Method of metal sulfide bioleaching with acidithiobacillus ferrooxidans

Abstract

A method to increase bioleaching efficiency comprising contacting a modified Acidithiobacillus ferrooxidans with pyrite, chalcopyrite or combination thereof, wherein the bioleaching efficiency is increased as compared to a wild type Acidithiobacillus ferrooxidans. The modified Acidithiobacillus ferrooxidans can comprises one or more mutations in the petB2 gene (in petll operon) and / or the petBl gene (in petl operon) of A. ferrooxidans so as to knock down or knock out expression of petB2 or petB 1. Considering that the dPetB2 cells can still oxidize sulfur, these cells can overcome restricted chalcopyrite bioleaching through accelerated iron oxidation, while maintaining levels of sulfur oxidation. This advantage can be reinforced by the reduced formation ofjarosite. An increase in the contribution of the non-contact iron oxidation over the direct contact oxidation mechanism can enhance the bioleaching of iron sulfide ores.

Description

[0001] Attorney’s Docket No.105067-101 Method of Metal Sulfide Bioleaching with Acidithiobacillus ferrooxidans CROSS REFERENCE TO RELATED APPLICATION(S) This application claims the benefit of U.S. Provisional Application No.63 / 671,661, filed July 15, 2024, which is incorporated by reference as if disclosed herein in its entirety. STATEMENT OF GOVERNMENT SUPPORT This invention was made with government support under DE-AR0001340 awarded by the U.S. Department of Energy. The government has certain rights in the invention. INCORPORATION OF SEQUENCE LISTING The contents of the text file named “Sequences_final.xml”, which was created on July 10, 2025 and is 69.0 KB is size, are hereby incorporated by reference in their entireties. BACKGROUND Bioleaching, or biomining is a process that extracts valuable metal from low-grade ore using microorganisms such as bacteria. Acidithiobacillus ferrooxidans is an iron-oxidizing chemolithotroph that plays a key role in industrial metal bioleaching or biomining. Despite increasing scientific and industrial interest in this organism, their unusual physiological traits and growth conditions make it difficult to use this strain. Additionally, genetic engineering of A. ferrooxidans has not been successful due to low transformation and recombination efficiencies. SUMMARY The acidophilic chemolithoautotroph Acidithiobacillus ferrooxidans plays an important role in biogeochemical iron and sulfur cycling and is a member of the microbial consortia used in industrial hydrometallurgical processing of copper and gold. Metal sulfide bioleaching is catalyzed by the regeneration of ferric iron and acid by cells adhered in biofilms or through non- contact interactions. However, bioleaching of chalcopyrite, the dominant unmined form of copper on Earth, is generally slow and incomplete due to surface passivation. Here, we report the implementation of CRISPR interference (CRISPRi) using the catalytically inactive Cas12a (dCas12a) in A. ferrooxidans to knockdown the expression of genes in the petI and petII operons. These operons encode bc1complex proteins and knockdown of these genes enabled the manipulation (enhancement or repression) of iron oxidation, which is normally inhibited by the presence of sulfur. The petB2 gene knockdown strain demonstrated enhanced pyrite and chalcopyrite oxidation, which correlated with reduced biofilm formation and decreased surface passivation. These findings highlight the utility of CRISPRi / dCas12a technology for engineering A. ferrooxidans while unveiling a new strategy to manipulate and improve bioleaching efficiency, Attorney’s Docket No.105067-101 with potential applications in environmentally sustainable and economically significant metal processing. Provided herein is a method of metal sulfide bioleaching by Acidithiobacillus ferrooxidans via gene silencing using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated gene (Cas). CRISPR / Cas is a microbial adaptive immune system which is used to defend against infections and widely used gene-editing tools in many cells due to high efficiency and ease. Furthermore, CRISPR interference (CRISPRi) uses a catalytically inactive (nuclease-deficient) Cas protein to silence target genes, enabling to study the functional role of the gene. Acidithiobacillus ferrooxidans is iron- and sulfur-oxidizing acidophiles which plays an important role in bioleaching or biomining. We recently developed a new pJRD vector carrying DNase-Deactivated Francisella tularensis Cas12a (ddCas12a), which is applicable to A. ferrooxidans, for the first time. Applications of CRISPR(i) are very limited in extremophiles, including acidophilic bacteria, and Cas12a has not been applied and studied in A. ferrooxidans, up to date. This invention includes the application of the CRISPRi using the developed ddCas12a to the bioleaching of lowgrade metal sulfides with A. ferrooxidans. During the growth and metabolism, A. ferrooxidans prioritizes to use sulfur over iron, due to the higher energy density of sulfur. This can inhibit iron oxidation under the conditions where sulfur is abundant, such as sulfidic ores. In A. ferrooxidans (ATCC 23270), electron transport chain bc1 complex has an important role in iron and sulfur oxidation, as this complex catalyzes the electron transfer from a low-potential quinol to high-potential cytochrome c. And two operons of petI and petII encode two distinct bc1 complexes which are expressed under iron-rich (petI) and sulfur-rich (petII) conditions, respectively. Since the petB2 gene (in petII operon) and petB1 gene (in petI operon) were the most expressed genes in A. ferrooxidans under the growth of sulfur or iron, respectively, we chose both genes as knockdown targets with our ddCas12a system. The knockdown cells (dPetB2 and dPetB1) were applied to the bioleaching of pyrite (FeS2) and chalcopyrite (CuFeS2), which is considered the most abundant but recalcitrant copper sulfide is known for low leaching due to rapid surface passivation. While the dPetB1 cells showed comparable or lower bioleaching of both minerals as compared to the wild type cells, the dPetB2 cells showed significantly higher bioleaching efficiency. The dPetB2 cells achieved 35% and 68% of final iron and copper bioleaching efficiency from pyrite and chalcopyrite, respectively, at the end of experiment. Furthermore, less jarosite, which is main cause of surface passivation during the (chalco)pyrite leaching, was detected in the mineral residues with dPetB2 cells. These results indicate that the knockdown of Attorney’s Docket No.105067-101 petB2 gene, which silences a major sulfur oxidation pathway, enabled less surface passivation, and thereby enhanced bioleaching efficiency of both iron sulfidic minerals. Particularly, the final chalcopyrite bioleaching efficiency achieved by the dPetB2 cells was the highest number among the reported values in the literatures, without any additives. The enhanced copper extraction from chalcopyrite by regulating gene expression in A. ferrooxidans in this study provides a novel strategy to deal with industrially and economically important primary mineral. BRIEF DESCRIPTION OF THE FIGURES Embodiments of the invention are described below with reference to the following accompanying drawings. FIG.1. Overview of iron and sulfur oxidation proteins and electron transport pathways of A. ferrooxidans. (A) Protein complexes implicated in iron and sulfur oxidation, (B) structural diagram of the bc1 complex, and (C) electron fluxes that occur during iron and sulfur oxidation under different conditions. In Panel B, an electron is serially transferred to Rieske iron-sulfur protein (PetA, Uniprot identification Q93A06) and cytochrome c1 (PetC, Uniprot identification Q93A10), as ubiquinol is oxidized at Qo site. Simultaneously, another electron travels back across the membrane through cytochrome b (PetB, Uniprot identification Q9KIW3), contributing the reduction of quinone at Qisite. In Panel C, the electrons from the oxidation of iron and RISCs are transmitted either to reduce O2 or NAD+via electron carrier proteins, in the presence of iron (blue), iron and low sulfur (0.1%, w / v) (red), and iron and high sulfur (0.5%, w / v) (black, hypothetical). During iron oxidation, approximately 95% of electrons are transported to downhill pathway (Cyc2 → Rusticyanin (Rus) → Cyc1 → aa3 oxidase) and 5% of electrons are passed uphill pathway (Cyc2 → Rus → CycA1 → bc1 complex (encoded by petI operon)→ Quinone pool (Q pool) → NADH hydrogenase (NDH)). During sulfur oxidation, the electrons are directly transmitted to enzymes (Q pool → bc1 complex (encoded by petII operon) → (Hipip and CycA2) → aa3 oxidase), or bd / bo3 complexes), or directly to NDH for NAD+reduction. Arrows with dashed or X marks indicate lower or inhibited electron flows, respectively. Abbreviations: OM, outer-membrane; IM, inner-membrane; Qo, quinone oxidation site; Qi, quinol-reduction site. FIG. 2. gRNA design for dCas12a CRISPRi in A. ferrooxidans. (A) A schematic diagramof the dCas12a system constructed in the pJRD215 vector. The catalytically active FnCas12a and the J23119 promoter up to the first direct repeat sequences were amplified from pFnCpf1_min, followed by inactivation of Cas12a and insertion of spacers, then cloned onto pJRD215 vector with rrnB terminator. The FnCas12 was made catalytically inactive by D917A / E1006A mutations (dCas12a), and the expression of the designed dCas12a system is controlled by tac promoter. (B) Different designs of dCas12a arrays with one target spacers with different sequences (placY1 and Attorney’s Docket No.105067-101 placY2), and two target spacers (placY3). (C) Predicted secondary structures of the different ddCas12 designs with placY1, placY2, and placY3 formulated by NUPACK webserver (http: / / www. nupack. org / ). The free energy of secondary structure was estimated. (D) Growth of E. coli cells (lacY1, lacY2, and lacY3) transformed with placY1, placY2, and placY3 plasmids, respectively, under lactose, in terms of OD600. Error bars indicate the standard deviations of triplicated analyses. Symbols indicate statistical significance (p < 0.05): *, compared to lacY1; #, compared to lacY2; †, compared to lacY3. FIG. 3. Sulfur and iron oxidations under high sulfur conditions. Profiles of sulfateproduction and Fe2+consumption of the wild type (WT) and engineered A. ferrooxidans with knockdown petA2 (dPetA2) and petB2 (dPetB2) genes (A and B), and petA1 (dPetA1) and petB1 (dPetB1) genes (C and D), under high sulfur conditions (0.5% S, w / v) over time. Error bar indicates the standard deviations of triplicate analyses. Symbols indicate statistical significance (p < 0.05): *, compared to WT; #, compared to dPetA2 (for A and B) or dPetA1 (for C and D); †, compared to dPetB2 (for A and B) or dPetB1 (for C and D). FIG. 4. Sulfur and iron oxidations under low sulfur conditions. Profiles of sulfate production and Fe2+consumption of the wild type (WT) and engineered A. ferrooxidans with knockdown petA2 (dPetA2) and petB2 (dPetB2) genes (A and B), and petA1 (dPetA1) and petB1 (dPetB1) genes (C and D), under low sulfur conditions (0.1% S, w / v) over time. Error bar indicates the standard deviations of triplicate analyses. Symbols indicate statistical significance (p < 0.05): *, compared to WT; #, compared to dPetA2 (for A and B) or dPetA1 (for C and D); †, compared to dPetB2 (for A and B) or dPetB1 (for C and D). FIG. 5. Effects of petB2 knockdown on bioleaching efficiency. (A) Iron leachingefficiency from pyrite (FeS2) and (B) copper leaching efficiency from chalcopyrite (CuFeS2) of the wild type (WT) and engineered A. ferrooxidans with knockdown petB2 (dPetB2) and petB1 (dPetB1) genes. (C) Quantification of planktonic cells of both wild type and engineered cells present in the solutions, and biofilm formation measured from the mineral residues after bioleaching. (D) Transcriptional expressions of the genes responsible for biofilm formation by A. ferrooxidans, including quorum sensing (QS), extracellular polymeric substance (EPS) precursors, and cyclic-di-GMP (c-di-GMP). (E) Copper leaching efficiency from chalcopyrite with the WT cells without (WT) or with removal of sulfur intermediates via periodic replacement of leaching media (WT – S intermediates), and (F) the addition of sulfur intermediates (thiosulfate and tetrathionate, WT + S intermediates) (* indicates the statistical significance (p < 0.05) compared to the control). Error bars indicate the standard deviations of at least triplicates analyses. Attorney’s Docket No.105067-101 Symbols indicate the statistical significance (p < 0.05) compared to the wild type (*) and dPetB1 cells (#), unless otherwise noted. FIG. 6. Proposed impacts of petB2 knockdown on phenotypic shifts of A. ferrooxidansand mechanistic consequences during bioleaching. The observed phenotypic responses during thegrowth and bioleaching, in terms of substrate utilizations, cell localizations, and dominant bioleaching mechanisms, which were triggered by down-regulation of petB2 gene expression are depicted. Fig.7 Iron oxidations during the growth without sulfur. Fe2+consumption of the wild type (WT) and engineered A. ferrooxidans to knockdown petA2 (dPetA2) and petB2 (dPetB2) genes, in the absence of sulfur over time. Error bar indicates the standard deviations of triplicate analyses. Fe2+consumption of the wild type (WT) and engineered A. ferrooxidans to knockdown petA1 (dPetA1), petB1 (dPetB1), petA2 (dPetA2), and petB2 (dPetB2) genes, in the absence of sulfur over time. Error bar indicates the standard deviations of triplicate analyses. Symbols indicate statistical significances of the data for dPetA1 and dPetB1 cells compared to the WT(*), dPetA2 (#), and dPetB2 (†) cells. Fig. 8 Characterization of mineral residues produced after bioleaching of pyrite and chalcopyrite. The solid residues generated during the bioleaching of pyrite (A) and chalcopyrite (B) by the wild type (WT) and engineered A. ferrooxidans to knockdown petB1 (dPetB1) and petB2 (dPetB2) genes were analyzed by XRD. Abbreviations: J, jarosite; P, pyrite; S, sulfur; Cp, chalcopyrite. Fig. 9 Elemental peak corresponding to carbon detected in mineral residues after bioleaching of pyrite and chalcopyrite. After bioleaching of bioleaching experiments of pyrite and chalcopyrite with the wild type (WT) and engineered A. ferrooxidans to knockdown petB1 (dPetB1) and petB2 (dPetB2) genes, the solid residues were subjected to SEM-EDS analysis. Carbon composition of each specimen is shown with standard deviations of triplicate analyses. DETAILED DESCRIPTION Provided herein are compositions and methods for a gene silencing system for Acidithiobacillus ferrooxidans using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated gene (Cas). CRISPR / Cas is a microbial adaptive immune system which is used to defend against foreign infections and widely found in many prokaryotes. As CRISPR / Cas enables multiple gene manipulations with high efficiency and ease, it is considered as a powerful gene-editing tool in many cells. Definitions Attorney’s Docket No.105067-101 References in the specification to "one embodiment," "an embodiment," etc., indicate that the embodiment described may include a particular aspect, feature, structure, moiety, or characteristic, but not every embodiment necessarily includes that aspect, feature, structure, moiety, or characteristic. Moreover, such phrases may, but do not necessarily, refer to the same embodiment referred to in other portions of the specification. Further, when a particular aspect, feature, structure, moiety, or characteristic is described in connection with an embodiment, it is within the knowledge of one skilled in the art to affect or connect such aspect, feature, structure, moiety, or characteristic with other embodiments, whether or not explicitly described. The singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a compound" includes a plurality of such compounds, so that a compound X includes a plurality of compounds X. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for the use of exclusive terminology, such as "solely," "only," and the like, in connection with any element described herein, and / or the recitation of claim elements or use of "negative" limitations. The term "and / or" means any one of the items, any combination of the items, or all of the items with which this term is associated. The phrase "one or more" is readily understood by one of skill in the art, particularly when read in context of its usage. For example, one or more substituents on a phenyl ring refers to one to five, or one to four, for example if the phenyl ring is di-substituted. As used herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating a listing of items, “and / or” or “or” shall be interpreted as being inclusive, e.g., the inclusion of at least one, but also including more than one of a number of items, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” As used herein, the terms “including,” “includes,” “having,” “has,” “with,” or variants thereof, are intended to be inclusive similar to the term “comprising.” The term "about" can refer to a variation of ± 5%, ± 10%, ± 20%, or ± 25% of the value specified. For example, "about 50" percent can in some embodiments carry a variation from 45 to 55 percent. For integer ranges, the term "about" can include one or two integers greater than and / or Attorney’s Docket No.105067-101 less than a recited integer at each end of the range. Unless indicated otherwise herein, the term "about" is intended to include values, e.g., weight percentages, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment. The term about can also modify the endpoints of a recited range as discuss above in this paragraph. Throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub- ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. The term “expression” includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion. The term “expression vector” means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression. The term “operably linked” means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence. Acidithiobacillus ferrooxidans Described herein are methods and editing systems for genetic modification of Acidithiobacillus ferrooxidans (available for example from the American Type culture Collection as strain ATCC 19859, ATCC 23270, or strain ATCC 33020). As illustrated herein, use of Cas12a or a modified Cas12a enzyme that is less active provides improved genomic editing of Acidithiobacillus ferrooxidans. CRISPR / Cas The iron- and / or sulfur-oxidizing Acidithiobacillus ferrooxidans is a well-studied acidophile which plays a role in industrial metal bioleaching or biomining. Despite increasing scientific and industrial interest in this organism, their unusual physiological traits have hampered the development of genetic tools applicable to this organism. Although an uncharacterized type Attorney’s Docket No.105067-101 IV CRISPR / Cas system has been identified in A. ferrooxidans ATCC23270, application of this endogenous or other well-established CRISPR / Cas systems in A. ferrooxidans has been difficult. Provided herein is the development of a vector carrying Cpf1 (Cas12a, a subtype of Cas12 proteins) originated from Francisella tularensis, which is a single RNA-guided endonuclease of class II CRISPR system (Cas12a can also originate from Francisella novicida, Acidaminococcus sp., Lachnospiraceae sp., Prevotella sp.). Although Cas9 has been used in several bacteria, recent literature has revealed that it is hard to deploy in a variety of bacteria and even has adverse effects in E. coli. The high GC content of A. ferrooxidans genomes likely increases non-specific binding of NGG PAM site, further rendering Cas9 incompatible for use. Thus, Cas12 is becoming an alternative to Cas9 with advantages of having its own RNA processing capability, and thereby allowing simpler guide RNA (gRNA) sequences to be used. There are several additional reasons why Cas12a or modified forms of Cas12a are particularly useful for editing Acidithiobacillus ferrooxidans. Cas9 requires additional 80- nucleotide-long tracrRNA (trans-activating CRISPR RNA) to process crRNA (CRISPR RNA), whereas Cas12a only needs a 20-nucleotide direct repeat sequence preceding the crRNA. Simpler guide RNA (gRNA) sequences can therefore be used with Cas12a nucleases. Because Cas12a can process maturation of crRNA arrays itself, use of Cas12a systems do not require other RNase activities. Such self-processing of crRNA arrays by Cas12a facilitates multiplexed genome editing at high efficiencies. CRISPR / Cas systems include protospacer adjacent motifs (PAM) that are short DNA sequences (usually 2-6 base pairs in length) near the DNA region targeted for cleavage by a CRISPR system. Cas9 recognizes a G-rich PAM sequence (5’-NGG, where N can be any of four nucleotides). On the other hand, Cas12a binds T-rich PAM sites (5’TTTN). The unique PAM sequences of Cas12a systems significantly increase the on-target editing efficiency of Cas12a in high GC-content Acidithiobacillus ferrooxidans genomes (compared to Cas9 systems), due to the lower chance of the Cas12a system misreading the PAM sequences in the high GC genome. Following recognition of a PAM site, Cas9 cleaves target DNA upstream sequence at proximal position of the PAM, while the DNA repair system (for genome editing) usually destroys the PAM site because of the close proximity. This prevents future genome editing and Cas9 re- targeting. However, Cas12a cleaves the target DNA 18-23 nucleotides downstream of the PAM site. Thus, when using Cas12a editing systems, the PAM sites will remain available after DNA editing, which enables repeated cleavage events and thus improving the on-target editing efficiency. A further drawback of Cas9 is its toxicity in different bacteria. Attorney’s Docket No.105067-101 The editing compositions and methods described herein involve use of Cas12 as an alternative to other Cas nucleases, including Cas9. For example, a sequence of a Francisella tularensis subsp. novicida FTG type V CRISPR- associated protein Cas12a / Cpf1 is shown below (NCBI NZ_DS995364.1; SEQ ID NO:1). 1 MSIYQEFVNK YSLSKTLRFE LIPQGKTLEN IKARGLILDD 41 EKRAKDYKKA KQIIDKYHQF FIEEILSSVC ISEDLLQNYS 81 DVYFKLKKSD DDNLQKDFKS AKDTIKKQIS KYINDSEKFK 121 NLFNQNLIDA KKGQESDLIL WLKQSKDNGI ELFKANSDIT 161 DIDEALEIIK SFKGWTTYFK GFHENRKNVY SSNDIPTSII 201 YRIVDDNLPK FLENKAKYES LKDKAPEAIN YEQIKKDLAE 241 ELTFDIDYKT SEVNQRVFSL DEVFEIANFN NYLNQSGITK 281 FNTIIGGKFV NGENTKRKGI NEYINLYSQQ INDKTLKKYK 321 MSVLFKQILS DTESKSFVID KLEDDSDVVT TMQSFYEQIA 361 AFKTVEEKSI KETLSLLFDD LKAQKLDLSK IYFKNDKSLT 401 DLSQQVFDDY SVIGTAVLEY ITQQVAPKNL DNPSKKEQDL 441 IAKKTEKAKY LSLETIKLAL EEFNKHRDID KQCRFEEILS 481 NFAAIPMIFD EIAQNKDNLA QISIKYQNQG KKDLLQASAE 521 EDVKAIKDLL DQTNNLLHRL KIFHISQSED KANILDKDEH 561 FYLVFEECYF ELANIVPLYN KIRNYITQKP YSDEKFKLNF 601 ENSTLASGWD KNKESANTAI LFIKDDKYYL GIMDKKHNKI 641 FSDKAIEENK GEGYKKIVYK QIADASKDIQ NLMIIDGKTV 681 CKKGRKDRNG VNRQLLSLKR KHLPENIYRI KETKSYLKNE 721 ARFSRKDLYD FIDYYKDRLD YYDFEFELKP SNEYSDFNDF 761 TNHIGSQGYK LTFENISQDY INSLVNEGKL YLFQIYSKDF 801 SAYSKGRPNL HTLYWKALFD ERNLQDVVYK LNGEAELFYR 841 KQSIPKKITH PAKETIANKN KDNPKKESVF EYDLIKDKRF 881 TEDKFFFHCP ITINFKSSGA NKFNDEINLL LKEKANDVHI 921 LSIDRGERHL AYYTLVDGKG NIIKQDNFNI IGNDRMKTNY 961 HDKLAAIEKD RDSARKDWKK INNIKEMKEG YLSQVVHEIA 1001 KLVIEYNAIV VFEDLNFGFK RGRFKVEKQV YQKLEKMLIE 1041 KLNYLVFKDN EFDKTGGVLR AYQLTAPFET FKKMGKQTGI 1081 IYYVPAGFTS KICPVTGFVN QLYPKYESVS KSQEFFSKFD 1121 KICYNLDKGY FEFSFDYKNF GDKAAKGKWT IASFGSRLIN 1061 FRNSDKNHNW DTREVYPTKE LEKLLKDYSI EYGHGECIKA 1201 AICGESDKKF FAKLTSVLNT ILQMRNSKTG TELDYLISPV 1241 ADVNGNFFDS RQAPKNMPQD ADANGAYHIG LKGLMLLDRI 1281 KNNQEGKKLN LVIKNEEYFE FVQNRNN The D917 and / or E1005 residues of the SEQ ID NO:1 protein (highlighted above) can be mutated to generate a catalytically inactive form of this Cas12a (ddFnCas12a) protein. Any substitution at D917 and / or E1005 residue of SEQ ID NO:1 (or similar mutations / substitutions in SEQ ID NO: 3 and / or 4) that results in a protein with reduced (including about 5%, about 10%, about 15%, 20, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% reduction in activity as compared to wild-type) or no catalytically active protein, as compared to the non- Attorney’s Docket No.105067-101 mutated sequence (e.g., wild type) can be used in the methods provided herein. For example, the D917A / E1005A double mutation can be used as the ddFnCas12a catalytically inactive protein. A nucleotide sequence for the SEQ ID NO:1 Francisella tularensis Cas12a / Cpf1 protein is shown below (NCBI NZ_DS995364.1; SEQ ID NO:2). 1 ATGTCAATTT ATCAAGAATT TGTTAATAAA TATAGTTTAA 41 GTAAAACTCT AAGATTTGAG TTAATCCCAC AGGGTAAAAC 81 ACTTGAAAAC ATAAAAGCAA GAGGTTTGAT TTTAGATGAT 121 GAGAAAAGAG CTAAAGACTA CAAAAAGGCT AAACAAATAA 161 TTGATAAATA TCATCAGTTT TTTATAGAGG AGATATTAAG 201 TTCGGTTTGT ATTAGCGAAG ATTTATTACA AAACTATTCT 241 GATGTTTATT TTAAACTTAA AAAGAGTGAT GATGATAATC 281 TACAAAAAGA TTTTAAAAGT GCAAAAGATA CGATAAAGAA 321 ACAAATATCT AAATATATAA ATGACTCAGA GAAATTTAAG 361 AATTTGTTTA ATCAAAACCT TATCGATGCT AAAAAAGGGC 401 AAGAGTCAGA TTTAATTCTA TGGCTAAAGC AATCTAAGGA 441 TAATGGCATA GAACTATTTA AAGCTAATAG TGATATCACA 481 GATATAGATG AGGCGTTAGA AATAATCAAA TCTTTTAAAG 521 GTTGGACAAC TTATTTTAAG GGTTTTCATG AAAATAGAAA 561 AAATGTTTAT AGTAGCAATG ATATTCCTAC ATCTATTATT 601 TATAGGATAG TAGATGATAA TTTGCCTAAA TTTCTAGAAA 641 ATAAAGCTAA GTATGAGAGT TTAAAAGACA AAGCTCCAGA 681 AGCTATAAAC TATGAACAAA TTAAAAAAGA TTTGGCAGAA 721 GAGCTAACCT TTGATATTGA CTACAAAACA TCTGAAGTTA 761 ATCAAAGAGT TTTTTCACTT GATGAAGTTT TTGAGATAGC 801 AAACTTTAAT AATTATCTAA ATCAAAGTGG TATTACTAAA 841 TTTAATACTA TTATTGGTGG TAAATTTGTA AATGGTGAAA 881 ATACAAAGAG AAAAGGTATA AATGAATATA TAAATCTATA 921 CTCACAGCAA ATAAATGATA AAACACTCAA AAAATATAAA 961 ATGAGTGTTT TATTTAAGCA AATTTTAAGT GATACAGAAT 1001 CTAAATCTTT TGTAATTGAT AAGTTAGAAG ATGATAGTGA 1041 TGTAGTTACA ACGATGCAAA GTTTTTATGA GCAAATAGCA 1081 GCTTTTAAAA CAGTAGAAGA AAAGTCTATT AAGGAAACAC 1121 TATCTTTACT ATTTGATGAT TTAAAAGCTC AAAAACTTGA 1161 TTTGAGTAAA ATTTATTTTA AAAATGATAA ATCTCTTACT 1201 GATCTATCAC AACAAGTTTT TGATGATTAT AGTGTTATTG 1241 GTACAGCGGT ACTAGAATAT ATAACTCAAC AAGTAGCACC 1281 TAAAAATCTT GATAACCCTA GTAAGAAAGA GCAAGATTTA 1321 ATAGCCAAAA AAACTGAAAA AGCAAAATAC TTATCTCTAG 1361 AAACTATAAA GCTTGCCTTA GAAGAATTTA ATAAGCATAG 1401 AGATATAGAT AAACAGTGTA GGTTTGAAGA AATACTTTCA 1441 AACTTTGCGG CTATTCCGAT GATATTTGAT GAAATAGCTC 1481 AAAACAAAGA CAATTTGGCA CAGATATCTA TCAAATACCA 1521 AAATCAAGGT AAAAAAGACC TACTTCAAGC TAGTGCAGAA 1561 GAAGATGTTA AAGCTATCAA GGATCTTTTA GATCAAACTA 1601 ATAATCTCTT GCATAGGCTA AAAATATTTC ATATTAGTCA 1641 ATCAGAAGAT AAGGCAAATA TTTTAGACAA GGATGAGCAT 1681 TTTTATCTAG TATTTGAGGA GTGCTACTTT GAGCTAGCGA 1721 ATATAGTGCC TCTTTATAAC AAAATTAGAA ACTATATAAC 1761 TCAAAAGCCA TATAGTGATG AGAAATTTAA GCTCAATTTT 1801 GAGAACTCGA CTTTGGCGAG TGGCTGGGAC AAAAACAAAG Attorney’s Docket No.105067-101 1841 AGTCTGCTAA TACAGCAATT TTATTTATCA AAGATGATAA 1881 ATATTATCTT GGTATTATGG ATAAAAAACA TAACAAAATA 1921 TTTAGCGATA AAGCTATTGA AGAAAATAAA GGAGAAGGCT 1961 ACAAGAAAAT TGTTTATAAG CAAATTGCAG ATGCCTCAAA 2001 AGATATCCAA AATTTGATGA TTATTGATGG AAAAACTGTA 2041 TGTAAAAAAG GCAGAAAAGA TCGAAATGGA GTAAACAGGC 2081 AGTTACTAAG CTTAAAGAGA AAACATTTGC CAGAGAATAT 2121 ATATCGTATT AAAGAAACTA AAAGCTATTT AAAGAATGAA 2161 GCAAGATTTA GTAGAAAAGA TTTATATGAT TTTATAGATT 2201 ATTACAAAGA TAGACTTGAT TATTATGACT TTGAATTTGA 2241 GCTAAAGCCA TCAAATGAGT ATTCAGATTT TAATGATTTT 2281 ACTAACCATA TTGGTTCTCA AGGCTATAAA CTAACATTTG 2321 AGAATATATC TCAAGACTAT ATAAATAGTC TAGTAAATGA 2361 AGGCAAACTT TATTTGTTCC AAATCTATAG TAAAGATTTT 2401 TCAGCTTATA GCAAAGGGCG ACCAAATCTA CATACTTTAT 2441 ATTGGAAAGC GCTGTTTGAT GAGAGAAATC TTCAAGATGT 2481 GGTTTATAAG CTAAATGGTG AGGCAGAGCT TTTTTATCGT 2521 AAACAATCAA TACCTAAAAA AATCACTCAC CCAGCCAAAG 2561 AGACAATAGC TAATAAAAAC AAAGATAATC CTAAAAAAGA 2601 GAGTGTTTTT GAATATGATT TAATCAAGGA TAAACGCTTT 2641 ACTGAAGATA AGTTTTTCTT TCACTGTCCT ATTACAATCA 2681 ATTTTAAATC TAGTGGAGCT AATAAGTTTA ATGATGAAAT 2721 CAATTTATTG CTAAAAGAAA AAGCAAATGA TGTTCATATA 2761 TTAAGTATAG ATAGAGGTGA AAGACATTTA GCTTACTATA 2801 CTTTGGTAGA TGGTAAAGGA AATATTATCA AGCAAGATAA 2841 TTTCAACATC ATTGGTAACG ATAGAATGAA AACAAACTAC 2881 CATGATAAGC TTGCTGCAAT AGAGAAAGAT AGGGATTCAG 2921 CTAGGAAAGA CTGGAAAAAG ATAAATAACA TCAAAGAGAT 2961 GAAAGAGGGC TATCTATCTC AGGTAGTTCA TGAAATAGCT 3001 AAGCTAGTTA TAGAGTATAA TGCTATTGTG GTTTTTGAGG 3041 ATTTAAATTT TGGATTTAAA AGAGGGCGTT TCAAGGTAGA 3081 GAAGCAGGTC TATCAAAAGT TAGAAAAAAT GCTAATTGAG 3121 AAACTAAACT ATCTAGTTTT CAAAGATAAT GAGTTTGATA 3161 AAACTGGGGG AGTGCTTAGA GCTTATCAGC TAACAGCACC 3201 TTTTGAGACT TTTAAAAAGA TGGGTAAACA AACAGGTATT 3241 ATCTACTATG TACCAGCTGG TTTTACTTCA AAAATTTGTC 3281 CTGTAACTGG TTTTGTAAAT CAGTTATATC CTAAGTATGA 3321 AAGTGTCAGC AAATCTCAAG AGTTCTTTAG TAAGTTTGAC 3361 AAGATTTGTT ATAACCTTGA TAAGGGCTAT TTTGAGTTTA 3401 GTTTTGATTA TAAAAACTTT GGTGACAAGG CTGCCAAAGG 3441 CAAGTGGACT ATAGCTAGCT TTGGGAGTAG ATTGATTAAC 3481 TTTAGAAATT CAGATAAAAA TCATAATTGG GATACTCGAG 3521 AAGTTTATCC AACTAAAGAG TTGGAGAAAT TGCTAAAAGA 3561 TTATTCTATC GAATATGGGC ATGGCGAATG TATCAAAGCA 3601 GCTATTTGCG GTGAGAGCGA CAAAAAGTTT TTTGCTAAGC 3641 TAACTAGTGT CCTAAATACT ATCTTACAAA TGCGTAACTC 3681 AAAAACAGGT ACTGAGTTAG ATTATCTAAT TTCACCAGTA 3721 GCAGATGTAA ATGGCAATTT CTTTGATTCG CGACAGGCGC 3761 CAAAAAATAT GCCTCAAGAT GCTGATGCCA ATGGTGCTTA 3801 TCATATTGGG CTAAAAGGTC TGATGCTACT AGATAGGATC 3841 AAAAATAATC AAGAGGGCAA AAAACTCAAT TTGGTTATCA 3881 AAAATGAAGA GTATTTTGAG TTCGTGCAGA ATAGGAATAA Attorney’s Docket No.105067-101 3921 CTAA Another example of a type V CRISPR-associated protein Cas12a / Cpf1 Francisella tularensis nuclease can have the following sequence (NCBI WP_003040289.1; SEQ ID NO:3). 1 MSIYQEFVNK YSLSKTLRFE LIPQGKTLEN IKARGLILDD 41 EKRAKDYKKA KQIIDKYHQF FIEEILSSVC ISEDLLQNYS 81 DVYFKLKKSD DDNLQKDFKS AKDTIKKQIS EYIKDSEKFK 121 NLFNQNLIDA KKGQESDLIL WLKQSKDNGI ELFKANSDIT 161 DIDEALEIIK SFKGWTTYFK GFHENRKNVY SSNDIPTSII 201 YRIVDDNLPK FLENKAKYES LKDKAPEAIN YEQIKKDLAE 241 ELTFDIDYKT SEVNQRVFSL DEVFEIANFN NYLNQSGITK 281 FNTIIGGKFV NGENTKRKGI NEYINLYSQQ INDKTLKKYK 321 MSVLFKQILS DTESKSFVID KLEDDSDVVT TMQSFYEQIA 361 AFKTVEEKSI KETLSLLFDD LKAQKLDLSK IYFKNDKSLT 401 DLSQQVFDDY SVIGTAVLEY ITQQIAPKNL DNPSKKEQEL 441 IAKKTEKAKY LSLETIKLAL EEFNKHRDID KQCRFEEILA 481 NFAAIPMIFD EIAQNKDNLA QISIKYQNQG KKDLLQASAE 521 DDVKAIKDLL DQTNNLLHKL KIFHISQSED KANILDKDEH 561 FYLVFEECYF ELANIVPLYN KIRNYITQKP YSDEKFKLNF 601 ENSTLANGWD KNKEPDNTAI LFIKDDKYYL GVMNKKNNKI 641 FDDKAIKENK GEGYKKIVYK LLPGANKMLP KVFFSAKSIK 681 FYNPSEDILR IRNHSTHTKN GSPQKGYEKF EFNIEDCRKF 721 IDFYKQSISK HPEWKDFGFR FSDTQRYNSI DEFYREVENQ 761 GYKLTFENIS ESYIDSVVNQ GKLYLFQIYN KDFSAYSKGR 801 PNLHTLYWKA LFDERNLQDV VYKLNGEAEL FYRKQSIPKK 841 ITHPAKEAIA NKNKDNPKKE SVFEYDLIKD KRFTEDKFFF 881 HCPITINFKS SGANKFNDEI NLLLKEKAND VHILSIDRGE 921 RHLAYYTLVD GKGNIIKQDT FNIIGNDRMK TNYHDKLAAI 961 EKDRDSARKD WKKINNIKEM KEGYLSQVVH EIAKLVIEYN 1001 AIVVFEDLNF GFKRGRFKVE KQVYQKLEKM LIEKLNYLVF 1041 KDNEFDKTGG VLRAYQLTAP FETFKKMGKQ TGIIYYVPAG 1081 FTSKICPVTG FVNQLYPKYE SVSKSQEFFS KFDKICYNLD 1121 KGYFEFSFDY KNFGDKAAKG KWTIASFGSR LINFRNSDKN 1161 HNWDTREVYP TKELEKLLKD YSIEYGHGEC IKAAICGESD 1201 KKFFAKLTSV LNTILQMRNS KTGTELDYLI SPVADVNGNF 1241 FDSRQAPKNM PQDADANGAY HIGLKGLMLL GRIKNNQEGK 1281 KLNLVIKNEE YFEFVQNRNN The D917 and / or E1006 residues of the SEQ ID NO:3 protein (highlighted above) can be mutated to generate a catalytically inactive form or a form with reduce catalytic activity of this Cas12a (ddFnCas12a) protein. In another example, a Francisella tularensis subsp. novicida U112 Cas12 nuclease, also referred to as an FnCas12a can have the following sequence (NCBI A0Q7Q2.1, SEQ ID NO:4). 1 MSIYQEFVNK YSLSKTLRFE LIPQGKTLEN IKARGLILDD 41 EKRAKDYKKA KQIIDKYHQF FIEEILSSVC ISEDLLQNYS 81 DVYFKLKKSD DDNLQKDFKS AKDTIKKQIS EYIKDSEKFK 121 NLFNQNLIDA KKGQESDLIL WLKQSKDNGI ELFKANSDIT Attorney’s Docket No.105067-101 161 DIDEALEIIK SFKGWTTYFK GFHENRKNVY SSNDIPTSII 201 YRIVDDNLPK FLENKAKYES LKDKAPEAIN YEQIKKDLAE 241 ELTFDIDYKT SEVNQRVFSL DEVFEIANFN NYLNQSGITK 281 FNTIIGGKFV NGENTKRKGI NEYINLYSQQ INDKTLKKYK 321 MSVLFKQILS DTESKSFVID KLEDDSDVVT TMQSFYEQIA 361 AFKTVEEKSI KETLSLLFDD LKAQKLDLSK IYFKNDKSLT 401 DLSQQVFDDY SVIGTAVLEY ITQQIAPKNL DNPSKKEQEL 441 IAKKTEKAKY LSLETIKLAL EEFNKHRDID KQCRFEEILA 481 NFAAIPMIFD EIAQNKDNLA QISIKYQNQG KKDLLQASAE 521 DDVKAIKDLL DQTNNLLHKL KIFHISQSED KANILDKDEH 561 FYLVFEECYF ELANIVPLYN KIRNYITQKP YSDEKFKLNF 601 ENSTLANGWD KNKEPDNTAI LFIKDDKYYL GVMNKKNNKI 641 FDDKAIKENK GEGYKKIVYK LLPGANKMLP KVFFSAKSIK 681 FYNPSEDILR IRNHSTHTKN GSPQKGYEKF EFNIEDCRKF 721 IDFYKQSISK HPEWKDFGFR FSDTQRYNSI DEFYREVENQ 761 GYKLTFENIS ESYIDSVVNQ GKLYLFQIYN KDFSAYSKGR 801 PNLHTLYWKA LFDERNLQDV VYKLNGEAEL FYRKQSIPKK 841 ITHPAKEAIA NKNKDNPKKE SVFEYDLIKD KRFTEDKFFF 881 HCPITINFKS SGANKFNDEI NLLLKEKAND VHILSIDRGE 921 RHLAYYTLVD GKGNIIKQDT FNIIGNDRMK TNYHDKLAAI 961 EKDRDSARKD WKKINNIKEM KEGYLSQVVH EIAKLVIEYN 1001 AIVVFEDLNF GFKRGRFKVE KQVYQKLEKM LIEKLNYLVF 1041 KDNEFDKTGG VLRAYQLTAP FETFKKMGKQ TGIIYYVPAG 1081 FTSKICPVTG FVNQLYPKYE SVSKSQEFFS KFDKICYNLD 1121 KGYFEFSFDY KNFGDKAAKG KWTIASFGSR LINFRNSDKN 1161 HNWDTREVYP TKELEKLLKD YSIEYGHGEC IKAAICGESD 1201 KKFFAKLTSV LNTILQMRNS KTGTELDYLI SPVADVNGNF 1241 FDSRQAPKNM PQDADANGAY HIGLKGLMLL GRIKNNQEGK 1281 KLNLVIKNEE YFEFVQNRNN The D917 and E1006 residues of the SEQ ID NO:4 protein (highlighted above) can be mutated to generate a catalytically inactive form or a form with reduce catalytic activity of this Cas12a (ddFnCas12a) protein. Variants and homologs of these sequences can also be used in the methods and systems described herein. For example, such variants can have less than 100% sequence identity to any of the sequences described herein. The variants and homologs can have about at least 40% sequence identity, or at least 50% sequence identity, or at least 60% sequence identity, or at least 70% sequence identity, or at least 80% sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or 60-99% sequence identity, or 70-99% sequence identity, or 80-99% sequence identity, or 90-95% sequence identity, or 90-99% sequence identity, or 95-97% sequence identity, or 97-99% sequence identity, or 100% sequence identity with any of sequences described herein. Guide RNAs Attorney’s Docket No.105067-101 A CRISPR guide RNA can be used that can target a Cas enzyme, including a defective Cas enzyme, to the desired location in the genome, where it can cleave the DNA for generation of a genomic modification. A guide RNA interacts with CRISPR / Cas to guide it to a specific target site. Each guide RNA can comprise one or more regions, including for example, a first region that is complementary to the target site in the target sequence (targeting guide RNA (crRNA)) and a second region that forms one or more stem loop structures, the trans-activating CRISPR RNA / nuclease-binding guide RNA (tracrRNA). The first region of each guide RNA is different such that each guide RNA guides CRISPR / Cas to a specific target site. The second region of each guide RNA can be the same in all guide RNAs. The first region of the guide RNA is complementary to the target site in the target sequence such that the first region of the guide RNA can base pair with the target site. The guide RNAs can be designed to include one or more, for example, one or two targeting sequences. In various embodiments, the first region of the guide RNA can comprise from about 10 nucleotides to more than about 25 nucleotides. For example, the region of base pairing between the first region of the guide RNA and the target site in the target sequence can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, or more than 25 nucleotides in length. The guide RNA also comprises a second region that forms a secondary structure. In some embodiments, the secondary structure comprises one or more stem (or hairpin) and loop structures. The length of the loop and the stem can vary. For example, the loop can range from about 3 to about 10 nucleotides in length, and the stem can range from about 3 to about 20 base pairs in length. The stem can comprise one or more bulges of 1 to about 10 nucleotides. Thus, the overall length of the second region can range from about 10 to about 60 nucleotides in length. In some embodiments, the guide RNAs can have one, two, three or four stem structures with double- stranded regions of about 3-5 nucleotides. The gRNA can have 1 or more spaces, such as 1, 2, 3, 4, or 5 spacers. In one embodiment, the gRNA has 2 spacers. A variety of guide RNAs can be used to modify A. ferrooxidans. Cas12a nucleases can use guide RNAs that include both the targeting guide RNA (crRNA) sequences and the nuclease- binding guide RNA (tracrRNA) sequences. The guide RNAs for use with Cas12 nucleases also target sites near TTTV PAM sites. In embodiments in which the guide RNA is introduced into the cell as a DNA molecule, the guide RNA coding sequence can be operably linked to promoter control sequence for Attorney’s Docket No.105067-101 expression of the guide RNA in the cell. For example, the RNA coding sequence can be operably linked to a promoter sequence that is recognized by polymerase. The DNA molecule encoding the guide RNA can be linear or circular. In some embodiments, the DNA sequence encoding the guide RNA can be part of a vector. The vector can comprise additional expression control sequences, selectable marker sequences, origins of replication, and the like. Bioleaching In some examples, bioleaching experiments of pyrite and chalcopyrite were carried out in 250 mL Erlenmeyer flasks with working volumes of 100 mL. The leaching media consisted of 0.8 g / L, (NH4)2SO4; 0.1 g / L, K2HPO4; 2.0 g / L, MgSO4·7H2O; 5 ml / L, MD-TMS, and 10 mM, citric acid (final pH of 1.8). For chalcopyrite bioleaching, 100 mM of FeSO4·7H2O was added to accelerate initial leaching. Wild type or engineered cells (dPetB2 or dPetB1) with cell density of 8.3×107cells / mL were inoculated. All experiments were conducted in triplicate. While the dPetB1 cells showed comparable or lower bioleaching of both minerals as compared to the wild type cells, the dPetB2 cells showed significantly higher bioleaching efficiency. The dPetB2 cells achieved 35% and 68% of final iron and copper bioleaching efficiency from pyrite and chalcopyrite, respectively, at the end of experiment. Furthermore, less jarosite, which is main cause of surface passivation during the (chalco)pyrite leaching, was detected in the mineral residues with dPetB2 cells. These results indicate that the knockdown of petB2 gene, which silences a major sulfur oxidation pathway, enabled less surface passivation, and thereby enhanced bioleaching efficiency of both iron sulfidic minerals. Particularly, the final chalcopyrite bioleaching efficiency achieved by the dPetB2 cells was the highest number among the reported values in the literatures, without any additives. The enhanced copper extraction from chalcopyrite by regulating gene expression in A. ferrooxidans in this study provides a novel strategy to deal with industrially and economically important primary mineral. The invention will be further described by the following non-limiting examples. EXAMPLES Introduction Acidithiobacillus ferrooxidans oxidize iron or reduced inorganic sulfur compounds (RISCs) and have generated interest for use in metal bioleaching as well additional biotechnology applications. In a bioleaching process, metal sulfide ores are oxidized via ferric iron and proton attack, either through direct contact mechanisms or indirect interactions, and dissolution can proceed through thiosulfate mechanisms or polysulfide mechanisms. The oxidation of many sulfides can be incomplete, as surface passivation can occur. This is especially problematic for Attorney’s Docket No.105067-101 the oxidation of chalcopyrite (CuFeS2), which holds 70% of the unmined copper on Earth, and this material will need to be processed to supply the copper necessary for global electrification. Surface passivation occurs through the formation of jarosite, oxides and polysulfide, and the extent of surface passivation is influenced by biofilm formation. Given that the RISC metabolism of A. ferrooxidans both directly and indirectly influences cell adherence and biofilm formation, the manipulation of cellular metabolism (i.e. iron vs RISC utilization) may impact surface passivation, consequently affecting the extent of bioleaching of chalcopyrite and other sulfidic ores. During aerobic growth, electrons from iron and sulfur are used to reduce O2 or to produce reducing power (NAD(P)H) through a series of protein complexes (Fig.1A). The cytochrome bc1complex (cytochrome b [PetB], cytochrome c1 [PetC], and the Rieske iron-sulfur protein [PetA]) play important role in these processes, enabling electron transfer and proton translocation across the membrane, thus contributing to ATP synthesis (Fig. 1B). Under variations in substrate availability or redox states, the cytochrome bc1 complex can redirect electron flow to different pathways, optimizing energy production and metabolic efficiency. This electron bifurcation allows the organism to adapt to changing environmental conditions and optimize energy utilization. Due to the various oxidation states of RISCs and the combined involvement of both enzymatic and nonenzymatic reactions in sulfur oxidation, the electron fluxes in A. ferrooxidans in environments rich in both iron and reduced sulfur, such as sulfidic ores and acid mine drainage, are expected to be complex. In the most studied A. ferrooxidans type strain (ATCC 23270), the petI and petII operons encode distinct bc1 complexes expressed under iron-rich and sulfur-rich conditions, respectively. Under high sulfur concentrations, A. ferrooxidans prioritizes the use of sulfur over iron, due to the higher energy density of sulfur (Fig. 1C). Thus, iron oxidation is inhibited under sulfur-rich conditions, due to a preferential electron flow from sulfur oxidation, which can negatively affect the bioleaching of iron sulfide minerals including chalcopyrite. We hypothesized that the downregulation of the petII operon may enhance iron oxidation under high sulfur concentrations, offering potential opportunities for influencing bioleaching mechanisms, leading to reduced surface passivation and enhancing metal sulfide bioleaching. The use of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated protein (Cas) system for genome editing has revolutionized genetic engineering. CRISPR interference (CRISPRi) uses a catalytically inactive (nuclease-deficient) Cas protein to silence target genes, enabling functional studies of genes without genome modification. Although extensively applied in many bacteria, CRISPRi applications to acidophiles, including A. ferrooxidans, have been limited. A Type IV CRISPR / Cas was identified Attorney’s Docket No.105067-101 in A. ferrooxidans ATCC23270, but this endogenous system remains uncharacterized. Recently a well-established Class 2 Type II CRISPR / nuclease-deficient Cas9 (dCas9) was introduced to A. ferrooxidans (DSM 14882), and the authors used this CRISPRi to knock down the expression of the nitrogenase nifH gene, observing deceased growth on ammonium (NH4+). Another study used dCas9 in A. ferridurans to decrease sulfur oxidation by suppressing the expression of HdrA (heterodisulfide reductase) and TusA (thiosulfate carrier). These reports demonstrate the successful transcriptional repression of target genes; however, however CRISPRi has yet be used to create cells with useful new attributes. Moreover, the high off-target efficiency and cytotoxicity of Cas9 can restrict its use in many bacteria. To address this, another Class 2 system, Cas12a (Cpf1) has become a useful alternative with functional advantages, such as easy multiplex genome editing, compatibility with high GC organisms (such as A. ferrooxidans), and lower toxicity. However, the use of Cas12a based CRISPRi systems in non-model bacteria, including extremophiles, has been rarely reported. Here, we report CRISPRi with DNase-deactivated Francisella novicida Cas12a (dCas12a) in A. ferrooxidans. After optimizing the CRISPRi system in E. coli for enhanced knockdown efficiency, this system was investigated in A. ferrooxidans to reduce expression of the petA2 and petB2 genes (in the petII operon), and the petA1 and petB1 genes (in the petI operon). The mutant cells responded differently depending on available sulfur concentrations and the cells were further evaluated for their impact on the bioleaching of the sulfidic ores, pyrite, and chalcopyrite as well as the impact of these mutations on biofilm formation and surface passivation. Materials and Methods Experimental materials Strains used in this study include E. coli DH10β and E. coli BL21 obtained from NEB (Ipswich, MA), E. coli S17-1 ATCC 47055 and A. ferrooxidans ATCC 23270 purchased from ATCC (Manassas, Virginia). All A. ferrooxidans strains were initially grown in 100 mL of iron and sulfur growth media (F2S medium) with an initial optical density measured at 600 nm (OD600) of 0.001, which corresponds to a cell density of 8.3 × 106cells / mL, in shaking incubator (30℃ and 140 rpm). The F2S medium consisted of (NH4)2SO4, 0.8 g / L; HK2PO4, 0.1 g / L; MgSO4·7H2O, 2.0 g / L; Trace mineral solution (MD-TMS, ATCC), 5 mL / L; citric acid, 1.92 g / L; FeSO4·7H2O, 27.8 g / L; and dispersed sulfur (#S789400, Toronto Research Chemicals), 0.1% (w / v). The media was filtered through a 0.2 µm pore size (Thermo Fisher Scientific, Waltham, MA) prior to use, and sulfur was added to the media after filtration. The pFnCpf1_min (pY002) plasmid expressing FnCpf1 (Cas12a) and spacers 1–4 of CRISPR array following the J23119 promoter, from Francisella tularensis subsp. Novicida, was sourced from Addgene (#69975). Attorney’s Docket No.105067-101 Enzymes and reagents for DNA manipulation were obtained from NEB, and oligonucleotides were purchased from Integrated DNA Technologies (Coralville, Iowa). All strains, plasmids, and oligonucleotides used in this study were present in Tables S1–S3. Table S1. Plasmids and bacterial strain used in this study. Strains or Description Source or Plasmids Reference Strains E. coli DH10b Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 NEB galE15 e14- ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 Δ(mrr-hsdRMS-mcrBC) E. coli S17-1 recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 integrated ATCC (ATCC 47055) into the chromosome E. coli BL21 fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS NEB ElacY1 E. coli BL21 with placY1 ElacY2 E. coli BL21 with placY2 ElacY3 E. coli BL21 with placY3 A. ferrooxidans Type strain ATCC (ATCC 23270) dPetA2 ATCC23270 with pPetA2 This study dPetB2 ATCC23270 with pPetB2 This study dPetA1 ATCC23270 with pPetA1 This study dPetB1 ATCC23270 with pPetB1 This study Plasmids pFnCpf1_min Plasmid expresses FnCpf1 (Cas12a) and spacers 1–4 Addgene: (Cas12a) of CRISPR array following the J23119 promoter, from pY002 Francisella tularensis subsp. novicida. pYI11 pJRD215 empty vector with tac promoter and rrnB 1 terminator pJRD_Cas12a pYI11 designed to express Cas12a up to the first direct This study repeat sequences of CRISPR array Attorney’s Docket No.105067-101 pJRD_ddCas12a pJRD_Cas12a introduced with the E1006A / D917A This study double mutations for catalytical inactivation placY1 pJRD_dFnCpf1 for lacY knockdown with 1 target This study spacer RNA array placY2 pJRD_dFnCpf1 for lacY knockdown with 1 target This study spacer RNA array placY3 pJRD_dFnCpf1 for lacY knockdown with 2 target This study spacers RNA array pPetA2 pJRD_dFnCpf1for petA2 knockdown with 2 target This study spacers RNA array pPetB2 pJRD_dFnCpf1for petB2 knockdown with 2 target This study spacers RNA array pPetA1 pJRD_dFnCpf1for petA1 knockdown with 2 target This study spacers RNA array pPetB1 pJRD_dFnCpf1for petB1 knockdown with 2 target This study spacers RNA array Table S2. Primers used in this study. Target Strand Sequence (5’→3’)Cloning pYI28 + ATTTCACACAGGAGGTAAAGGATCCATGTCAATTTATCAA GAATTTGTTAATAAATATAG (SEQ ID NO.: 5) – CTTTCGTTTTATTTGGGTACTGAATTATCTGAAGGCAC (SEQ ID NO.: 6) pYI30 + TGTGGTTTTTGCTGATTTAAATTTTGGATTTAAAAG (SEQ ID NO.: 7) – ATAGCATTATACTCTATAACTAG (SEQ ID NO.: 8) pYI49 + TTAAGTATAGCAAGAGGTGAAAGACATTTAG (SEQ ID NO.: 9) – TATATGAACATCATTTGCTTTTTC (SEQ ID NO.: 10) Site-directed mutagenesis placY1 + TTATTCTTTTCAAATAAAACGAAAGGCTC (SEQ ID NO.: 11) – ACCGAACATCATCTACAACAGTAGAAATTATTTAAAG (SEQ ID NO.: 12) Attorney’s Docket No.105067-101 placY2 + TGTTGTAGATTAGCGATTTATGAAGGTCATTTTTTTGTCTA GCTTTAATGC (SEQ ID NO.: 13) – GTAGAAATTGGAATAATAGCGAGAACAGAATCTACAACA GTAGAAATTATTTAAAG (SEQ ID NO.: 14) placY3 + ATATGGTTGATGTCATGTAGCATCTACAACAGTAGAAATT GG (SEQ ID NO.: 15) – TTTCCAGAACTATTTAATGCCAAATAAAACGAAAGGCTC (SEQ ID NO.: 16) dPetA2 + GTTGTAGATATGGCGGAGGCATTCTTCGGCAAATAAAACG AAAGGCTC (SEQ ID NO.: 17) – AGTAGAAATTAGCAACGACCCGGCGTAGTAATCTACAACA GTAGAAATTATTTAAAG (SEQ ID NO.: 18) dPetB2 + GTTGTAGATGGCACGCGTAATCAAAGGATCAAATAAAACG AAAGGCTC (SEQ ID NO.: 19) – AGTAGAAATTGGAGCCATGGCAGGGGCAATATCTACAACA GTAGAAATTATTTAAAG (SEQ ID NO.: 20) dPetA1 + GTTGTAGATTTTTAATGTAGCCAACATTTCAAATAAAACGA AAGGCTC (SEQ ID NO.: 21) – AGTAGAAATTTAATAATAAATCGGACCCCGATCTACAACA GTAGAAATTATTTAAAG (SEQ ID NO.: 22) dPetB1 + GTTGTAGATTTGATCGAGCGGGTGGCGACCAAATAAAACG AAAGGCTC (SEQ ID NO.: 23) – AGTAGAAATTTCCATGCCAAAATAATGAAGATCTACAACA GTAGAAATTATTTAAAG (SEQ ID NO.: 24) Digital PCR dPetA2 + CTGTGTTGCATACCGCATTAC (SEQ ID NO.: 25) – ATTACGCGTGCCGAAAGA (SEQ ID NO.: 26) dPetB2 + CGGAGGCATTCTTCGGATATG (SEQ ID NO.: 27) – GTAACCCAACCGCCGATAAA (SEQ ID NO.: 28) dPetA1 + ACATGTATCGTTCCAGAGTTCC (SEQ ID NO.: 29) – CATGGTGCAACACTTCCTTTC (SEQ ID NO.: 30) dPetB1 + CCGTCCAGTGTACAGGATAATG (SEQ ID NO.: 31) – CACCCGCTCGATCAAGAAATA (SEQ ID NO.: 32)AFE_2321 + CAGGATCTGCGTGCCTATAAA (SEQ ID NO.: 33) Attorney’s Docket No.105067-101 – GCCGCATCTTCCAAACATAAA (SEQ ID NO.: 34)AFE_2322 + GTGTACCGCAAGTCGTCTATT (SEQ ID NO.: 35)– AAGGTTGGTTCTCGCCAAT (SEQ ID NO.: 36)AFE_2323 + GTTCCCAGCGTTCCTTCAT (SEQ ID NO.: 37) – TGAGGATGGTAGCCCAGAA (SEQ ID NO.: 38)AFE_2324 + CCATCCAGGGCTATCAGATACT (SEQ ID NO.: 39) – TACCGGGTCACAGACTTCTATC (SEQ ID NO.: 40)AFE_0053 + ATAAGGAAAGGCCGTGGATG (SEQ ID NO.: 41) – TCATGGGAATCGCCTTGTATT (SEQ ID NO.: 42)AFE_1360 + CAAAGCAATAACCACGCACTC (SEQ ID NO.: 43)– CCGGATAACGCGTCAGAATATAA (SEQ ID NO.: 44) galU + TCCCACCACTCCCAGATT (SEQ ID NO.: 45) – AGAACATTCCACCCGCTATG (SEQ ID NO.: 46)AFE_1373 + GGTCGGTTCACCCAAGTAT (SEQ ID NO.: 47)– GAAGACGTGCGAGATTTGTTG (SEQ ID NO.: 48)AFE_1852 + CCCATTCGTAACGTGGTTTG (SEQ ID NO.: 49)– CCAAGGCGGGAAATGCT (SEQ ID NO.: 50)AFE_1379 + GACACCGTTCCGGCATC (SEQ ID NO.: 51)– CGATTGATCGTGGGCACTT (SEQ ID NO.: 52)AFE_1374 + CCGTTGCTGCTGATGGAATA (SEQ ID NO.: 53)– CACGTGGAGTATAACAGGCATC (SEQ ID NO.: 54)AFE_1172 + CACGGTACCGGAGTCGAAC (SEQ ID NO.: 55)– TTAGCCAAGCGGCCCAA (SEQ ID NO.: 56)

[0002] Attorney’s Docket No.105067-101 Table S3. Sequences of target spacer sequences used in this study. Plasmid Target gene Sequence (5’→3’) PAM placY1 lacY TCTGTTCTCGCTATTATTCC TTTG (SEQ ID NO.: 57) placY2 lacY TCTGTTCTCGCTATTATTCC TTTC (SEQ ID NO.: 57) placY3 lacY TCTGTTCTCGCTATTATTCC TTTC (SEQ ID NO.: 57) GCTACATGACATCAACCATA TTTG (SEQ ID NO.: 58) pPetA2 petA2 TACTACGCCGGGTCGTTGCT TTTC (SEQ ID NO.: 59) ATGGCGGAGGCATTCTTCGG TTTC (SEQ ID NO.: 60) pPetB2 petB2 ATTGCCCCTGCCATGGCTCC TTTC (SEQ ID NO.: 61) GGCACGCGTAATCAAAGGAT TTTC (SEQ ID NO.: 62) pPetA1 petA1 CGGGGTCCGATTTATTATTA TTTC (SEQ ID NO.: 63) TTTTAATGTAGCCAACATTT TTTC (SEQ ID NO.: 64) pPetB1 petB1 CTTCATTATTTTGGCATGGA TTTC (SEQ ID NO.: 65) TTGATCGAGCGGGTGGCGAC TTTC (SEQ ID NO.: 66) Pyrite (FeS2, Cat# 77817) was purchased from Sigma-Aldrich (St. Louis, MO) and chalcopyrite (CuFeS2) concentrate (24.8% Cu, 27.2% Fe, and 30.7% S) was provided by Freeport- McMoRan (Phoenix, AZ) and described elsewhere. All chemicals were sourced from Sigma- Aldrich (St. Louis, MO), unless otherwise noted. Plasmid construction and genetic manipulation Given the 4 native gRNA sequences that are from the original F. novicida strain following the J23119 promoter, the sequences up to the end of the first native gRNA (with direct repeat Attorney’s Docket No.105067-101 sequence of 5’ GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT (SEQ ID NO.: 67)) were amplified and cloned into pYI11 vector, the empty pJRD vector with tac promoter, using pYI28 primers (Table S2) via NEBuilder HiFi DNA Assembly following the manufacturer's instructions. The resulting construct (pJRD_Cas12a) was then converted into a catalytically inactivated form by a series of E1006A and D917A double mutations were made on the pJRD_Cas12a via Q5 Site-Directed Mutagenesis Kit (NEB), using pYI30 and pYI49 primers, respectively (Table S2). The final plasmid (pJRD_dCas12a) was referred to as dCas12a. To make the pPetA2, pPetB2, pPetA1, and pPetB1 plasmids for knockdown the petA2, petB2, petA1, and petB1 genes, respectively, the two target spacer sequences for each target gene (Table S3) with a 19-nt direct repeat sequence (5’ AATTTCTACTGTTGTAGAT (SEQ ID NO.: 68)), which contains the cleavage site to separate the first crRNA from the second crRNA, by Q5 Site-Directed Mutagenesis Kit (NEB), using relevant primer sets (Table S2). All constructed plasmids were transformed into E. coli DH10β for sequence verification before use. The gRNA sequences were designed using Benchling and CHOPCHOP. After verification, placY1–Y3 were transformed into E. coli BL21 and referred to as lacY1, lacY2, and lacY3, respectively. In addition, the sequence verified pPetA2, pPetB2, pPetA1, and pPetB1 were conjugally transferred to A. ferrooxidans by filter mating technique using the donor strain E. coli S17-1, as previously described. The resulting transconjugants were recovered in AFM1 medium containing 0.8 g / L, (NH4)2SO4; 0.1 g / L, HK2PO4; 2.0 g / L, MgSO4·7H2O; 5 ml / L, MD-TMS; and 72 mM, FeSO4·7H2O (final pH of 1.8) and screened in SM4 selection medium containing 0.8 g / L, (NH4)2SO4; 2.0 g / L, MgSO4·7H2O; 0.1 g / L, K2HPO4; 0.19 g / L, citric acid; 5 ml / L, MD-TMS; 40 µg / ml, leucine; 19 µg / mL, diaminopimelic acid; 17.9 µg / mL, Fe2(SO4)3; 1 g / L, dispersed sulfur; (final pH of 5.0) with kanamycin (50 mg / mL) to isolate the engineered cells. The isolated strains recombinantly expressing pPetA2, pPetB2, pPetA1, and pPetB1 were referred to as dPetA2, dPetB2, dPetA1, and dPetB1, respectively. Quantification of transcriptional gene expression The wild type and engineered strains (dPetA2, dPetB2, dPetA1, and dPetB1) were harvested at the stationary phase during the growth under 50 mL of F2S medium. Total RNA of the cells was extracted using RNeasy Mini kit (Qiagen, USA), and reversely transcribed to cDNA using QuantiTech Reverse Transcription Kit (Qiagen), as per the protocols. The concentration of petA2, petB2, petA1, and petB1 genes were analyzed by QIAcuity Digital PCR (dPCR) System (Qiagen). In addition, the expressions of genes responsible for biofilm formation were measured after the bioleaching experiments. 1 mL of cell-mineral mixtures was collected from each condition of the bioleaching. The total RNA was extracted, then converted to cDNA, as described Attorney’s Docket No.105067-101 previously. Several genes that were proposed to encode the extracellular polymeric substance (EPS) precursors UDP-glucose, UPD-galactose, and dTDP-rhamnose (luxA, AFE_2321; pgm, AFE_2324; galU; and AFE_2323), and genes encoding two distinct signaling mechanisms of quorum sensing (afeI, AFE_1999) and c-di-GMP (AFE_0053, AFE_1172, AFE_1360, AFE_1373, AFE_1374, AFE_1379, and AFE_1852), which regulate the biofilm formation, in A. ferrooxidans, were selected. The template cDNA was fragmented by XbaI and the dPCR reactions were carried out with the QIAcuity EG PCR Kit (Qiagen), following the manufacturer’s instructions. The absolute copy number of genes in samples was calculated using Poisson statistics and the final transcriptional gene expression was normalized with cDNA concentration of sample. The primer sequences for the dPCR reactions were present in Table S3. Phenotypic evaluation of CRISPRi The effect of the different CRISPR array (i.e., number of gRNA and secondary structure) on knockdown efficiency was evaluated in E. coli cells. The ElacY1, ElacY2, and ElacY3cells were grown in M9 medium with 0.4% lactose to limit the cell to use lactose for growth, while the lactose induces the tac promoter to express our dCas12a systems. The growth of cells with different CRISPR array were monitored, in terms of OD measured at 600 nm. The phenotypic responses of the engineered A. ferrooxidans by silencing petA2 and petB2 genes were examined by the growth tests with different sulfur concentrations. The dPetA2 and dPetB2 cells were grown in 100 mL of F2S medium with low (0.1%, w / v) and high (0.5%, w / v) dispersed sulfur. The profiles of iron and sulfur oxidations of the conditions were monitored, in comparison with the wild type, dPetA1, and dPetB1 cells. For dPetA2 and dPetB2 cells, the growth in the absence of sulfur (F2S medium without sulfur) was additionally assessed. The growth tests with A. ferrooxidans were performed in a shaking incubator (30℃ and 140 rpm), in triplicates. Bioleaching experiments Bioleaching experiments were conducted to see if the improved iron oxidation by repressing the gene involved in sulfur oxidative electron transfer pathway can affect the bioleaching of the sulfidic ores. Since we observed that the downregulating effects for the tested genes were more obvious in dPetB2 cells than dPetA2, the bioleaching experiments were performed only with the dPetB2, in comparison with the wild type and dPetB1 cells. Bioleaching experiments of pyrite and chalcopyrite were conducted in 250 mL Erlenmeyer flasks with working volumes of 100 mL. The leaching media consisted of 0.8 g / L, (NH4)2SO4; 0.1 g / L, K2HPO4; 2.0 g / L, MgSO4·7H2O; 5 ml / L, MD-TMS, and 10 mM, citric acid (final pH of 1.8). For chalcopyrite bioleaching, 100 mM of FeSO4·7H2O was added to accelerate initial leaching Attorney’s Docket No.105067-101 due to the poor bioleaching efficiency of this mineral. Wild type or engineered cells (dPetB2 or dPetB1) at OD600 of 1.0 were inoculated to adjust the initial cell density of 8.3×107cells / mL. In addition, the effect of the presence of sulfur intermediates on the bioleaching was further examined either by removing or adding sulfur intermediates during the bioleaching of chalcopyrite with the wild type cells. The wild type cells at initial OD600 of 0.01 were inoculated to a 14 mL Falcon round-bottom tube with a 10 mL of working volume (the same leaching media used for the chalcopyrite bioleaching above). For removing the sulfur metabolites, the leaching solution was periodically replaced (once in 1–3 days) with fresh media. For adding sulfur intermediates, thiosulfate (sodium thiosulfate) tetrathionate (sodium tetrathionate dihydrate), which are the common sulfur metabolites produced during the bioleaching of sulfidic ores, were exogenously added at the final concentrations of 50 ^M. The conditions without removing or adding sulfur intermediates were operated as controls. For all bioleaching experiments, the pulp densities of pyrite or chalcopyrite of 1.0% (w / v) were used. All experimental conditions were run in triplicate and incubated at 30℃ and 140 rpm. The water evaporation was compensated by adding distilled water, and pH was not adjusted as it was maintained below 2 for all tested conditions throughout the experiments. Analytical methods OD600 was measured using a GENESYS 10S UV-VIS spectrophotometer. The soluble Fe2+concentrations were measured by titration with cerium sulfate with a ferroin indicator, and sulfate concentration was measured using a barium sulfate turbidimetric method, as previously described. After the bioleaching experiments, total soluble iron and copper concentrations were analyzed by atomic absorption spectrometer (iCE 3300, Thermo Fisher Scientific, Waltham, MA). The solid residues after the bioleaching were characterized with a PANalytical XPert3 Powder X- ray diffraction (XRD) with Empyrean Cu Ka radiation (k = 0.15418 nm) equipped with a PIXcel1D detector, and a Zeiss-Sigma VP scanning electron microscopy (SEM) connected to a Bruker XFlash Detector. The sample preparations for XRD and SEM were described previously. Biofilm formation was quantified using crystal violet assay, following the previous description. For quantifying the number of planktonic cells, 1 mL of cell-mineral mixtures were filtered through a membrane filter with 0.7 um pore size, then the filter-through was mixed with 5X SYBR Green I nucleic acid stain (Invitrogen, USA), according to the previous method. Results dCas12a constructed on pJRD vector was evaluated in E. coli The catalytically active FnCas12a was cloned into pJRD215, a broad-host-range mobilizable vector that has been used for the transformation of A. ferrooxidans (Fig. 2A). The Attorney’s Docket No.105067-101 expression of the Cas gene was controlled by tac promoter, which is a strong constitutive promoter effective for gene expression in A. ferrooxidans The FnCas12a was converted to a catalytically inactivated form (dCas12a) by introducing the D917A / E1006A double mutations, inactivating the DNase activity without interrupting the RNA processing and DNA binding. We inserted the dCas12a following the J23119 promoter up to the first direct repeat from pFnCpf1_min, into pJRD215 vector, in which the expression of the designed dCas12a is controlled by tac promoter (Fig.2A). The lacY gene was chosen as a target for knockdown in E. coli cells as it can be used as a growth-dependent phenotype. As the design of CRISPR RNA (crRNA) affects RNA processing and targeting efficiency, the arrays were designed with one target spacers (20 bp) with different sequences in placY1 and placY2, and with two target spacers in placY3 (Fig. 2B). For placY1 and placY2 plasmids, additional sequences (TTTTTTGTCTAGCTTTAATGC (SEQ ID NO.: 69)) from pFnCpf1_min were included to ensure sufficient physical space for dCas12a to process the designed crRNA, avoiding potential interference by rrnB. In addition, this additional sequence was slightly modified in placY3 (TTTTCCAGAACTATTTAATGC (SEQ ID NO.: 70)) to maximize free energy of secondary structure. Structural analyses were performed by NUPACK, and the placY1 showed secondary structures (Fig.2C), which can potentially disrupt the proper operation of the CRISPR array. The placY2 showed better RNA structure with proper folding of direct repeats, while the placY3 further improved the structures, resulting in a higher free energy. Then, these different dCas12a arrays were evaluated for growth suppression of E. coli cells. Under lactose conditions, the growth of E. coli transformed with lacY2 was inhibited by almost half as compared to the cells with lacY1, while the cells with lacY3 ceased growing before reaching the exponential phase (Fig.2D). These results indicated that the use of two target spacer sequences, while minimizing the secondary RNA structure, increased the on-target efficiency. We opted to use the two target spacers without additional sequence extension (before rrnB terminator) for the subsequent experiments, since the proper functioning of the designed CRISPR array in the absence of additional sequences was observed, in terms of knockdown efficiency, compared to the number of target spacers (data not shown). These results confirm that the dCas12a expressed via the pJRD215 vector reduced the transcription of the target gene without apparent toxicity to E. coli cells, which is important considering that the conjugal plasmid transfer from E. coli to A. ferrooxidans is required for conjugal transformation. Knockdown of petA2 and petB2 overcome suppressed iron oxidation in A. ferrooxidans After confirming functionality of the dCas12a expressed from the pJRD215 plasmid in E. coli, the plasmids were conjugally transferred to A. ferrooxidans. The petA2 and petB2 genes in Attorney’s Docket No.105067-101 petII operon, and petA1 and petB1 genes in petI operon, which are two highly expressed genes under growth in sulfur and iron, respectively, were targeted for knockdown. The engineered strains were referred to as dPetA2, dPetB2, dPetA1, and dPetB1. In the absence of sulfur (Fe only medium), the lower transcriptional expressions of petA2 and petB2 genes in all cells (excluding dPetA2 and dPetB2, respectively), as measured by dPCR indicate that these genes are related to sulfur oxidation (Table 1). Likewise, the lower expression of petA1 and petB1 genes of all strains (excluding dPetA1 and dPetB1, respectively) (Table 1), support the repression of the electron flux from iron oxidation caused by growth in sulfur (Fig.1C). The transcriptional expression levels of the targeted genes in each of the engineered cells, were decreased by ~90% as compared to the wild type cells, and these knockdowns did not affect the expression levels of the non-targeted genes (Table 1). In addition, notable transcriptional expression of petA1 and petB1 genes weas observed in the dPetA2 and dPetB2 cells, under high sulfur conditions (Table 1). These results demonstrate the successful knockdown of the targeted genes in A. ferrooxidans with low off-target efficiency by the dCas12a system constructed in the pJRD plasmid. The tac promoter successfully drove the expression of the dCas12 and when combined with the J23119 promoter, the design was sufficient to support the expression of downstream designed CRISPRi array gRNA sequences in A. ferrooxidans, as has been observed in other extremophiles. Table 1. Transcriptional gene expression of petA2, petB2, petA1, and petB1 genes in the wild type (WT) and engineered A. ferrooxidans with knockdown petA2 (dPetA2), petB2 (dPetB2), petA1 (dPetA1), and petB1 (dPetB1) genes under different growth conditions. Transcriptional gene expression (×108copies / g cDNA)aCells petA2 petB2 petA1 petB1 Fe only WT 3.2 ± 0.3 2.1 ± 0.5 9.9 ± 0.2 8.6 ± 1.0 dPetA2 0.51 ± 0.02*3.0 ± 0.1 8.7 ± 0.5 9.3 ± 0.9 dPetB2 2.7 ± 0.6 0.13 ± 0.02*9.3 ± 0.8 9.0 ± 0.4 dPetA1 3.4 ± 0.8 1.9 ± 0.1 0.25 ± 0.04*8.3 ± 0.1 dPetB1 4.7 ± 0.3 3.1 ± 0.1 9.1 ± 0.5 0.89 ± 0.06*Fe and low S (0.1%, w / v) WT 8.3 ± 0.3 9.2 ± 0.8 7.6 ± 1.1 7.8 ± 0.5 dPetA2 0.81 ± 0.02*8.7 ± 1.5 6.7 ± 0.2 7.8 ± 0.2 dPetB2 7.3 ± 1.2 1.0 ± 0.1*9.1 ± 0.5 8.6 ± 1.1 dPetA1 7.0 ± 0.2 8.9 ± 1.5 0.73 ± 0.03*7.7 ± 0.3 Attorney’s Docket No.105067-101 dPetB1 8.4 ± 0.7 8.6 ± 0.9 7.4 ± 1.1 0.74 ± 0.12*Fe and high S (0.5%, w / v) WT 9.2 ± 1.1 9.8 ± 1.0 0.84 ± 0.02 0.14 ± 0.03 dPetA2 1.2 ± 0.2*9.3 ± 1.1 6.8 ± 0.5 7.2 ± 0.1 dPetB2 9.5 ± 0.1 0.91 ± 0.05*6.5 ± 0.2 8.1 ± 0.01 dPetA1 8.8 ± 1.0 9.0 ± 0.9 1.0 ± 0.1 0.85 ± 0.02 dPetB1 9.4 ± 0.8 9.6 ± 0.6 0.38 ± 0.01 0.29 ± 0.01 All tested growth medium contains 100 mM Fe2+. Symbols (*) indicate statistical significance (p< 0.05) of the gene expressions in knockdown cells compared to the wild type cells.The engineered cells were grown under different iron and sulfur concentrations, and their phenotypic responses were compared to the wild type cells. Under the high sulfur conditions (0.5%, w / v), the wild type cells oxidized sulfur while the iron oxidation was found to be repressed (Figs.3A and B). This was in contrast to the dPetA2 and dPetB2 strains which oxidized Fe2+, and less sulfur was oxidized by both cell lines (Figs.3A and B). The effect was more pronounced in the dPetB2 cells. These results suggest that the knockdown of either the petA2 or petB2 genes enables the cells to overcome the suppression of iron oxidation that normally occurs under high sulfur conditions, which is consistent to the transcriptional expressions of petA1 and petB1 genes in the dPetA2 and dPetB2 cells under high sulfur conditions (Fig. 1C and Table 1). In contrast, the profiles of iron oxidation were comparable among both engineered and wild type cells when growing only with iron, which supports the functions of the petA2 and petB2 genes for the support of sulfur oxidation (Fig.7 and Table 1). The knockdowns of the petA1 and petB1 genes showed the opposite results, as the iron oxidation remained largely suppressed, while the sulfur oxidation was similar or enhanced as compared to the wild type cells (Figs.3C and D). The repressed iron oxidation of both dPetA1 and dPetB1 cells in iron only medium further supports the functional roles of these genes in iron oxidation (Fig.7 and Table 1). Different effects were seen under lower sulfur conditions (0.1% S, w / v) (Fig.4). Sulfur oxidation by the dPetA2 and dPetB2 cells was similar to the wild type while the iron oxidation was even further accelerated in the knockdowns, with dPet2B again showing the greatest effect (Figs.4A and B). However, under these same conditions, the dPetA1 and dPetB1 cells exhibited enhanced sulfur oxidation. The knockdowns of the petA1 and petB1 genes led to reduced iron oxidation as compared to the wild type cells, which is not surprising considering the majority of electrons (~95%) from iron transfers via the downhill pathway (Figs.1 and 4C and D). Overall, these results indicate that A. ferrooxidans derives energy preferably from sulfur over iron when Attorney’s Docket No.105067-101 both substrates are present, and this can be manipulated in either direction with the knockdowns of the two different bc1 complexes (Figs.3 and 4). Enhanced iron oxidation improves bioleaching A. ferrooxidans has been widely investigated for its role in industrial mineral sulfide bioleaching and it has been shown to participate in direct contact interactions via biofilm formation as well as indirect, non-contact interactions by planktonic cells. Given the improved iron oxidation observed under sulfur abundant conditions by the dPetA2 and dPetB2 cells, we examined the effect of these knockdowns on the bioleaching of iron-bearing sulfidic ores, pyrite (FeS2) and chalcopyrite. Since we observed the better performance of the dPetB2 cells over the dPetA2 cells, in terms of the iron oxidation (Figs. 3 and 4), only the dPetB2 and dPetB1 cells, targeting of the knockdowns of the cytochrome b, were evaluated in the bioleaching experiments, while wild type cells served as controls. Remarkably, the knockdown of the petB2 gene led to enhanced bioleaching efficiencies of both minerals. The dPetB2 cells achieved final iron and copper bioleaching efficiencies of 35 ± 1% and 68 ± 3% from pyrite and chalcopyrite, respectively, which are up to 2- and 4-fold higher than the pdPetB1 or wild type control strains (Figs. 5A and B). The solid residues after the bioleaching experiments were found to be mainly composed of sulfur, jarosite, and uncreated pyrite and / or chalcopyrite, in all conditions (Fig.8). It is noteworthy that the conditions with the dPetB2 cells had fewer peaks corresponding to jarosite, particularly for chalcopyrite, in comparison with the wild type and dPetB1 cells. Considering that the jarosite formation is a main cause of the surface passivation, reduced jarosite formation is consistent with the higher bioleaching efficiency observed with this cell line (Figs. 5A and B). Furthermore, elemental analysis results indicated that the peak corresponding to carbon was not identified in either the pyrite and chalcopyrite residues after the bioleaching with dPetB2 cells, compared to the wild type and dPetB1 cells (Fig.9). This also implies that fewer dPetB2 cells were attached to the minerals during the experiments. The mineral contact modes of the cells were further evaluated, and 2-fold more planktonic cells along with up to 4- and 6-fold less biofilm formation was observed in the pyrite and chalcopyrite bioleaching with the dPetB2 cells, respectively, as compared to the dPetB1 and wild type controls (Figs. 5C and D). These results were consistent with the significantly lower transcriptional expression of the genes involved in the biofilm formation in A. ferrooxidans (i.e., sum of expressions of genes responsible for quorum sensing, cyclic-di-GMP (c-di-GMP), and extracellular polymeric substance) which was observed under the bioleaching conditions for both minerals with the dPetB2 cells (Fig.5E). In addition, the expressions of biofilm genes were higher Attorney’s Docket No.105067-101 in the conditions with the dPetB1 cells than the wild type cells, although both conditions showed comparable quantitative biofilm results. The knockdown of the cytochrome b in the dPetB2 cells caused the cells to reduce biofilm formation and remain in a planktonic state. This appears to play a crucial role in enhancing bioleaching, considering that biofilm formation can promote surface passivation via jarosite formation. Given that the extracellular sulfur metabolites and proteins generated in sulfur metabolism of A. ferrooxidans contribute to cell attachment and biofilm formation, we further examined the effect of the reduced sulfur oxidation on bioleaching. This was evaluated in wild type A. ferrooxidans cells by removing or adding sulfur intermediates that are produced during sulfur oxidation to chalcopyrite bioleaching experiments. When the sulfur intermediates were removed by periodic replacement of the leaching medium, the copper bioleaching efficiency wasincreased by 1.4-fold (Fig. 5F). On the other hand, the bioleaching efficiencies deteriorated uponthe addition of thiosulfate and tetrathionate, which are major RISCs generated during the sulfur oxidation, as compared to the controls (Fig.5G). Discussion A. ferrooxidans is rare in its ability to oxidize both iron and sulfur, and the manipulation of this substrate preference will be important as these industrially important microbes are developed for biotechnology applications. Although it is known that the petI and petII operons are found to encode ubiquinol cytochrome c reductase bc1 complexes, which catalyze electron transport during iron and sulfur oxidation (Fig.1), a full mechanistic understanding of the roles these operons play in metabolism and substrate selectivity is lacking, partially due to limited genetic tools for these organisms. Using CRISPRi with dCas12a, we observed that the downregulation of genes petA2 and petB2 (in the petII operon) led to improved iron oxidation by A. ferrooxidans in the presence of sulfur, particularly under high sulfur conditions where the iron oxidation is most suppressed in the wild type cells (Figs.3 and 4). In contrast, the suppression of petA1 and petB1 genes (in the petI operon) led to decreased iron oxidation by the cells as compared to the wild type. These results indicate that the energy substrate utilization can be tuned via regulation of the expression of genes in the petI and petII operons. Moreover, it seems that knockdown of the cytochrome b (PetB) had more of an impact than the knockdown of the Rieske iron-sulfur protein (PetA) in both operons, suggesting the cytochrome b is a metabolic control point for regulating substrate utilization, given its more direct role in electron transfer with the quinone pool. In the case of the petII operon, the observation that the petB2 gene plays more a prominent role than petA2 during sulfur oxidation is consistent with its higher transcriptional gene expression compared to other genes within petII operon. Attorney’s Docket No.105067-101 It is worth noting how manipulation of the major electron transport gene influences the metabolic pathways within A. ferrooxidans. A signal transducing system RegBA has been suggested to bind to the operons involved in iron or sulfur oxidation in A. ferrooxidans, in response to redox changes in the quinone pool. Variations in electron fluxes could be sensed by the signal transducing system, allowing the cells to establish a hierarchical order of substrate utilization. Given that cytochrome bc1complexes bifurcate electron transfer upon substrate availability for energy conservation, targeting major genes controlling electron transfer, as opposed to targeting a specific gene responsible for iron / sulfur oxidation, leads to the significant attenuation of overall substrate utilization by single gene knockdowns. The observed metabolic flexibility of A. ferrooxidans could also impact the growth and adaptation of the cells to varying environmental conditions, which is consistent its competitiveness in different ecological niches. The enhanced iron oxidation of A. ferrooxidans under sulfur-abundant conditions can have a significant impact on metal recovery from sulfidic ores, such as chalcopyrite which is the most abundant yet recalcitrant copper sulfide. Remarkably, bioleaching with the dPetB2 cells resulted in approximately 70% of the copper to be extracted from chalcopyrite, which is substantially better than what has ever been reported for the bioleaching efficiency of this mineral. During the bioleaching of chalcopyrite, direct contact by cells in biofilms as well as non-contact by planktonic cells contributes to copper liberation. The knockdown of the petB2 gene led to increased iron oxidation and this correlated with the cell localization during the bioleaching, as these cells exhibited a tendency towards a planktonic state, with lower biofilm formation and related biofilm gene expression (Figs. 5C–E and S3). These results suggest that the dominant bioleaching mechanisms can be engineered by regulating the metabolic gene expressions in A. ferrooxidans. It is plausible that the promoted iron oxidation combined with the reduced sulfur oxidation spontaneously encourages the activity of the planktonic cells, thus the overall bioleaching was shifted to favor the indirect, non-contact pathway (Fig.6). The higher cell attachment to minerals under the bioleaching conditions with the dPetB1 cells supports this possibility (Fig.9). Although the cell attachment is an important step for the mineral bioleaching, the excessive biofilm formation likely promotes surface passivation of chalcopyrite via jarosite formation, which inhibit the bioleaching. We observed less jarosite formation under the dPetB2 conditions (Fig.8), and we found that the bioleaching of chalcopyrite by the wild type cells was increased or decreased when removing (media replacement) or adding the sulfur metabolites, respectively (Figs. 5F and G). Therefore, we conclude that the reduced cell attachment coupled with enhanced iron oxidation enabled the improved bioleaching of the pyrite and chalcopyrite. Attorney’s Docket No.105067-101 It is noteworthy that such high chalcopyrite bioleaching efficiencies are not commonly observed with iron-oxidizing bacteria alone, such as Leptospirillum sp. This phenomenon may be partially attributed to the stronger adhesion forces exhibited by Leptospirillum sp., on minerals, in comparison to other bioleaching organisms including A. ferrooxidans. Rapid cell adhesion by L. ferriphilum leads to the swift coverage of chalcopyrite surfaces with sulfur and substantial amounts of jarosite, which result in low copper extraction. Furthermore, recent studies indicate that a deficiency of sulfur-oxidizing bacteria during bioleaching can result in low mineral dissolutions. Indeed, a previous bioleaching experiment using dialysis membranes reported that the bioleaching of copper waste materials reached the lowest efficiency when solely relying on the contact mechanism by A. ferrooxidans. Considering that the dPetB2 cells can still oxidize sulfur, these cells likely overcome the restricted chalcopyrite bioleaching through accelerated iron oxidation, while maintaining sulfur oxidation to some extent. This advantage could be reinforced by the reduced formation of jarosite. Our observations suggest that an increase in the contribution of the non-contact iron oxidation over the direct contact oxidation mechanism can enhance the bioleaching of iron sulfide ores. The limited repertoire of genetic tools available for A. ferrooxidans has significantly impeded the comprehensive characterization of its unique physiological traits and constrained the exploration of its promising practical applications. Although the CRISPR / Cas system has been widely used for genome editing and silencing, it has been poorly explored in extremophiles due to the harsh growth conditions. Particularly for acidophiles, only two of recent studies explored the CRISPRi with dCas9 in A. ferrooxidans and A. ferridurans. We demonstrate the applicability of the CRISPRi / dCas12a on environmentally and industrially important biomining organism, A. ferrooxidans, and explored the phenotypic responses of the core genes involved in the key metabolic processes of this organism. With technical advantages of Cas12a over Cas9, the multiplexing genome editing further enables the intricate phenotypic modifications, which should accelerate our ability to explore the poorly characterized metabolic pathways of this organism. Furthermore, the compatibility of pJRD based Cas12a / CRISPRi system provides a versatile molecular tool for genetic manipulation of other extremophiles, where genetic modification is often challenged. All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains. All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, Attorney’s Docket No.105067-101 it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention. The specific compositions and methods described herein are representative, exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention. The invention illustratively described herein may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims. As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to “a guide RNA” or “a nuclease” or “a cell” includes a plurality of such guide RNAs, nucleases or cells, and so forth. In this document, the term “or” is used to refer to a nonexclusive or, such that “A or B” includes “A but not B,” “B but not A,” and “A and B,” unless otherwise indicated. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants. Attorney’s Docket No.105067-101 The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. The Abstract is provided to comply with 37 C.F.R. §1.72(b) to allow the reader to quickly ascertain the nature and gist of the technical disclosure. The Abstract is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims.

Claims

Attorney’s Docket No.105067-101 CLAIMS WHAT IS CLAIMED:

1. A method to increase bioleaching efficiency comprising contacting a modified Acidithiobacillus ferrooxidans with pyrite, chalcopyrite or combination thereof, wherein the bioleaching efficiency is increased as compared to a wild type Acidithiobacillus ferrooxidans, wherein the modified Acidithiobacillus ferrooxidans comprises one or more mutations in the petB2 gene (in petII operon) and / or the petB1 gene (in petI operon) of A. ferrooxidans so as to knock down or knock out expression of petB2 or petB1.

2. The method of claim 1, wherein the one or more mutations are in the petB2 gene.

3. The method of claim 1 or 2, wherein at least 25% or at least 50% of iron and copper bioleaching efficiency was achieved from pyrite and chalcopyrite, respectively.

4. The method of any one of claims 1 to 3, wherein there is reduced production of jarosite as compared to wild type A. ferrooxidans.

5. The method of any one of claims 1 to 4, wherein no additives are added to aid the bioleaching process.

6. The method of any one of claims 3 to 5, wherein at least 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39% or 40% and / or at least 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 7%6, 77%, 78%, 79% or 80% of iron and copper bioleaching efficiency was achieved from pyrite and chalcopyrite, respectively.

7. A modified Acidithiobacillus ferrooxidans, wherein the modification comprises one or more mutations in the petB2 gene (in petII operon) and / or the petB1 gene (in petI operon) of A. ferrooxidans so as to knock down or knock out expression of petB2 or petB1.

Images