Biomarker PAX5 for sepsis-related diseases and use thereof

By detecting PAX5 levels in peripheral blood immune cells, a biomarker for the early diagnosis and prognosis of sepsis is provided, solving the problem of difficulty in early diagnosis of sepsis in existing technologies and improving the accuracy of diagnosis and the timeliness of treatment.

WO2026017138A1PCT designated stage Publication Date: 2026-01-22CHENGDU CELENOV BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/109250
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-19
Filing Date
2025-07-18
Publication Date
2026-01-22

AI Technical Summary

Technical Problem

Current technologies lack specific molecular markers for early diagnosis of sepsis before organ dysfunction occurs, leading to delayed treatment and impacting patient survival rates.

Method used

By utilizing PAX5 as a biomarker, and detecting PAX5 levels in peripheral blood immune cells, we aim to develop products and methods for the early diagnosis, risk assessment, immune status evaluation, prognosis prediction, and treatment selection of sepsis.

Benefits of technology

It enables early diagnosis of sepsis when the SOFA score is below 2, improving diagnostic sensitivity and specificity, reducing the risk of patient death due to treatment delay, and demonstrating good diagnostic efficacy. ROC analysis showed that the AUC was 0.8, which exceeded the diagnostic efficacy of the commonly used clinical indicator PCT.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025109250-FTAPPB-I100001
    Figure PCTCN2025109250-FTAPPB-I100001
  • Figure PCTCN2025109250-FTAPPB-I100002
    Figure PCTCN2025109250-FTAPPB-I100002
  • Figure PCTCN2025109250-FTAPPB-I100003
    Figure PCTCN2025109250-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention relates to a biomarker PAX5 for sepsis-related diseases and a use thereof. The present invention provides a use of PAX5 or an active fragment or functional fragment thereof in the preparation of a product for early diagnosis, risk assessment, immune status evaluation, prognostic prediction and / or treatment plan selection of a sepsis-related disease in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

PAX5, a biomarker for sepsis-related diseases, and its applications

[0001] Cross-references to related applications

[0002] This application claims the benefit of Chinese patent application CN202410977801.7, filed on July 19, 2024; the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention belongs to the field of molecular diagnostics and relates to early diagnostic biomarkers for sepsis-related diseases and their uses. Specifically, it relates to the use of PAX5 as a biomarker in the preparation of products for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment of sepsis-related diseases. Background Technology

[0004] Currently, sepsis diagnosis primarily relies on clinical indicators, with the diagnostic criterion being "infection + SOFA ≥ 2". The SOFA score, or Sequential Organ Failure Assessment, is a scoring system that assesses the severity and prognosis of critically ill patients based on clinical blood biochemistry tests and clinical indicators; a higher score indicates a more severe condition. Currently, procalcitonin (PCT) is used clinically to assist in sepsis diagnosis. However, elevated PCT only indicates infection, offering good differentiation between infected and non-infected patients, but it is difficult to distinguish between common infections and sepsis. In summary, due to the lack of sepsis-specific molecular markers, clinicians struggle to make early diagnoses and screenings before organ dysfunction (SOFA ≥ 2) occurs. Early intervention is a universal principle in sepsis treatment and management. For every hour that treatment is delayed, the patient's survival rate decreases by approximately 7.6% (Ferrer, R., et al. Effectiveness of treatments for severe sepsis: a prospective, multicenter, observational study. American Journal of Respiratory and Critical Care Medicine 180, 861-866 (2009).; Kumar, A., et al. Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock. Critical Care Medicine 34, 1589-1596 (2006).). If a new molecular biomarker for sepsis can be found, allowing for early warning and diagnosis of sepsis before organ dysfunction occurs, the window for intervention can be extended, enabling patients to receive more timely treatment.

[0005] Chinese patent application CN118050527A discloses that neutrophil gelatinase-associated lipotransferase 2 or a combination of neutrophil gelatinase-associated lipotransferase 2 and matrix Gla protein can be used as protein biomarkers for diagnosing sepsis. It has high diagnostic efficacy, with an area under the curve of 0.903, and good sensitivity and specificity. It can be developed into a kit for diagnosing sepsis, which can diagnose sepsis at an early stage and enable patients to receive timely and accurate treatment.

[0006] Chinese patent application CN117965718A discloses a sepsis-related biomarker and its application. The biomarker is tiRNA-1:34-Lys-CTT-5, which can be used to prepare products for early diagnosis and / or prognostic assessment of sepsis. The product detects the expression level of tiRNA-1:34-Lys-CTT-5 in a sample for non-diagnostic purposes, thereby enabling early diagnosis and / or prognostic assessment of sepsis. tiRNA-1:34-Lys-CTT-5 has a higher diagnostic value for sepsis than inflammatory mediators such as IL-6, IL-10, and TNF-α, improving the accuracy of early diagnosis. Furthermore, it significantly improves the area under the receiver operating characteristic (ROC) curve (AUC) for assessing sepsis prognosis, helping clinicians to adjust treatment plans promptly based on this biomarker and improve patient survival rates.

[0007] There is currently a need in this field for more biomarkers or reagents for the early diagnosis of sepsis. Summary of the Invention

[0008] This invention discloses the application of PAX5 detection in peripheral blood immune cells of infected patients. It is the first discovery of differential PAX5 expression in peripheral blood immune cells between sepsis patients and healthy individuals, suggesting that this indicator can serve as a molecular marker for sepsis diagnosis. Peripheral blood is one of the most readily available clinical specimens, and detecting PAX5 levels in peripheral blood immune cells can aid in the early diagnosis of sepsis.

[0009] To achieve the above-mentioned technical objectives, the present invention proposes the following technical solution:

[0010] In a first aspect, the present invention provides the use of PAX5, or its active or functional fragments, in the preparation of products for the early diagnosis, risk assessment, immune status assessment, prognosis prediction (or assessment, judgment) and / or treatment selection of sepsis-related diseases.

[0011] In some implementations, PAX5 is used as a biomarker.

[0012] In some implementations, the early stage of sepsis-related disease is SOFA < 2.

[0013] In some implementations, the subject is diagnosed with or suspected of being infected.

[0014] In some implementations, the sepsis-related disease includes sepsis, severe sepsis, or septic shock.

[0015] In some preferred embodiments, the sepsis-related disease is sepsis.

[0016] In some embodiments, the product includes reagents, kits, and / or detection devices for determining PAX5 levels in samples from a subject.

[0017] In some implementations, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.

[0018] In some preferred embodiments, the sample is derived from the subject's bodily fluids and is selected from at least one of the following:

[0019] Blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.

[0020] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.

[0021] In some preferred embodiments, the reagent or kit is selected from or includes at least one of the following:

[0022] Primers, probes, antibodies, biochips (such as protein chips, gene chips, etc.), and small molecule compounds for the specific detection of PAX5.

[0023] In some preferred embodiments, the detection device is adapted to the method of using the reagent or kit, for example, a detection device for real-time quantitative reverse transcription PCR, microarray detection, DNA blotting, RNA blotting in situ hybridization, immunofluorescence, immunohistochemistry, or RNA blotting or in situ hybridization.

[0024] In some preferred embodiments, the reagent is directly or indirectly labeled with a detectable tag, the detectable tag being selected from at least one of the following:

[0025] Radioactive isotopes, fluorescent groups, chemiluminescent components, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions or ligands.

[0026] In some embodiments, the PAX5 is a substance selected from the group consisting of:

[0027] PAX5 gene, PAX5 mRNA, PAX5 mRNA cDNA, or PAX5 protein.

[0028] In some implementations, the PAX5 level includes the PAX5 nucleic acid molecule level and / or the PAX5 protein molecule level.

[0029] In some implementations, the object is a mammal, such as a human or a non-human primate, preferably a human.

[0030] Secondly, the present invention provides a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction (or assessment, judgment) and / or treatment selection of sepsis-related diseases in subjects, the product comprising reagents, kits and / or detection devices for detecting PAX5 levels in samples from subjects.

[0031] In some implementations, PAX5 is used as a biomarker.

[0032] In some implementations, the early stage of sepsis-related disease is SOFA < 2.

[0033] In some implementations, the subject is diagnosed with or suspected of being infected.

[0034] In some implementations, the sepsis-related disease includes sepsis, severe sepsis, or septic shock.

[0035] In some implementations, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.

[0036] In some preferred embodiments, the sample is derived from the subject's bodily fluids and is selected from at least one of the following:

[0037] Blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.

[0038] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.

[0039] In some preferred embodiments, the reagent or kit is selected from or includes at least one of the following:

[0040] Primers, probes, antibodies, biochips (such as protein chips, gene chips, etc.), and small molecule compounds for the specific detection of PAX5.

[0041] In some preferred embodiments, the detection device is adapted to the method of using the reagent or kit, for example, a detection device for real-time quantitative reverse transcription PCR, microarray detection, DNA blotting, RNA blotting in situ hybridization, immunofluorescence, immunohistochemistry, or RNA blotting or in situ hybridization.

[0042] In some preferred embodiments, the reagent is directly or indirectly labeled with a detectable tag, the detectable tag being selected from at least one of the following:

[0043] Radioactive isotopes, fluorescent groups, chemiluminescent components, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions or ligands.

[0044] In some embodiments, the PAX5 is a substance selected from the group consisting of:

[0045] PAX5 gene, PAX5 mRNA, PAX5 mRNA cDNA, or PAX5 protein.

[0046] In some implementations, the PAX5 level includes the PAX5 nucleic acid molecule level and / or the PAX5 protein molecule level.

[0047] In some implementations, the object is a mammal, such as a human or a non-human primate, preferably a human.

[0048] In some preferred embodiments, the product is a reagent kit.

[0049] In some preferred embodiments, the kit includes:

[0050] (i) Detect an effective amount of reagent used to detect PAX5 in the target sample;

[0051] (ii) Optionally, at least one substance selected from the group consisting of:

[0052] Containers or packaging, additives, solutions, buffer solutions, negative controls, positive controls, or instructions.

[0053] In some preferred embodiments, the kit includes, but is not limited to, one or more of the following: Western blot kit, enzyme-linked immunosorbent assay (ELISA) kit, radioimmunoassay (RIA) kit, radioimmunodiffusion kit, two-dimensional biphasic immunodiffusion kit, rocket immunoelectrophoresis kit, immunohistochemical staining kit, immunoprecipitation assay kit, complement fixation assay kit, fluorescence activated cell sorting (FACS) kit, aptamer chip kit, microarray kit, protein chip kit, qPCR kit, and flow cytometry kit.

[0054] Thirdly, the present invention provides a system for early diagnosis, risk assessment, immune status assessment, prognostic prediction (or assessment, judgment), and / or treatment selection of sepsis-related diseases, the system comprising:

[0055] (1) A first device for collecting and / or receiving PAX5 level data in a sample of an object;

[0056] (2) A second device for analyzing the data to evaluate the early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of the subject’s sepsis-related disease;

[0057] An elevated PAX5 level in the sample compared to normal control values ​​and / or ordinary infection values ​​indicates that the subject has sepsis-related disease, or is at risk of progressing to sepsis-related disease, or is at risk of immunosuppression, or is at risk of poor prognosis.

[0058] In some implementations, the early stage of sepsis-related disease is SOFA < 2.

[0059] In some implementations, the subject is diagnosed with or suspected of being infected.

[0060] In some implementations, the sepsis-related disease includes sepsis, severe sepsis, or septic shock.

[0061] In some implementations, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.

[0062] In some preferred embodiments, the sample is derived from the subject's bodily fluids and is selected from at least one of the following:

[0063] Blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.

[0064] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.

[0065] In some implementations, the PAX5 level includes the PAX5 nucleic acid molecule level and / or the PAX5 protein molecule level.

[0066] In some embodiments, the PAX5 is a substance selected from the group consisting of:

[0067] PAX5 gene, PAX5 mRNA, PAX5 mRNA cDNA, or PAX5 protein.

[0068] Fourthly, the present invention provides a method for early diagnosis, risk assessment, immune status assessment, prognostic prediction (or assessment, judgment), and / or treatment selection of sepsis-related diseases, the method comprising:

[0069] 1) Collect and / or process samples of the object to bring the PAX5 level to a detectable level;

[0070] 2) Detect the PAX5 level of the object using any of the aforementioned products or systems;

[0071] 3) Interpret the results and conduct predictive analysis;

[0072] An elevated PAX5 level in the sample compared to normal control values ​​and / or common infection values ​​indicates that the subject has sepsis-related disease, or is at risk of progressing to sepsis-related disease, or is at risk of immunosuppression, or is at risk of poor prognosis.

[0073] In some implementations, the early stage of sepsis-related disease is SOFA < 2.

[0074] In some implementations, the subject is diagnosed with or suspected of being infected.

[0075] In some implementations, the sepsis-related disease includes sepsis, severe sepsis, or septic shock.

[0076] In some implementations, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.

[0077] In some preferred embodiments, the sample is derived from the subject's bodily fluids and is selected from at least one of the following:

[0078] Blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.

[0079] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.

[0080] In some implementations, the PAX5 level includes the PAX5 nucleic acid molecule level and / or the PAX5 protein molecule level.

[0081] In some embodiments, the PAX5 is a substance selected from the group consisting of:

[0082] PAX5 gene, PAX5 mRNA, PAX5 mRNA cDNA, or PAX5 protein.

[0083] This invention utilizes various sequencing analysis methods, blood sample testing from clinically infected patients, and follow-up on the clinical outcomes of these patients to identify significant expression changes of the PAX5 molecule in the early stages of sepsis. This allows for differentiation between infected and non-infected patients, as well as between those with common infections and those who ultimately progress to sepsis. It holds promise as an immunomarker for the early diagnosis, immune status assessment, and prognosis of sepsis. PAX5 exhibits superior diagnostic efficacy, with an AUC of 0.8 in ROC analysis, exceeding the diagnostic efficacy of the commonly used clinical marker PCT. Therefore, the sepsis biomarker provided by this invention is of great significance for the early clinical diagnosis of sepsis and also has promising applications in the in vitro diagnostic reagent industry. Attached Figure Description

[0084] Figure 1 shows the level of PAX5 mRNA in peripheral blood immune cells of healthy volunteers, patients with common infections, and patients with sepsis detected by digital PCR.

[0085] Figure 2 shows the ROC curve analysis of the diagnostic efficacy of PAX5, demonstrating that PAX5 can effectively distinguish between patients with common infections and patients with sepsis.

[0086] Figure 3 shows the ROC curves for survival and prognosis analysis of 176 sepsis patients in the sequencing dataset E-MTAB-7581 from the Biostudies database, demonstrating that PAX5 has good predictive power (AUC = 0.8).

[0087] Figure 4 shows the Kaplan-Meier survival curves for the survival and prognosis analysis of 479 sepsis patients in the GEO database sequencing dataset GSE65682, demonstrating that the expression level of PAX5 can predict the patient's prognosis and survival.

[0088] Figure 5 shows the expression of PAX5 in peripheral blood immune cells by flow cytometry. Detailed Implementation

[0089] To make the objectives, technical solutions, and advantages of the embodiments of this disclosure clearer, the technical solutions of the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this disclosure. All other embodiments obtained by those skilled in the art based on the described embodiments of this disclosure without creative effort are within the scope of protection of this invention.

[0090] This invention may be implemented in other specific forms without departing from its essential attributes. It should be understood that, without conflict, any and all embodiments of this invention can be combined with technical features of any or more other embodiments to obtain further embodiments. This invention includes such further embodiments obtained through combinations.

[0091] All publications and patents mentioned in this disclosure are incorporated herein by reference in their entirety. In the event of any conflict between the use or terminology used in any publications and patents incorporated by reference and the use or terminology used in this disclosure, the use and terminology of this disclosure shall prevail.

[0092] The chapter titles used in this article are for organizational purposes only and should not be construed as limiting the subject matter.

[0093] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0094] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0095] As disclosed herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0096] The range of numbers used in this disclosure should be understood as including all numbers within that range. For example, the range 1 to 20 should be understood to include any number, combination of numbers, or subrange from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0097] As disclosed herein, the terms “comprises” or “comprising” mean “including, but not limited to”. This term is intended to be open-ended to specify the presence of any of the stated features, elements, integers, steps, or components, but does not exclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Therefore, the term “comprising” includes the more restrictive terms “consisting of” and “substantially consisting of”. In one embodiment, the term “comprising” as used throughout the disclosure, particularly in the claims, may be replaced by the term “consisting of”.

[0098] As indicated in this disclosure, the terms “optional,” “any,” “arbitrary,” or “any one” mean that the event or situation described below may, but does not necessarily, occur, including the circumstances in which the event or situation occurs or does not occur. As used herein, “an” and “a” refer to one or more grammatical objects.

[0099] As this disclosure illustrates, “and / or” should be understood to mean any one of the options or a combination of any two or more of the options.

[0100] As used in this disclosure, the term "sepsis-related disease" refers to a class of diseases characterized by life-threatening organ dysfunction caused by a dysregulated host response to infection, including, but not limited to, sepsis, septic shock, and severe sepsis. In some preferred embodiments, the sepsis-related disease is sepsis. For a specific definition and diagnostic criteria for sepsis, please refer to Singer M, Deutschman CS, Seymour CW, et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016; 315(8):801-810. doi:10.1001 / jama.2016.0287.

[0101] As used in this disclosure, the term "PAX5" refers to the PAX gene, a family of genes that encode paired regions of important transcription factors during human embryonic development. The PAX5 gene is a nuclear trans-transcription factor first discovered in B cells in 1989 by Barberis et al. (Barberis A, Superti-Furga G, Vitelli L, et al. Developmental and tissue-specific regulation of a novel transcription factor of the sea urchin[J]. Genes Dev. 1989, 3(5): 663-675). Located on chromosome 9p13, it encodes a B cell-specific activator protein (BSAP), which controls organogenesis and tissue differentiation (Carotta S, Holmes ML, Pridans C, et al. Pax5 maintains cellular identity by repressing gene expression throughout B cell differentiation[J]. Cell Cycle. 2006, 2452-2456.). It plays a crucial role in the early stages of B cell formation, neurogenesis, spermatogenesis, and the inhibition of osteoclast formation.

[0102] As used herein, the terms "reagent," "detection reagent," or "reagent for detecting PAX5 levels" are used interchangeably and refer to substances that are specifically targeted at the PAX5 molecule and can be used to directly or indirectly detect the presence and / or quantity of PAX5. These detection substances can detect PAX5 at the gene or protein level. Based on the sequence of the PAX5 molecule, those skilled in the art can prepare or obtain commercially available reagents specifically targeting the PAX5 molecule using conventional methods. For example, detection reagents available in this application include, but are not limited to: antibodies (preferably monoclonal antibodies) with detection specificity for the PAX5 molecule, probes, gene chips, PCR primers, gRNA, etc. Furthermore, for ease of detection, the detection reagents disclosed herein may also carry detectable markers, including but not limited to: radioisotopes, fluorophores, chemiluminescent components, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or haptens), etc. The detection reagents disclosed herein may exist in solution, immobilized on a carrier (such as a substrate or adsorbent), or in other manner conventional in the art, as long as such manner of existence is suitable for the detection of PAX5 in biological samples. For example, when the detection reagents of the present invention are nucleotide probes, they may exist in the form of a biochip (or "microarray").

[0103] The terms "product" or "detection product" as used herein are used interchangeably and refer to substances, combinations of reagents or their combined use, or auxiliary devices that include the detection of PAX5. Depending on the requirements of the detection method used, appropriate PAX5 detection substances can be selected and formulated into products suitable for the detection method, such as kits. Those skilled in the art can adjust and modify the detection method and the reagents contained in the product according to actual conditions and needs. The products disclosed herein may also include other reagents clinically used for early diagnosis, risk assessment, immune status assessment, prognostic prediction (or assessment, judgment), and / or treatment selection of sepsis-related diseases in subjects, to assist or validate the results obtained by detecting PAX5. Those skilled in the art can make routine selections according to specific needs.

[0104] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. All reagents or instruments without a specified manufacturer are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0105] Example 1: Validation of the clinical diagnostic efficacy of PAX5 in differentiating between common infections and sepsis

[0106] This invention enrolled 40 patients with common infections, 11 patients with sepsis, and 20 healthy volunteers from West China Hospital of Sichuan University as normal controls. Peripheral blood immune cells were collected from them, and the PAX5 mRNA level was analyzed by PCR.

[0107] Digital PCR was used to detect the level of PAX5 mRNA in peripheral blood immune cells of healthy volunteers (n=20), patients with common infection (n=40), and patients with sepsis (n=11). Differences between groups were compared using a one-way ANOVA test, and the Mann-Whitney u test was used to compare the common infection group and the sepsis group alone (p<0.0001) (Figure 1).

[0108] Digital PCR was used to detect the absolute expression level of PAX5 in the peripheral blood of patients: the absolute copy number of the gene mRNA was detected using a Bio-Rad QX200 ddPCR instrument. The QX200 ddPCR system mainly uses microfluidic technology to achieve large-scale partitioning of the sample to be tested, with each sample being prepared into approximately 20,000 nanometer-sized droplets before detection. The specific steps are as follows:

[0109] (1) Extraction of total RNA.

[0110] Peripheral blood from patients was collected using EDTA-containing anticoagulant tubes and lysed overnight (-80°C) with an appropriate volume of Trizol in an enzyme-free environment or on ice for 30 minutes.

[0111] Melt the lysed blood at room temperature, invert and mix well, then let it stand at room temperature for 10 minutes. Add 1 / 5 of the sample volume (approximately 200 μL) of chloroform. Vortex mix for 30 seconds, let stand for 5 minutes, and you will observe a pinkish color in the lower layer and a colorless upper layer.

[0112] Centrifuge at 4°C: 12000g, 20 minutes.

[0113] After centrifugation, the sample was clearly divided into three layers: pinkish miscellaneous proteins in the bottom layer, white DNA in the middle layer, and RNA in the top colorless aqueous layer; the RNA was carefully aspirated into a new enzyme-free tube.

[0114] Add an equal volume of isopropanol, mix it with the RNA, and transfer the mixture to -20°C. Wait for the RNA to precipitate (about 1-2 hours). After centrifuging at 12000g for 10 minutes at 4°C, white, lumpy RNA precipitate will be visible at the bottom of the tube.

[0115] Remove the supernatant and resuspend the RNA in the precipitate by adding the prepared DEPC (ethanol:DEPC = 3:1);

[0116] Centrifuge at 4°C, 12000g, for 5 minutes, repeat twice.

[0117] After washing away the supernatant, the RNA was air-dried in a fume hood until the precipitate became colorless and transparent. Then, 30 μL of enzyme-free water was added, and the mixture was thoroughly mixed. The RNA concentration was then measured using a Thermo Scientific Nanodrop.

[0118] Reverse transcription. Genomic DNA removal: Add 1 μg of qualified RNA to the following reaction system, gently mix with a pipette, then transfer the prepared reaction mixture to a metal bath and react at 42°C for 2 minutes.

[0119] Table 1 Genome Removal Reaction System

[0120] Remove the mixture from the metal bath after the above reaction is complete, and then prepare the reverse transcription reaction system according to the grouping in the table below. After completion, place the mixture in a PCR instrument for reverse transcription. The reverse transcription program is: 37°C, 15 minutes; 85°C, 2 minutes; 4°C incubation.

[0121] Table 2 Reverse Transcription Reaction System

[0122] (3) After reverse transcription is complete, dilute the resulting cDNA to approximately 0.2 ng / μL RNA equivalent and prepare the ddPCR reaction system for the gene to be tested: 1 μL cDNA template, Bio-rad QX200™ ddPCR™ 10 μL of enzyme premixed reaction solution and 0.8 μL of primers (0.4 μL each of forward and reverse primers) were added to a final volume of 20 μL with water. The primer sequences for PAX5 involved in this invention are: PAX5-F: ACTTGCTCATCAAGGTGTCAG (SEQ ID NO:1); PAX5-R: TCCTCCAATTACCCCAGGCTT (SEQ ID NO:2).

[0123] The scatter bar chart results showed that the PAX5 mRNA level in patients with common infections was significantly lower than that in healthy controls; while the PAX5 mRNA level in patients with sepsis was significantly lower than that in patients with common infections (p<0.0001) (Figure 1).

[0124] Receiver operating characteristic (ROC) analysis of the diagnostic efficacy of PAX5 showed that the area under the curve (AUC) was 0.9524 in the common infection group compared with the sepsis group, indicating that PAX5 mRNA level has high diagnostic efficacy in differentiating between sepsis and common infection (p<0.0001) (Figure 2).

[0125] The results show that PAX5, as a novel biomarker, can effectively distinguish between sepsis and common infections, and is expected to be applied in clinical practice to differentiate and diagnose patients with common infections and sepsis.

[0126] Example 2: Receiver Operating Curve (ROC) and Kaplan-Meier Survival Curve Evaluation of PAX5's Predictive Power for Sepsis Patients

[0127] This invention analyzes the sequencing dataset E-MTAB-7581 (https: / / www.ebi.ac.uk / biostudies / arrayexpress / studies?query=E-MTAB-7581) from the Biostudies database, which contains data from 176 sepsis patients. PAX5 expression and clinical outcome information were collected, and receiver operating characteristic (ROC) curve analysis was performed. The ROC curve was plotted by calculating the sensitivity, specificity, and false positive rate (1-specificity) at all cutoff points. Sensitivity was plotted on the ordinate (true positive rate) and (1-specificity) on the x-axis (false positive rate), creating the ROC curve. The area under the curve (AUC) reflects the diagnostic value; a larger AUC, closer to 1.0, indicates better diagnostic efficacy and higher accuracy; a AUC closer to 0.5 indicates lower diagnostic efficacy; and an AUC of 0.5 indicates no diagnostic value. On the ROC curve, the point at the upper left corner of the curve is often selected as the optimal cutoff point, at which the sensitivity and specificity are relatively optimal. The ROC results show that the area under the curve (AUC) is 0.8, the sensitivity is 0.878, the specificity is 0.628, and the optimal cutoff value is 4.845, indicating good accuracy and clinical application value (Figure 3).

[0128] This invention analyzed the sequencing dataset GSE65682 from the public GEO database (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE65682) containing clinical prognostic information from 479 sepsis patients. PAX5 expression and clinical outcome information were collected, and Kaplan-Meier survival curve analysis was performed. Kaplan-Meier survival curves are primarily used to analyze the impact of a single factor on survival, estimate patient survival rates, and plot survival curves. The survival curve is a continuous step-shaped curve plotted with survival time on the horizontal axis and survival rate on the vertical axis, illustrating the relationship between survival time and survival rate. In medicine and biology, Kaplan-Meier survival curves are commonly used to assess disease prognosis and treatment effectiveness. The analysis showed that PAX5 expression was significantly correlated with the survival of sepsis patients (Figure 4). Kaplan-Meier survival curves were used to analyze the prognostic value of PAX5 for sepsis patients in the GSE65682 dataset. The results showed that PAX5 expression was significantly associated with the survival rate of sepsis patients (p = 0.0017) (Figure 4).

[0129] Example 3: Flow cytometry detection and verification of PAX5

[0130] 5.1: Flow cytometry detection to verify PAX5

[0131] The invention was further validated using flow cytometry, which revealed that the PAX5 protein level in peripheral blood immune cells was significantly lower in the sepsis group compared to the healthy control group. This suggests that detecting the PAX5 protein level in peripheral blood immune cells can also be used for the diagnosis of sepsis (Figure 5).

[0132] 5.1.1: Construction of animal models

[0133] All wild-type C57 mice (SPF grade) used in this invention were purchased from Beijing Huafukang Biotechnology Co., Ltd., with an age range of 7-8 weeks and a weight range of 20g-25g. All purchased mice underwent a one-week acclimatization period at the Experimental Animal Center of the Frontier Medical Research Center, West China Hospital, Sichuan University. The rearing room was well-ventilated, with humidity at 50%-60%, and the room temperature controlled at approximately 26℃. Day and night cycles were alternated, each lasting 12 hours. Mice were fed standard feed and had free access to water. Experiments were conducted after the one-week acclimatization period.

[0134] Construction of a severe infection (sepsis) model (designated as the sepsis group): 6-8 week old C57 black mice were selected. The mice were anesthetized with sodium pentobarbital. The abdomen of the mice was prepared with a shaving tool. After disinfection with iodine, the mice were opened under aseptic conditions. A small incision was made 0.5 cm to the left of the midline of the abdomen. The cecum was separated with surgical forceps (curved forceps) and gently removed. Then, a sterile No. 4 suture was used to ligate the cecum 0.75 cm from the cecum end. Then, an 18-gauge needle was used to puncture the cecum once. After that, the cecum was put back into the abdominal cavity. The muscle layer and the outer skin layer of the mice were sutured. After disinfection with iodine, the mice were put back into the breeding cage for observation.

[0135] The healthy sham surgery group (referred to as the control group) served as the control: the left and right operations before laparotomy were the same as those of the mild / severe model. After laparotomy to find the cecum, it was not ligated or punctured, but gently placed back into the abdominal cavity. The muscle layer and outer skin layer of the mouse were sutured, and after disinfection with iodine, it was put back into the breeding cage for observation.

[0136] Immediately after modeling, all mice were subcutaneously injected with 800 μL of physiological saline for fluid rewarming, and 20 mg / kg of ciprofloxacin was injected intramuscularly into the inner thigh.

[0137] 5.1.2 Flow cytometry verification of PAX5 expression:

[0138] (1) A sepsis model was established using the above animal modeling method, with the sham-operated group as a healthy control.

[0139] (2) Collect 50 μL of mouse peripheral blood into a K3EDTA blood anticoagulant tube and mix by inverting.

[0140] (3) Add flow cytometry antibodies for all genes to be tested according to the instructions (generally 2.5 μL / test): CD45 (brand: BD Pharmaceuticals) TM Since there is no direct-labeled flow cytometry antibody for PAX5, the primary antibody selected in this invention is PAX5 (brand: Invitrogen; catalog number: PA1-109), along with DyLight 488 goat anti-rabbit IgG secondary antibody (catalog number 35552). The antibody was then incubated at room temperature (20°C) in the dark for 15 minutes.

[0141] (4) Add 450 μL of 1×FACs hemolysin to the counting tube and lyse it at room temperature (20℃) in the dark for 15 minutes to fully lyse the red blood cells.

[0142] (5) For flow cytometer detection, the sample does not need to be washed. Add DapI to the flow cytometer 5 minutes before the cell liveness and death staining, and then it can be used on the instrument.

[0143] (6) Results Analysis

[0144] The FAC file from the flow cytometer was analyzed using Fiowjo 10.0.

[0145] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. Use of PAX5 or an active fragment, a functional fragment thereof in the preparation of a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject; Preferably, said PAX5 is used as a biomarker; Preferably, said sepsis-related disease is in early stage, SOFA < 2; and / or, said subject is confirmed infected or suspected infected; Preferably, said sepsis-related disease comprises sepsis, severe sepsis or septic shock, more preferably sepsis; Preferably, said product comprises reagents, kits and / or detection devices for determining PAX5 level in a sample from a subject; Preferably, said sample is from a body fluid, cells, tissues, metabolites and / or excreta of a subject; Preferably, said sample is from a body fluid of a subject, selected from at least one of: blood, plasma, extracellular fluid, interstitial fluid, lymph or cerebrospinal fluid; More preferably, said sample is from blood of a subject; Most preferably, said sample is from peripheral blood of a subject.

2. Use according to claim 1, characterized in that, Said reagents, kits are selected from or comprise at least one of: primers, probes, antibodies, biochips or small molecule compounds specific for detecting PAX5; and / or, said detection devices are adapted to the method of use of said reagents or kits, for example: detection devices for real-time quantitative reverse transcription PCR, biochip detection method, Southern blotting method, Northern blotting method in situ hybridization method, immunofluorescence method, immunohistochemical method, or Northern blotting method or in situ hybridization method; and / or, said reagents are directly or indirectly labeled with a detectable label selected from at least one of: radioisotope, fluorescent group, chemiluminescent moiety, enzyme, enzyme substrate, enzyme cofactor, enzyme inhibitor, dye, metal ion or ligand.

3. Use according to any one of claims 1-2, characterized in that, Said PAX5 is selected from the group consisting of: PAX5 gene, PAX5 mRNA, cDNA of PAX5 mRNA or PAX5 protein; and / or, said PAX5 level comprises PAX5 nucleic acid molecule level and / or PAX5 protein molecule level.

4. A product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, Said product comprises reagents, kits and / or detection devices for detecting PAX5 level in a sample from a subject; Preferably, said PAX5 level comprises PAX5 nucleic acid molecule level and / or PAX5 protein molecule level; Preferably, said sepsis-related disease is in early stage, SOFA < 2; and / or, said subject is confirmed infected or suspected infected; Preferably, said sepsis-related disease comprises sepsis, severe sepsis or septic shock, more preferably sepsis; Preferably, said sample is from a body fluid, cells, tissues, metabolites and / or excreta of a subject; Preferably, said sample is from a body fluid of a subject, selected from at least one of: blood, plasma, extracellular fluid, interstitial fluid, lymph or cerebrospinal fluid; More preferably, said sample is from blood of a subject; Most preferably, said sample is from peripheral blood of a subject.

5. The product of claim 4, wherein, Said reagents, kits are selected from or comprise at least one of: primers, probes, antibodies, biochips or small molecule compounds specific for detecting PAX5 level; Preferably, the agent is directly or indirectly labeled with a detectable label selected from at least one of: a radioisotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion, or a ligand.

6. The product according to claim 4 or 5, characterized in that, The PAX5 is a substance selected from the group consisting of: a PAX5 gene, a PAX5 mRNA, a cDNA of a PAX5 mRNA, or a PAX5 protein.

7. The product of claim 6, wherein, The product is a kit comprising: (i) a detection-effective amount of an agent for detecting PAX5 in a subject sample; (ii) optionally, at least one substance selected from the group consisting of: a container or package, an adjuvant, a solution, a buffer, a negative control, a positive control, or an instruction; Preferably, the kit comprises one or more of a Western blot kit, an enzyme-linked immunosorbent assay kit, a radioimmunoassay kit, a radioimmunodiffusion kit, a two-dimensional double immunodiffusion kit, a rocket immunoelectrophoresis kit, an immunohistochemical staining kit, an immunoprecipitation assay kit, a complement fixation assay kit, a fluorescence-activated cell sorting kit, an aptamer chip kit, a microarray kit, a protein chip kit, a qPCR kit, a flow cytometry analysis kit.

8. A system for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, The system comprises: (1) a first device for collecting and / or receiving PAX5 level data in a subject sample; (2) a second device for analyzing the data to assess early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment regimen selection of a sepsis-related disease in the subject; wherein an elevated PAX5 level in the sample compared to a normal control value and / or a common infection value indicates that the subject is suffering from a sepsis-related disease, or is at risk of developing a sepsis-related disease, or is at risk of immune suppression, or is at risk of a poor prognosis condition; Preferably, the early stage of the sepsis-related disease is SOFA < 2; and / or, the subject is confirmed to be infected or suspected to be infected; Preferably, the sepsis-related disease comprises sepsis, severe sepsis, or septic shock, more preferably sepsis; Preferably, the sample is from a body fluid, cells, tissues, metabolites, and / or excreta of the subject; Preferably, the sample is from a body fluid of the subject, selected from at least one of: blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid; More preferably, the sample is from blood of the subject; Most preferably, the sample is from peripheral blood of the subject.

9. The system of claim 8, wherein, The PAX5 level comprises a PAX5 nucleic acid molecule level and / or a PAX5 protein molecule level.

10. The system of claim 9, wherein, The PAX5 is a substance selected from the group consisting of: a PAX5 gene, a PAX5 mRNA, a cDNA of a PAX5 mRNA, or a PAX5 protein.