG sequences could be identifiable in EVs derived from the blood of DYT1 dystonia patients. exRNA was isolated from the plasma of TOR1A DYT1 carriers with or without manifesting symptoms and healthy controls (Figure 3d). The dGAG-specific TaqMan probe assay on the plasma samples confirmed that the TOR1A exRNA pre- amplicon was present in the blood and could identify TOR1A DYT1 carriers. The clustering in the 2D graph was irrespective of symptom occurrence in the TOR1A DYT1 carriers. In conclusion, we established that dGAG information present in TORI A DYT1 carriers can be evaluated by analyzing cellular secretions or blood samples. This finding holds relevance for diagnostic applications without requiring an invasive biopsy. Example 4. TORI A exRNA as a reporter for TORI A DYT1 allele disruption in gene-edited hNPCs

[0173] Disruption of the TORI A DYT1 allele by SaCas9-KKH activity induces Non- Homologous End Joining (NHEJ) repair, resulting in genetic changes around the targeted cleavage position23. If an easily screenable phenoty pe is not observed following SaCas9-KKH activity, as encountered with DYT1 dystonia versus healthy controls in hNPC cultures, a comprehensive genotype analysis involving cell lysis. gDNA extraction, and NGS sequencing is required. We hypothesized, based on our dGAG-specific TaqMan probe assay observations, that assessing TOR1A exRNA in the secretions of hNPCs would provide a non-damaging alternative to genomic assessment of cells to evaluate disruptions following SaCas9-KKH targeting of the TOR1A DYT1 allele. The primary requirement is that the TORI A -derived transcript, the source of exRNA in DYT1 hNPCs, accurately7reflects the TOR1A DYT1 status in the gDNA. Analysis of both gDNA and RNA / cDNA from DYT1 hNPCs exhibited an expected 50:50 DYTEWT allele ratio when considering the 17bp region upstream of the dGAG site in the TORI A gene (Figure 4a). NGS sequencing analysis of both gDNA and RNA / cDNA confirmed that the same region in healthy control hNPCs does not carry7the TOR1A DYT1 mutation (Figure 8d). Next, we isolated exRNA from DYT1 hNPCs and verified whether the TOR1A DYT1 information could also be detected with NGS sequencing (Figure 4b). We also confirmed that EV transcripts contain the 50:50 DYTEWT TOR1A allele when considering the 17 bp region upstream of the dGAG site in the TOR1A gene. To assess whether TOR1A exRNA is a reliable readout for the disruption of the TOR1A DYT1 allele, DYT1 hNPCs were electroporated with SaCas9-KKHposand sgRNA3PC)S-encoding plasmids prior to FACS sorting and culturing of TORI A DYT1 -targeted hNPCs for EV secretion. Analysis of exRNA from SaCas9-KKH and sgRNA3 expressing hNPCs showed a decrease in NGS reads of the TOR1A DYT1 allele and the occurrence of insertions and deletions around the targeted cleavage site (Figure 4c). However, exRNA tends to underreport TOR1A DYT1 disruption. While 41.5% of the TOR1A DYT1 allele shows changes at the gDNA level in DYT1 hNPCs, exRNA indicates that only 9.4% of the TOR1A DYT1 allele is disrupted (Figure 4d). To evaluate the capability7of exRNA in reporting TOR1A DYT1 editing in their hNPC-donor cells, we analyzed EVs and their donor hNPCs after gene editing with the top three performing gRNAs (gRNAs 1, 2, and 3) using our TOR1A DYTl-specific TaqMan probe assay (Figure 4e). To compare edited and non-edited EVs / hNPCs. we performed FACS separation of SaCas9-KKH / GFPposand SaCas9-KKH / GFPNEGhNPCs poor to EV secretion, exRNA isolation, and EV-donor hNPC transcript isolation. We conducted a correlation analysis in parallel on both the transcript of the hNPC and their exRNA with our dGAG-specific TaqMan probe assay. Our negative control (SaCas9- KKH / GFPNEG), expected to lack edits in the TORI A DYT1 region (Figure 8e). exhibited high Rn levels of the dGAG-FAM TaqMan probe in both our DYT1 hNPCs and their exRNA. However, the Rn levels of the dGAG-FAM probe in SaCas9-KKH expressing hNPCs dropped significantly for all three gRNAs due to TORI A DYT1 editing (p=0.0002). The reduction in the intact TOR1A DYT1 due to SaCas9-KKH activity compared to non-edited hNPCs was 23.02 ± 1 .58% (A mean ± SED), and 34.76 ± 8.59% (A mean ± SED) in the exRNA derived from the hNPC cells. To enable this comparison using the dGAG-FAM probe, the data was normalized to the GAG-VIC probe. In conclusion, we demonstrated that exRNA carried by EVs serves as a reporting tool for monitoring edited events on the TORI A DYT1 allele in their donor cells.

[0174] Example 5. Targeting of mouse brain implanted hNPCs with AAV9

[0175] We chose AAV9 as the carrier for our gene editing machinery due to its high efficiency in delivering genetic material to the CNS, making it ideal for targeting neurological diseases and brain disorders2425. To evaluate the efficacy of AAV9 in targeting hNPCs. we utilized a CRE traffic light reporter system that was expressed in hNPCs by lentiviral transduction and puromycin selection (Figure 5a). CRE activity encoded by AAV9 is expected to interact with the reporter system, switching the fluorescence from red (OFF STATE) to green (ON STATE) (Figure 5b). hNPCs were transduced with the AAV9-CMV enhancer / chicken p-actin (CBA)-CRE vector, and green fluorescence (ON STATE) was observed, indicating functional CRE delivery and reporter activation (Figure 5c). Green fluorescence was not observed in our PBS-exposed in vitro condition. To assess AAV9 activity in vivo, 200,000 of our CRE traffic light reporter expressing-hNPCs were implanted intracranially with AAV9-Cre in nude mice (Figure 5d). Twenty -one days post-injection of ~2xIO10genome copies (gc) / kg AAV9-CBA-CRE or AAV9-Null and implantation of hNPCs, the xenografts in the mouse brains were analyzed for green fluorescence in coronal sections. hNPCs implants exposed to AAV9-CBA-CRE showed 67 ± 10% (A mean ± SED) more cells with green fluorescence (ON STATE) than our AAV9-null condition (Figure 5e). Upon microscopic examination of the brains, the disparity in fluorescence between our experimental conditions was confirmed (Figure 5f). In conclusion, our findings demonstrate the effective transduction of implanted hNPCs by AAV9, highlighting its potential as a promising capsid for delivering CRISPR genome editing tools in the brain.

[0176] Example 6. Disruption of the TOR1A DYT1 allele in vivo with AAV9- SaCas9-KKH

[0177] To assess TORI A DYT1 allele targeting in the brain using genome editing, gRNA 3 was cloned into an all-in-one AAV backbone with SaCas9-KKH26and packaged into an AAV9 capsid, referred to as AAV9-SaCas9-KKH (Figure 6a). DYT1 hNPCs implanted into the striatum of nude mice were intracranially treated with approximately 2xlO10gc / kg of either AAV9-SaCas9-KKH or AAV9-Null (empty AAV9 capsid). After 21 days, the mice were sacrificed to collect cardiac blood and / or brain tissues. exRNA and gDNA were isolated from each sample respectively and used in downstream NGS sequencing analysis. Three in vivo experiments were conducted (Figure 9a). In experiments 1 and 3, we analyzed the hNPC implant treated with AAV9-SaCas9-KKH or AAV9-null. gDNA was isolated from coronal brain sections containing our treated hNPCs, and PCR amplicon surrounding the dGAG region was generated to be compatible with NGS sequencing and CRISPResso2 analysis19. Sequence analysis revealed edits in the DYT1 allele at the target site in the AAV9-SaCas9-KKH-treated samples, whereas no such edits were observed in the AAV9-null-treated brains (Figure 9b). We quantified the edits in both conditions and found significantly more TORI A DYT1 allele editing in the AAV9- SaCas9-KKH samples compared to the AAV9-null samples (3.6% ± 1.64 vs 0.7% ± 1.09, mean ± SD respectively) (Figure 6b). In experiments 2 and 3, we analyzed the plasma of the xenograft mice to determine if exRNA could indicate whether our genome editing therapeutic intervention in the brain successfully altered TOR1A DYT1 in the DYT1 hNPCs (Figure 9a). An amplicon was generated after isolating exRNA and cDNA conversion to be assessed with NGS sequencing and CRISPResso2 analysis. TOR1A DYT1 allele edits due to saCas9-KKH activity could be observed in the AAV9-SaCas9-KKH conditions. Notably, the NGS reads encoding the TOR1A DYT1 region derived from hNPC exRNA were rare and truncated, necessitating filtering to extract relevant information about the modified TORI A DYT1 allele. These reads did not capture all the edit variations observed in the brain tissue samples. Nonetheless, edited TOR1A DYT1 allele reads were significantly more prevalent in the plasma of the AAV9-SaCas9-KKH treated group compared to the AAV9-null treated group (Figure 6c). In conclusion, AAV9-SaCas9- KKH effectively targets the TORI A DYT 1 region in the brain of a xenograft DYT 1 model, and the impact of the gene editing can be assessed through blood analysis.

[0178] References

[0179] 1. Breakefield, X.O., Blood, A.J.. Li, Y., Hallett, M.. Hanson, P.I., and Standaert, D.G. (2008). The pathophysiological basis of dystonias. Nat Rev Neurosci 9, 222-234. doi.org / 10.1038 / nm2337.

[0180] 2. Tsuboi, T., Jabarkheel, Z., Foote, K.D., Okun, M.S., and Wagle Shukla. A. (2019). Importance of the initial response to GPi deep brain stimulation in dystonia: A nine year quality of life study. Parkinsonism Relat Disord 64, 249-255. doi.org / 10.1016 / j.parkreldis.2019.04.024.

[0181] 3. Tsuboi, T., Cif, L., Coubes, P., Ostrem, J.L., Romero, D.A., Miyagi, Y., Lozano, A.M., De Vloo, P., Haq, I , Meng, F., et al. (2020). Secondary Worsening Following DYT1 Dystonia Deep Brain Stimulation: A Multi-country Cohort. Front Hum Neurosci 14, 242. doi.org / 10.3389 / fnhum.2020.00242.

[0182] 4. Caffall, Z.F., Wilkes, B.J., Hernandez-Martinez, R., Rittiner, J.E., Fox, J.T., Wan, K.K., Shipman, M.K., Titus, S.A., Zhang, Y.-Q., Patnaik, S., et al. (2021). The HIV protease inhibitor, ritonavir, corrects diverse brain phenotypes across development in mouse model of DYT-TOR1A dystonia. Sci Transl Med 13. doi.org / 10. 1126 / scitranslmed.abd3904.

[0183] 5. Jung, I.-H., Chang, K.W., Park, S.H., Chang, W.S., Jung, H.H., and Chang, J.W. (2022). Complications After Deep Brain Stimulation: A 21 -Year Experience in 426 Patients. Front Aging Neurosci 14. doi.org / 10.3389 / fiiagi.2022.819730.

[0184] 6. Nance, E., Pun, S.H., Saigal, R., and Sellers, D.L. (2021). Drug delivery' to the central nervous system. Nat Rev Mater 7, 314-331. doi.org / 10. 1038 / s41578-021-00394-w. 7. Leung, J.C., Klein, C., Friedman, J., Vieregge, P., Jacobs, H., Doheny,

[0185] D., Kamm, C., DeLeon, D., Pramstaller, P.P., Penney. J.B., et al. (2001). Novel mutation in the TOR1A (DYT1) gene in atypical early onset dystonia and polymorphisms in dystonia and early onset parkinsonism. Neurogenetics 3, 133-143. doi.org / 10. 1007 / S100480100111.

[0186] 8. Doheny, D., Danisi, F., Smith, C., Morrison, C., Velickovic, M., De Leon, D.. Bressman, S.B., Leung, J.. Ozelius, L., Klein. C., et al. (2002). Clinical findings of a myoclonus-dystonia family with two distinct mutations. Neurology 59, 1244-1246. doi.org / 10.1212 / wnl.59.8.1244.

[0187] 9. Calakos, N., Patel, V.D., Gottron, M., Wang, G., Tran-Viet, K.-N., Brewington, D., Beyer, J.L., Steffens, D.C., Krishnan. R.R.. and Zuchner, S. (2010). Functional evidence implicating a novel TORI A mutation in idiopathic, late-onset focal dystonia. J Med Genet 47, 646-650. doi.org / 10. 1136 / jmg.2009.072082.

[0188] 10. Fan, Y., Si, Z , Wang, L., and Zhang, L. (2023). DYT-TOR1A dystonia: an update on pathogenesis and treatment. Front Neurosci 17, 1216929. doi.org / 10.3389 / fhms.2023.1216929.

[0189] 11. Ozelius, L.J., Hewett, J.W., Page, C.E., Bressman, S B., Kramer, P L., Shalish, C., de Leon, D., Brin, M.F., Raymond, D., Corey, D.P., et al. (1997). The early -onset torsion dystonia gene (DYT1) encodes an ATP -binding protein. Nat Genet 17, 40-48. doi.org / 10. 1038 / ng0997-40.

[0190] 12. Cruz, L., Gyorgy, B., Cheah, P.S., Kleinstiver, B.P., Eimer, W.A., Garcia, S.P., Sharma, N., Ozelius, L.J., Bragg, D C., Joung, J.K., et al. (2020). Mutant Allele-Specific CRISPR Disruption in DYT1 Dystonia Fibroblasts Restores Cell Function. Mol Ther Nucleic Acids 21, 1-12. doi.org / 10. 1016 / j.omtn.2020.05.009.

[0191] 13. Kleinstiver, B.P., Prew, M.S., Tsai, S.Q., Nguyen, N.T., Topkar, V. V, Zheng, Z., and Joung, J.K. (2015). Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol 33, 1293- 1298. doi.org / 10. 1038 / nbt.3404.

[0192] 14. Rufino-Ramos, D., Lule, S., Mahjoum. S., Ughetto, S., Cristopher Bragg, D., Pereira de Almeida, L., Breakefield, X.O., and Breyne, K. (2022). Using genetically modified extracellular vesicles as a non-invasive strategy to evaluate brain-specific cargo. Biomaterials 281, 121366. doi.org / 10. 1016 / j. biomaterials.2022. 121366. 15. Maalouf, K.E., Vaine, C.A., Frederick, D.M., Yoshinaga, A., Obuchi,

[0193] W.. Mahjoum, S., Nieland. L., Al Ali, J., Bragg. D.C.. Breakefield, X.O., el al. (2023). Tracking human neurologic disease status in mouse brain / plasma using reporter-tagged, EV-associated biomarkers. Mol Ther 31, 2206-2219. doi.org / 10. 1016 / j.ymthe.2023.05.011.

[0194] 16. Nogueras-Ortiz, C.J., Eren, E., Yao, P., Calzada, E., Dunn, C.. Volpert, O., Delgado-Peraza, F., Mustapic, M.. Lyashkov, A., Rubio, F.J., et al. (2024). Single- extracellular vesicle (EV) analyses validate the use of LI Cell Adhesion Molecule (L1CAM) as a reliable biomarker of neuron-derived EVs. J Extracell Vesicles 13. doi.org / 10. 1002 / jev2.12459.

[0195] 17. Chatteijee, M., Ozdemir, S., Fritz, C., Mobius. W., Kleineidam, L., Mandelkow, E., Biemat, J., Dogdu, C., Peters, O., Cosma, N.C., et al. (2024). Plasma extracellular vesicle tau and TDP-43 as diagnostic biomarkers in FTD and ALS. Nat Med 30, 1771-1783. doi.org / 10.1038 / s41591-024-02937-4.

[0196] 18. Clement, K., Rees, H , Canver, M.C., Gehrke, J.M., Farouni, R.. Hsu, J.Y., Cole, M.A.. Liu, D.R., Joung, J.K.. Bauer, D.E., et al. (2019). CRlSPResso2 provides accurate and rapid genome editing sequence analysis. Nat Biotechnol 37, 224-226. doi.org / 10.1038 / s41587-019-0032-3.

[0197] 19. O’Brien, K., Breyne, K., Ughetto, S., Laurent, L.C., and Breakefield,

[0198] X.O. (2020). RNA delivery by extracellular vesicles in mammalian cells and its applications. Nat Rev Mol Cell Biol 21, 585-606. doi.org / 10. 1038 / s41580-020-0251- y-

[0199] 20. Sadik, N., Cruz, L., Gurtner, A., Rodosthenous, R.S., Dusoswa, S.A., Ziegler, O.. Van Solinge, T.S., Wei, Z., Salvador-Garicano, A.M., Gyorgy, B., et al. (2018). Extracellular RNAs: A New Awareness of Old Perspectives. Methods Mol Biol 1740, 1-15. doi.org / 10.1007 / 978-1 -4939-7652-2 1.

[0200] 21. Gruner, H.N., and McManus, M.T. (2021). Examining the evidence for extracellular RNA function in mammals. Nat Rev Genet 22, 448-458. doi.org / 10. 1038 / S41576-021-00346-8.

[0201] 22. Boing, A.N., van der Pol, E., Grootemaat, A.E., Coumans, F.A.W., Sturk, A., and Nieuwland, R. (2014). Single-step isolation of extracellular vesicles by size-exclusion chromatography. J Extracell Vesicles 3. doi.org / 10.3402 / jev.v3.23430. 23. Yang, Z., Fu, Y., Zhao, J., Zhang, F., Li, S., Zhao, M., Wen, W„ Zhang, L., Cheng, T., Zhang, J., et al. (2023). Superior Fidelity and Distinct Editing Outcomes of SaCas9 Compared with SpCas9 in Genome Editing. Genomics Proteomics Bioinformatics 21, 1206-1220. doi.org / 10. 1016 / J.GPB.2022. 12.003.

[0202] 24. Chakrabarty, P., Rosario, A., Cruz, P., Siemienski, Z., Ceballos-Diaz, C., Crosby, K., Jansen, K., Borchelt, D.R.. Kim, J.-Y., Jankowsky, J.L., et al. (2013). Capsid Serotype and Timing of Injection Determines AAV Transduction in the Neonatal Mice Brain. PLoS One 8, e67680. doi.org / 10.1371 / joumal.pone.0067680.

[0203] 25. Hudry, E., and Vandenberghe, L.H. (2019). Therapeutic AAV Gene Transfer to the Nervous System: A Clinical Reality. Neuron 101, 839-862. doi.org / 10. 1016 / j.neuron.2019.02.017.

[0204] 26. Nieland, L., Vrijmoet, A.B., Jetten, I.W., Rufino-Ramos, D., de Reus, A.J.E.M., Breyne, K., Kleinstiver, B.P., Maguire, C.A., Broekman, M.L.D., Breakefield, X.O., et al. (2024). CRISPR targeting of mmu-miR-21a through a single adeno-associated virus vector prolongs survival of glioblastoma-bearing mice. Mol Ther. doi.org / 10.1016 / J.YMTHE.2024.11.023.

[0205] 27. Im, W., Moon, J., and Kim, M. (2016). Applications of CRISPR / Cas9 for Gene Editing in Hereditary' Movement Disorders. J Mov Disord 9, 136-143. doi.org / 10. 14802 / jmd. 16029.

[0206] 28. A Clinical Trial of PR001 (LY3884961) in Patients With Peripheral Manifestations of Gaucher Disease (PROCEED) | Clinical Research Trial Listing www. centerwatch.com / clinical-trials / listings / NCT05487599 / a-clinical-trial-of-pr001- ly3884961-in-patients-with-peripheral-manifestations-of-gaucher-disease-proceed.

[0207] 29. Campos, L.J.. Arokiaraj, C.M., Chuapoco, M.R.. Chen, X., Goeden, N., Gradinaru, V., and Fox, A.S. (2023). Advances in AAV technology for delivering genetically encoded cargo to the nonhuman primate nervous system. Current Research in Neurobiology 4, 100086. doi.org / 10.1016 / J.CRNEUR.2023. 100086.

[0208] 30. Goertsen, D., Flytzanis, N.C., Goeden, N., Chuapoco, M.R., Cummins, A., Chen. Y.. Fan, Y., Zhang, Q., Sharma. J., Duan, Y., et al. (2021). AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset. Nature Neuroscience 2021 25: 1 25,

[0209] 106- 115. doi. org / 10.1038 / s41593 -021 -00969-4. 31. Asokan, A., and Shen, S. (2023). Redirecting AAV vectors to extrahepatic tissues. Molecular Therapy 31, 3371-3375. doi.org / 10.1016 / j.ymthe.2023. 10.005.

[0210] 32. Wang, C., Pan, C., Yong, H., Wang, F„ Bo, T„ Zhao, Y., Ma, B., He, W., and Li, M. (2023). Emerging non- viral vectors for gene delivery. J Nanobiotechnology 21, 1-18. doi.org / 10.1186 / S12951-023-02044-5.

[0211] 33. Pacesa, M.. Pelea, O., and Jinek, M. (2024). Past, present, and future of CRISPR genome editing technologies. Cell 187, 1076-1 100. doi. org / 10. 1016 / J. CELL.2024.01.042.

[0212] 34. Albanese, A., Bhatia, K., Bressman, S.B., Delong, M.R., Fahn, S., Fung, V.S.C., Hallett, M., Jankovic, J., Jinnah, H.A., Klein, C., et al. (2013). Phenomenology and classification of dystonia: a consensus update. Mov Disord 28, 863-873. doi.org / 10.1002 / mds.25475.

[0213] 35. Laurie Ozelius, P., and Naomi Lubarr, M. (2016). DYT1 Early-Onset Isolated Dystonia. GeneReviews® [Internet],

[0214] 36. King, C.S., Caffall, Z.F., Soderblom, E.J., and Calakos, N. (2023). DYT-TOR1 A genotype alters extracellular vesicle composition in murine cell model and shows potential for biomarker discovery’. Dystonia 2. doi.org / 10.3389 / dyst.2023.11053.

[0215] 37. Thompson, A.G., Gray. E., Heman-Ackah. S.M., Mager, I., Talbot, K., Andaloussi, S. EL Wood, M.J., and Turner, M.R. (2016). Extracellular vesicles in neurodegenerative disease - pathogenesis to biomarkers. Nat Rev Neurol 12, 346- 357. doi. org / 10. 1038 / nmeurol.2016.68.

[0216] 38. Abels, E.R., and Breakefield. X.O. (2016). Introduction to Extracellular Vesicles: Biogenesis, RNA Cargo Selection, Content, Release, and Uptake. Cell Mol Neurobiol 36, 301-312. doi.org / 10.1007 / sl0571-016-0366-z.

[0217] 39. Kostyushev, D., Kostyusheva, A., Brezgin, S., Smirnov, V., Volchkova. E., Lukashev, A., and Chulanov, V. (2020). Gene Editing by Extracellular Vesicles. Int J Mol Sci 21. doi.org / 10.3390 / ijms21197362.

[0218] 40. Yao, X., Lyu, P., Yoo, K., Yadav, M.K., Singh, R., Atala, A., and Lu, B. (2021). Engineered extracellular vesicles as versatile ribonucleoprotein delivery’ vehicles for efficient and safe CRISPR genome editing. J Extracell Vesicles 10, el2076. doi. org / 10.1002 / j ev2. 12076. 41. Chen, R., Huang, H., Liu, H., Xi, J., Ning, J., Zeng, W., Shen, C., Zhang, T., Yu, G., Xu, Q., et al. (2019). Friend or Foe? Evidence Indicates Endogenous Exosomes Can Deliver Functional gRNA and Cas9 Protein. Small 15, el902686. doi.org / 10.1002 / smll.201902686.

[0219] 42. Leandro, K., Rufino-Ramos, D., Breyne, K., di lanni, E., Lopes, S. M., Jorge Nobre, R., Kleinstiver, B. P., Perdigao, P. R. L.. Breakefield, X. O., & Pereira de Almeida, L. (2024). Exploring the potential of cell-derived vesicles for transient delivery of gene editing payloads. Advanced Drug Delivery Reviews, 21 1, 1 15346. doi.org / 10. 1016 / j.addr.2024.115346

[0220] 43. Rufino-Ramos, D., Leandro, K., Perdigao, P. R. L., O'Brien, K., Pinto, M. M., Santana, M. M., van Solinge, T. S., Mahjoum. S., Breakefield, X. O., Breyne. K., & Pereira de Almeida, L. (2023). Extracellular communication between brain cells through functional transfer of Cre rnRNA. doi.org / 10. 1101 / 2023.01.29.525937

[0221] 44. Rufino-Ramos, D., Lule, S., Mahjoum, S., Ughetto, S., Cristopher Bragg, D., Pereira de Almeida. L., Breakefield, X. O.. & Breyne, K. (2022). Using genetically modified extracellular vesicles as a non-invasive strategy to evaluate brain-specific cargo. Biomaterials, 281, 121366. doi.org / 10. 1016 / j. biomaterials.2022.121366

[0222] 45. Ito, N., Hendriks, W.T., Dhakal, J., Vaine, C.A., Liu, C., Shin, D., Shin, K., Wakabayashi-Ito, N.. Dy, M., Multhaupt-Buell, T., et al. (2016). Decreased N-TAF1 expression in X-linked dystonia-parkinsonism patient-specific neural stem cells. Dis Model Meeh 9, 451-462. doi.org / 10.1242 / dmm.022590.

[0223] 46. Al Ali, J., Vaine, C.A., Shah, S., Campion, L., Hakoum, A., Supnet, M.L.. Acuna. P., Aldykiewicz, G., Multhaupt-Buell, T., Ganza, N.G.M., et al. (2021). <scp> TAF1 < / scp> Transcripts and Neurofilament Light Chain as Biomarkers for X- linked Dystonia-Parkinsonism. Movement Disorders 36, 206-215. doi.org / 10. 1002 / mds.28305.

[0224] 47. Henry, R.T., and Casto, R. (1989). Simple and inexpensive delivery of halogenated inhalation anesthetics to rodents. Am J Physiol 257, R668-71. doi.org / 10.1152 / ajpregu. 1989.257.3. R668.

[0225] 48. Xu, Q., Ming, Z., Dart, A.M., and Du, X. (2007). Optimizing dosage of ketamine and xylazine in murine echocardiography. Clin Exp Pharmacol Physiol 34, 499-507. doi.org / 10. 1111 / j. 1440-1681.2007.04601.X. 49. Stringer, C., Wang, T., Michaelos, M., and Pachitariu, M. (2021). Cellpose: a generalist algorithm for cellular segmentation. Nat Methods 18. 100-106. doi.org / 10.1038 / s41592-020-01018-x.

[0226] 50. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682. doi.org / 10.1038 / nmeth.2019.

[0227] 51. Tinevez, J.-Y., Perry, N., Schindelin, J., Hoopes, G.M., Reynolds, G.D., Laplantine, E., Bednarek, S.Y., Shorte, S.L., and Eliceiri, K.W. (2017). TrackMate: An open and extensible platform for single-particle tracking. Methods 115, 80-90. doi.org / 10.1016 / j.ymeth.2016.09.016.

[0228] OTHER EMBODIMENTS

[0229] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:1 . A composition comprising a nucleic acid encoding Staphylococcus aureus Cas9 protein comprising E782K7N968K / R1015H mutations (SaCas9-KKH), and a nucleic acid encoding a guide RNA targeting DYT1, wherein the guide RNA comprises a sequence selected from the group consisting of:

2. The composition of claim 1, comprising a viral vector comprising the sequence encoding SaCas9-KKH and the sequence encoding the guide RNA, and one or more promoter sequences operably linked to the Cas9 and / or gRNA.

3. The composition of claim 2, further comprising one or more enhancer sequences; a polyadenylation site; and / or insulator sequences, operably linked to the Cas9 and / or gRNA.

4. The composition of claim 4, wherein the enhancer sequence is a woodchuck hepatitis virus posttranscriptional response element (WPRE).

5. The composition of claim 3, wherein the promoter is a brain tissue specific promoter or a pan-cell type promoter.

6. The composition of claim 6, wherein the promoter is a human choline acetyltransferase (ChAT), cytomegalovirus (CMV), or chicken -actin (CBA) promoter.

7. The composition of claim 3, wherein the viral vector is an adeno-associated viral (AAV) vector comprising a pair of inverted terminal repeats (ITRs) flanking a cassette comprising one or more promoters and the sequence encoding SaCas9- KKH and the sequence encoding the guide RNA.

8. The composition of claim 7, comprising a first promoter operably linked to the sequence encoding SaCas9-KKH and a second promoter operably linked to the sequence encoding the guide RNA, optionally wherein the second promoter is a polymerase III promoter, optionally a human U6 promoter, Hl promoter, 7sk promoter, or tRNA promoter.

9. The composition of claim 7, comprising a promoter, a sequence encoding SaCas9- KKH, a 2A sequence, and the sequence encoding the guide RNA, wherein the promoter drives expression of the SaCas9-KKH and the guide RNA.

10. The composition of claim 8 or 9, wherein the promoter or the first promoter is a brain tissue specific promoter or a pan-cell type promoter.

11. The composition of claim 10, wherein the promoter is a cytomegalovirus (CMV) or chicken -actin (CBA) promoter.

12. A composition comprising SaCas9-KKH protein, and a guide RNA targeting DYT1, wherein the guide RNA comprises a sequence selected from the group consisting of:

13. The composition of claim 12, wherein the SaCas9-KKH and guide RNA are present in ribonucleoprotein (RNP) complexes.

14. The composition of claim 12, further comprising one or more carriers, preferably a nanoparticle.

15. The composition of claim 14, wherein the nanoparticle is a lipid nanoparticle (LNP).

16. A method of treating a subject who has DYT1 dystonia, the method comprising administering to the subject a therapeutically effective amount of the composition of claims 1-15.

17. The method of claim 16, wherein the composition is administered systemically or by stereotactic injection into the brain.

18. A method comprising: obtaining a sample comprising extracellular vesicles (EVs), preferably a sample comprising a biofluid or tissue, from a living subject who has undergone a treatment comprising genome editing; isolating the EVs from the sample; and detecting the presence of edited sequences in the EVs.

19. The method of claim 18, wherein the biofluid is serum, saliva, cerebrospinal fluid (CSF), urine, semen, sweat, or tears.

20. The method of claim 18, further comprising: converting mRNA transcripts in the isolated EVs to cDNA; pre-amplifying one or more target sequences in the cDNAto provide a population of target amplicons; and detecting the presence of edited sequences in the target amplicons.

21. The method of claims 18 to 20, wherein detecting the presence of edited sequences comprises using RT-PCR or qRT-PCR, or using sequencing, preferably next generation sequencing.

22. The method of claim 20, wherein detecting the presence of edited sequences in the amplicons comprises performing amplification in the presence of a population of fluorescent probes comprising a first set of probes that bind to the target sequence on one allele and a set of second probes that bind to the target sequence on a second allele, wherein the first and second probes are labeled with fluorescent reporters with non-overlapping emission spectra, and detecting fluorescence signals corresponding to each probe set during amplification, optionally wherein the differences between the alleles are due to a disease-associated (pathogenic) mutation or due to gene editing.

23. The method of claims 18 to 22, wherein the subject has DYT1 dystonia and has been treated with a genome editing treatment that disrupts a 3 bp deletion (c.907_909dGAG) in exon 5 of TOR1A.

24. The method of claim 23, wherein the genome editing treatment comprises administering to the subject a therapeutically effective amount of the composition of claims 1-15.