Microbial delivery of small molecules for modulation of immunometabolism in cancer therapy

Abstract

The invention provides engineered bacterium capable of expressing an AhR agonist or a composition comprising said bacterium, for use in cancer treatment - e.g. immunotherapy; and methods for using the engineered bacterium for therapeutic purposes.

Description

[0001] TITLE: Microbial delivery of small molecules for modulation of immunometabolism in cancer therapy

[0002] FIELD OF INVENTION

[0003] The technology described herein relates to engineered bacteria, pharmaceutical compositions comprising the engineered bacteria, methods for producing recombinant therapeutics, and methods for using the engineered bacteria for therapeutic purposes. Specifically, the invention provides an engineered bacterium that secretes AhR agonist(s), such as indole-derived compounds, for use in cancer therapy.

[0004] BACKGROUND

[0005] Using the immune system to combat cancer by means of immunotherapy is a promising strategy for cancer treatment, which is getting more popular as a first-line treatment worldwide for several types of cancers. Immunotherapy drugs are not directly toxic to cancer cells; instead they act by activating the immune cells that are then able to eliminate the cancerous cells. There are several types of immunotherapy currently in use, including CAR-T, checkpoint inhibitors, cancer vaccines as well as cytokine therapy. CAR-T therapy works by retrieving T-cells from the patient, genetically modifying them to recognize cancer cells and inserting them back into the patient. This method can work quite well, but is a personalized, laborious, and a quite expensive method. Checkpoint inhibitors acts by introducing antibodies that inhibit the immune-suppressive mechanisms of cancer cells, thereby allowing T-cells to recognize and kill cancer cells. Checkpoint inhibition is the most widely used type of immunotherapy today with multiple clinical trials ongoing in combination with chemotherapy and other forms of cancer therapy. However, some cancer types are not responsive to checkpoint inhibitors due to low infiltration of immune cells into the tumor microenvironment. Cancer vaccines supply cancer antigens; this induces the generation of immune cells, which can detect cancer cells and eliminate them. Cytokine therapy uses immune-activating signalling proteins, but it has the drawback of high systemic toxicity.

[0006] SUMMARY OF INVENTION

[0007] The present invention represents a novel approach to cancer treatment by modulation of the host immune system using local delivery of AhR agonists. As an illustarative example, the inventors have through the genetic engineering of E. coli Nissle unlocked the potential to produce high amounts of indole-derived compounds, specifically indole- acetic acid capable of modulating the immune response against cancer. The present invention thereby utilizes a living vector (i.e. the recombinant bacterial strain) that is able to replicate within the tumor environment and provide local delivery of the AhR agonists. The invention is a new modality for cancer treatment, specifically one that harnesses the immune system through immunometabolism modulation and involves local delivery of AhR agonists, which has the potential to bring significant value to patients and society in several ways:

[0008] The present invention has the potential to significantly enhance the body's immune system mechanisms against cancer, leading to more effective treatment outcomes.

[0009] The local delivery of AhR agonists can increase the precision and effectiveness of the treatment.

[0010] Traditional systemic cancer treatments often come with debilitating side effects. The present invention offers a targeted treatment option with fewer or less severe side effects, improving the quality of life for cancer patients.

[0011] The present invention has applications across various types and stages of cancer, making it valuable for a wide range of patients.

[0012] The exemplary recombinant strain of the present invention has been evaluated extensively using both in vitro assays and a relevant murine cancer model, achieving successful colonization with no off-target colonization, a significant reduction in tumor volume, and increase in survival rate. Further, an elevation in both CD4+ and CD8+ T- cell counts demonstrated a marked stimulation of the adaptive immune system. This all together highlights the immense potential of the present technology.

[0013] In a first aspect, the present invention provides a recombinant bacterial cell capable of producing and secreting an AhR agonist, or a composition comprising said recombinant bacterial call, for use in treatment of cancer, said recombinant cell comprising wherein said recombinant bacterial cell comprises one or more recombinant or native genes encoding one or more enzymes selected from the group:

[0014] (a) an aspartate aminotransferase (EC 2.6.1.1),

[0015] (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74),

[0016] (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),

[0017] (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),

[0018] (d) an aromatic 2-oxoacid reductase (EC 1.1.1.110),

[0019] (e) a monooxygenase (EC 1.14.-.-),

[0020] (f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175),

[0021] (g) an (aryl)acrylate reductase (EC 1.3.8.15),

[0022] (h) a L-tryptophan ammonia lyase (EC 4.3.1.31),

[0023] (i) a L-Tryptophan decarboxylase (EC 4.1.1.105), and (j) a monoamine oxidase (EC 1.4.3.4), and wherein at least one of said enzymes is recombinantly expressed.

[0024] Preferably, the AhR agonist is an indole-derivative of Formula I Formula I wherein p is 0 or 1; wherein Ri is a C1-C5 hydrocarbon, preferably a C1-C2 hydrocarbon, wherein Ri is optionally substituted preferably with =0 or -OH; and wherein R2 is - COOH, -CHO, or -NH2.

[0025] In one embodiment, the AhR agonist I selected from indole-3-acetic acid, indole-3- carbaldehyde, indole-3-lactic acid, indole-3-acetaldehyde, indole-3-propionic acid, indole-3-pyruvate, 3-Indoleacrylic acid, and Tryptamine. Preferably indole-3-acetic acid, indole-3-carbaldehyde, and indole-3-lactic acid. Most preferably indole-3-acetic acid.

[0026] In a second aspect, the present invention provides a kit of parts for use as a medicament comprising (i) a recombinant bacterial cell of the invention, and (ii) a second part selected from the group: CAR-T cells, adoptive T cells, immune checkpoint inhibitors and cancer drugs, or a combination of any thereof.

[0027] In a third aspect, the present invention provides a recombinant Escherichia cell capable of producing indole-3 acetic acid, said recombinant cell comprising:

[0028] (a) a first nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3', wherein said first nucleic acid sequence encodes an aspartate aminotransferase (EC 2.6.1.1), and wherein the amino acid sequence of said aspartate aminotransferase (EC 2.6.1.1) has at least 70% sequence identity to SEQ ID NO. 2,

[0029] (b) a second nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3', wherein said second nucleic acid sequence encodes an indole-3- pyruvate decarboxylase (EC 4.1.1.74), and wherein the amino acid sequence of said indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70% sequence identity to SEQ ID NO. 10, and

[0030] (c) a third nucleic acid sequence operatively liked to ribosomal binding site 5' ACAGGAGGG 3', wherein said first nucleic acid sequence encodes an indole-3- acetaldehyde dehydrogenase (EC 1.2.1.3), and wherein said indole-3- acetaldehyde dehydrogenase (EC 1.2. 1.3) has at least 70% sequence identity to SEQ ID NO. 18, wherein said first, second, and third nucleic acid sequences are within an operon operatively linked to promoter 5' TGCTGGACTCGTCGTAATCCTGCGTGTATAATTGGC 3' (SEQ ID NO. 63), and wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1).

[0031] DESCRIPTION OF THE INVENTION

[0032] Abbreviations, terms and definitions

[0033] Disorder / Disease: A disease is a pathophysiological response to internal or external factors; while a disorder is a disruption to regular bodily structure and function. For the purpose of the present application the term "disorder" is to be understood to be an umbrella term that encompasses both a disease and a disorder in a mammalian subject that may be treated by the recombinant bacterial cells of the present invention.

[0034] Immunotherapy is a medical term defined as the "treatment of disease by inducing, enhancing, or suppressing an immune response".

[0035] Indole is an organic compound with the formula CeF CCNHs. Indole is classified as an aromatic heterocycle. It has a bicyclic structure, consisting of a six-membered benzene ring fused to a five-membered pyrrole ring. Indole derivatives (or indole-derived compounds) are derivatives of indole, where one or more H’s have been replaced by other groups. Substitution at the meta-position is an example of an indole derivative of particular relevance in the present application, such as indole-3-acetic acid, indole-3- carbaldehyde, indole-3-lactic acid, Indole-3-acetaldehyde, indole-3-propionic acid, indole-3-pyruvate, and 3-Indoleacrylic acid.

[0036] Adoptive t-cell therapy is a type of immunotherapy in which T cells are given to a patient to help the body fight diseases, such as cancer. Specifically, tumor-specific cytotoxic T cells are isolated from the patient to be treated, expanded ex vivo, and then infused back into cancer patients with the goal of recognizing, targeting, and destroying tumor cells.

[0037] CAR-T cell therapy is a therapy, where a patient's own immune cells are engineered to treat their cancers. Specifically, in CAR T-cell therapies, T cells are taken from the patient's blood and are engineered by adding a chimeric antigen receptor (CAR). This helps them better identify specific cancer cell antigens. The CAR T-cells are then given back to the patient. Solid tumor is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Different types of solid tumors are named after the type of cells that form them. Examples of solid tumors are sarcomas, carcinomas, and lymphomas.

[0038] An agonist is a compound that activates a receptor to produce a biological response. An AhR agonist is a compound that activates the aryl hydrocarbon receptor. Preferably, the AhR agonist is an indole-derivative according to Formula I - i.e. indole substituted at the meta-position. Formula I wherein p is 0 or 1; wherein Ri is a C1-C5 hydrocarbon (i.e. a Ci, C2, C3, C4, or C5 hydrocarbon), preferably a C1-C4 hydrocarbon (i.e. a Ci, C2, C3, or C4 hydrocarbon), more preferably a C1-C3 hydrocarbon (i.e. a Ci, C2, or C3 hydrocarbon), most preferably a Ci or C2 hydrocarbon, wherein Ri is optionally substituted preferably with =0 or -OH; and wherein R2 is -COOH, -CHO, or -NH2.

[0039] The Ahr agonist may most preferably be selected from indole-3-acetic acid, indole-3- carbaldehyde, indole-3-lactic acid, indole-3-acetaldehyde, indole-3-propionic acid, indole-3-pyruvate, 3-Indoleacrylic acid, and Tryptamine. gi number: (geninfo identifier) is a unique integer which identifies a particular sequence, independent of the database source, which is assigned by NCBI to all sequences processed into Entrez, including nucleotide sequences from DDBJ / EMBL / GenBank, protein sequences from SWISS-PROT, PIR and many others.

[0040] Transgene: a gene or genetic material that has been transferred naturally or by any of a number of genetic engineering techniques from one organism to another. The transgene that is transferred to the recipient can be from other individuals of the same species or even from unrelated species.

[0041] Devoid of a gene encoding a functional protein: a microorganism that is devoid of a gene capable of expressing a functional protein (e.g. tryptophan indole-lyase) is a microorganism that either lacks the respective gene, or the gene is modified (e.g. inactivated) such that it is not able to express a functional protein. A range of genetic modifications are suitable for inactivating a gene, including the deletion of the gene (knockout) from the genome of a microbial cell; deletion of its cognate regulatory sequences (e.g. promoter); substitution of, or addition of, at least one nucleotide leading to a loss of expression of a functional polypeptide encoded by the gene. Where the encoded polypeptide is an enzyme, the genetic modification leads to a loss of detectable enzymatic activity of the respective polypeptide in the microbial cell.

[0042] RBS: Ribosomal Binding Site is a sequence of nucleotides upstream of the start codon of an mRNA transcript that is responsible for the recruitment of a ribosome during the initiation of protein translation.

[0043] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows: (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment).

[0044] EC number: Enzyme classification number or Enzyme commission number is a numerical classification scheme for enzymes, based on the chemical reactions they catalyze, in accordance with the original guidelines of Webb, E. C. (1992). Enzyme nomenclature 1992: recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology on the nomenclature and classification of enzymes. Academic Press. ISBN 978-0-12-227164-9.

[0045] Description of the figures

[0046] Figure 1: Engineered EcN producing IAA (EcNIAA) activates Ah R. (a) Illustration of the biosynthetic pathway introduced into EcN to produce indole-3-acetetic acid. The endogenous pathway for indole synthesis was abolished by knocking out tnaA encoded tryptophanase in the genome, (b) Quantification of tryptophan-derived metabolites in EcN with empty expression cassette plasmid (EcNctrl) and 3 strains with different RBS combinations (n=2 biological replicates), (c) AhR activity presented as relative luminescent units (RLU) derived from luciferase-expressing AhR reporter cells following stimulation with 10% supernatant of either EcNIAAor EcNctrl, empty media, or media with 10 pM IAA spike-in for 48 hours (n=6 biological replicates) Data represented as mean ± SEM, overall difference in mean determined with ANOVA and post-hoc analysis of comparison between groups using Tukey's Honest Significant Difference test. ***p < 0.001 (b,c)

[0047] Figure 2: (a) Schematic of experiment using CT-26 model. Seven-week-old female BALB / c mice were subcutaneously implanted with CT-26 cells on their right flank (n > 9 per group) and allowed to grow to a size of 75-200 mm3before being randomized and intratumorally injected with 107CFU EcNctrlor EcNIAAin 20 pL PBS (Day 0). Tumor size was measured three times a week using a caliper and the survival was followed until day 45 after which any remaining animals were tumor-free, (b) Mean tumor trajectories (c) Kaplan-Meier survival analysis censored at 45 days after three consecutive measurements with no tumors, (d) Bacterial colonization in tumors and livers presented as CFU per gram of organ. Individual points represent the mean of each animal calculated from 4 technical replicates, (e) Weights of liver and spleen, (f) Percentage of CD3+cells from tumors of animals treated with EcNctrlor EcNIAA. Data represent the frequency of CD3+ cells as a percentage of the parent population for each treatment group. For each animal, half of the tumor was sectioned and instantaneously preserved by snap freezing in liquid nitrogen. Subsequently, these samples were simultaneously thawed for flow cytometry assessment, employing a T-cell specific panel.

[0048] Data represented as mean ± SEM. Statistical significance determined using Wilcoxon Rank Sum at the final observation timepoint preceding the first euthanasia according to humane endpoints (b), log-rank test (c) and two-tailed Student's t-test (e,f). *p < 0.05, ***p < 0.001.

[0049] Figure 3: EcNIAAincreases abundance of tumor-infiltrating lymphocytes, (a) Workflow schematic for histological analysis. Tumors of comparable size from both the EcNIAA(n=3) and EcNctrl(n =3) treated animals were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4pM for subsequent H&E staining, FISH microscopy, and immunohistochemical detection of CD4+, CD8+, and Granzyme B+ cells, (b) Representative immunohistochemistry images depicting the comparison between an EcNctrltreated animal (top) and an EcNIAAtreated one (bottom), scale bar = 250 pM. (c) Quantitative analysis of marker-positive cells conducted using QuPath software on whole slide images from both the EcNctrl(n=3) and EcNIAA(n=3) treated groups.

[0050] Data represented as mean ± SEM. Statistical significance determined with ANOVA and post-hoc analysis of comparison between groups using Tukey's Honest Significant Difference test (c). **p < 0.01, *p < 0.05.

[0051] Figure 4: Elevated levels of IAA in tumors is sufficient to activate AhR and drives changes in systemic and local cytokine expression, (a) Quantification of indole derivatives was performed on tumor homogenates using LC-HRMS to determine their concentrations, (b) AhR activation was quantified by measuring the relative luminescence units (RLU) produced by luciferase-expressing AhR reporter cells when stimulated with 20% tumor homogenates from animals treated with either EcNIAAor EcNctrl. (c) Differential cytokine abundances in tumor tissue and plasma are displayed in volcano plots as Iog2 fold-changes, comparing subjects treated with EcNIAAto those with EcNctrl. Cytokines that are statistically significantly downregulated are indicated in black, while those upregulated are in light grey.

[0052] Data represented as mean ± SEM. Statistical significance determined with ANOVA and post-hoc analysis of comparison between groups using Tukey's Honest Significant Difference test. ***p < 0.001 (a), two-tailed Student's t-test (b) and two-tailed Student's t-test with Bonferroni-Holm correction for multiple comparisons (c).

[0053] Figure 5: Treatment with EcNIAAdemonstrate efficacy in an additional model of CRC and is associated with lasting immunity, (a) Schematic of experimental using MC38 model. Seven-week-old female C57BL / 6 mice were subcutaneously implanted with MC38 cells on their right flank (n > 9 per group) and allowed to grow to a size of 75-200 mm3before being randomized and intratumorally injected with 107CFU EcNctrlor EcNIAAin 20 pL PBS (Day 0). Tumor size was measured three times a week using a calliper and the survival was followed until day X after which all remaining animals were tumor-free, (b) Mean tumor trajectories, (c) Kaplan-Meier survival analysis censored at 25 days, (d) Bacterial colonization in tumors presented as CFU per gram of tumor. Individual points represent the mean of each animal calculated from 4 technical replicates, (e) Weights of liver and spleen.

[0054] Data represented as mean ± SEM. Statistical significance determined using Wilcoxon Rank Sum at day 7 and final observation timepoint preceding the first euthanasia according to humane endpoints (b), log-rank test (c) **p < 0.0, *p < 0.05

[0055] Figure 6: EcN is co-localized in areas with necrosis. Representative images of areas with bacteria from animal study with CT-26 tumors receiving intratumoral injection of EcNctrl(top, n = 3) and EcNIAA(bottom, n=3).

[0056] Figure 7: Enzymatic pathways to indole-derivatives AhR agonists, (a) aspartate aminotransferase (EC 2.6.1.1), (b) indole-3-pyruvate decarboxylase (EC 4.1.1.74), (c) indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), (d) aromatic 2-oxoacid reductase (EC 1.1.1.110), (e) monooxygenase (EC 1.14.-.-), (f) phenyllactyl-CoA dehydratase (EC 4.2.1.175), (g) (aryl)acrylate reductase (EC 1.3.8.15), (h) L-tryptophan ammonia lyase (EC 4.3.1.31), (i) L-Tryptophan decarboxylase (EC 4.1.1.105), (j) monoamine oxidase (EC 1.4.3.4), (k) tryptophan indole lyase (EC 4.1.99.1). Detailed description of the invention

[0057] The present invention concerns recombinant bacterial cells, developed to produce AhR agonist compounds. The bacterial cells are intended for use as a therapeutic agent in cancer treatment.

[0058] The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that belongs to the family of basic helix-loop-helix transcription factors. The activation of AhR by endogenous and environmental factors has important physiologic effects, including the regulation of the immune response. The AhR thereby provides a molecular pathway for potentially modulating the immune response in health and disease. The potential to target the AhR for therapeutic immunomodulation thereby exists.

[0059] Several pathways of tryptophan metabolism have been implicated in the regulation of AhR activation. Tryptophan-derived metabolites may thereby be considered leading AhR ligands candidates. Indole-derived compounds, such as indole acetic acid, are known agonists to activate the Aryl hydrocarbon receptor (AhR).

[0060] The recombinant cell of the present invention addresses the problem of providing a local delivery of a therapeutic payload - indole-derived compounds - at the cancer tumor site. The present invention provides a live carrier that both produces a therapeutic agent and replicates within the tumor environment, where it provides local delivery of the therapeutic compound.

[0061] Commonly used laboratory bacterial species, such as Escherichia coli can accumulate in tumors. Advances in synthetic biology provide the means of modifying these tumorhoming bacteria for drug delivery applications. An advantage of using such modified bacteria is that they can specifically accumulate in the tumor site and act locally, whereas classical drug treatments suffer from systemic exposure of the body.

[0062] The present invention may be considered a new mode for delivering the active agent. No prior art provides sufficient evidence that this mode of administration of indole- derived compounds would be effective in treatment of cancer. The present inventors have for the first time demonstrated that a recombinant strain according to the present invention, as disclosed herein, can activate of the AhR receptor, and that it is possible to obtain a significant reduction in tumor volume in an aggressive cancer model immune- competent mice using the treatment modality of the present invention, which highlights the immense potential of the present technology.

[0063] The present invention concerns recombinant bacteria expressing Aryl hydrocarbon receptor (AhR) agonists, or a population derived therefrom, which will accumulate and proliferate in the body at the tumor site due to its hypoxic and immune-suppressed microenvironment. These bacteria will via their expression of AhR agonists promote immune cell activation in the tumor microenvironment, while minimizing systemic toxicity. The present technology thereby offers the opportunity to unleash a local immune response only within the cancerous lesion and thus a more localized approach to immunotherapy, potentially reducing toxicities associated with systemic therapy. Using the immune system to combat cancer by means of immunotherapy is a potent strategy for cancer treatment.

[0064] As evidenced herein, the use of AhR agonist-expressing tumor-homing E.coli Nissle 1917 is a promising strategy to treat and / or prevent cancer, avoiding systemic exposure of the body to therapeutic agents, by efficient colonization at the tumor microenvironment and locally providing sufficient levels of AhR agonist to activate the immune cells. Specifically, an improved antitumor activity and survival in two syngeneic mouse models, with durable remission and clearance of bacteria after tumor remission was observed. Further, the mode of action using orthogonal methods of histology and flowcytometry was investigated, and it was shown that treatment with EcNIAAinfluenced the immune-cell composition in the tumor-microenvironment, favoring a milieu associated with higher infiltration of CD4+ and CD8+.

[0065] The targeted delivery of immune-activating agents into an immune-suppressed tumor microenvironment enhances the treatment of tumors in a patient mediated by the patient's own native adaptive immune response, adoptive T-cell, CAR-T therapy, and / or cancer drugs. Future work could be directed towards combining treatment modalities with EcNIAAsuch as the co-delivery of checkpoint-inhibitors, as established in other microbially based therapeutic platforms.

[0066] I. A recombinant bacterial cell for use in treatment of cancer

[0067] Some types of bacteria have the property of specifically accumulating at tumor sites when injected into a cancer patient - such bacteria are exploited in the present invention for recombinant engineering to make them AhR agonist-producing bacteria, preferably indole derivative-producing bacteria.

[0068] In one aspect the present invention provides a recombinant bacterial cell, a cell culture comprising the recombinant bacterial cell, or a composition comprising the recombinant bacterial cell, for use in treatment of cancer, said recombinant bacterial cell being a live bacterium having the property of accumulating at tumor sites. In one embodiment, the recombinant bacterial cell for use in treatment of cancer is a live bacterium having the property of accumulating at solid tumors, where it by secreting AhR agonist compounds, e.g. indole derived compounds, acts as a therapeutic agent in treatment of the solid tumor (such as demonstrated in examples 3-6).

[0069] In one embodiment, the recombinant bacterial cell for use in treatment of cancer is a species of a genus selected from among Escherichia, Listeria, Salmonella, Bifidobacterium, Streptococcus, Lactobacillus, Fusobacterium, Corynebacterium, Sphingomonas, Paracoccus, Staphylococcus, Enterobacter, Klebsiella, Citrobacter, Roseomonas, Sphingomonas, Staphylococcus, Sphingomonas, Actinomyces, Pseudomonas, Acinetobacter, Neisseria, and Enterobacter. Preferably, the recombinant bacterial cell for use in treatment of cancer is a species of a genus selected from among Escherichia, Listeria, Salmonella, and Bifidobacterium. Most preferably, the recombinant bacterial cell for use in treatment of cancer is a species of a genus the Escherichia.

[0070] In a most preferred embodiment, the recombinant bacterial cell is a strain of E. coll, where members of this species have the added advantage of being easily engineered. In one such embodiment, the recombinant strain is an E. coll Nissle strain, such as E. coli Nissle 1917, which further is a well-characterized probiotic strain, classified as a risk group I organism and has GRAS status.

[0071] Bacterial cells, such as E. coli Nissle has been previously investigated as a microbial vector for drug delivery. The present inventors have for the first time reported herein that a bacterial cell - E. coli Nissle - expressing an AhR agonist can successfully be used in cancer treatment, by targeted delivery of the AhR agonist (immune-activating agent) to the solid tumors by virtue of the ability of the bacterial cell to accumulate at the tumor site. The exemplary recombinant strain of the present invention has been evaluated extensively using both in vitro assays and a relevant murine cancer model, achieving successful colonization with no off-target colonization, a significant reduction in tumor volume, and increase in survival rate (see Example 3 and 5). Further, an elevation in both CD4+ and CD8+ T-cell counts demonstrated a marked stimulation of the adaptive immune system (see Example 4). This all together highlights the immense potential of the present technology.

[0072] Though the recombinant bacterial cell is selected based on its property of accumulating at tumors sites and therefore will be mostly restricted to the tumor sites, the cell may be engineered to be auxotrophic to ensure control of its growth and enhance safety. Higher amounts of auxotrophic bacteria can potentially be safely injected into the bloodstream than what is deemed safe for non-auxotrophic replicating strains. In one embodiment, the cells may be designed to contain DAP (diaminopimelic acid) auxotroph NdapA, deletion of chromosomal copies of the dapA gene (SEQ ID NO.70) encoding 4- hydroxy-tetrahydrodipicolinate synthase (SEQ ID NO.71) which will inhibit growth in environments such as the bloodstream where DAP is not present.

[0073] In one aspect, the recombinant bacterial cell of the invention for use in treatment of cancer is engineered to produce and secrete an AhR agonist. As demonstrated herein such AhR agonist can facilitate significant reduction in tumor volume and increase in survival rate of subjects suffering from cancer. The AhR agonist is anticipated for promoting immune cell activation as an elevation in both CD4+ and CD8+ T-cell counts was observed, demonstrating a marked stimulation of the adaptive immune system.

[0074] AhR agonists are known in the art, and may be screened for by use of the method set out in Example 2.1, Furthermore, the amount of a specific AhR agonist secreted by the recombinant bacterial cell of the invention can be quantified, for example by LC-HRMS as set out in Example 1.2.1.

[0075] In one aspect, the AhR agonist is a tryptophan metabolite, and the recombinant bacterial cell of the invention comprises one of more nucleic acid molecules encoding one or more enzymes for conversion of tryptophan to a tryptophan metabolite having AhR agonist properties. In one such embodiment, the expression of said tryptophan metabolite confers on the cell the ability to promote immune cell activation and thereby provide treatment against cancer, on administration to a cancer patient.

[0076] In one aspect, the AhR agonist is an indole-derivative and the recombinant bacterial cell of the invention comprises one of more nucleic acid molecules encoding one or more enzymes for conversion of tryptophan to an indole-derivative having AhR agonist properties. In one such embodiment, the expression of said indole-derivative confers on the cell the ability to promote immune cell activation and thereby provide treatment against cancer, on administration to a cancer patient. Figure 7 illustrates enzymatic pathways to a variety of AhR agonists, specifically a variety of indole-derivatives.

[0077] In one embodiment, the AhR agonist is an indole-derivative according to Formula I - i.e. indole substituted at the meta-position. Formula I wherein p is 0 or 1; wherein Ri is a C1-C5 hydrocarbon (i.e. a Ci, C2, C3, C4, or C5 hydrocarbon), preferably a C1-C4 hydrocarbon (i.e. a Ci, C2, C3, or C4 hydrocarbon), more preferably a C1-C3 hydrocarbon (i.e. a Ci, C2, or C3 hydrocarbon), most preferably a Ci or C2 hydrocarbon, wherein Ri is optionally substituted preferably with =0 or -OH; and wherein R is -COOH, -CHO, or -NH2.

[0078] In one embodiment, the AhR agonist is an indole-derivative according to Formula I, wherein p is 0 or 1; wherein Ri is a Ci hydrocarbon, a C2-C5 saturated hydrocarbon chain, or a C2-C5 unsaturated hydrocarbon chain (e.g. monounsaturated), preferably a Ci hydrocarbon or a C2 saturated or monounsaturated hydrocarbon, and is optionally substituted preferably with =0 or -OH; and wherein R2 is -COOH, -CHO, or -NH2.

[0079] In one embodiment, the AhR agonist is selected from indole-3 acetic acid, indole-3 carbaldehyde, indole-3-lactic acid, indole-3-acetaldehyde, indole-3-propionic acid, indole-3-pyruvate, 3-Indole acrylic acid, and Tryptamine. In a preferred embodiment, the AhR agonist is indole-3 acetic acid.

[0080] In one aspect, the invention provides a recombinant bacterial cell capable of producing and secreting an AhR agonist, or a composition comprising said recombinant bacterial cell, for use in prevention and / or treatment of cancer, wherein said recombinant bacterial cell comprises one or more recombinant or native nucleic acid molecules encoding one or more enzymes selected from the group:

[0081] (a) an aspartate aminotransferase (EC 2.6.1.1),

[0082] (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74),

[0083] (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),

[0084] (d) an aromatic 2-oxoacid reductase (EC 1.1.1.110),

[0085] (e) a monooxygenase (EC 1.14.-.-),

[0086] (f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175),

[0087] (g) an (aryl)acrylate reductase (EC 1.3.8.15),

[0088] (h) a L-tryptophan ammonia lyase (EC 4.3.1.31),

[0089] (i) a L-Tryptophan decarboxylase (EC 4.1.1.105), and

[0090] (j) a monoamine oxidase (EC 1.4.3.4), and wherein at least one of said enzymes is recombinantly expressed.

[0091] In one aspect, the invention provides a recombinant bacterial cell capable of producing and secreting an AhR agonist, or a composition comprising said recombinant bacterial cell, for use in prevention and / or treatment of cancer, wherein said recombinant bacterial cell comprises one or more recombinant genes encoding one or more enzymes selected from the group:

[0092] (a) an aspartate aminotransferase (EC 2.6.1.1),

[0093] (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),

[0094] (d) an aromatic 2-oxoacid reductase (EC 1.1.1.110),

[0095] (e) a monooxygenase (EC 1.14.-.-),

[0096] (f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175),

[0097] (g) an (aryl)acrylate reductase (EC 1.3.8.15),

[0098] (h) a L-tryptophan ammonia lyase (EC 4.3.1.31),

[0099] (i) a L-Tryptophan decarboxylase (EC 4.1.1.105), and

[0100] (j) a monoamine oxidase (EC 1.4.3.4).

[0101] In a further aspect thereof, the microorganism is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (also known as tryptophanase) (EC 4.1.99.1). A microorganism that is unable to express a functional tryptophan indole lyase (EC 4.1.99.1) is unable to catalyze the reaction: L-tryptophan + H2O indole + pyruvate + NH3. A microorganism of the invention devoid of genes capable of expressing a functional tryptophanase (EC 4.1.99.1) produces enhanced levels of preferred indole-derivatives due to enhanced flux into the desired pathway.

[0102] Enzyme (a): A microorganism capable of expressing a functional aspartate aminotransferase (EC 2.6.1.1) is able to catalyze the conversion of L-tryptophan to indole-3 pyruvate. In one preferred embodiment, the amino acid sequence of said aspartate aminotransferase (EC 2.6.1.1) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 2 (AspC from E. coll), SEQ ID NO: 4 (from Bacillus subtilis), SEQ ID NO: 6 (from Bacillus subtilis) or SEQ ID NO: 8 (from Pyricutaria oryzae). Most preferably, the amino acid sequence of said aspartate aminotransferase (EC 2.6.1.1) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 2 (AspC from E. coll').

[0103] Enzyme (b): A microorganism capable of expressing a functional indole-3-pyruvate decarboxylase (EC 4.1.1.74) is able to catalyze the conversion of indole-3-pyruvate to indole-3-acetaldehyde. In one preferred embodiment, the amino acid sequence of said indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 10 (IpdC from Enterobacter) , SEQ ID NO: 12 (from Arabidopsis thaiiana), SEQ ID NO: 12 (from Saccharomyces cerevisiae) or SEQ ID NO: 16 (from Mycobacterium tuberculosis). Most preferably, the amino acid sequence of said aspartate aminotransferase (EC 4.1.1.74) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 10 (IpdC from Entero bacter).

[0104] Enzyme (c): A microorganism capable of expressing a functional indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3) is able to catalyze the conversion of indole-3-aldehyde to indole-3-acetic acid. In one preferred embodiment, the amino acid sequence of said dehydrogenase (EC 1.2.1.3) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 18 (ladl from Ustilago maydis), SEQ ID NO: 20 (from Mesobacillus subterraneus), SEQ ID NO: 22 (from Acinetobacter baumannii) or SEQ ID NO: 24 (from Pseudomonas syringae). Most preferably, the amino acid sequence of said dehydrogenase (EC 1.2.1.3) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 18 (ladl from Ustilago maydis).

[0105] Enzyme (d): A microorganism capable of expressing a functional aromatic 2-oxoacid reductase (EC 1.1.1.110) is able to catalyze the conversion of indole-3-pyruvate to indole-3-lactiv acid. In one preferred embodiment, the amino acid sequence of said aromatic 2-oxoacid reductase (EC 1.1.1.110) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 26 (from Mesobacillus subterraneus), SEQ ID NO: 28 (from Candidatus Nanogingivaiaceae), SEQ ID NO: 30 (from Clostridium botulinum) or SEQ ID NO: 32 (from Clostridium botulinum). Most preferably, the amino acid sequence of said aromatic 2-oxoacid reductase (EC 1.1.1.110) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 26 (xx from xx).

[0106] Enzyme (e): A microorganism capable of expressing a functional monooxygenase (EC 1.14.-.-, such as EC 1.14.14.1) is able to catalyze the conversion of Indole-3-acetic acid to ndole-3-carbaldehyde. In one preferred embodiment, the amino acid sequence of said monooxygenase (EC 1.14.-.-) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 34 (from Arabidopsis thaliana)..

[0107] Enzyme (f): A microorganism capable of expressing a functional phenyllactyl-CoA dehydratase (EC 4.2.1.175) is able to catalyze the conversion of indole-3-lactic acid to 3-indole acrylic acid. In one embodiment, phenyllactyl-CoA dehydratase (EC 4.2.1.175) is a heterodimeric protein consisting of FldB and FldC. In one preferred embodiment, the amino acid sequence of said phenyllactyl-CoA dehydratase FldB has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 36 (from Clostridium sporogenes) and the amino acid sequence of said phenyllactyl-CoA dehydratase FldC has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 38 (from Clostridium sporogenes).

[0108] Enzyme (g): A microorganism capable of expressing a functional (aryl)acrylate reductase (EC 1.3.8.15) is able to catalyze the conversion of 3-indole acrylic acid to indole-3-propionic acid. In one preferred embodiment, the amino acid sequence of said (aryl)acrylate reductase (EC 1.3.8.15) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 40 (from Clostridium botulinum') or SEQ ID NO: 42 (xx from Peptostreptococcus equinus'). Most preferably, the amino acid sequence of said (aryl)acrylate reductase (EC 1.3.8.15) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 40 (from Clostridium botulinum').

[0109] Enzyme (h): A microorganism capable of expressing a functional L-tryptophan ammonia lyase (EC 4.3.1.31) is able to catalyze the conversion of L-Tryptophan to 3-indole acrylic acid. In one preferred embodiment, the amino acid sequence of said L-tryptophan ammonia lyase (EC 4.3.1.31) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 44 (xx from Pubrivivax benzoatilyticus') .

[0110] Enzyme (i): A microorganism capable of expressing a functional L-Tryptophan decarboxylase (EC 4.1.1.105) is able to catalyze the conversion of L-tryptophan to tryptamine. In one preferred embodiment, the amino acid sequence of said L- Tryptophan decarboxylase (EC 4.1.1.105) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 46 (from Homo sapiens), SEQ ID NO: 48 (from Bradyrhizobium guangzhouense) , SEQ ID NO: 50 (from Sulfitobacter mediterraneus), or SEQ ID NO: 52 (from Nibribacter koreensis). Most preferably, the amino acid sequence of said L-Tryptophan decarboxylase (EC 4.1.1.105) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,

[0111] 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 46 (xx from Homo sapiens) .

[0112] Enzyme (j): A microorganism capable of expressing a functional monoamine oxidase (EC 1.4.3.4) is able to catalyze the conversion of tryptamine to indole-3-acetaldehyde. In one preferred embodiment, the amino acid sequence of said monoamine oxidase 1

[0113] (EC 1.4.3.4) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 54 (from Thermoanaerobacterales bacterium), SEQ ID NO: 56 (from Corynebacterium ammoniagenes), SEQ ID NO: 58 (from Actinomycetota bacterium), or SEQ ID NO: 60 (xx from Bacillus subtiiis). Most preferably, the amino acid sequence of said monoamine oxidase (EC 1.4.3.4) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID NO: 54 (from Thermoanaerobacterales bacterium).

[0114] In one embodiment, the invention provides a recombinant bacterial cell capable of producing an AhR. agonist, or a composition comprising said recombinant bacterial cell, for use in prevention and / or treatment of cancer, wherein said recombinant bacterial cell comprises one or more genes encoding one or more enzymes selected from the groups:

[0115] (I): (a) an aspartate aminotransferase (EC 2.6.1.1);

[0116] (II): (a) an aspartate aminotransferase (EC 2.6.1.1) and (b) an indole-3- pyruvate decarboxylase (EC 4.1.1.74);

[0117] (HI): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3);

[0118] (IV): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);

[0119] (V): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105);

[0120] (VI): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4);

[0121] (VII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC

[0122] 1.2.1.3);

[0123] (VIII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC

[0124] 1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);

[0125] (IX): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110);

[0126] (X): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175); (XI): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC

[0127] 4.2.1.175), and (g) an (aryl)acrylate reductase (EC 1.3.8.15);

[0128] (XII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31); or

[0129] (XIII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31) and (g) an (aryl)acrylate reductase (EC 1.3.8.15), and wherein at least one of said nucleic acid molecules is a recombinant nucleic acid molecule. Hence, at least one of the enzymes is recombinantly expressed.

[0130] In one embodiment, the invention provides a recombinant bacterial cell capable of producing an AhR. agonist, or a composition comprising said recombinant bacterial cell, for use in prevention and / or treatment of cancer, wherein said recombinant bacterial cell comprises one or more recombinant genes encoding one or more enzymes selected from the groups:

[0131] (I): (a) an aspartate aminotransferase (EC 2.6.1.1);

[0132] (II): (a) an aspartate aminotransferase (EC 2.6.1.1) and (b) an indole-3- pyruvate decarboxylase (EC 4.1.1.74);

[0133] (HI): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3);

[0134] (IV): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);

[0135] (V): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105);

[0136] (VI): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4);

[0137] (VII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC

[0138] 1.2.1.3);

[0139] (VIII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC

[0140] 1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);

[0141] (IX): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110);

[0142] (X): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC

[0143] 4.2.1.175); (XI): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175), and (g) an (aryl)acrylate reductase (EC 1.3.8.15);

[0144] (XII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31); or

[0145] (XIII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31) and (g) an (aryl)acrylate reductase (EC 1.3.8.15).

[0146] Hence, in this embodiment, all mentioned enzymes are recombinantly expressed.

[0147] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-pyruvate, wherein said recombinant bacterium comprises a transgene or recombinant nucleic acid molecule encoding enzyme (a) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3-pyruvate as compared to cells of the nonrecombinant microorganism from which it was derived.

[0148] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3- acetaldehyde, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a) and (b) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3- acetaldehyde as compared to cells of the non-recombinant microorganism from which it was derived.

[0149] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-acetic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a), (b), and (c) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3-acetic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0150] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3- carbaldehyde, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a), (b), (c), and (e) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole- 3-carbaldehyde as compared to cells of the non-recombinant microorganism from which it was derived.

[0151] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing tryptamine, wherein said recombinant bacterium comprises a transgene or recombinant nucleic acid molecule encoding enzyme (i) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of tryptamine as compared to cells of the non-recombinant microorganism from which it was derived.

[0152] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3- acetaldehyde, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (i) and (j) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3- acetaldehyde as compared to cells of the non-recombinant microorganism from which it was derived.

[0153] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-acetic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (i), (j), and (c) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3-acetic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0154] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3- carbaldehyde, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (i), (j), (c), and (e) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3- carbaldehyde as compared to cells of the non-recombinant microorganism from which it was derived.

[0155] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-lactic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a) and (d) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3-lactic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0156] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3 acrylic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a), (d), and (f) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3 acrylic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0157] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-propionic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (a), (d), (f), and (g) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3- propionic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0158] In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3 acrylic acid, wherein said recombinant bacterium comprises a transgene or recombinant nucleic acid molecule encoding enzymes (h) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3 acrylic acid as compared to cells of the nonrecombinant microorganism from which it was derived. In one embodiment, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3-propionic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding enzymes (h) and (g) as specified herein. Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3-propionic acid as compared to cells of the non-recombinant microorganism from which it was derived.

[0159] In one most preferred aspect, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3 acetic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding an aspartate aminotransferase (EC 2.6.1.1), an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and an indole-3- acetaldehyde dehydrogenase (EC 1.2.1.3). Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3 acetic acid as compared to cells of the non-recombinant microorganism from which it was derived. In one preferred embodiment, the aspartate aminotransferase (EC 2.6.1.1) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 2 (AspC from E. coli), the indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 10 (ipdC from Enterobacter), and the indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 18 (ladl from Ustilago maydis).

[0160] In a most preferred embodiment, the invention provides a recombinant E. coli cell capable of producing indole-3-acetic acid, or a composition comprising said recombinant E. coli cell, for use in prevention and / or treatment of cancer, wherein said recombinant E. coli cell comprises:

[0161] (a) a first nucleic acid sequence encoding an aspartate aminotransferase (EC 2.6.1.1) having at least 70% sequence identity to SEQ ID NO. 1 [i.e. codon optimized aspC from E. coli], wherein said first nucleic acid sequence is operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e. RBSb],

[0162] (b) a second nucleic acid sequence encoding an indole-3-pyruvate decarboxylase (EC 4.1.1.74) having at least 70% sequence identity to SEQ ID NO. 9 [i.e codon optimized ipdC from Enterobacter], wherein said second nucleic acid sequence is operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e. RBSb], and (c) a third nucleic acid sequence encoding an Indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3) having at least 70% sequence identity to SEQ ID NO. 17 [i.e. codon optimized iadl from Ustilago maydis], wherein said first nucleic acid sequence is operatively liked to ribosomal binding site 5' ACAGGAGGG 3' [i.e. RBSa], wherein said first, second and third nucleic acid sequences are within an operon operatively linked to a promoter defined by SEQ ID NO. 63 [i.e. promoter MS6], and wherein said recombinant E. coli cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1).

[0163] In one other preferred aspect, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3 lactic acid, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding an aspartate aminotransferase (EC

[0164] 2.6.1.1) and an aromatic 2-oxoacid reductase (EC 1.1.1.110). Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3 lactic acid as compared to cells of the non-recombinant microorganism from which it was derived. In one preferred embodiment, the aspartate aminotransferase (EC 2.6.1.1) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 2 (AspC from E. coli) and the aromatic 2-oxoacid reductase (EC 1.1.1.110) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 26 (from Mesobacillus subterraneus).

[0165] In another preferred aspect, the invention provides a composition for use in treatment of cancer comprising cells of a recombinant bacterium capable of producing indole-3 carbaldehyde, wherein said recombinant bacterium comprises one or more transgenes or recombinant nucleic acid molecules encoding an aspartate aminotransferase (EC

[0166] 2.6.1.1), an indole-3-pyruvate decarboxylase (EC 4.1.1.74), an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), and a monooxygenase (EC 1.14.-.-). Preferably, said recombinant bacterium is further genetically modified in being devoid of genes capable of expressing tryptophan indole lyase (EC:4.1.99.1). Cells of said bacterium are therefore capable of producing increased amounts of indole-3 carbaldehyde as compared to cells of the non-recombinant microorganism from which it was derived. In one preferred embodiment, the aspartate aminotransferase (EC 2.6.1.1) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 10 (AspC from E. coli), the indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 10 (IpdC from Enterobacter), the indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 18 (ladl from Ustilago maydis), and the a monooxygenase (EC 1.14.-.-) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO: 34 (from Arabidopsis thaliana).

[0167] Expression of heterologous proteins may negatively affect expression hosts, because resources that could be used for growth are directed for synthesis of the product protein. Protein expression strength is largely determined by how much mRNA is produced and how much mRNA is translated into proteins. These processes can be controlled by modifying promoter strength and the strength of the ribosome binding site (RBS). However, transcription and translation are not the only factors, which determine how much active protein is produced. The capacity of the cell to perform correct protein folding, disulphide bond formation and translocation can be a limiting factor for protein secretion. Therefore, fine-tuning the level of recombinant cytokine protein expression may be needed to obtain optimal conditions for active protein production.

[0168] As a means for regulating the expression of recombinant enzymes in the recombinant cell, different promoters may be used. In one embodiment, the recombinant bacterial cell of the invention comprises one or more heterologous nucleic acid sequence(s) encoding one or more enzymes for production of an AhR agonist. The heterologous nucleic acid molecules encoding said enzymes may each be cognately linked to a promoter, such as a constitutive or inducible promoter. Alternatively, the heterologous nucleic acid molecules encoding said enzymes may be cloned within an operon linked to a common cognate promoter.

[0169] For example, where the recombinant bacterium is a strain of E. coli, the nucleic acid sequence of the promoter may be selected from members of the Anderson promoter collection (http: / / parts.igem.org / Promoters / Catalog / Andersonmay), which are generally recognized as being suitable for general protein expression in E. coli. The collection is known to cover a range of activities - i.e. different promoter strengths - so by testing different promoters it should be possible for a person skilled in the art to find a promoter activity that suits a specific application. In another embodiment, the recombinant bacterium is a strain of E. coli and the nucleic acid sequence of the promoter is selected from SEQ ID NO: 63 (MS6 promoter) and SEQ ID NO: 64 (MS8 promoter), preferably SEQ ID NO: 63 (MS6 promoter).

[0170] As a further means of regulating the expression of recombinant enzymes in the recombinant cell, different ribosomal binding sites (RBSs) having different strengths may be used to modify the translational strength of the cytokine gene. In bacteria, translational strength is defined by the Shine-Dalgarno / ribosome binding site (RBS) sequence directly upstream of the start codon.

[0171] In one embodiment, the recombinant bacterial cell of the invention comprises one or more heterologous nucleic acid sequence(s) encoding one or more enzymes for production of an AhR agonist, wherein said one or more heterologous nucleic acid sequence(s) are operably linked to an optimized ribosomal binding site sequence.

[0172] For example, where the recombinant bacterium is a strain of E. coli, the nucleic acid sequence of the RBS may be selected from RBSa: 5' ACAGGAGGG 3' and RBSb: 5' AAAGGAGAA 3'.

[0173] The AhR agonist is secreted from the recombinant bacterium to act as the therapeutic agent for treatment of cancer tumors. Examples 1 demonstrates that the recombinantly expressed AhR agonist indole-3-acetic acid was indeed secreted from E. coli, as the medium was found to comprise this AhR agonists. For E. coli, there are naturally transporters found for closely related compounds, hence the AhR agonist is likely transported by the same means.

[0174] The heterologous nucleic acid molecules may be cloned into a self-replicating episome introduced into the microorganism, or may alternatively be cloned into the chromosome of the microorganism. The episome may be a native plasmid of the microorganism or a heterologous plasmid. Hence, in one aspect, the recombinant bacterial cell of the invention comprises one or more plasmids that comprise the one or more recombinant nucleic acid molecules encoding the one or more enzymes for producing the AhR agonist. The coding sequence of the one or more recombinant nucleic acid molecules encoding the sequence of the one or more enzymes is operatively linked to a promoter, RBS, and signal peptide in the cell, these being selected to provide a desired expression level of the enzyme(s) in the recombinant bacterium of the invention, leading to efficient production of the AhR agonist.

[0175] In one embodiment, the recombinant cell of the invention is E. coli Nissle 1917 comprising plasmid pMUTl engineered to comprise the one or more recombinant nucleic acid molecule(s) encoding the one or more enzymes for expression in E. coli and facilitating production of an AhR agonist as disclosed herein. If the origin of the nucleic acid molecule(s) encoding the one or more enzymes is an organism different from E. coli, then the nucleic acid molecule(s) may preferably be codon optimized for expression in E. coli, as recognized by a person skilled in the art. SEQ ID NO: 65 is an exemplary plasmid for expression of enzymes according to the present invention, said plasmid being a modified version of the E. coli native pMUTl plasmid.

[0176] II. Cancer treatment by the recombinant bacterial cell

[0177] As discussed previously, the recombinant bacterial cell of the invention is a bacterium having the property of accumulating at tumor sites, especially solid tumors, where it as a therapeutic agent in treatment of the solid tumor by producing and secreting AhR agonist compound(s), which promote immune cell activation.

[0178] In one embodiment, the invention provides a recombinant bacterial cell as disclosed herein for use in prevention and / or treatment of cancer, preferably for use in treatment of cancer, most preferably solid tumor cancer.

[0179] In one aspect, those cancers for which the recombinant bacterial cells of the invention may be used in providing therapeutic treatment may be selected from the group:

[0180] Adrenocortical Carcinoma; AIDS-Related Cancer; AIDS-Related Lymphoma; Lymphoma; Anal Cancer; Gastrointestinal Carcinoid Tumor; Astrocytomas; Atypical Teratoid / Rhabdoid Tumor, Basal Cell Carcinoma; Bile Duct Cancer; Bladder Cancer; Bone Cancer; Ewing Sarcoma; Osteosarcoma; Malignant Fibrous Histiocytoma; Brain Tumors; Lung Cancer; Burkitt Lymphoma; Non-Hodgkin Lymphoma; Carcinoid Tumor; Cardiac Tumor, Medulloblastoma; Cervical Cancer; Cholangiocarcinoma; Chordoma; Myeloproliferative Neoplasm; Rectal Cancer; Craniopharyngioma; Cutaneous T-Cell Lymphoma; Mycosis Fungoides; Ductal Carcinoma In Situ; Endometrial Cancer; Uterine Cancer; Ependymoma; Esophageal Cancer; Esthesioneuroblastoma; Fallopian Tube Cancer; Gallbladder Cancer; Gastric Cancer; Gastrointestinal Carcinoid Tumor; Gastrointestinal Stromal Tumor; Gestational Trophoblastic Disease; Hepatocellular Cancer; Hodgkin Lymphoma; Hypopharyngeal Cancer; Intraocular Melanoma; Islet Cell Tumor, Pancreatic Neuroendocrine Tumor; Langerhans Cell Histiocytosis; Laryngeal Cancer; Lip and Oral Cavity Cancer; Liver Cancer; Lung Cancer, Pleuropulmonary Blastoma, Tracheobronchial Tumor; Lymphoma; Melanoma; Melanoma, Merkel Cell Carcinoma; Mesothelioma, Metastatic Squamous Neck Cancer; Midline Tract Carcinoma With NUT Gene Changes; Mouth Cancer; Multiple Endocrine Neoplasia Syndromes; Multiple Myeloma; Myelodysplastic Syndromes, Myelodysplastic / Myeloproliferative Neoplasm; Myeloproliferative Neoplasm; Nasal Cavity cancer; Paranasal Sinus Cancer; Nasopharyngeal Cancer; Non-Hodgkin Lymphoma; Non-Small Cell Lung Cancer; Pleuropulmonary Blastoma; Oropharyngeal Cancer; Osteosarcoma; Ovarian Cancer; Pancreatic Cancer; Papillomatosis; Paraganglioma; Parathyroid Cancer; Penile Cancer; Pheochromocytoma; Pituitary Tumor; Plasma Cell Neoplasm; Breast Cancer; Lymphoma; Peritoneal Cancer; Prostate Cancer; Recurrent Cancer; Renal Cell Cancer; Retinoblastoma; Rhabdomyosarcoma, Salivary Gland Cancer; Sarcoma;; Skin Cancer; Small Intestine Cancer; Soft Tissue Sarcoma; Squamous Cell Carcinoma; T-Cell Lymphoma, Testicular Cancer; Thymoma and Thymic Carcinoma; Thyroid Cancer; Urethral Cancer; Uterine Cancer, Endometrial; Uterine Sarcoma; Vaginal Cancer; Vascular Tumors; Vulvar Cancer; Chondrosarcoma; Osteosarcoma; Rhabdomyosarcoma; Heart cancer; Carcinoid tumor, gastrointestinal; Colon cancer; Extrahepatic bile duct cancer; Gastrointestinal stromal tumor; Hepatocellular cancer; Pancreatic cancer; Endometrial cancer; Renal cell carcinoma; transitional cell cancer; Gestational trophoblastic tumor; Wilms tumor; Oral cancer; Paranasal sinus and nasal cavity cancer; Pharyngeal cancer; Salivary gland cancer; AIDS-related lymphoma; Anaplastic large cell lymphoma; Angioimmunoblastic T-cell lymphoma; Burkitt's lymphoma; Cutaneous T-cell lymphoma; Diffuse large B-cell lymphoma; Follicular lymphoma; Hepatosplenic T-cell lymphoma; Hodgkin's lymphoma; Hairy cell leukemia; Intravascular large B-cell lymphoma; Lymphoplasmacytic lymphoma; Lymphomatoid granulomatosis; Mantle cell lymphoma; Marginal zone B-cell lymphoma; Mediastinal large B cell lymphoma; Myelodysplastic syndromes; Mucosa-associated lymphoid tissue lymphoma; Mycosis fungoides; Nodal marginal zone B cell lymphoma; Primary central nervous system lymphoma; Primary cutaneous follicular lymphoma; Primary cutaneous immunocytoma; Primary effusion lymphoma; Plasmablastic lymphoma; Splenic marginal zone lymphoma; Skin adnexal tumors; sebaceous carcinoma; Merkel cell carcinoma; Sarcomas of primary cutaneous origin; dermatofibrosarcoma protuberans; Bronchial adenoma and carcinoid; Mesothelioma; Pleuropulmonary blastoma; Kaposi sarcoma; Epithelioid hemangioendothelioma; Desmoplastic small round cell tumor; and Liposarcoma.

[0181] In one preferred embodiment, the recombinant bacterial cell of the invention may be used in providing therapeutic treatment of soft tissue sarcoma, melanoma, carcinomas, osteosarcoma, haemangiosarcoma, lymphoma or mast cell tumour, haemangiosarcoma, lingual SCC, osteosarcoma, nasal adenocarcinoma or fibrosarcoma

[0182] In one aspect, the recombinant bacterial cell or composition according to the present invention is for use as a therapeutic for animals, in particular mammals selected from the group consisting of humans, dogs, cats, pigs, cattle, horses, goats, and sheep, as well as poultry (e.g. chickens). Another aspect of the invention provides a method of treating a patient suffering from a cancerous disease - such as selected from the above mentioned list of diseases - said method comprising administering a recombinant cell according to the invention to said patient. In one preferred embodiment the cancerous disease is a solid tumor cancerous disease.

[0183] In a further aspect, the invention concerns the use of a recombinant cell according to the present invention in the manufacture of a medicament for the treatment of cancer, preferably a medicament for treatment of a solid tumor cancer. in Administration of the recombinant cell to the patient

[0184] In therapeutic applications, such as treating cancer, the composition according to the invention is for administration in an amount sufficient to at least partially cure or arrest the symptoms of the disease and its complications. An amount adequate to accomplish this is defined as "a therapeutically effective dose". Amounts effective for this purpose will depend on a number of factors known to those skilled in the art such as the severity of the disease and the weight and general state of the patient.

[0185] The recombinant bacterial cell of the invention for use in the prevention and / or treatment of cancer, is suitable for administration to the subject by a mode of administration selected from the group: intravenous, intra-arterial, intraperitoneal, intralymphatic, sub-cutaneous, intradermal, intramuscular, intraosseous infusion, intraabdominal, oral, intratumor, intravascular, intravenous bolus; and intravenous drip. Preferably the mode of administration is either intravenous, intralymphatic, intratumoral, or intraperitoneal administration. Most preferably the mode of administration is intravenous.

[0186] In one embodiment, the recombinant bacterium of the invention is administered as a population of bacterial cells capable of producing and secreting a therapeutic dose to the patient in need thereof. Such population may comprise at least 10A5 bacterial cells, such as at least 10A6 bacterial cells, 10A7 bacterial cells, or at least 10A8 bacterial cells. In one embodiment, a therapeutic dose of between 10A3 to 10A10 bacterial cells, preferably between 10A4 to 10A9 bacterial cells, most preferably between 10A5 to 10A8 bacterial cells is administered to the patient.

[0187] In one embodiment, the administered recombinant population provides an intertumoral concentration the AhR. agonist of at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 pg / ml.

[0188] Following administration to the subject, the microorganism of the invention is capable of surviving and / or colonizing within the subject, preferably colonizing at the tumor site. The recombinant cell of the invention may be administered together with other cancer treaments, such as adaptive T-cell therapy, CAR-T therapy, and / or cancer drugs.

[0189] In one aspect, the invention provides a kit of parts comprising (i) the recombinant bacterial cell expressing an ArH agonist as disclosed herein and (ii) cells for CAR-T cell therapy.

[0190] The administration of the recombinant cell of the present invention in combination with other cancer treaments may be carried out as one combined dosage or as separate dosages, wherein (i) the recombinant bacterial cell expressing an AhR agonist as disclosed herein is administered before or after (ii) cells for CAR-T cell therapy.

[0191] In another aspect, the invention provides a kit of parts comprising (i) the recombinant bacterial cell expressing and AhR agonist as disclosed herein and (ii) other cancer drugs, such as immune checkpoint inhibitors, chemotherapeutics or radiotherapy. Examples of immune checkpoint inhibtiors comprise anti-PDl; anti-PD-Ll; anti-CTLA4; anti-CD40L; anti-CD-137; anti-IL-10; anti-IL-lOR; CCL21; anti-OX40; Anti-B7-H4; LIGHT; anti- LAG3; and anti-GITR. Examples of chemotherapeutics comprise doxorubicin; paraplatin; cyclophosmamide; epirubicin, 5-fluoro uracil; gemcitabine; eribulin; mutamycin; paclitaxel; and docetaxel.

[0192] The administration of the recombinant cell of the present invention in combination with these other cancer treaments may be carried out as one combined dosage or as separate dosages, wherein (i) the recombinant bacterial cell expressing an AhR agonist as disclosed herein is administered before or after (ii) other cancer drugs, such as immune checkpoint inhibitors, chemotherapeutics or radiotherapy. Examples of immune checkpoint inhibitors comprise anti-PDl; anti-PD-Ll; anti-CTLA4; anti-CD40L; anti-CD- 137; anti-IL-10; anti-IL-lOR; CCL21; anti-OX40; Anti-B7-H4; LIGHT; anti-LAG3; and anti-GITR. Examples of chemotherapeutics comprises doxorubicin; paraplatin; cyclophosmamide; epirubicin, 5-fluoro uracil; gemcitabine; eribulin; mutamycin; paclitaxel; and docetaxel.

[0193] IV. A kit of parts

[0194] In one aspect, the present invention provides a kit of parts for use as a medicament comprising (i) a recombinant bacterial cell of the invention, and (ii) a second part selected from the group: CAR-T cells, adoptive T cells, immune checkpoint inhibitors and cancer drugs, or a combination of any thereof.

[0195] In one preferred embodiment, a kit of parts for use as a medicament is provided, comprising (i) a recombinant bacterial cell of the invention, and (ii) an immune checkpoint inhibitors. V. A recombinant cell producing indole-3 acetic acid

[0196] In one aspect, the invention provides a recombinant bacterial cell producing indole-3 acetic acid. The invention provides a recombinant E. coli cell capable of producing indole- 3-acetic acid by recombinant expression of (a) an aspartate aminotransferase having at least 70, 75, 80, 85, or 90% sequence identity to SEQ ID NO. 2 (AspC from E. coli), (b) an indole-3-pyruvate decarboxylase having at least 70, 75, 80, 85, or 90% sequence identity to SEQ ID NO. 10 (IpdC from Enterobacter), and (c) a dehydrogenase having at least 70, 75, 80, 85, or 90% sequence identity to SEQ ID NO. 18 (ladl from Ustilago maydis), and preferably wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase.

[0197] In a preferred embodiment, the invention provides a recombinant Escherichia coli cell capable of producing indole-3-acetic acid, said recombinant cell comprising:

[0198] (a) a first nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [RBSb], wherein said first nucleic acid sequence encodes an aspartate aminotransferase (EC 2.6. 1.1), and wherein the amino acid sequence of said aspartate aminotransferase (EC 2.6. 1.1) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity to SEQ ID NO. 2 [i.e. AspC from E. coli],

[0199] (b) a second nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e. RBSb], wherein said second nucleic acid sequence encodes an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and wherein the amino acid sequence of said indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity to SEQ ID NO. 10 [i.e IpdC from Enterobacter], and

[0200] (c) a third nucleic acid sequence operatively liked to ribosomal binding site 5' ACAGGAGGG 3' [i.e. RBSa], wherein said first nucleic acid sequence encodes an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), and wherein the amino acid sequence of said indole-3-acetaldehyde dehydrogenase (EC 1.2. 1.3) has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity to SEQ ID NO. 18 [i.e ladl from Ustilago maydis], wherein said first, second, and third nucleic acid sequences are within an operon operatively linked to promoter 5' TGCTGGACTCGTCGTAATCCTGCGTGTATAATTGGC 3' (SEQ ID NO. 63) [i.e promoter MS6], and wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1). In a preferred embodiment, the invention provides a recombinant Escherichia coli cell capable of producing indole-3-acetic acid, said recombinant cell comprising:

[0201] (a) a first nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e RBSb], wherein said first nucleic acid sequence encodes an aspartate aminotransferase (EC 2.6. 1.1), and wherein the amino acid sequence of said aspartate aminotransferase (EC 2.6. 1.1) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 2 [i.e AspC from E. coli],

[0202] (b) a second nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e RBSb], wherein said second nucleic acid sequence encodes an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and wherein the amino acid sequence of said indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 10 [i.e IpdC from Enterobacter], and

[0203] (c) a third nucleic acid sequence operatively liked to ribosomal binding site 5' ACAGGAGGG 3' [i.e RBSa], wherein said first nucleic acid sequence encodes an indole-3-acetaldehyde dehydrogenase (EC 1.2. 1.3), and wherein the amino acid sequence of said indole-3-acetaldehyde dehydrogenase (EC 1.2. 1.3) has at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 18 [i.e ladl from Ustilago maydis], wherein said first, second, and third nucleic acid sequences are within an operon operatively linked to promoter 5' TGCTGGACTCGTCGTAATCCTGCGTGTATAATTGGC 3' (SEQ ID NO. 63) [i.e promoter MS6], and wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1).

[0204] In a preferred embodiment, the invention provides a recombinant E. coli cell capable of producing indole-3-acetic acid, said recombinant cell comprising:

[0205] (a) a first nucleic acid sequence having at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 1 [i.e. codon optimized aspC from E. coli] encoding an aspartate aminotransferase (EC 2.6.1.1), wherein said first nucleic acid sequence is operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e. RBSb], (b) a second nucleic acid sequence having at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 9 [i.e. codon optimized IpdC from Enterobacter] encoding an indole-3-pyruvate decarboxylase (EC 4.1.1.74), wherein said second nucleic acid sequence is operatively liked to ribosomal binding site 5' AAAGGAGAA 3' [i.e. RBSb], and

[0206] (c) a third nucleic acid sequence having at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, most preferably at least 90% sequence identity to SEQ ID NO. 17 [i.e. codon optimized iadl from Ustilago maydis] encoding an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), wherein said first nucleic acid sequence is operatively liked to ribosomal binding site 5' ACAGGAGGG 3' [i.e. RBSa], wherein said first, second, and third nucleic acid sequences are within an operon operatively linked to a promoter defined by SEQ ID NO. 63 [i.e. promoter MS6], and wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1).

[0207] In a further aspect, the present invention provides a kit of parts comprising (i) the recombinant E. coli cell capable of producing indole-3-acetic acid as disclosed herein, and (ii) a second part selected from the group: CAR-T cells, adoptive T cells, immune checkpoint inhibitors and cancer drugs, or a combination of any thereof.

[0208] EXAMPLES

[0209] EXAMPLE 1: Engineering probiotic Escherichia coli Nissle 1917 to produce IAA For recombinant production of indole-3-acetic acid in Escherichia coli Nissle 1917 (EcN), the following genes were expressed in a tnaA knockout EcN stain: aspartate aminotransferase aspC gene from E. coli K-12 (UniProtKB entry P00509) to convert tryptophan to indole-3-pyruvate, decarboxylase IpdC gene from Enterobacter cloacae (UniProtKB entry P23234 to produce the intermediate indole-3-acetaldehyde, and dehydrogenase gene iadl from Ustilago maydis (UniProtKB entry P09317) to produce indole-3-acetic acid (illustrated in Figure la).

[0210] 1.1 Strain Construction

[0211] The three-step biosynthetic pathway was cloned on the cryptic plasmid pMUT under the control of a constitutive promoter MS6 (SEQ ID NO. 63) designed for use in vivo and two strong predicted ribosomal binding site variants RBSa: 5' ACAGGAGGG 3' and RBSb: 5' AAAGGAGAA 3'.

[0212] In the operon generated, the aspartate aminotransferase aspC gene from E. coli K-12 (UniProtKB entry P00509) (SEQ ID NO. 2) was cloned to convert tryptophan to indole- 3-pyruvate, followed by the decarboxylase ipdC gene from Enterobacter cloacae fUniProtKB entry P23234 (SEQ ID NO. 10) and the dehydrogenase gene iadl from Ustilago maydis (UniProtKB entry P09317) (SEQ ID NO. 18) to produce the intermediate indole-3-acetaldehyde and the final product of the reaction, indole-3-acetic acid, respectively. All genes were codon optimized for expression in E. coll - i.e. SEQ ID NOs 1, 9, and 17, respectively).

[0213] A tryptophanase tnaA knockout (AtnaA), [2,649,949 -> 2,651,364] (52.42 centisomes, 189°) on Chromosome NZ_CP022686.1 (SEQ ID NO 61) EcN was generated to abolish production of indole from the engineered biotherapeutic and was used as the background strain for all experiments. To generate the tnaA knockout (EcN AtnaA), a cassette approximately 1,100 base pairs in length, inclusive of homologous regions flanking the native tnaA gene, was synthesized. This cassette was employed to disrupt the open reading frame of the specified gene using seamless lambda red-mediated integration of double-stranded DNA (dsDNA), complemented by CRISPR / Cas9 counterselection, as delineated in prior studies.

[0214] Plasmid construction and purification: The plasmids constructed herein were assembled via Gibson Assembly, utilizing E. coli Top 10 as the cloning host. Plasmid SEQ ID NO. 65 was used as backbone. Promoters, ribosome binding sites, and genes of interest were amplified employing Q5 High-Fidelity DNA Polymerase (New England Biolabs). The assembly process followed the supplier's protocol (Gibson Assembly Protocol (E5510)), where 1.5 pL of the Gibson mixture was used to transform One Shot™ TOP10 Chemically Competent E. coli (Thermo Fisher) as per the supplier's guidelines (One Shot™ TOP10 Thermo Fisher Catalog Numbers C4040-10). Selection of transformed cells occurred on selective culture media, followed by colony verification through PCR and subsequent sequencing. A positive clone was cultured in 2 mL LB containing 50 pg / mL kanamycin for 16 hours. Post incubation, plasmid isolation was conducted using the NucleoSpin Plasmid EasyPure extraction kit (Macherey Nagel, ref. 740727.250).

[0215] The purified plasmid facilitated the transformation of electrocompetent E. coli Nissle 1917 cells (Tn7:sfGFP+, StrepR, AtnaA) via electroporation. The sfGFP was genomically integrated at the attTn7 site, spanning positions 2672041 to 2672355, and expressed under the BBa_J23101 promoter. The EcN strains used in this study had been previously cured of any native pMUTl plasmid. Preparation of bacterial supernatants: Glycerol stocks of EcN were inoculated in Lysogeny Broth with 100 pg / mL streptomycin, and 50 pg / mL kanamycin and grown overnight at 37 °C with shaking 250 RPM. Overnight cultures were diluted 100-times into fresh media and grown until late exponential phase. Cultures were centrifuged at 4000xg for 10 min and supernatants were filter-sterilized using a 0.22 pm syringe filter. Supernatants were stored at - 20 °C for further use. 1.2 Quantitative analysis of tryptophan derived metabolites

[0216] Quantitative analysis was conducted on the spent medium from the engineered strains and the control strain harboring the empty pMUTl (EcNctrl) vector to measure the spectrum of tryptophan-derived metabolites, which have the potential to act as agonists for the Aryl hydrocarbon Receptor (AhR), an important transcription factor involved in cell homeostasis and immune cell responses. Three distinct combinations of Ribosomal Binding Site (RBS) variants RBSa and RBSb were evaluated, in conjunction with the constitutive MS6 promoter, within the pMUTl plasmid vector.

[0217] 1.2.1 Targeted high -resolution LC-HRMS:

[0218] Reference solutions for the tryptophan-derivatives, along with internal standard solutions, were formulated at 1 mg / ml concentration. These analytes were then mixed and diluted with 10% ethanol in MilliQ water to prepare 0, 0.5 pg / ml, 1 pg / ml, 5 pg / ml, 10 pg / ml, 50 pg / ml, 100 pg / ml, and 200 pg / ml solutions. An internal standard at a fixed concentration of 4 pg / ml was included in all reference solutions and sample preparations. Calibration curves were constructed from these mixed standards.

[0219] For analysis, 2 pL from each sample was introduced into a high-efficiency liquid chromatography quadrupole time-of-flight mass spectrometry system, which included a Dionex Ultimate 3000 RS liquid chromatograph (Thermo Scientific, CA, USA) connected to a Bruker maXis time-of-flight mass spectrometer with an electrospray interface (Bruker Daltonics, Bremen, Germany), functioning in negative ion mode. Separation of analytes was achieved on a Poroshell 120 SB-C18 column sized at 2.1 x 100 mm with 2.7 pm particle diameter (Agilent Technologies, CA, USA). The column temperature was maintained at 40 °C, with the sampler at 4 °C. The mobile phases for UPLC consisted of water with 0.1% formic acid (solvent A) and acetonitrile with 0.1% formic acid (solvent B). The elution of analytes commenced with 1% of solvent B for the initial minute, increased through a linear gradient to 15% at 3 minutes, reached 50% at 6 minutes, and peaked at 95% solvent B at 9 minutes. This gradient was held steady till the 10- minute mark, after which the solvent mix was returned to starting conditions by 10.1 minutes, followed by a re-equilibration period until 13 minutes. The elution was performed at a steady flow rate of 0.4 mL / min. Mass spectrometry data acquisition was in full scan mode at a frequency of 2 Hz across a scan range from 50 to 1000 m / z. The electrospray interface was set to the following parameters: Nebulizer pressure at 2 bar, dry gas flow at 10 L / min at a temperature of 200 °C, and capillary voltage at 4500 V. For enhanced measurement precision, calibration was executed externally and internally using sodium formate clusters (Sigma-Aldrich, Schnelldorf, Germany), complemented by a lock-mass calibration (hexakis (1H,1H, 2H-perfluoroetoxy) phosphazene, Apollo Scientific, Manchester, UK). 1.2.2. Results

[0220] The results are recorded in Table 1 and graphically illustrated in Figure lb. Notably, MS6-RBSb-aspC-RBSb-ipdC-RBSa-iadl (hereafter referred to as EcNIAA) exhibited a pronounced increase in IAA production and was chosen as the candidate for subsequent experiments. The EcNIAAplasmid is provided as SEQ ID NO. 66.

[0221] EXAMPLE 2: Activation of AhR by the engineering probiotic strain expressing IAA

[0222] The ability of EcNIAAto activate the AhR was examined. For this purpose, spent medium from both the modified and the control strain was prepared and their ability to activate the receptor was assessed using a mammalian AhR reporter cell line. 2.1 AhR activity assay

[0223] HT29-Lucia™ AhR Cells (Invivogen, Catalog number ht2l-ahr) were handled according to the manufacturer's instructions. Briefly, cells were thawed and passaged for two generations in absence of selection antibiotic Zeocin (Invivogen CAS number: 11006- 33-0). Subsequent passages were maintained in lOOpg / mL Zeocin and 1% penicillinstreptomycin. Cells were harvested before reaching 90% confluency and approximately 50.000 cells were seeded in 96-well plates (Greiner bio-one, Catalog number: 655160) in 160-180 pL volume. 20-40 pL of sample or positive control was then added to a final volume of 200 pL and incubated for 24-48 hours. FICZ (Sigma-Aldrich, CAS number: 172922-91-7) was used as positive control at a working concentration of 20 pM. Following incubation, 20pL of stimulated cell supernatant was transferred to a black 96- plate with optical bottom (Thermo Fisher, Catalog number: 165305). 50 pL QUANTI- Luc™: Luciferase Detection Reagent (InvivoGen, Catalog number: rep-qlc4r2) was added to each well and luminescence was immediately read on a Synergy Hl plate reader (BioTek, Winooski, VT, USA) using 2mm read-height, 200 ms integration time and 100 gain.

[0224] 2.2 Results

[0225] Notably, a significant elevation in the activation of the receptor by EcNIAAcompared with the control strain and the baseline media condition was detected (see Figure lc).

[0226] An elevation in the levels of any other tryptophan-derived metabolites was not detected (Table 1 and Figure lb), indicating that activation of the AhR by the engineered strain could be ascribed specifically to the presence of IAA.

[0227] The control strain's ability to activate the AhR, despite the targeted disruption of indole production, implies that EcN may synthesize alternative activating compounds, reflecting capacity of the AhR to respond to a diverse array of ligands.

[0228] The results obtained indicate that the engineered EcNIAAcan produce and secrete high quantities of IAA with a robust ability to activate the target receptor.

[0229] EXMAPLE 3: Microbial delivery of IAA mediates antitumor immunity

[0230] Having demonstrated the ability of the engineered strain EcNIAAto produce high quantities of IAA in an in vitro setting, the subsequent objective was to examine the effects of localized IAA delivery in murine models of colorectal cancer (CRC). Syngeneic murine tumor models, with a complete immune landscape, allows a translational approach to study the efficacy of new immunotherapies. CT26 cells are a commonly used murine colorectal cancer model, with clinically relevant mutations of colorectal cancer (CRC) and high infiltration of immune cells. 3.1 Cell culture and maintenance

[0231] The murine colorectal carcinoma cell line CT-26 cell line was purchased from ATCC (Catalog number: CRL-2638) and MC38 cell line was kindly provided by Professor Janine Erler, Copenhagen University. Luciferase-labelled HT29-Lucia cells, which serve as AhR reporter cells governed by the Cyplal gene promoter (referred to as AhR reporter cells), were acquired from InvivoGen (catalogue reference: ht2l-ahr). CT-26 and MC38 celllines were grown in RPMI 1640 Medium (Thermo Fisher Scientific, Catalog number: 11875093) and HT29-Lucia cells in McCoy's 5A (Modified) Medium (Thermo Fisher Scientific, Catalog number: 16600082). Media was supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Catalog number: A5670701), and 1% penicillinstreptomycin (Thermo Fisher Scientific, Catalog number: 15140148) in a humidified incubator at 37 °C with 5% CO2. Cells were maintained by changing the media twice per week and passaged upon reaching 90% confluency to ensure optimal growth conditions and cellular health.

[0232] 3.2 Animal experiments

[0233] The animal experiments were conducted in accordance with the Danish Animal Experiments Act on protective of animals used for scientific purpose (LBK 1107 from 02 / 07 / 2022) and Directive 2010 / 63 / EU of the European Parliament. Moreover, the study protocols were approved by the Animal Experimentation Committee under the Ministry of Food, Fishing, and Agriculture (license number 2021-15-0201-00925). Thirty female BALB / c mice (Janvier) seven weeks-old and thirty-five female C57BL / 6 (Taconic) seven weeks-old underwent a minimum of 5 days of acclimatization with ad libitum access to tap water and chow diet (A30, Safe diets). At study start 3x105 CT26 (BALB / c mice) and 3x105 MC38 (C57BL / 6 mice) tumor cells in 100 pl serum-free media were subcutaneously engrafted on the right hind flank. Tumors were grown to an average volume of 50-200 mm3 before the mice were randomized into two groups (n > 9). Animals received 1x107 CFU bacteria in 20 pl PBS by intratumoral injection. Tumors were assessed three times per week using calliper and the volume was estimated using the formula 0.5 x (Longest dimension x shortest WimensionJ ^2). A rechallenge with 3x105 MC38 tumor cells in 100 pl serum free media was performed for five remaining tumor-free animals following treatment with EcNIAA and six age-matched treatment naive C57BL / 6 mice as controls. As the studies progressed mice would be humanely euthanized using cervical dislocation when tumor volumes reached 2000 mm3 or fluid ulceration appeared on the tumor. Whole blood was collected upon euthanizing and immediately processed using BD Biosciences Microtainer™ Tubes with Microgard™ Closure (Thermo Fisher Scientific product code 12957646) by centrifugation at 9000xg for 2 minutes. Plasma was collected and immediately stored at -20° C for further use. Moreover, organs weights for liver and spleen as well as tumor weights were recorded. In addition, tumors and livers were processed according to description for generation of homogenates below. The mice were co-housed in groups of 4-6 in IVC, 22 °C ± 2 °C, light cycle was 6 am to 6 pm, and the mice were given ad libitum access to water and chow diet (A30, Safe diets) during the whole study period. The animal studies were carried out as single-blinded trials, with measurements and ulceration scoring conducted by an animal caretaker who was blinded to treatment assignment. 3.3 Preparation of tumor- and liver homogenates and determination of colony-forming units

[0234] After dissection, uniformly sized tumor sections or entire livers were placed into GentleMACS C tubes and homogenized using the m_Imptumor_01_01 program. To remove cell clumps, the homogenized samples were then forced through a 70 pm cell strainer. Serial dilutions of the homogenates of tumor and liver were plated on LB plates containing selective antibiotics and bacterial colonies were counted the following day compute the CFU.

[0235] 3.4 Cryopreservation of tumors

[0236] Half of the tumor from each animal was cryopreserved, Briefly, tumors were cleaned and sectioned into 3 x 3 mm pieces using a scalpel. These pieces were then submerged in 1 mL of storage media consisting of 90% fetal bovine serum (Thermo Fisher Scientific, Catalog number: A5670701) and 10% dimethyl sulfoxide for snap-freezing and cryopreservation in liquid nitrogen.

[0237] 3.5 Flow cytometric analysis

[0238] The cryopreserved portion of tumors was thawed in a 37 °C water bath and tissues were immediately transferred to 15 mL-tube and washed in 10 mL RPMI 1640 Medium with 10% fetal bovine serum. After thawing, biopsies were further cut into smaller pieces on a TES-99 cooling surface at 4°C and incubated in digestion medium consisting of RPMI1640 supplemented 200 U / mL collagenase IV (Sigma-Aldrich, Catalog number: 17104019) and 10 U / mL DNAse I (Sigma-Aldrich, Catalog number: 11284932001) for 30 minutes at 37°C. The digestion suspension was centrifuged at 400xg 4°C and the pellet was resuspended in TrypLE Express (Thermofisher Catalog number: 12604013) to yield a single-cell suspension.

[0239] All subsequent steps were performed on ice when possible. Single-cell suspension was filtered with 70pm cell strainer into a 50 mL collection tube and the filter was washed repeatedly using PBS. The single cell suspension was then centrifuged at 400xg 4°C and the pellet was resuspended in FACS buffer. For intracellular staining, cells were fixed using a 1% paraformaldehyde solution in PBS and then stained in a 0.1% (w / v) saponin permeabilization buffer. Data acquisition was performed on a LSRFortessaTM X-20 (BD Biosciences), and compensation was carried out using single-color stained Ultra Comp beads (Invitrogen). Analysis of the flow cytometry data was conducted using FlowJo version 10.10 (Tree Star). Fluorescence minus one controls were employed to establish gating for the markers (Figure 6). Antibodies used for extra- and intracellular targets in the panel are listed in Table 2.

[0240] 3.4 Results

[0241] Tumors were engrafted in BALB / c mice and allowed to grow to a size of 50-250 mm3before being randomized into two groups receiving a single intratumoral injection of 107EcNIAAor EcNctrl(Figure 2a).

[0242] The administration of bacteria was well-tolerated in all animals, and a significant reduction in tumor growth was observed in mice treated with EcNIAAcompared to those receiving the control strain (Figure 2b). Treatment with EcNIAAalso significantly promoted the overall survival in CT-26 tumor-bearing mice based on euthanization according to humane endpoints (Figure 2c).

[0243] The presence of viable bacteria in tumors was determined by plating serial dilutions of tumor homogenates, revealing that all animals harboured viable bacteria in tumors at the time of euthanization (Figure 2d) up to 27 days post infection, confirming the ability of EcN colonize the tumors for longer periods. Any potential off-target colonization in the liver (the organ most associated with off-target colonization) was also investigated, but no viable bacteria in the liver were observed (Figure 2d).

[0244] In mice, spleen enlargement is commonly observed in transplantable tumor models. Additionally, spleen volume has been studied as a surrogate biomarker for myeloid- derived suppressor cell (MDSC) accumulation and treatment response in several human cancers. Tumor bearing mice treated with EcNIAAshowed a decrease in spleen weight, although this difference was not statistically significant (Figure 2e). The presence of EcN within the tumors was also confirmed using Fluorescence In Situ Hybridization (FISH) microscopy to investigate the spatial distribution of bacteria in the tumor microenvironment. It was observed that EcN primarily colonized tissue immediately adjacent to necrotic regions, and no noticeable differences in colonization between EcNIAAand EcNctrlwas observed.

[0245] Flow cytometric analysis of frozen tumor tissues revealed that EcNIAAtreatment shifted the immune cell composition, with a greater percentage of CD45+ leukocytes expressing CD3+(Figure 2f), indicative of an enriched presence of T and NKT cells in animals treated with EcNIAA.

[0246] The present findings indicate that treatment with EcN is well-tolerated, consistently leading to successful tumor colonization in all tested animals and with no observed off- target colonization. Notably, the engineered EcN strain, capable of IAA production, significantly contributed to reducing tumor volume and enhancing survival in the experimental model.

[0247] Example 4: EcN™ increases abundance of tumor-infiltrating lymphocytes

[0248] To assess whether EcNIAAwould stimulate the adaptive immune cells, three animals with size-matched tumors from both groups were evaluated through histological analysis using immunohistochemistry for markers of CD4+, CD8+and GzmB+on serial sections from the same tumor (Figure 3a).

[0249] 4.1 Immunohistochemical analysis of tumors

[0250] Tumor biopsies were immediately fixed in 4% buffered paraformaldehyde (pH 7.4) and then stored at 4°C for a minimum of 24 hours prior to embedding in paraffin (FFPE). For antigen retrieval, the sections were microwaved for 15 minutes in Tris-EGTA buffer at pH 9. This was followed by a pre-incubation in 2% bovine serum albumin for 10 minutes, and then an incubation at room temperature for one hour with primary antibodies diluted in 2% BSA. These included Granzyme B, Cat. No. ab255598 (Abeam), made in rabbit, diluted 1:3200, CD4 Cat. No. abl83685 (Abeam), made in rabbit, diluted 1:500, and CD8 Cat. No. D4W2Z (Cell Signaling), made in rabbit, diluted 1:250. To amplify the reaction, sections were incubated for 40 minutes with biotinylated secondary antibody immunoglobulins, Goat anti-Rabbit: BA-1000 diluted 1:200. Subsequently, 3% hydrogen peroxide was used to block endogenous peroxidase. A third layer incubation was then conducted with a preformed Avidin and Biotinylated horseradish peroxidase macromolecular complex (for CD4 and Granzyme B: Elite ABC, Code no. PK-6100, for CD8a: ABC, code no. PK-4000 Vector Laboratories) for 30 minutes. The reaction was visualized using 3,3-diaminobenzidine (DAB+) (for Granzyme B: SK-4105, for CD4 and CD8a: code no. SK-4100 Vector Laboratories) for 15 minutes, and sections were counterstained with Mayer's Hematoxylin. Fluorescence in situ hybridization (FISH) was used to detect the presence and distribution of bacteria within a section of the tumor. A universal bacterial probe (Bacllni) (AdvanDx, Woburn, MA), labeled at the 5' end with Texas Red, was employed to detect bacteria. For nuclear visualization, DAPI (4', 6- diamidino-2-phenylindole) was used as a DNA stain (Life Technologies, OR, USA). Fluorescence microscopy was conducted using an inverted Zeiss LSM 880 confocal microscope (Zeiss, Jena, DE). Observations were made either with a Plan-Apochromat 63x / 1.40 Oil DIC M27 objective or an EC Plan-Neofluar 40x / 1.30 Oil DIC M27 objective.

[0251] 4.2 Results

[0252] A significant increase in the abundance of CD4+ and CD8+ cells was observed in animals treated with EcNIAA, and a discernible trend towards higher abundance of Granzyme B positive cells p=0.069) in the treatment group indicative of a more cytotoxic milieu, although this change was not statistically significant (Figure 3c).

[0253] The observed elevation in both CD4+ and CD8+ T-cell counts in EcNIAA-treated tumors demonstrates a marked stimulation of the adaptive immune system. This enhanced immune response could be driven by increased recruitment and / or proliferation of T- cells within the tumor environment, highlighting the immunomodulatory potential of EcNIAAtreatment.

[0254] EXAMPLE 5: EcNIAAdrives local and global changes in cytokine expression

[0255] To elucidate the mechanisms driving the observed immunological shift, indole derivatives in the tumor were measured and the capacity of tumor homogenates to activate AhR in an ex-vivo assay was assessed. Further, using a targeted proteomics assay, levels of different cytokines from plasma and tumor samples were quantified.

[0256] 5.1. Investigation of indole derivatives at tumor site

[0257] A notable increase in the tumor levels of IAA in the EcNIAAtreated group was found, whereas the concentrations of ILA and I3A did not differ significantly (Figure 4a).

[0258] Tumor homogenates from animals treated with EcN demonstrated significantly enhanced activation of the AhR (Figure 4b), indicative of the strains ability to produce therapeutically relevant titers in the tumor microenvironment.

[0259] 5.2. Investigation of cytokines from plasma and tumor samples

[0260] Using a targeted proteomics assay, the levels of 48 different cytokines in both plasma and tumor samples were quantified. 5.2.1 Preparation of plasma from whole blood

[0261] Whole blood was collected upon euthanization and immediately processed using BD Microtainer™ Tubes with Microgard™ Closure (Thermo Fisher, Product Code. 12957646) by centrifugation at 9000xg for 2 minutes. Plasma was collected and immediately stored at -20 °C for further use.

[0262] 5.2.1 Plasma and tumor biomarker measurements

[0263] Plasma and tumor biomarkers were determined using proximity extension assay technology (Olink proteomics Inc.) on a Olink Target 48 Mouse Cytokine panel. Biomarkers with more than 20% of measurements outside of the assays limit of detection were excluded from the analysis.

[0264] 5.2.2 Results

[0265] It was observed that animals treated with EcNIAAexhibited elevated tumor levels of IFN- y, CXCL9, and IL27, alongside reduced IL17a concentrations (Figure 4c, left panel). Correspondingly, plasma analyses revealed a similar trend for CXCL9 and IL17a, with the additional finding of increased levels of the chemokine CXCL11 (Figure 4c, right panel). These results indicate that EcN can be utilized to locally deliver IAA and effectively alter the tumor microenvironment, leading to changes in local and global cytokine expression patterns.

[0266] EXAMPLE 6: Intratumoral delivery of IAA drives anti-cancer immunity in multiple models of colorectal cancer.

[0267] To validate the observed effects in the CT-26 model, the effect of EcNIAAwas tested in an additional immunocompetent syngeneic model. MC38 (Figure 5a), with high infiltration of immune cells but distinct composition and phenotype of myeloid, lymphoid, and stromal cells compared to the CT-26 model.

[0268] Treatment with EcNIAAalso demonstrated a significant decrease in the tumor volume compared to the control group (Figure 5b), as well as a significant improvement in the overall survival (Figure 5c). Strikingly, it was found that almost half of the animals (5 / 12) treated with EcNIAAwere tumor-free after 9 days of treatment.

[0269] The presence of viable bacteria in tumors was confirmed, and any potential off-target colonization in the liver was also investigated, but no viable bacteria in the liver were observed (Figure 2d). Finally, tumor bearing mice treated with EcNIAAshowed a decrease in spleen weight (Figure 2e).

[0270] Together, these results indicate that treatment with EcNIAA, and local delivery of IAA, can induce a strong immune response in several tumor models. Statistical testing

[0271] Statistical analyses were conducted using RStudio version 4.1.0, utilising the rstatix and DescTools packages. Data are presented as mean ± SEM unless otherwise specified. P values of < 0.05 were considered statistically significant. *P < 0.05, **P <0.01, ***P <0.001 and ****P <0.0001. For comparisons between two groups, either a dependent sample t-test or paired Wilcoxon-signed rank test was employed. In cases of multiple comparisons, The Tukey's honestly significant difference test (Tukey's HSD) or Benjamini-Hochberg Procedure adjustments were performed.

Claims

CLAIMS1. A recombinant bacterial cell capable of producing an AhR agonist for use in treatment of cancer, wherein said recombinant bacterial cell comprises one or more recombinant or native genes encoding one or more enzymes selected from the group:(a) an aspartate aminotransferase (EC 2.6.1.1),(b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74),(c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),(c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3),(d) an aromatic 2-oxoacid reductase (EC 1.1.1.110),(e) a monooxygenase (EC 1.14.-.-),(f) a phenyllactyl-CoA dehydratase (EC 4.2.1.175),(g) an (aryl)acrylate reductase (EC 1.3.8.15),(h) a L-tryptophan ammonia lyase (EC 4.3.1.31),(i) a L-Tryptophan decarboxylase (EC 4.1.1.105), and(j) a monoamine oxidase (EC 1.4.3.4), and wherein at least one of said enzymes is recombinantly expressed.

2. The recombinant bacterial cell for use according to claim 1, wherein said recombinant bacterial cell is devoid of genes capable of expressing tryptophan indole- lyase (EC 4.1.99.1).

3. The recombinant bacterial cell for use according to claim 1 or 2, wherein the AhR agonist is an indole-derivative.

4. The recombinant bacterial cell for use according to any one of claims 1-3, wherein the AhR agonist is an indole-derivative of Formula IFormula I wherein p is 0 or 1; wherein Ri is a C1-C5 hydrocarbon, preferably a C1-C2 hydrocarbon, wherein Ri is optionally substituted preferably with =0 or -OH; and wherein R2 is - COOH, -CHO, or -NH2.

5. The recombinant bacterial cell for use according to any one of claims 1-4, wherein the AhR. agonist is selected from indole-3-acetic acid, indole-3-carbaldehyde, indole-3- lactic acid, indole-3-acetaldehyde, indole-3-propionic acid, indole-3-pyruvate, 3- Indoleacrylic acid, and Tryptamine.

6. The recombinant bacterial cell for use according to any one of claims 1-5, wherein said recombinant bacterial cell comprises one or more genes encoding:(I): (a) an aspartate aminotransferase (EC 2.6.1.1);(II): (a) an aspartate aminotransferase (EC 2.6.1.1) and (b) an indole-3- pyruvate decarboxylase (EC 4.1.1.74);(HI): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3);(IV): (a) an aspartate aminotransferase (EC 2.6.1.1), (b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and (c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);(V): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105);(VI): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4);(VII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC1.2.1.3);(VIII): (i) a L-Tryptophan decarboxylase (EC 4.1.1.105) and (j) a monoamine oxidase (EC 1.4.3.4), and (c) an indole-3-acetaldehyde dehydrogenase (EC1.2.1.3), and (e) a monooxygenase (EC 1.14.-.-);(IX): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110);(X): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC4.2.1.175);(XI): (a) an aspartate aminotransferase (EC 2.6.1.1) and (d) an aromatic 2- oxoacid reductase (EC 1.1.1.110), and (f) a phenyllactyl-CoA dehydratase (EC4.2.1.175), and (g) an (aryl)acrylate reductase (EC 1.3.8.15);(XII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31); or(XIII): (h) a L-tryptophan ammonia lyase (EC 4.3.1.31) and (g) an (aryl)acrylate reductase (EC 1.3.8.15).

7. The recombinant bacterial cell for use according to any one of claims 1-6, wherein the AhR. agonist is indole-acetic acid, and wherein said recombinant bacterial cell comprises one or more genes encoding:(a) an aspartate aminotransferase (EC 2.6.1.1),(b) an indole-3-pyruvate decarboxylase (EC 4.1.1.74), and(c) an indole-3-acetaldehyde dehydrogenase (EC 1.2.1.3).

8. The recombinant bacterial cell for use according to any one of claims 1-7, wherein: a) the amino acid sequence of the aspartate aminotransferase has at least 70% sequence identity to SEQ ID NO. 2, b) the amino acid sequence of the indole-3-pyruvate decarboxylase has at least 70% sequence identity to SEQ ID NO. 10, and c) the amino acid sequence of the dehydrogenase has at least 70% sequence identity to SEQ ID NO. 18.

9. The recombinant bacterial cell for use according to any one of claims 2-8, wherein the amino acid sequence of the tryptophan indole-lyase has at least 70% sequence identity to SEQ ID NO. 62.

10. The recombinant bacterial cell for use according to any one of claims 1-9, wherein said cancer is a solid tumor cancer.

11. The recombinant bacterial cell for use according to any one of claims 1-10, wherein said bacterial cell has the property of accumulating at tumor sites.

12. The recombinant bacterial cell for use according to any one of claims 1-11, wherein said bacterial cell is a genus selected from Escherichia, Listeria, Salmonella, Bifidobacterium, Streptococcus, Lactobacillus, Fusobacterium, Corynebacterium, Sphingomonas, Paracoccus, Staphylococcus, Enterobacter, Klebsiella, Citrobacter, Roseomonas, Sphingomonas, Staphylococcus, Sphingomonas, Actinomyces, Pseudomonas, Acinetobacter, Neisseria, and Enterobacter, preferably is a strain of Escherichia coll, most preferably is Escherichia coll Nissle.

13. The recombinant bacterial cell for use according to any one of claims 1-12, wherein said recombinant bacterial cell is administered by injection, preferably intravenous, intralymphatic, intratumoral, or intraperitoneal administration.

14. A recombinant Escherichia coll cell capable of producing indole-3-acetic acid, said recombinant cell comprising:(a) a first nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3', wherein said first nucleic acid sequence encodes an aspartate aminotransferase (EC 2.

6. 1.1), and wherein the amino acid sequence of said aspartate aminotransferase (EC 2.

6. 1.1) has at least 70% sequence identity to SEQ ID NO. 2,(b) a second nucleic acid sequence operatively liked to ribosomal binding site 5' AAAGGAGAA 3', wherein said second nucleic acid sequence encodes an indole-3- pyruvate decarboxylase (EC 4.1.1.74), and wherein the amino acid sequence of said indole-3-pyruvate decarboxylase (EC 4.1.1.74) has at least 70% sequence identity to SEQ ID NO. 10, and(c) a third nucleic acid sequence operatively liked to ribosomal binding site 5' ACAGGAGGG 3', wherein said first nucleic acid sequence encodes an indole-3- acetaldehyde dehydrogenase (EC 1.

2. 1.3), and wherein said indole-3- acetaldehyde dehydrogenase (EC 1.

2. 1.3) has at least 70% sequence identity to SEQ ID NO. 18, wherein said first, second, and third nucleic acid sequences are within an operon operatively linked to promoter 5' TGCTGGACTCGTCGTAATCCTGCGTGTATAATTGGC 3' (SEQ ID NO. 63), and wherein said recombinant cell is devoid of genes capable of expressing tryptophan indole-lyase (EC 4.1.99.1).

15. A kit of parts comprising (i) the recombinant cell or compositions for use according to any one of claims 1-13 or the recombinant cell according to claim 14 and (ii) a second part selected from the group: CAR-T cells, adoptive T cells, immune checkpoint inhibitors and cancer drugs, or a combination of any thereof.

Images