Oxynitidine derivatives as tyrosyl DNA phosphodiesterase inhibitors and radiosensitizers
Oxynitidine derivatives are developed to inhibit TDP1, enhancing the sensitivity of cancer cells to ionizing radiation and TOPI inhibitors, addressing the limitations of current treatments and improving treatment efficacy.
Patent Information
- Application Number
- PCT/US2025/038739
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-22
- Filing Date
- 2025-07-22
- Publication Date
- 2026-01-29
AI Technical Summary
Current cancer treatments, such as ionizing radiation and topoisomerase I inhibitors, are limited by the activity of tyrosyl DNA phosphodiesterase (TDP1), which hinders DNA repair and reduces their efficacy. There is a need for new inhibitors that can enhance radiosensitivity and synergize with TOPI inhibitors for improved antineoplastic activity.
Development of oxynitidine derivatives that inhibit TDP1 and/or human topoisomerase I, which can be used alone or in combination with chemotherapeutic agents like camptothecin, and ionizing radiation to sensitize cancer cells.
The oxynitidine derivatives effectively inhibit TDP1, enhancing the sensitivity of cancer cells to ionizing radiation and TOPI inhibitors, leading to increased antineoplastic activity and improved treatment outcomes.
Smart Images

Figure US2025038739_29012026_PF_FP_ABST
Abstract
Description
OXYNITIDINE DERIVATIVES AS TYROSYL DNA PHOSPHODIESTERASE INHIBITORS AND RADIOSENSITIZERSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Patent Application no. 63 / 674,198, filed July 22, 2024, which is hereby incorporated herein by reference in its entirety.STATEMENT OF GOVERNMENTAL INTEREST
[0002] This invention was made with government support under BC 006150 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0003] A computer readable form of the Sequence Listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The Sequence Listing is contained in the file created on July 22, 2025, having the file name “24-0544_Sequence_Listing_ST26.xml,” and being 16,775 bytes in size.BACKGROUND
[0004] Tyrosyl DNA phosphodiesterase (TDP1) is an enzyme that functions as a regulator of non-homologous end joining (NHEJ) in the repair of DNA double-strand break (DSB) and a DNA repair enzyme that removes the 3 ’-adducts of DNA breaks, including 3’- phosphoglycolate, the metabolite formed by ionizing radiation (IR), to promote the NHEJ repair process. Accordingly, cells with deficient TDP1 show decreased NHEJ and are highly sensitive to IR. These observations indicate that TDP1 might be a potential target for cancer radiotherapy, and its inhibitors might be capable to sensitize cancer cells to IR. TDP1 is also known to repair damage caused by stalled topoisomerase IB (TOPI) covalent complexes, the formation of which is a mechanism of action for TOPI inhibitors, a well-known class of antineoplastic agents (including camptothecin and its derivatives). Thus, TDP1 activity can limit efficacy of TOPI inhibitors and, conversely, TDP1 inhibitors may enhance TOPI inhibitor activity. Therefore, there is a need for new TDP1 inhibitors as antitumor agents that can, e.g., increase the radiosensitivity of cancer cells and act synergistically with TOPI inhibitors for enhanced antineoplastic activity.SUMMARY
[0005] The inventors have discovered a class of oxynitidine derivatives that inhibit tyrosyl DNA phosphodiesterase (TDP1) and / or human topoisomerase I (TOPI). Various compounds of Formula I are useful as anti-cancer agents, either alone or in combination with a chemotherapeutic agent that induces TOPI-mediated DNA damage, such as camptothecin. The compounds may also be radiosensitizing agents that would be used in combination with ionizing radiation.
[0006] In an aspect, the disclosure provides compounds of Formula I and pharmaceutically acceptable salts thereof:Formula I
[0007] In this aspect of the disclosure, the variables of Formula I, e.g. R1, R2, R7, R8, X and Y, carry the following definitions:
[0008] The groupwhich RYis selected from -LYA-RYA,-LYA-CyYA, -methyl, ethyl, and -Cs-Csalkyl, which Cs-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl. In these definitions, each LYAis independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; and RYAis selected from -NRYD2, -NHRYD, -NH2, -NHBOC, -ORYD, -OH, -SRYD, -SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl; and CyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one ormore substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; or
[0009] the groupwhich Rxis selected from -AX-LXA-RXA, -Ax-LXA-CyXA-Ax-Ci-C8alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, and can be substituted by oxo, -CyXA, and -RXA. In these definitions, each Axis independently O, NH or absent; each LXAis independently Ci-Csalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBOC, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2I!XI), in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Cs-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cealkyl which Ci-CCalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.
[0010] In the compounds of Formula I according to this aspect of the disclosure, the group R1is selected from Cy1A-L1A-, R1A-L1A-, Cy1B-L1B-Cy1A-L1A-, R1B-L1B-Cy1A-L1A, C1-C4 alkyl, (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo) and H. In these definitions, each L1Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy1Ais independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Cs-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-CCalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, Ci-Csfluoroalkoxy; R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl; Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; R1Bis selectedfrom R1E2N-, R1EHN-, H2N-, BOCHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0011] In the compounds of Formula I according to this aspect of the disclosure, the group R2is selected from Ci-C4alkyl (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo), Cy2A-L2A-, R2A-L2A-, R2B-L2B-Cy2A-L2A-, Cy2B-L2B-Cy2A- L2A-, and H. In these definitions, each L2Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy2Ais independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Cs-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cbalkyl which Ci -Chalky I can be substituted by oxo, halogen, nitro, cyano, Ci-Chalkoxy, Ci-Csfluoroalkyl, Ci-Chfluoroalkoxy; R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl; Cy2Bis selected from Ch-Cioheterocycloalkyl, Ch-Cioheteroaryl, Ch-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Chalkyl which Ci-Chalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Chalkoxy, Ci-Chfluoroalkyl, Ci-Csfluoroalkoxy; R2Bis selected from R2E2N-, R2EHN-, H2N-, BOCHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Chalkyl; and each L2Bis independently Ci-Chalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-CUalkyl.
[0012] In the compounds of Formula I according to this aspect of the disclosure, the groups R3, R4, R6and R9are each independently H, halogen, cyano, Ci-C4alkyl (which Ci-C4alkyl can contain one or more double or triple bonds), or Ci-C4fluoroalkyl,
[0013] In the compounds of Formula I according to this aspect of the disclosure, the group R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy.
[0014] In the compounds of Formula I according to this aspect of the disclosure, the group R7is selected from H, Cy7A-L7A-A7-, R7A-L7A-A7-, R7B-L7B-Cy7A-L7A-A7-, Cy7B-L7B-Cy7A-L7A-A7-, and C1-C4 alkyl (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo). In these definitions, each A7is independently O, NH or absent; each L7Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy7Ais independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci -Chalky I can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS- and -CN, in which each R7Dis independently Ci-Cealkyl; Cy7Bis selected from C4-Cwheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; R7Bis selected from R7E2N-, R7EHN-, H2N-, BOCHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0015] In the compounds of Formula I according to this aspect of the disclosure, the group R8is selected from H, Cy8A-L8A-A8-, R8A-L8A-A8-, R8B-L8B-Cy8A-L8A-A8-, Cy8B-L8B-Cy8A-L8A-A8-, and C1-C4 alkyl (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo); in which A8is O, NH, -O(O)C- or absent; each L8Ais independently a bond or Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo or hydroxy, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy8Ais independently selected from C4- Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci -Chalky I can besubstituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, Ci-Csfluoroalkoxy; R8Ais selected from H, R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, -CN and halo (e g., Cl or F), in which each R8Dis independently Ci-Cealkyl; Cy8Bis selected from C4- Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci -Chalky I can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently a bond or Ci-C4alkyl, which Ci-C4 lkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0016] In the compounds of Formula I according to this aspect of the disclosure, at least one of R1, R2, R7and R8is other than H or C1-C4 alkyl.
[0017] This aspect of the disclosure also includes pharmaceutically-acceptable salts of the compounds of the disclosure as described herein.
[0018] Pharmaceutical compositions including a compound or salt of Formula I together with a pharmaceutically acceptable carrier are also disclosed.
[0019] The disclosure provides methods of inhibiting TDP1 and / or TOPI in vivo or in vitro including contacting a cell nucleus with a compound or salt of Formula I.
[0020] The disclosure provides methods of treating cancer in a patient including administering a therapeutically effective amount of a compound or salt of Formula I to the patient (e.g., in the form of a pharmaceutical composition as described herein).
[0021] The disclosure provides methods of treating cancer in a patient including administering a therapeutically effective amount of a compound or salt of Formula I in combination with and a TOPI inhibitor that is not a compound or salt of Formula I to the patient.
[0022] The disclosure provides methods of treating cancer in a patient including administering a therapeutically effective amount of a compound or salt of Formula I in combination with ionizing radiation.
[0023] The disclosure provides compounds of Formula I useful as TDP1 inhibitors useful as radiosensitizing and antineoplastic agents.
[0024] The disclosure provides pharmaceutical compositions containing a compound of Formula I as a first active agent and optionally one or more additional active agents.BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIGS. 1A, IB, 1C, and ID show that TDP1 is upregulated in colorectal cancer (CRC) cells and its knockout makes HCT116 cells sensitive to ionizing radiation (IR). (FIG. 1A) Expression levels of TDP1 in 11 types of tumors and the corresponding normal tissues in The Cancer Genome Atlas (TCGA) database. (FIG. IB, 1C) The sensitivity of wild-type and SgTDPl-HCT116 cells to IR. The colony formation assay results (FIG. IB) and survival curves (FIG. 1C). (FIG. ID) Western blotting gel of wild type and SgTDPl-HCTl 16 cells.
[0026] FIGS. 2A, 2B, 2C, 2D, 2E, 2F and 2G show screening for radiosensitizers. (FIG. 2A) A schematic diagram of colony formation assay. (FIG. 2B) The representative images of colony formation assay of NTD119B combined with or without IR in HCT116 cells. (FIG. 2C) The HCT116 cells survival after being treated with the active compounds alone (left) or combined with IR (2 GY, right), using PT33 as a positive control. The tested concentration of several compounds according to Formula I is 0.1 pM otherwise NTD119B (also known as, compound 45) and NTD119C (1.0 pM). The experiments were conducted independently at least twice. (FIG. 2D) The structure the TDP1 inhibition gel of NTD119B. Lane 1, DNA alone; lane 2, DNA and TDP1; lanes 3-10, DNA, TDP1 and NTD119B at 0.051, 0.15, 0.46, 1.4, 4.1, 12.3, 37, and 111 pM. Combination effects of NTD119B with IR in HCT116 (FIG. 2E), RKO (FIG. 2F), SW480 (FIG. 2G) and NCM 460 (FIG. 2J) cells were tested through colony formation assays. The experiments were conducted independently at least twice. FIGS. 2H and 21 provide data for additional compounds. FIG. 2K provides data on combination effects of compound 49 on HCT116 cells. FIG. 2L provides combination index values for compound 45 and compound 49 with IR in the various cell lines.
[0027] FIGS. 3A, 3B, 3C, 3D and 3E show the radiosensitization activity ofNTD119B in vivo. (FIG. 3 A) Acute toxicity of NTD119B in Kunming mice (n = 3). (FIG. 3B) The schematic diagram of the experiments. The effects of combination administration on tumor volume (FIG. 3C (top; graphical) and (bottom; visual) panels), tumor weight (FIG. 3D) and body weight (FIG. 3E).
[0028] FIGS. 4A, 4B, 4C and 4D show NTD119B induced DSB by targeting cellular TDP1. (FIG. 4A) Thermal melting curves of cel lular TDP1 after incubation of NTD119B with IR, (FIG. 4B) In vivo Complex of Enzyme (ICE) assay of NTD119B combined with IR inHCT116 (FIG. 4C) Hypothetical binding mode between NTD119B and TDP1 (PDB 1 RFF). NTD119B was shown as yellow carbon atoms ball and stick representation. (FIG. 4D) Radiosensitization of NTD119B in SgTDPl-HCTl 16 cells.
[0029] FIGS. 5 A, 5B, 5C, 5D, 5E, 5F, 5G and 5H show NTD119B suppresses NHEJ repair by blocking the recruitment of XRCC4 to DNA damage sites. (FIG. 5 A) Schematic diagrams for the NHEJ (top) and HR (bottom) reporters. (FIG. 5B) The effects of NTD119B on the NHEJ repair level in HCT116 and SgTDP 1 -HCT 116 cells. (FIG. 5C) The effect of HR repair levels in HCT116 cells treated with NTD119B. (FIG. 5D) Protein expression levels detected through western blotting assays. (FIG. 5E) The quantified transcript and translation levels of XRCC4, Ku70, Ku80 and Lig4 in HCT116 cells after NTD119B treatment combined with IR. (FIG. 5F ) C o-localization images of X-ray repair cross complementing protein 4 (XRCC4) and phosphorylated H2A histone family member X (y-EEAX). (FIG. 5G) Colocalization analysis of XRCC4 and y-I-fcAX on the zoom of figure D by Image J software. (FIG. 5H) y -HsAX foci induced by NTD119B and IR alone or combining treatment in HCT116 cells. Every experiment was repeated at least three times independently.
[0030] FIG. 6A, 6B, 6C, 6D, 6E, 6F and 6G show that NTD119B can significantly increase cellular p53-inducible gene 3 (PIG3) expression. (FIG. 6A) Volcano plot of RNA seq experiments in HCT116 cells treated with NTD119B. Negative regulators with a threshold of false discovery rate (FDR) < 0.05 are labeled as small gray dots. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of the selected significantly positive (FIG. 6B) and negative (FIG. 6C) genes. (FIG. 6D) Gene set enrichment analysis (GSEA analysis) of p53 signaling pathway. Transcript (FIG. 6E) and translation (FIG. 6F) levels of PIG3 in HCT116 cells treated with NTD119B combined with IR. (FIG. 6G) Immunohistochemical results of PIG3 protein expression in tumor tissues after being treated with DMSO (top panel), and NTD119B at 1 mg / kg (middle panel) and 10 mg / kg (bottom panel). Every experiment was repeated at least three times independently.
[0031] FIG. 7A, 7B, 7C, 7D, 7E, 7F, 7G, 7H, 71 and 7J show that NTD119B induced ROS- mediated mitochondrial dysfunction, cell cycle arrest and apoptosis. (FIG. 7A) ROS levels in HCT116 cells after being treated of NTD119B with or without IR. (FIG. 7B) NTD119B induced ROS-mediated mitochondrial dysfunction detected by intercellular ROS. (FIG. 7C) NTD119B induced ROS-mediated mitochondrial dysfunction detected by mitochondrial membrane potential. (FIG. 7D) Mitochondrial membrane potential ofHCT116 cells after being treated of NTD119B with or without IR for 24 h. (Red fluorescence and greenfluorescence represent the high and low membrane potentials, respectively. Scale bar = 30 pm). (FIG. 7E) GSEA analysis of cell cycle. (FIG. 7F) Cell cycle profiles of HCT116 cells after being treated of NTD119B with or without IR. (FIG. 7G) GSEA analysis of apoptosis. (FIG. 7H) Apoptosis of HCT116 cells after being treated of NTD119B with or without IR. (FIG. 71) TUNEL assays of HCT116 tumor tissues after being treated of NTD119B with or without IR. Scale bar = 200 pm. (FIG 7J) Expression of apoptosis-related proteins in HCT116 cells after being treated of NTD119B with or without IR for 24 h.
[0032] FIG 8 shows a schematic for the synthesis of 12-(2-(dimethylamino)ethyl)-2- methoxy-3-(2-morpholinoethoxy)-[l,3]dioxolo[4',5':4,5]benzo[l,2-c]phenanthridin-13(12H)- one (NTD119B).
[0033] FIG. 9 shows a schematic for the synthesis of 2,3-dimethoxy-13-(2-(pyrrolidin-l- yl)ethoxy)-5 -(3 -(4-(2-(pyrrolidin- 1 -yl)ethyl)piperazin- 1 -yl)propoxy)- [l,3]dioxolo[4',5':4,5]benzo[l,2-c]phenanthridine (YH-J113).DETAILED DESCRIPTIONDEFINITIONS
[0034] Prior to setting forth the aspects and embodiments of the disclosure in detail, it may be helpful to provide definitions of certain terms to be used in this disclosure. Compounds are described using standard nomenclature. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. Unless clearly contraindicated by the context each compound name includes the free acid or free base form of the compound as well as all pharmaceutically acceptable salts of the compound.
[0035] The term “compounds of Formula I” encompasses all compounds that satisfy Formula I, in any stereoisomeric form, including any enantiomers, racemates and stereoisomers, as well as all pharmaceutically acceptable salts of such compounds.
[0036] The terms “a” and “an” do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced item. The term “or” means “and / or”. The open- ended transitional phrase “comprising” encompasses the intermediate transitional phrase “consisting essentially of’ and the close-ended phrase “consisting of.” Claims reciting one of these three transitional phrases, or with an alternate transitional phrase such as “containing” or “including” can be written with any other transitional phrase unless clearly precluded by the context or art. All methods described herein can be performed in any suitable order unlessotherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention as used herein. Unless defined otherwise, technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs.
[0037] An “active agent” means a compound (including a compound disclosed herein), element, or mixture that when administered to a patient, alone or in combination with another compound, element, or mixture, confers, directly or indirectly, a physiological effect on the patient. The indirect physiological effect may occur via a metabolite or other indirect mechanism.
[0038] A dash ("-") that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -(C=O)OH is attached through carbon of the keto (C=O) group.
[0039] Unless defined to the contrary in the context of a specifically described genus of compounds:
[0040] “Alkyl” is a branched or straight chain saturated aliphatic hydrocarbon group, having the specified number of carbon atoms, generally from 1 to about 8 carbon atoms. The term Ci-Cealkyl as used herein indicates an alkyl group having from 1, 2, 3, 4, 5, or 6 carbon atoms. Other embodiments include alkyl groups having from 1 to 8 carbon atoms, 1 to 4 carbon atoms or 1 or 2 carbon atoms, e.g. Ci-C4alkyl and Ci-C2alkyl. When Co-Cnalkyl is used herein in conjunction with another group, for example, -Co-C2alkyl(phenyl), the indicated group, in this case phenyl, is either directly bound by a single covalent bond (Coalkyl), or attached by an alkyl chain having the specified number of carbon atoms, in this case 1, 2, 3, or 4 carbon atoms. Alkyls can also be attached via other groups such as heteroatoms as in -0-Co-C4alkyl(C3-C7cycloalkyl). Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, 3 -methylbutyl, t-butyl, n-pentyl, and sec-pentyl.
[0041] “Alkoxy” is an alkyl group as defined above with the indicated number of carbon atoms covalently bound to the group it substitutes by an oxygen bridge (-O-). Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, 2-butoxy, t-butoxy, n-pentoxy, 2-pentoxy, 3- pentoxy, iso-pentoxy, neopentoxy, n-hexoxy, 2- hexoxy, 3 -hexoxy, and 3 -m ethylpentoxy.
[0042] “Cycloalkyl” is a saturated hydrocarbon ring group, having the specified number of carbon atoms. Monocyclic cycloalkyl groups typically have from 3 to about 8 carbon ring atoms or from 3 to 7 (3, 4, 5, 6, or 7) carbon ring atoms. Cycloalkyl substituents may be pendant from a substituted nitrogen, sulfur, oxygen or carbon atom, or a substituted carbon atom that may have two substituents may have a cycloalkyl group, which is attached as a spiro group. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl as well as bridged or caged saturated ring groups such as norbomane or adamantine.
[0043] “Haloalkyl” includes both branched and straight-chain alkyl groups having the specified number of carbon atoms, substituted with 1 or more halogen atoms, up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.
[0044] “Haloalkoxy” is a haloalkyl group as defined herein attached through an oxygen bridge (oxygen of an alcohol radical).
[0045] “Halo” or “halogen” indicates any of fluoro, chloro, bromo, and iodo.
[0046] “Mono- and / or di-alkylamino” is a secondary or tertiary alkyl amino group, wherein the alkyl groups are independently chosen alkyl groups, as defined herein, having the indicated number of carbon atoms. The point of attachment of the alkylamino group is on the nitrogen. Examples of mono- and di-alkylamino groups include ethylamino, dimethylamino, and methyl-propyl-amino.
[0047] The term “substituted,” as used herein, means that any one or more hydrogens on the designated atom or group is replaced with a selection from the indicated group, provided that the designated atom's normal valence is not exceeded. When the substituent is oxo (i.e., =0) then 2 hydrogens on the atom are replaced. When an oxo group substitutes aromatic moieties, the corresponding partially unsaturated ring replaces the aromatic ring. For example, a pyridyl group substituted by oxo is a pyridone. Combinations of substituents and / or variables are permissible only if such combinations result in stable compounds or useful synthetic intermediates. A stable compound or stable structure is meant to imply a compound that is sufficiently robust to survive isolation from a reaction mixture, and subsequent formulation into an effective therapeutic agent. Unless otherwise specified substituents are named into thecore structure. For example, it is to be understood that when aminoalkyl is listed as a possible substituent the point of attachment of this substituent to the core structure is in the alkyl portion.
[0048] Suitable groups that may be present on a “substituted” or “optionally substituted” position include, but are not limited to, e g., halogen; cyano; hydroxyl; oxo; amino; or 1 to about 6 carbon atoms; alkoxy groups having one or more oxygen linkages and from 1 to about 8, or from 1 to about 6 carbon atoms; haloalkyl groups having one or more halogens and from 1 to about 8, or from 1 to about 6 carbon atoms; haloalkoxy groups having one or more oxygen linkages and one or more halogens and from 1 to about 8, or from 1 to about 6 carbon atoms; and aminoalkyl groups including groups having one or more N atoms and from 1 to about 8, or from 1 to about 6 carbon atoms.
[0049] In various embodiments an “optionally substituted group” that is not further defined with a listing of substituents is optimally substituted with one or more substituents independently chosen from halogen, hydroxyl, amino, cyano, oxo, -COOH, Ci-Cealkyl, Ci-Cealkoxy, C3-C?cycloalkyl, (mono- or di-Ci-C4alkylamino)Co-C4alkyl, Ci-C2haloalkyl, and Ci-C2haloalkoxy.
[0050] A “dosage form” means a unit of administration of an active agent. Examples of dosage forms include tablets, capsules, injections, suspensions, liquids, emulsions, creams, ointments, suppositories, inhalable forms, transdermal forms, and the like.
[0051] “Pharmaceutical compositions” are compositions comprising at least one active agent, such as a compound or salt of Formula I, and at least one other substance, such as a carrier. Pharmaceutical compositions optionally contain one or more additional active agents. When specified, pharmaceutical compositions meet U.S. FDA GMP (good manufacturing practice) standards for human or non-human drugs.
[0052] “Pharmaceutically acceptable salts” includes derivatives of the disclosed compounds in which the parent compound is modified by making inorganic and organic, non-toxic, acid or base addition salts thereof where the counterion salt is pharmaceutically acceptable. The salts of the present compounds can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting free acid forms of these compounds with a stoichiometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, or the like), or by reacting free base forms of these compounds with a stoichiometric amount of theappropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two. Generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred, where practicable. Salts of the present compounds further include solvates of the compounds and of the compound salts.
[0053] Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts and the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, conventional non-toxic acid salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, mesylic, esylic, besylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, HOOC-(CH2)n-COOH where n is 0-4, and the like.
[0054] The term “carrier” applied to pharmaceutical compositions / combinations of the present disclosure refers to a diluent, excipient, or vehicle with which an active compound is provided. To be pharmaceutically acceptable a carrier must be safe, non-toxic and neither biologically nor otherwise undesirable.
[0055] A “patient” is a human or non-human animal in need of medical treatment. Medical treatment can include treatment of an existing condition, such as a disease or disorder, prophylactic or preventative treatment, or diagnostic treatment. In certain embodiments disclosed herein “medical treatment” means treatment of a diagnosed cancer or known tumor. In certain embodiments the patient is a human patient.
[0056] When a compound of Formula I is provided with “an additional active agent” the compound of Formula I is a first active agent and the additional active agent(s) can be provided simultaneously in a single dosage form, provided concomitantly in separate dosage forms, or provided in separate dosage forms for administration separated by some amount of time that is within the time in which both the compound of Formula I and the additional active agent are within the blood stream of a patient. In certain embodiments the compound of Formula I and the additional active agent need not be prescribed for a patient by the same medical care worker. In certain embodiments the additional active agent or agents need notrequire a prescription. Administration of the compound of Formula I and the additional active agent can occur via any appropriate route, for example, oral tablets, oral capsules, oral liquids, inhalation, injection, suppositories or topical contact.
[0057] “Treatment,” as used herein includes providing a compound of Formula I, either as the only active agent or together with an additional active agent sufficient to: (a) prevent or decrease the likelihood a disease or a symptom of a disease from occurring in a patient who may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e. arresting its development; and (c) relieving the disease, i.e., causing a remission of the disease. “Treating” and “treatment” also means providing a therapeutically effective amount of a compound of Formula I as the only active agent or together with at least one additional active agent to a patient having a disease or disorder that can be effectively treated with a TDP1 inhibitor, such a cancer.
[0058] A “therapeutically effective amount” of a pharmaceutical composition / combination of this disclosure means an amount effective, when administered to a patient, to provide a therapeutic benefit such as an amelioration of symptoms, e.g., an amount effective to decrease the symptoms of cancer. For example, a patient having cancer may present detectable levels of certain tumor markers, including CA 125, CEA, CA19-9, AFP, PSA, and galactosyltransferase. A therapeutically effect amount is thus an amount sufficient to provide a significant reduction in elevated tumor marker levels or an amount sufficient to provide a return of tumor marker levels to the normal range. A therapeutically effective amount is also an amount sufficient to prevent a significant increase in tumor size relative that usually seen in untreated patients having the same cancer, or significantly reduce tumor size or tumor number, or causes tumors to disappear from the patient’s body altogether.
[0059] Preferably the counterion is a pharmaceutically acceptable counterion. Suitable anionic salt forms include, but are not limited to, acetate, benzoate, benzilate, bitartrate, bromide, carbonate, chloride, citrate, edetate, edisylate, estrate, fumarate, gluceptate, gluconate, hydrobromide, hydrochloride, iodide, lactate, lactobionate, malate, maleate, mandelate, mesylate, methyl bromide, methyl sulfate, mucate, napsylate, nitrate, embonate, phosphate and diphosphate, salicylate and disalicylate, stearate, succinate, sulfate, tartrate, tosylate, Suitable cationic salt forms include, but are not limited to, aluminum, benzathine, calcium, ethylenediamine, lysine, magnesium, meglumine, potassium, procaine, sodium, tromethamine, zinc, and the like, including triethiodite, valerate, and the like.
[0060] A significant increase or reduction in the detectable level of tumor markers, tumor size, or tumor number, is any detectable change that is statistically significant in a standard parametric test of statistical significance such as Student’s T-test, where p < 0.05.CHEMICAL DESCRIPTION
[0061] The disclosure provides compounds, pharmaceutically acceptable salts and compositions of according to Formula I, methods of treating cancer in a patient, comprising administering a therapeutically effective amount of a compound of Formula I, which may be a TDP1 inhibitor or cancel cell sensitizer to ionizing radiation, to a patient in need of such treatment. In certain situations, the compounds of Formula I may contain one or more asymmetric elements such as stereogenic centers, stereogenic axes and the like, e.g. asymmetric carbon atoms, so that the compounds can exist in different stereoisomeric forms. These compounds can be, for example, racemates or optically active forms. For compounds with two or more asymmetric elements, these compounds can additionally be mixtures of diastereomers. For compounds having asymmetric centers, it should be understood that all of the optical isomers and mixtures thereof are encompassed. In addition, compounds with carbon-carbon double bonds may occur in Z- and E-forms, with all isomeric forms of the compounds being included in the present disclosure. In these situations, single enantiomers, i.e., optically active forms, can be obtained by asymmetric synthesis, synthesis from optically pure precursors, or by resolution of the racemates. Resolution of the racemates can also be accomplished, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography, using, for example using a chiral HPLC column.
[0062] Where a compound exists in various tautomeric forms, the invention is not limited to any one of the specific tautomers, but rather includes all tautomeric forms.
[0063] The present disclosure includes all isotopes of atoms occurring in the present compounds. Isotopes include those atoms having the same atomic number but different mass numbers. By way of general example, and without limitation, isotopes of hydrogen include tritium and deuterium and isotopes of carbon includenC,13C, and14C.
[0064] Generally, the disclosure provides compounds and salts of Formula I in which the variables, e.g., R'-R9, X, Y, and their sub-variables, carry any of the definitions set forth below. Any of the variable definitions set forth below can be combined with any other of the variable definitions so long as a stable compound results.
[0065] In an aspect, the disclosure provides compounds and salts of Formula I and the pharmaceutically acceptable salts thereof:Formula I
[0066] In this aspect of the disclosure, the variables of Formula I, e.g. R1, R2, R7, R8, X and Y, carry the following definitions:which RYis selected from -LYA-RYA,-LYA-CyYA, -methyl, ethyl, and -Cs-Csalkyl, which Cs-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl. In these definitions, each LYAis independently Ci-Csalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; and RYAis selected from -NRYD2, -NHRYD, -NH2, -NHBOC, -ORYD, -OH, -SRYD, -SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl; and CyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; orbonds, and can be substituted by oxo, -CyXA, and -RXA. In these definitions, each Axis independently O, NH or absent; each LXAis independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBOC, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2RXI), in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Cs-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, Ci-Cafluoroalkoxy.
[0069] In the compounds of Formula I according to this aspect of the disclosure, the group R1is selected from Cy1A-L1A-, R1A-L1A-, Cy1B-L1B-Cy1A-L1A-, R1B-L1B-Cy1A-L1A, C1-C4 alkyl, (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo) and H. In these definitions, each L1Ais independently Ci-Csalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy1Ais independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, Ci-Csfluoroalkoxy; R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl; Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Cg-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; R1Bis selected from R1E2N-, R1EHN-, H2N-, BOCHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Csalkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0070] In the compounds of Formula I according to this aspect of the disclosure, the group R2is selected from Ci-C4alkyl (which can contain one or more double or triple bonds, and isoptionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo), Cy2A-L2A-, R2A-L2A-, R2B-L2B-Cy2A-L2A-, Cy2B-L2B-Cy2A- L2A-, and H In these definitions, each L2Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy2Ais independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-CCalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl; Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; R2Bis selected from R2E2N-, R2EHN-, H2N-, BOCHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0071] In the compounds of Formula I according to this aspect of the disclosure, the groups R3, R4, R6and R9are each independently H, halogen, cyano, Ci-C4alkyl (which Ci-C4alkyl can contain one or more double or triple bonds), or Ci-C4fluoroalkyl,
[0072] In the compounds of Formula I according to this aspect of the disclosure, the group R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy.
[0073] In the compounds of Formula I according to this aspect of the disclosure, the group R7is selected from H, Cy7A-L7A-A7-, R7A-L7A-A7-, R7B-L7B-Cy7A-L7A-A7-, Cy7B-L7B-Cy7A-L7A-A7-, and C1-C4 alkyl (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo). In these definitions, each A7is independently O, NH or absent; each L7Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy7Ais independently selected fromC4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which C i -Chalky 1 can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS- and -CN, in which each R7Dis independently Ci-Cealkyl; Cy7Bis selected from C4-Cwheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R7Bis selected from R7E2N-, R7EHN-, H2N-, BOCHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0074] In the compounds of Formula I according to this aspect of the disclosure, the group R8is selected from H, Cy8A-L8A-A8-, R8A-L8A-A8-, R8B-L8B-Cy8A-L8A-A8-,Cy8B-L8B-Cy8A-L8A-A8-, and C1-C4 alkyl (which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo); in which A8is O, NH, -O(O)C- or absent; each L8Ais independently a bond or Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo or hydroxy, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; each Cy8Ais independently selected from C4- Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cealkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R8Ais selected from H, R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, -CN and halo (e.g., Cl or F), in which each R8Dis independently Ci-Cealkyl; Cy8Bis selected from C4- Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cealkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy; R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci- C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and canhave one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-Chalkyl.
[0075] In the compounds of Formula I according to this aspect of the disclosure, at least one of R1, R2, R7, R8and R9is other than H or C1-C4 alkyl.
[0076] In various embodiments of the compounds and pharmaceutically-acceptable salts of Formula I, the groupwhich RYis selected from-LYA-RYA,-LYA-CyYA,-methyl,-ethyl, and-Ca-Csalkyl, which Ca-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, in which each LYAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, andRYAis selected from -NRYD2, -NHRYD, -NH2, -NHBoc, -ORYD, -OH, -SRYD, - SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl, andCyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Cwcycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Chalkyl which Ci -Chalky I can be substituted by oxo, halogen, cyano, Ci-Chalkoxy, Ci-Chfluoroalkyl, Ci-Chfluoroalkoxy; orthe groupwhich Rxis selected from-AX-LXA-RXA,-Ax-LXA-CyXA’-Ax-Ci-C8alkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, and can be substituted by oxo,-CyXA, and-RXA, in which each Axis independently O, NH or absent, each LXAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBoc, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2RXIJ, in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R1is selected fromCy1A-L1A-,R1A-L1A-,Cy1B-L1B-Cy1A-L1A-,RiB.LiB_CyIA_LIA_,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, andH, whereineach L1Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy1Ais independently or selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from C 1 -CNalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl;Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from C 1 -C?al ky 1 which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy;R1Bis selected from R1E2N-, R1EHN-, H2N-, BocHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,R2is selected fromCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo,Cy2A-L2A-,R2A-L2A-,R2B_L2B_Cy2A_L2A_5Cy2B-L2B-Cy2A-L2A-, andH, wherein each L2Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one ormore CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy2Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl;Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Cwcycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, Ci- Cafluoroalkoxy;R2Bis selected from R2E2N-, R2EHN-, H2N-, BocHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R3is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R4is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl ;R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy;R6is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R7is selected fromH,Cy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.5Cy7B-L7B-Cy7A-L7A-A7-,Ci-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A7is independently O, NH or absent each L7Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cwheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS-, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R8is selected fromH,Cy8A-L8A-A8-,R8A_L8A_A8_,R8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8A-L8A-A8-, andCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A8is O, NH, -O(O)C- or absent; each L8Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cwheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, in which each R8Dis independently Ci-Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; andR9is H, with the proviso that at least one of R1, R2, R7, R8, and R9is other than H or C1-C4 alkyl.
[0077] In various embodiments of the compounds and pharmaceutically-acceptable salts of Formula I, at least one of R1, R2, R7and R8is other than H or C1-C4 alkyl.
[0078] In various embodiments of the compounds and pharmaceutically-acceptable salts ofFormula I, the group
[0079] In various such embodiments, RYis -LYARYA.
[0080] In various such embodiments, RYAis -NRYD2, -NHRYDor -NH2. For example, in various embodiments, RYAis -NRYD2, for example, dimethylamino, diethylamino, or dipropylamino. In various embodiments, RYAis dimethylamino.
[0081] In various embodiments, RYis -LYACyYA.
[0082] In various such embodiments, CyYAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci -Chalky I which Ci- Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl or Ci- Cifluoroalkoxy. In various such embodiments CyYAis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LYAthrough a nitrogen atom thereof In various embodiments, CyYAis unsubstituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LYAthrough a nitrogen atom thereof.
[0083] In various embodiments in which RYincludes an LYAgroup, LYAis -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. For example, in various embodiments, LYAis -CH2CH2-. In various embodiments, LYAis -CH2CH2CH2-.
[0084] In various other embodiments in which RYincludes an LYAgroup, LYAis Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2. For example, in various embodiments, LYAis -CH2CH2N+(CH3)2CH2CH2-.
[0085] In various embodiments, RYis methyl.
[0086] In various embodiments, RYis ethyl.
[0087] In various embodiments, RYis Ca-Cgalkyl, which Cs-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10isindependently H or Ci-C4alkyl; and in some embodiments, RYis Ci-Csalkyl having the formula -CnH(2n+i) in which n is in the range of 3-8, e.g., 4-8 or 5-8.
[0088] In various embodiments, RYis selected from -LYARYAand -LYACyYA, in which LYAis -CH2CH2- or -CH2CH2CH2-; and RYAis selected from -NRYD2, in which each RYDis independently Ci-Csalkyl; or CyYAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.
[0089] In various other embodiments of the compounds and pharmaceutically-acceptable salts of Formula I, the group
[0090] In various embodiments (i.e., in which Rxis -AX-LXA-RXA, -Ax-LXA-CyXA, or -Ax-Ci-Csalkyl), Axis O or NH. In various such embodiments, Axis O.
[0091] In various embodiments, Rxis -AX-LXARXA. In various embodiments, Rxis -RXA. In various such embodiments, (i.e., in which Rxis -AX-LXARXAor -RXA) RXAis -NRXD2, -NHRXD, or -NH2. In some embodiments RXAis -NRXD2, for example, dimethylamino, diethylamino, or dipropylamino. In various embodiments, RXAis dimethylamino.
[0092] In various embodiments, Rxis -Ax-LXACyXA. In various embodiments, Rxis -CyXA. In various such embodiments, CyXAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, or Ci-Csfluoroalkoxy. In various embodiments, CyXAis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LXAthrough a nitrogen atom thereof. In various embodiments, CyXAis unsubstituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LXAthrough a nitrogen atom thereof. In various embodiments, CyXAis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy.
[0093] In various embodiments (i.e., in which Rxis -AX-LXA-RXAor -Ax-LXA-CyXA), LXAis -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. In various embodiments LXAis -CH2CH2-. In various embodiments, LXAis -CH2CH2CH2-.
[0094] In various embodiments (i.e., in which Rxis -AX-LXA-RXAor -Ax-LXA-CyXA), LXAis Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.
[0095] In various embodiments, Rxis Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl. In various such embodiments, Rxis Ci-Csalkyl having the formula -CnH(2n+i) in which n is in the range of 1-8, while in some embodiments, Rxis Ci-Csalkyl having one or two double bonds. In still other embodiments, Rxis methyl or ethyl, e.g., methyl.
[0096] In various embodiments Rxis selected from -AX-LXA-RXAand -Ax-LXA-CyXA, in which Axis O; LXAis -CH2CH2- or -CH2CH2CH2-; RXAis -NRXD2, in which each RXDis independently Ci-C3alkyl; and CyXAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.
[0097] Regardless of the identityasdescribed above, in various embodiments of the compounds and salts of Formula I, R1is selected from Cy1A-L1A-, R1A-L1A-, R1B-L1B-Cy1A-L1A-, and Cy1B-L1B-Cy1A-L1A-; and R2is -Ci-C4alkyl, Ci- C4fluoroalkyl, or H. In these embodiments, compounds with particularly-defined substituents at the 5,9- or 6,9 positions on the tricyclic ring structure are provided.
[0098] In various such 5,9- or 6,9-substituted embodiments, R2is methyl, trifluoromethyl or ethyl. In various such embodiments R2is methyl.
[0099] In various such 5,9- or 6,9-substituted embodiments, each of R3, R4, R5, R6, R7, R8and R9is H. In various such embodiments, at least 5 of R3, R4, R5, R6, R7, R8and R9is H, e.g., at least 6 of R3, R4, R5, R6, R7, R8and R9
[0100] In various such 5,9- or 6,9-substituted embodiments, R1is Cy1A-L1A-.
[0101] For example, in various such embodiments, Cy1Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy. In various such embodiments, Cy1Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane,for example, bound to L1Athrough a nitrogen atom thereof. In various such embodiments, Cy1Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof. In various such embodiments, Cy1Ais an 4- (Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1 -nitrogen atom thereof.
[0102] In various such embodiments, Cy1Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some such embodiments, Cy1Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0103] In various such embodiments, Cy1Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Chalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some such embodiments, Cy1Ais optionally- substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0104] In various such embodiments, Cy1Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some such embodiments, Cy1Ais optionally-substituted phenyl, e g., tolyl, or unsubstituted phenyl.
[0105] Regarding R1again, in various such 5,9- or 6,9-substituted embodiments, R1is R1A-L1A-.
[0106] For example, in some such embodiments, R1Ais R1D2N-, R1DHN-, H2N-, or BocHN-. In some such embodiments, R1Ais R1D2N- in which each R1Dis independently selected from methyl, ethyl, propyl and butyl. In various embodiments, R1Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino. And in some such embodiments, R1Ais R1D-O-, HO-, R1D-S-, HS- in which each R1Dis independently selected from methyl, ethyl, propyl and butyl.
[0107] In various embodiments (e.g., when R1is Cy1A-L1A- or R1A-L1A-), L1Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. In various embodiments, L1Ais -CH2CH2-. In various embodiments, L1Ais -CH2CH2CH2-.
[0108] In various embodiments (e.g., when R1is Cy1A-L1A- or R1A-L1A-), L1Ais Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-. In various other embodiments, L1Ais Ci-Csalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH -.
[0109] In various other embodiments (e.g., when R1is Cy1A-L1A- or R1A-L1A-), L1Ais Ci- Cgalkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10. In some embodiments L1Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, for example, -NHCH2CH2- or -NHCH2CH2CH2-.
[0110] In yet other embodiments, L1Ais -SChNH-Ci-Cealkyl- or -SO2NR10-Ci-C6alkyl, for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.
[0111] Again regarding R1, in various such 5,9- or 6,9-substituted embodiments R1is Cy1B-L1B-Cy1A-L1A-. In various such embodiments, Cy1Ais as defined above with respect to the cases where R1is Cy1A-L1A- or R1A-L1A-. In various such embodiments, L1Ais as defined above with respect to the cases where R1is Cy1A-L1A- or R1A-L1A-.
[0112] In various such embodiments, Cy1Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci- C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy. For example, in various embodiments, Cy1Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof. In various embodiments, Cy1Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof. In various embodiments, Cy1Bis a 4-(Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1 -nitrogen atom thereof.
[0113] In various such embodiments, Cy1Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, Ci-C3fluoroalkoxy. For example, in various embodiments, Cy1Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0114] In various such embodiments, Cy1Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl which Ci-C3alkyl can be substituted by oxo, halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, Ci-C3fluoroalkoxy.For example, in various embodiments, Cy1Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0115] In various such embodiments, Cy1Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl which Ci-C3alkyl can be substituted by oxo, halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, Ci-C3fluoroalkoxy. For example, in some embodiments, Cy1Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0116] Again regarding R1, in various such 5,9- or 6,9-substituted embodiments, R1is R1B-L1B-Cy1A-L1A-. In various such embodiments, R1Ais as defined above with respect to the cases where R1is R1A-L1A-. In various such embodiments, L1Ais as defined above with respect to the cases where R1is Cy1A-L1A- or R1A-L1A-.
[0117] In various such embodiments, R1Bis R1E2N-, R1EHN-, H2N-, or BocHN-. For example, in some such embodiments, R1Bis R1E2N- in which each R1Eis independently selected from methyl, ethyl, propyl and butyl, e.g., in some embodiments, R1Bis dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino. In other such embodiments, R1Bis R1E-O-, HO-, R1E-S-, HS- in which each R1Eis independently selected from methyl, ethyl, propyl and butyl.
[0118] In various embodiments (e g., in which R1is Cy1B-L1B-Cy1A-L1A- or RiB.LiB_CyiA_LiA_)L1Bis.CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-. In some embodiments, L1Bis -CH2CH2-. In some embodiments L1Bis -CH2CH2CH2-.
[0119] In various embodiments (e.g., in which R1is Cy1B-L1B-Cy1A-L1A- or R1B-L1B-Cy1A-L1A-), L1Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2-or -C(O)CH2CH2-. In other embodiments, L1Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10. In various other embodiments, L1Bis -O-Ci-C3alkyl-, -NH-Ci-C3alkyl, or NR10-Ci-C3alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-, and in other embodiments, L1Bis -SChNH-Ci-Csalkyl- or -SO2NR10-Ci-C3alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.
[0120] In various such 5,9- or 6,9-substituted embodiments, R1is selected from R1A-L1A- and Cy1A-L1A- , in which L1Ais -CH2CH - or -CH2CH2CH2-; R1Ais R1D2N-, in which each R1Dis independently Ci-C3alkyl; and Cy1Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
[0121] In various such 5,9- or 6,9-substituted embodiments as described above, the groupwhich RYis as described with respect to any aspect or embodiment above.
[0122] In various such 5,9- or 6,9-substituted embodiments as described above , the groupwhich Rxis as described with respect to any aspect or embodiment above.
[0123] Regardless of the identitydescribed above, in various embodiments of the compounds and salts of Formula I, R1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; and R2is selected from Cy2A-L2A-, R2A-L2A-, R2B-L2B-Cy2A-L2A-, and Cy2B-L1B-Cy2A-L2A-. In these embodiments, compounds with particularly-defined substituents at the 5,8- or 6,8 positions on the tricyclic ring structure are provided.
[0124] In various such 5,8- or 6,8-substituted embodiments, R1is methyl, trifluoromethyl or ethyl, and in some embodiments, methyl.
[0125] In various such 5,8- or 6,8-substituted embodiments, each of R3, R4, R5, R6, R7, R8and R9is H. In various such 5,8- or 6,8-substituted embodiments, at least 5 of R3, R4, R5, R6, R7, R8and R9is H, e g., at least 6 of R3, R4, R5, R6, R7, R8and R9.
[0126] In various such 5,8- or 6,8-substituted embodiments, R2is Cy2A-L2A-.
[0127] In various such embodiments, Cy2Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci -Chalky I (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci-Cafluoroalkoxy. In various embodiments, Cy2Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof In various embodiments, Cy2Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogenatom thereof. For example, in various embodiments, Cy2Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L2Athrough the 1 -nitrogen atom thereof.
[0128] In various such embodiments, Cy2Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy2Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0129] In various such embodiments, Cy2Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci- Cafluoroalkoxy. For example, in some embodiments, Cy2Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0130] In various such embodiments, Cy2Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from C i-CFalkyl (which Ci-Cs.alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy2Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0131] In various 5,8- or 6,8-substituted embodiments, R2is R2A-L2A-.
[0132] In various such embodiments, R2Ais R2D2N-, R2DHN-, H2N-, or BocHN-. For example, in some embodiments, R2Ais R2D2N- in which each R2Dis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R2Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0133] In various such embodiments, R2Ais R2D-O-, HO-, R2D-S-, or HS- in which each R2Dis independently selected from methyl, ethyl, propyl and butyl.
[0134] In various embodiments (e.g., in which R2is Cy2A-L2A- or R2A-L2A-), L2Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. In various such embodiments, L2Ais -CH2CH2-. In various such embodiments, L2Ais -CH2CH2CH2-.
[0135] In various embodiments (e.g., in which R2is Cy2A-L2A- or R2A-L2A-), L2Ais Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.
[0136] In various embodiments (e.g., in which R2is Cy2A-L2A- or R2A-L2A-), L2Ais Ci-Cgalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0137] In various embodiments (e.g., in which R2is Cy2A-L2A- or R2A-L2A-), L2Ais Ci- Csalkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10. For example, in some embodiments, L2Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, e.g., -NHCH2CH2- or -NHCH2CH2CH2-.
[0138] In various embodiments (e.g., in which R2is Cy2A-L2A- or R2A-L2A-), L2Ais -SO2NH-Ci-C6alkyl- or -SO2NR10-Ci-C6alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.
[0139] Again regarding R2, in various such 5,8- or 6,8-substituted embodiments, R2is Cy2B-L2B-Cy2A-L2A-. In various such embodiments, Cy2Ais as defined above with respect to the cases where R2is Cy2A-L2A-. In various such embodiments, L2Ais as defined above with respect to the cases where R2is Cy2A-L2A- or R2A-L2A-.
[0140] In various such embodiments, Cy2Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci- C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy. For example, in some embodiments, Cy2Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof. In some embodiments, Cy2Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof. In some embodiments, Cy2Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L2Athrough the 1 -nitrogen atom thereof.
[0141] In various other embodiments, Cy2Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy. For example, in some embodiments, Cy2Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0142] In various other embodiments, Cy2Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can besubstituted by oxo), halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy. For example, in some embodiments, Cy2Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0143] In various other embodiments, Cy2Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy. For example, in some embodiments, Cy2Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0144] Again regarding R2, in various such 5,8- or 6,8-substituted embodiments , R2is R2B-L2B-Cy2A-L2A- invarious such embodiments, R2Ais as defined above with respect to the cases where R2is R2A-L2A-. In various such embodiments, L2Ais as defined above with respect to the cases where R2is Cy2A-L2A- or R2A-L2A-.
[0145] In various such embodiments, R2Bis R2E2N-, R2EHN-, H2N-, or BocHN-. For example, in some embodiments, R2Bis R2E2N- in which each R2Eis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R2Bis dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0146] In various such embodiments, R2Bis R2E-O-, HO-, R2E-S-, or HS- in which each R2Eis independently selected from methyl, ethyl, propyl and butyl.
[0147] In various embodiments (e.g., in which R2is Cy2B-L2B-Cy2A-L2A- or R2B.L2B_Cy2A_L2A_)L2Bis.CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-. In various such embodiments, L2Bis -CH2CH2-. In various such embodiments, L2Bis-CH2CH2CH2-.
[0148] In various embodiments (e.g., in which R2is Cy2B-L2B-Cy2A-L2A- or R2B-L2B-Cy2A-L2A-), L2Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0149] In various embodiments (e.g., in which R2is Cy2B-L2B-Cy2A-L2A- or R2B-L2B-Cy2A-L2A-), L2Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.
[0150] In various embodiments (e.g., in which R2is Cy2B-L2B-Cy2A-L2A- or R2B_L2B_Cy2A_L2A_),L2Bis-O-Ci-C3alkyl-, -NH-Ci-C3alkyl, or NR10-Ci-C3alkyl, for example, -NHCH2CH2- or -NHCH2CH2CH2-.
[0151] In various embodiments (e.g., in which R2is Cy2B-L2B-Cy2A-L2A- or R2B.L2B_Cy2A_L2A_); L2Bis-SO2NH-Ci-C3alkyl- or -SO2NR10-Ci-C3alkyl, for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-
[0152] In various 5,8- or 6,8-substituted embodiments, R2is selected from R2A-L2A- and Cy2A-L2A- , wherein L2Ais -CH2CH2- or -CH2CH2CH2-; R2Ais R2D2N-, in which each R2Dis independently Ci-C3alkyl; and Cy2Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
[0153] In various such 5,8- or 6,8-substituted embodiments as described above, the groupwhich RYis as described with respect to any aspect or embodiment above.
[0154] In various such 5,8- or 6,8-substituted embodiments as described above , the groupwhich Rxis as described with respect to any aspect or embodiment above.
[0155] Regardless of the identitydescribed above, in various embodiments of the compounds and salts of Formula I, R1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; and R7is selected from Cy7A-L7A-A7-, R7A-L7A-A7-, R7B-L7B-Cy7A-L7A-A7-, and Cy7B-L7B-Cy7A-L7A-A7-. In these embodiments, compounds with particularly-defined substituents at the 5,12 or 6,12 positions on the tricyclic ring structure are provided.
[0156] In various 5,12- or 6,12-substituted embodiments, each A7is independently O, NH or absent each L7Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cwheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS-, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cbalkyl which Ci-CCalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0157] In various 5,12- or 6,12-substituted embodiments, each of R1and R2is methyl, trifluoromethyl or ethyl. In various 5,12- or 6,12-substituted embodiments, each of R1and R2is methyl.
[0158] In various 5,12- or 6,12-substituted embodiments, each of R3, R4, R5, R6, R8and R9is H. In various 5,12- or 6,12-substituted embodiments, at least 4 of R3, R4, R5, R6, R8and R9is H, e.g., at least 5 of R3, R4, R5, R6, R8and R9.
[0159] In various 5,12- or 6,12-substituted embodiments, A7is O. In various 5,12- or 6,12- substituted embodiments, A7is NH. In various 5,12- or 6,12-substituted embodiments, A7is absent.
[0160] In various 5,12- or 6,12-substituted embodiments, R7is Cy7A-L7A-A7-.
[0161] In various such embodiments, Cy7Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Cealkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci-CCfluoroalkoxy. In various embodiments, Cy7Ais an optionally-substituted pyrrolidine,morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L7Athrough a nitrogen atom thereof. In various embodiments, Cy7Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L7Athrough a nitrogen atom thereof. For example, in various embodiments, Cy7Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L7Athrough the 1 -nitrogen atom thereof.
[0162] In various such embodiments, Cy7Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy7Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0163] In various such embodiments, Cy7Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Cbalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci- Cafluoroalkoxy. For example, in some embodiments, Cy7Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0164] In various such embodiments, Cy7Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from C i-Cbalkyl (which Ci-Cs.alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy7Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0165] Regarding R7, in other 5,12- or 6,12-substituted embodiments, R7is R7A-L7A-A7-.
[0166] In various such embodiments, R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S- and HS-.
[0167] In various such embodiments, R7Ais -CN.
[0168] In various such embodiments, R7Ais R7D2N-, R7DHN-, H2N-, or BocHN-. For example, in some embodiments, R7Ais R7D2N- in which each R7Dis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R7Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0169] In various such embodiments, R7Ais R7D-O-, HO-, R7D-S-, or HS- in which each R7Dis independently selected from methyl, ethyl, propyl and butyl.
[0170] In various embodiments (e.g., in which R7is Cy7A-L7A- or R7A-L7A-), L7Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. In various such embodiments, L7Ais -CH2CH2-. In various such embodiments, L7Ais -CH2CH2CH2-.
[0171] In various embodiments (e.g., in which R7is Cy7A-L7A- or R7A-L7A-), L7Ais Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.
[0172] In various embodiments (e.g., in which R7is Cy7A-L7A- or R7A-L7A-), L7Ais Ci-Csalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0173] In various embodiments (e.g., in which R7is Cy7A-L7A- or R7A-L7A-), L7Ais Ci- Cgalkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10. For example, in some embodiments, L7Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, e.g., -NHCH2CH2- or -NHCH2CH2CH2-
[0174] In various embodiments (e.g., in which R7is Cy7A-L7A- or R7A-L7A-), L7Ais -SChNH-Ci-Cealkyl- or -SO2NR10-Ci-C6alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.
[0175] Again regarding R7, in various such 5,12- or 6,12-substituted embodiments, R7is Cy7B-L7B-Cy7A-L7A-. In various such embodiments, Cy7Ais as defined above with respect to the cases where R7is Cy7A-L7A-. In various such embodiments, L7Ais as defined above with respect to the cases where R7is Cy7A-L7A- or R7A-L7A-.
[0176] In various such embodiments, Cy7Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from C 1 -Chalky I (which Ci- Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci- Cifluoroalkoxy. For example, in some embodiments, Cy7Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L7Athrough a nitrogen atom thereof. In some embodiments, Cy7Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L7Bthrough a nitrogen atom thereof. In some embodiments, Cy7Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L7Bthrough the 1 -nitrogen atom thereof.
[0177] In various other embodiments, Cy7Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy7Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0178] In various other embodiments, Cy7Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci- Cdluoroalkoxy. For example, in some embodiments, Cy7Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0179] In various other embodiments, Cy7Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy7Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0180] Again regarding R7, in various such 5,12- or 6,12-substituted embodiments, R7is R7B-L7B-Cy7A-L7A-. in various such embodiments, R7Ais as defined above with respect to the cases where R7is R7A-L7A-. In various such embodiments, L7Ais as defined above with respect to the cases where R7is Cy7A-L7A- or R7A-L7A-.
[0181] In various such embodiments, R7Bis R7E2N-, R7EHN-, H2N-, or BocHN-. For example, in some embodiments, R7Bis R7E2N- in which each R7Eis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R7Bis dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0182] In various such embodiments, R7Bis R7E-O-, HO-, R7E-S-, or HS- in which each R7Eis independently selected from methyl, ethyl, propyl and butyl.
[0183] In various embodiments (e.g., in which R7is Cy7B-L7B-Cy7A-L7A- or R7B.L7B_Qy7A.L7A_)L7,!is -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-. In various such embodiments, L7Bis -CH2CH2-. In various such embodiments, L7Bis-CFfcCFBCFb-.
[0184] In various embodiments (e.g., in which R7is Cy7B-L7B-Cy7A-L7A- or R7B-L7B-Cy7A-L7A-), L7Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0185] In various embodiments (e.g., in which R7is Cy7B-L7B-Cy7A-L7A- orR7B-L7B-Cy7A-L7A-), L7Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.
[0186] In various embodiments (e.g., in which R7is Cy7B-L7B-Cy7A-L7A- or R7B_L7B_Cy7A_L7A_),L7Bis-O-Ci-C3alkyl-, -NH-Ci-C3alkyl, or NR10-Ci-C3alkyl, for example, -NHCH2CH2- or -NHCH2CH2CH2-.
[0187] In various embodiments (e.g., in which R7is Cy7B-L7B-Cy7A-L7A- or R7B_L7B_Cy7A_L7A_), J^7Bis-SO2NH-Ci-C3alkyl- or -SO2NR10-Ci-C3alkyl, for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.
[0188] In various 5,12- or 6,12-substituted embodiments, A7is O; L7Ais -CH2CH2- or -CH2CH2CH2-; R7Ais R7D2N-, in which each R70is independently Ci-C3alkyl; and Cy7Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
[0189] In various such 5,12- or 6,12-substituted embodiments as described above, the groupwhich RYis as described with respect to any aspect or embodiment above.
[0190] In various such 5,12- or 6,12-substituted embodiments as described above , the groupwhich Rxis as described with respect to any aspect or embodiment above.
[0191] Regardless of the identity ofas described above, in various embodiments of the compounds and salts of Formula I, R1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; and R8is selected from Cy8A-L8A-A8-, R8A-L8A-A8-, R8B-L8B-Cy8A-L8A-A8-, and Cy8B-L8B-Cy8A-L8A-A8-. In these embodiments,compounds with particularly-defined substituents at the 5,11 or 6,11 positions on the tricyclic ring structure are provided.
[0192] In various 5,11- or 6,11 -substituted embodiments, each A8is O, NH, -O(O)C- or absent; each L8Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, in which each R8Dis independently Ci-Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cbalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0193] In various 5,11- or 6,11 -substituted embodiments, each of R1and R2is methyl, trifluoromethyl or ethyl. In various 5,11- or 6, 11 -substituted embodiments, each of R1and R2is methyl.
[0194] In various 5,11- or 6,11 -substituted embodiments, each of R3, R4, R5, R6, R7and R9is H. In various 5, 11 - or 6, 11 -substituted embodiments, at least 4 of R3, R4, R5, R6, R7and R9is H, e.g., at least 5 of R3, R4, R5, R6, R7and R9.
[0195] In various 5,11- or 6, 11 -substituted embodiments, A8is O. In various 5,11- or 6,11- substituted embodiments, A8is NH. In various 5,11- or 6,11-substituted embodiments, A8is -O(O)C-. In various 5,11- or 6,11-substituted embodiments, A8is absent.
[0196] In various 5,11- or 6,11-substituted embodiments, R8is Cy8A-L8A-A8-.
[0197] In various such embodiments, Cy8Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci -Chalky I (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, and Ci-Csfluoroalkoxy. In various embodiments, Cy8Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof. In various embodiments, Cy8Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof. For example, in various embodiments, Cy8Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L8Athrough the 1 -nitrogen atom thereof.
[0198] In various such embodiments, Cy8Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which C -Csal kyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy8Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e g., unsubstituted cyclohexane or unsubstituted adamantane.
[0199] In various such embodiments, Cy8Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from C, -Chalky I (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci- Cdluoroalkoxy. For example, in some embodiments, Cy8Ais optionally-substituted imidazole, pyrrole, or pyrazole, e g., unsubstituted imidazole, pyrrole, or pyrazole.
[0200] In various such embodiments, Cy8Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-O.alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy. For example, in some embodiments, Cy8Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0201] Regarding R8, in other 5,11- or 6,11-substituted embodiments, R8is R8A-L8A-A8-.
[0202] In various such embodiments, R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S- and HS-, in which each R8Dis independently Ci-Cealkyl.
[0203] In various such embodiments, R8Ais H.
[0204] In various such embodiments, R8Ais -CN.
[0205] In various such embodiments, R8Ais halo (e.g., Cl or F).
[0206] In various such embodiments, R8Ais R8D2N-, R8DHN-, H2N-, or BocHN-. For example, in some embodiments, R8Ais R8D2N- in which each R8Dis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R8Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0207] In various such embodiments, R8Ais R8D-O-, HO-, R8D-S-, or HS- in which each R8Dis independently selected from methyl, ethyl, propyl and butyl.
[0208] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais Ci- Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.
[0209] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais a bond.
[0210] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-. In various such embodiments, L8Ais -CH2CH2-. In various such embodiments, L8Ais -CH2CH2CH2-.
[0211] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais Ci-Cgalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.
[0212] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais Ci-Csalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0213] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais Ci- Cgalkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10. For example, in some embodiments, L8Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, e.g., -NHCH2CH2- or -NHCH2CH2CH2-.
[0214] In various embodiments (e.g., in which R8is Cy8A-L8A- or R8A-L8A-), L8Ais -SO2NH-Ci-C6alkyl- or -SO2NR10-Ci-C6alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-
[0215] Again regarding R8, in various such 5,11- or 6,11 -substituted embodiments, R8is Cy8B-L8B-Cy8A-L8A-. In various such embodiments, Cy8Ais as defined above with respect to the cases where R8is Cy8A-L8A-. In various such embodiments, L8Ais as defined above with respect to the cases where R8is Cy8A-L8A- or R8A-L8A-.
[0216] In various such embodiments, Cy8Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci- C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy. For example, in some embodiments, Cy8Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof. In some embodiments, Cy8Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L8Bthrough a nitrogen atom thereof. In some embodiments, Cy8Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L8Bthrough the 1 -nitrogen atom thereof.
[0217] In various other embodiments, Cy8Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy. For example, in some embodiments, Cy8Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.
[0218] In various other embodiments, Cy8Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy. For example, in some embodiments, Cy8Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
[0219] In various other embodiments, Cy8Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy. For example, in some embodiments, Cy8Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.
[0220] Again regarding R8, in various such 5,11- or 6,11 -substituted embodiments, R8is R8B-L8B-Cy8A-L8A-. In various such embodiments, R8Ais as defined above with respect to the cases where R8is R8A-L8A-. In various such embodiments, L8Ais as defined above with respect to the cases where R8is Cy8A-L8A- or R8A-L8A-.
[0221] In various such embodiments, R8Bis R8E2N-, R8EHN-, H2N-, or BocHN-. For example, in some embodiments, R8Bis R8E2N- in which each R8Eis independently selected from methyl, ethyl, propyl and butyl. In some embodiments, R8Bis dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or butypropylamino.
[0222] In various such embodiments, R8Bis R8E-O-, HO-, R8E-S-, or HS- in which each R8Eis independently selected from methyl, ethyl, propyl and butyl.
[0223] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B-L8B-Cy8A-L8A-), L8Bis Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci- Cralkyl.
[0224] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B-L8B-Cy8A-L8A-))L8Bis a bond.
[0225] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B.L8B_Qy8A.L8A_)L8'5is -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-. In various such embodiments, L8Bis -CH2CH2-. In various such embodiments, L8Bis-CFfeCFhCFb-.
[0226] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B-L8B-Cy8A-L8A-), L8Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.
[0227] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B-L8B-Cy8A-L8A-), L8Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.
[0228] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or R8B_L8B_Cy8A_L8A_),L8Bis-O-Ci-C3alkyl-, -NH-Ci-C3alkyl, or NR10-Ci-C3alkyl, for example, -NHCH2CH2- or -NHCH2CH2CH2-.
[0229] In various embodiments (e.g., in which R8is Cy8B-L8B-Cy8A-L8A- or RSBjym.QySA.LSA.),L8Bis-SO2NH-Ci-C3alkyl- or -SO2NR10-Ci-C3alkyl, for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-
[0230] In various 5,12- or 6,12-substituted embodiments, A8is O or NH; L8Ais -CH2CH2-, -CH2CH2CH2- or -CH2CH2CH2CH2-; R8Ais R8D2N-, in which each R8Dis independently Ci-C3alkyl; Cy8Ais selected from piperazine, pyrrolidine, piperidine, morpholine, thiazinane, azepane and azocane; L8Bis -CH2CH2- or -CH2CH2CH2-; R8Bis R8D2N-, in which each R8Dis independently Ci-C3alkyl; and Cy8Bis selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
[0231] In various such 5,11- or 6,11 -substituted embodiments as described above, the groupwhich RYis as described with respect to any aspect or embodiment above.
[0232] In various such 5,11- or 6,11 -substituted embodiments as described above , the groupwhich Rxis as described with respect to any aspect or embodiment above.
[0233] In various embodiments of the compounds and pharmaceutically-acceptable salts of Formula I, R9is H.
[0234] In various embodiments, the disclosure provides a compound selected from the compounds below, or a pharmaceutically-acceptable salt thereof:5.8-substituted compounds: QC-39, QC-C10, QC-C1, QC-C13, QC-C6, QC-C12, QC-C2, QC-C11, QC-C3, QC-C9, QC-C5, QC-C8, QC-C4, ZJQ-F1, ZJQ-F23A, ZJQ-F24.5.9-substituted compounds: QC-1, QC-12, QC-2, QC-4, QC-13, QC-3, QC-54, TWL- 119B, QC-D24, QC-D29, QC-D10, QC-53, QC-D8, QC-52, QC-40, QC-5, QC-41, QC-43, QC-45, QC-D21, QC-D22, QC-D19, QC-D23, QC-D28, QC-E2, ZJQ-E2D,ZJQ-E4D, ZJQ-E5D, QC-112, QC-E5, ZJQ-G3, ZJQ-G4, ZJQ-G5, ZJQ-G6, ZJQ-G7, ZJQ-G9, ZJQ-G10, ZJQ-G11, ZJQ-G12, ZJQ-G13, ZJQ-G13, QC-3B6.11 -substituted compounds: YH-C9, YH-C10, YH-C13, YH-C95, YH-C64, YH- C104, YH-D3, YH-E45, YH-E81, YH-F19, YH-F47, YH-F48, YH-I60, YH-E85, YH-J63, YH-J64, YH-K81, YH-H32, YH-H33, YH-H34, YH-H38, YH-H39, YH- H40, YH-H41, YH-H47, YH-H48, YH-H49.6,9-substituted compounds: WM-C46, WM-C45, WM-B115, WM-B103, WM-B101, WM-C48, WM-B102, WM-C51, WM-C94, WM-C95, WM-C52, YH-H87, WM-C18, WM-C8, WM-C9, WM-C6, WM-C13, WM-C10, WM-C22, WM-C23, WM-D10, WM-C29, WM-C28, WM-D12, WM-D11.5.11 -substituted compounds: YH-J11, YH-J1 .5.12-substituted compounds: HDXII-13.6,8-substituted compounds: WM-D57, WM-D58, WM-D43, WM-D53, WM-D59, WM-D54.
[0235] In various embodiments, the disclosure provides a compound selected from:or a pharmaceutically-acceptable salt thereof
[0236] In various embodiments, the disclosure provides a compound selected from compounds XXP-J3, XXP-J57, XXP-J58, XXP-J64, XXP-J87, XXP-J93, XXP-J95, XXP- J97, XXP-J98, XXP-J101, and XXP-K3, or a pharmaceutically-acceptable salt thereof
[0237] In various embodiments, the disclosure provides a compound selected from the compounds of any of Tables 1-8, or a pharmaceutically-acceptable salt thereof.
[0238] In various embodiments, the disclosure provides a compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 100 micromolar, or a pharmaceutically-acceptable salt thereof.
[0239] In various embodiments, the disclosure provides a compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 50 micromolar, or a pharmaceutically-acceptable salt thereof.
[0240] In various embodiments, the disclosure provides a compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 25 micromolar, or a pharmaceutically-acceptable salt thereof.
[0241] In another aspect, the disclosure provides a pharmaceutical composition comprising a compound or salt as described herein, together with a pharmaceutically acceptable carrier.
[0242] In another aspect, the disclosure provides a method of inhibiting TDP1 and / or TOPI in vivo or in vitro comprising contacting a cell nucleus with a compound or salt as described herein.
[0243] In another aspect, the disclosure provides a method of treating cancer in a patient comprising administering a therapeutically effective amount of a compound or salt as described herein to the patient.
[0244] In another aspect, the disclosure provides a method of treating cancer in a patient comprising administering to the patient a therapeutically effective amount of a compound or salt as described herein in combination with and a TOPI inhibitor that is not a compound or salt as described herein.
[0245] In various embodiments, the TOPI inhibitor is camptothecin or a camptothecin derivative, an indolocarbazole, a dibenzonaphthyridinone, or an indenoisoquinoline.PHARMACEUTICAL COMPOSITIONS
[0246] Compounds disclosed herein can be provided or administered as the neat chemical, but can also be provided, and are preferably administered, as a pharmaceutical composition. Accordingly, the disclosure provides pharmaceutical compositions comprising a compound or pharmaceutically acceptable salt of a TDP1 inhibitor, such as a compound or salt of the disclosure, together with at least one pharmaceutically acceptable carrier. The pharmaceuticalcomposition / combination may contain a compound or salt of the disclosure as the only active agent, but can contain at least one additional active agent. The additional active agent can be camptothecin, a camptothecin analogue, a poly(ADP -ribose) polymerase (PARP) inhibitor, a cell cycle checkpoint inhibitor targeting ATR (Ataxia Telangiectansia-related kinase), a CHEK1 (cell cycle checkpoint kinase) inhibitor, a WEE1 inhibitor, a CDK (cyclin dependent kinase) inhibitor or other chemotherapeutic compound. In certain embodiments it is preferred that the additional active agent is compound or salt thereof chosen from camptothecin, irinotecan, topotecan, belotecan, and 10-hydroxycamptothecin (irinotecan, topotecan, belotecan, and 10-hydroxycamptothecin being considered herein as camptothecin derivatives). In certain embodiments the pharmaceutical composition is in a dosage form that contains from about 0.1 mg to about 2000 mg, from about 10 mg to about 1000 mg, from about 100 mg to about 800 mg, or from about 200 mg to about 600 mg of a compound of Formula I and optionally from about 0.1 mg to about 2000 mg, from about 10 mg to about 1000 mg, from about 100 mg to about 800 mg, or from about 200 mg to about 600 mg of an additional active agent in a unit dosage form. The pharmaceutical composition may also include a molar ratio of a compound of TDP1 inhibitor, such as a compound of Formula I, and an additional active agent. For example, the pharmaceutical composition may contain a molar ratio of about 0.5: 1, about 1 :1, about 2: 1, about 3: 1 or from about 1.5: 1 to about 4:1 of the compound of Formula I to the additional active agent.
[0247] Compounds disclosed herein may be administered orally, topically, parenterally, by inhalation or spray, sublingually, transdermally, via buccal administration, rectally, as an ophthalmic solution, or by other means, in dosage unit formulations containing conventional pharmaceutically acceptable carriers. The pharmaceutical composition may be formulated as any pharmaceutically useful form, e.g., as an aerosol, a cream, a gel, a pill, a capsule, a tablet, a syrup, a transdermal patch, or an ophthalmic solution. Some dosage forms, such as tablets and capsules, are subdivided into suitably sized unit doses containing appropriate quantities of the active components, e.g., an effective amount to achieve the desired purpose.
[0248] Carriers include excipients and diluents and must be of sufficiently high purity and sufficiently low toxicity to render them suitable for administration to the patient being treated. The carrier can be inert or it can possess pharmaceutical benefits of its own. The amount of carrier employed in conjunction with the compound is sufficient to provide a practical quantity of material for administration per unit dose of the compound.
[0249] Classes of carriers include, but are not limited to binders, buffering agents, coloring agents, diluents, disintegrants, emulsifiers, flavorants, glidants, lubricants, preservatives, stabilizers, surfactants, tableting agents, and wetting agents. Some carriers may be listed in more than one class, for example vegetable oil may be used as a lubricant in some formulations and a diluent in others. Exemplary pharmaceutically acceptable carriers include sugars, starches, celluloses, powdered tragacanth, malt, gelatin; talc, and vegetable oils. Optional active agents may be included in a pharmaceutical composition, which do not substantially interfere with the activity of the compound of the present disclosure.
[0250] The pharmaceutical compositions / combinations can be formulated for oral administration. These compositions contain between 0.1 and 99 weight % (wt.%) of a compound of Formula I and usually at least about 5 wt.% of a compound of Formula I. Some embodiments contain from about 25 wt.% to about 50 wt. % or from about 5 wt.% to about 75 wt.% of the compound of Formula I.METHODS OF TREATMENT
[0251] The TDP1 inhibitor compounds / pharmaceutical compositions / combinations disclosed herein are useful for treating disease and disorders in patients in which TDP1 (or TOPI) inhibition is beneficial. For example, compounds of Formula I are useful for treating cancer.
[0252] This disclosure provides methods of treating cancer by providing an effective amount of a compound or pharmaceutically acceptable salt of Formula I to a patient in need of such treatment. The compound or salt of Formula I may be provided as the only active agent or may be provided together with one or more additional active agents. In certain embodiments the compound of Formula I is administered together with another active agent, such as camptothecin, a camptothecin analogue, a poly(ADP -ribose) polymerase (PARP) inhibitor, a cell cycle checkpoint inhibitor targeting ATR (Ataxia Telangiectansia-related kinase), a CHEK1 (cell cycle checkpoint kinase) inhibitor, a WEE1 inhibitor, a CDK (cyclin dependent kinase) inhibitor or other chemotherapeutic compound.
[0253] In some embodiments, the disclosure provides methods of treating cancer and methods for killing a tumor cell in a subject, which methods include contacting the tumor cell with an effective amount of a compound or pharmaceutically acceptable salt of Formula I and irradiating the cancer or tumor cell with an effective amount of ionizing radiation. Additionally, methods of radiotherapy of cancers or a tumor cell are provided herein. Themethods include contacting the tumor cell with an effective amount of a compound or pharmaceutically acceptable salt of Formula I, and irradiating the tumor with an effective amount of ionizing radiation. As used herein, the term ionizing radiation refers to radiation comprising particles or photons that have sufficient energy or can produce sufficient energy via nuclear interactions to produce ionization. An example of ionizing radiation is x- radiation. An effective amount of ionizing radiation refers to a dose of ionizing radiation that produces an increase in cell damage or death when administered in combination with the compounds or pharmaceutically acceptable salt described herein. The ionizing radiation can be delivered according to methods as known in the art, including administering radiolabeled antibodies and radioisotopes.
[0254] The disclosure provides methods for contacting a tumor cell with an effective amount of a compound or pharmaceutically acceptable salt of Formula I, and can include a step of irradiating the tumor cell with an effective amount of ionizing radiation.
[0255] An effective amount of a pharmaceutical composition of the disclosure includes an amount sufficient to (a) inhibit the progression of cancer; (b) cause a remission; or (c) cause a cure of cancer, or (d) significantly reduce the level of cancer markers in a patient’s blood, serum, or tissues.
[0256] An effective amount of a pharmaceutical composition described herein will also provide a sufficient concentration of the active agents in the concentration when administered to a patient. A sufficient concentration of an active agent is a concentration of the agent in the patient’s body necessary to reduce cancer symptoms or slow cancer progression. Such an amount may be ascertained experimentally, for example by assaying blood concentration of the agent, or theoretically, by calculating bioavailability.
[0257] According to the methods of the disclosure, the compound or pharmaceutically acceptable salt of Formula I and at least one additional active agent may be: (1) coformulated and administered or delivered simultaneously in a combined formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by any other combination therapy regimen known in the art. When delivered in alternation therapy, the methods of the disclosure may comprise administering or delivering the compound or salt of Formula I and an additional active agent sequentially, e.g., in separate solution, emulsion, suspension, tablets, pills or capsules, or by different injections in separate syringes. In general, during alternation therapy, an effective dosage of each active ingredient isadministered sequentially, i.e., serially, whereas in simultaneous therapy, effective dosages of two or more active ingredients are administered together. Various sequences of intermittent combination therapy may also be used.
[0258] Methods of inhibiting TDP1 in vivo comprise providing a compound or pharmaceutically acceptable salt of Formula I to a patient having cancer, a concentration of the compound or salt of Formula I sufficient to inhibit TDP1 in vitro are included herein. In this instance the concentration includes an in vivo concentration, such as a blood or plasma concentration. The concentration of compound sufficient to inhibit TDP1 in vitro may be determined from an assay of TDP1 inhibition such as the assay provided in Method 1, herein.
[0259] Methods of treatment include providing certain dosage amounts of a compound or pharmaceutically acceptable salt of Formula I to a patient. Dosage levels of each active agent of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per patient per day). The amount of active ingredient that may be combined with the carrier materials to produce a single unit dosage form will vary depending upon the patient treated and the particular mode of administration. In certain embodiments about 0.1 mg to about 2000 mg, from about 10 mg to about 1500 mg, from about 100 mg to about 1000 mg, from about 200 mg to about 800 mg, or from about 300 to about 600 mg of a compound of Formula I and optionally from about 0.1 mg to about 2000 mg, from about 10 mg to about 1500 mg, from about 100 mg to about 1000 mg, from about 200 mg to about 800 mg, or from about 300 to about 600 mg of a compound of an additional active agent, for example a camptothecin, or camptothecin analogue are provided to a patient. It is preferred that each unit dosage form contains less than 1200 mg of active agent in total. Frequency of dosage may also vary depending on the compound used and the particular disease treated.
[0260] It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease in the patient undergoing therapy.PACKAGED FORMULATIONS
[0261] Methods comprising providing a compound or salt of a TDP1 inhibitor, such as a compound of Formula I, in a container together with instructions for using the compound to treat a patient suffering from cancer are included herein
[0262] Packaged pharmaceutical compositions / combinations are also included herein. Such packaged combinations include a TDP1 inhibitor, such as a compound of Formula I, in a container together with instructions for using the combination to all cancers, including those presently treated with TOPI inhibitors: colon cancer, rectal cancer, ovarian cancer, small cell lung cancer, cervical cancer, or glioma, in a patient. Pharmaceutical combinations include at least one additional active agent. In certain embodiments the additional active agent is camptothecin or a camptothecin analog such as irinotecan or topotecan.
[0263] The packaged pharmaceutical combination may include a TDP1 inhibitor, such as a compound of Formula I, and an additional active agent provided simultaneously in a single dosage form, concomitantly in separate dosage forms, or provided in separate dosage forms for administration separated by some amount of time that is within the time in which both the TDP1 inhibitor, such as a compound of Formula I, and the additional active agent are within the bloodstream of the patient.EXAMPLES
[0264] As a DNA repair enzyme, TDP1 is a potential target for the discovery of anticancer agents in chemotherapy and radiotherapy. While known that TDP1 inhibitors can enhance the activity of anticancer agents such as TOPI inhibitors and alkylating agents (Temozolomide), TDP1 inhibitors as radiosensitizers is new to the disclosure. Oxynitidine derivatives, such as compound 45 (NTD119B), that can be TDP1 inhibitors and radiosensitizers with anticancer activity are described herein. Colony formation assays demonstrated that NTD119B can enhance the sensitivity of CRC cells to X-ray radiation, including HCT116, SW480 and RKO cells; whereas, it showed low radiosensitization in A549 (lung cancer) and NCM460 (normal colon epithelium) cells and almost no radiosensitization to HGC-27 (gastric cancer) and Hela (cervical cancer) cells, indicating its selectivity to sensitize CRC cells to IR. Animal experiments indicated that NTD119B could enhance the antitumor activity of X-ray radiation significantly in the HCT116 xenograft model, and reduced tumor volume in high-dose combination group (10 mg / kg NTD119B and 1 GY) from sixth day post dose.
[0265] CETSA and ICE assays demonstrated that NTD119B targets cellular TDP1 and traps TDP1-DNA complex (TDPlcc) formation in HCT116 cells, leading to blocking the clearanceof the ends of DNA breaks, which reduces further repair of DNA breaks induced by IR. Furthermore, our experiments indicate that NTD119B could down-regulate the mRNA and protein expression of XRCC4 slightly and decreased the recruitment of XRCC4 to DNA damage sites induced by IR, which also suppressed NHEJ activity. Both Western blotting and immunofluorescence assays demonstrated that NTD119B increased y- foAX level induced by IR, indicating its ability to enhance IR-induced DNA damage. Therefore, NTD119B increased the IR-induced DNA damage significantly and showed radiosensitization in vitro and in vivo, possibly due to its TDP1 inhibition and the resulting NHEJ activity suppression. Conversely, NTD119B shows weak suppression to HR activity and weak radiosensitizing effect in SgTDPl-HCTl 16 cells compared with HCT116 cells.
[0266] RNA-seq analysis indicates that the p53 regulated gene PIG3 may be regulated by NTD119B. Its encoded protein PIG3 is a regulator between oxidative stress and DNA damage response in cancer. NTD119B increased the mRNA and protein expression levels of PIG3 significantly in HCT116 cells, and protein expression in xenograft tumor tissues after co-treatment with IR. PIG3 has been reported to have reductase activity and to lead to ROS production under strong damage stimuli in cells, which is consistent with the observed enhancement of the ROS levels in HCT116 cells under X-ray radiation condition by NTD119B, resulting in mitochondrial dysfunction. Bioinformatic analysis showed that NTD119B was primarily involved in the upregulation of p53 pathway and the downregulation of cell cycle. NTD119B could induce cell cycle arrest at G2 / M phase, especially after combining treatment with X-ray radiation (4 GY), 66.1% of HCT116 cells were arrested at G2 / M phase, which resulted in cancer cells more sensitive to IR. As a result, apoptosis was increased in HCT116 cells and xenograft tumor tissues after co-treatment of NTD119B with IR. Further studies indicated that NTD119B increased the apoptotic proteins expression, including cleaved-PARP, cleaved-Caspase9, cleaved-Caspase7, and cleaved- Caspase3 after co-treatment with IR. These results indicate that activation of p53 pathway and up-regulation expression of PIG3 is possibly another molecular mechanism by which NTD119B enhances the sensitivity of CRC cells to IR in addition to TDP1 inhibition.
[0267] In summary, TDP1 is a potential target for discovery of radiosensitizers, and the TDP1 inhibitor, NTD119B, shows radiosensitization significantly in CRC cells both in vitro and in vivo, and low acute toxicity and good PK parameters, indicating its druggability.
[0268] ABBREVIATIONS
[0269] The following abbreviations are used in the examples or elsewhere in the specification.BnBr = benzyl bromideK2CO3 = potassium carbonateDMF = dimethylformamideNaCICh = sodium chlorite n-BuLi = n-ButyllithiumPhMe = tolueneTSOH.H2O = tosylic acid monohydrateDCM = dichloromethane rt = room temperature(TfO)2S = trifluoromethanesulfonateTEA =triethylaminePd2(dba)s = Tris(dibenzylideneacetone)dipalladium(0)BINAP = 2,2'-bis(diphenylphosphino)-l,T-binaphthylK2CO3 = potassium carbonateCS2CO3 = cesium carbonateTHF - tetrahydrofuranH2SO4 = sulfuric acidSOCI2 = thionyl chlorideNaH =sodium hydridePd(OAc)2 = palladium(II) acetateP(o-Tol)3 - Tri(o-tolyl)phosphineNaCICh = sodium chloriteMeOH - methanolDMSO = dimethylsulfoxidePd(PPh3)4- tetrakis palladiumM0MC1 -= methoxymethyl chlorideNi(cod)2 - Bis(l,5-cyclooctadiene)nickel(0)TCM = trichloromethane (chloroform)AcOH = acetic acidPOCI3 = phosphoryl chlorideBr(CH2)3Br = 1,3 -dibromopropaneEXAMPLE 1. Synthesis of NTD119B (also, Compound 45; TWL-119B)
[0270] 12-(2-(dimethylamino)ethyl)-2-methoxy-3-(2-morpholinoethoxy)- [l,3]dioxolo[4',5':4,5]benzo[l,2-c]phenanthridin-13(12H)-one (NTD119B) was synthesized as shown in Scheme 1 (FIG. 8).
[0271] The reagents and conditions for Scheme 1 are as follows: (a) BnBr, K2CO3, DMF, 70 °C; (b) Sulfamic acid, NaC102, tert-Butanol, H2O; (c) i) n-BuLi, Funan, PhMe, -78 °C; ii) TsOH.H2O, DCM, rt; (d) i) (TfO)2S, DCM, TEA, -5 °C -rt; ii) Pd2(dba)3, BINAP, Benzenemethanimine, K2CO3, CS2CO3, THF, PhMe, 125 °C; (iii) 5% H2SO4, 1,4-dioxane, 55 °C. (e) i) SOCI2, reflux; ii) TEA, DCM, rt. (f) i) Cl(CH2)2NMe2 / HCl, NaH, DMF, 85 °C; ii) N2, Pd(OAc)2, P(o-tol)3, K2CO3, DMA, 150 °C; (g) N2, NaH, Pd(OAc)2, DMF, rt.-70 °C; (h) O(CH2)4N(CH2)2C1 / HC1, K2CO3, DMF, 90 °C
[0272] 12-(2-(dimethylamino)ethyl)-2-methoxy-3-(2-morpholinoethoxy)- [l,3]dioxolo[4',5':4,5]benzo[l,2-c]phenanthridin-13(12H)-one (TWL-119B): Yield 72%, 'H NMR (400 MHz, DMSO- ) 5 8.33 (d, J= 7.9 Hz, 1H), 7.89 (s, 1H), 7.75 (s, 1H), 7.72 (s, 1H), 7.67 (d, J= 9.3 Hz, 1H), 7.43 (s, 1H), 6.19 (s, 2H), 4.58-4.51 (m, 2H), 4.40-4.35 (m, 2H), 3.92 (s, 3H), 3.64-3.56 (m, 4H), 2.82-2.78 (m, 2H), 2.58-2.52 (m, 6H), 1.95 (s, 6H).13C NMR (126 MHz, CDCI3) 8 164.8, 152.9, 150.0, 147.6, 147.5, 135.4, 131.8, 129.0, 123.4, 121.2, 119.9, 118.4, 117.5, 109.2, 104.9, 104.7, 102.6, 101.7, 67.0, 57.8, 57.5, 56.3, 54.3, 50.3, 45.8. HRMS (ESI) m / . 520.2425 [M + H]+, calcd for C29H34N3O6 520.2442.EXAMPLE 2. Synthesis of YH- JI 13
[0273] 2,3 -Dimethoxy- 13-(2-(pyrrolidin- 1 -yl)ethoxy)-5-(3-(4-(2-(pyrrolidin- 1 - yl)ethyl)piperazin-l-yl)propoxy)-[l,3]dioxolo[4',5':4,5]benzo[l,2-c]phenanthridine (YH- J113) was synthesized as shown in Scheme 2 (FIG. 9).
[0274] The reagents and conditions for Scheme 2 are as follows: (a) N2, PdCl2(PPh3)2, TEA, MeCN, 80 °C. (b) i) N2, Me3OBF4, DCM, rt; ii) CF3CO2Ag, DCM, rt. (c) NaBr, TsOH H2O, MeOH, 80 °C. (d) POCI3, DMF, 100 °C. (e) KOH, MeOH, H2O, 80 °C. (f) Ac2O, AcOK, 140 °C. (g) K2CO3, MeOH, H2O, 80 °C. (h) i) N2, Br(CH2)3Cl, K2CO3, KI, DMF, RT; ii) l-(2- (Pyrrolidin-l-yl)ethyl)piperazine, K2COs, KI, DMF, RT; iii) A-( 2-hydroxy ethyl [pyrrolidine, NaH, DMF, 65 °C.
[0275] Yield 43%.!H NMR (500 MHz, CDC13) 3 9.10 (s, 1H), 8.51 (s, 1H), 7.79 (s, 1H), 7.11 (s, 1H), 7.07 (s, 1H), 6.09 (s, 2H), 4.94 (t, J= 6.1 Hz, 2H), 4.34 (t, J= 6.5 Hz, 2H), 4.10 (s, 3H), 4.08 (s, 3H), 3.17 (t, J= 6.1 Hz, 2H), 2.82-2.76 (m, 4H), 2 70-2.65 (m, 4H), 2.63- 2.47 (m, 14H), 2.26-2.22 (m, 2H), 1.89-1.85 (m, 4H), 1.83-1.79 (m, 4H).13C NMR (125 MHz, CDCI3) <5 157.4, 154.4, 151.7, 148.4, 146.1, 131.1, 129.7, 123.5, 114.5, 108.6, 104.0, 103.2, 102.9, 102.6, 100.9, 67.1, 65.3, 57.4, 56.0, 55.9, 55.3, 54.9, 54.5, 53.6, 53.3, 27.4, 23.4. HRMS (ESI) m / z: 686.3910 [M + H]+, calcd for C39H52N5O6 686.3912.
[0276] EXAMPLE 3: Additional syntheses
[0277] Additional synthesized compounds are represented in Table 1 through Table 8. The TDP1 inhibition experimental procedure is described in Method 1, below. The TOPI cleavage protocol is described in Method 2. TOPI cleavage is relative to 1 pM camptothecin (CPT), where 0 is inactive; + / 0 is less 20%, + is 20% to 50%; ++ is 50% to 75%; +++ is 75% to 95%; and ++++ is essentially the same as CPT.
[0278] Compounds herein utilize the following naming convention to describe positions on the oxynitidine ring system:TABLE 1: 5,8 BISUBSTITUTED COMPOUNDS:TABLE 2: 5,9 BISUBSTITUTED COMPOUNDS:TABLE 3: 6,8 BISUBSTITUTED COMPOUNDS:TABLE 4: 6,9 BISUBSTITUTED COMPOUNDS:inTABLE 5: 6,11 BISUBSTITUTED COMPOUNDS:TABLE 6: 5,11 BISUBSTITUTED COMPOUNDS:TABLE 7: 5,12 BISUBSTITUTED COMPOUNDS:TABLE 8: 6,12 BISUBSTITUTED COMPOUNDS:
[0279] Example 4: TDP1 is upregulated in CRC and the CRC cells with TDP1 knockdown shows high radiosensitivity.
[0280] To investigate the role of TDP1 in the development of cancer, the expression levels of TDP1 in 11 types of tumors and the corresponding normal tissues in TCGA database were analyzed. As shown in FIG. 1A, TDP1 mRNA expression is upregulated in all tumor tissues compared with the normal tissues with three types of tumors, colorectal cancer CRC (COAD and READ) and glioblastoma (GBM) showing the highest TDP1 expression in comparison with the corresponding normal tissues.
[0281] It has been reported that deletion and mutation of TDP1 sensitize cancer cells to IR. To verify, a TDP1 knockout HCT116 cell line (SgTDPl-HCTl 16, FIG. 1C) was constructed and tested for its sensitivity to X-ray radiation through colony formation assays. The results confirmed that knocking out TDP1 significantly increased the sensitivity of HCT116 cells to IR (FIG. IB). TDP1 is thus a potential target for cancer cell radiosensitization, and inhibiting TDP1 may enhance radiotherapy for cancer patients.
[0282] Example 5: NTD119B is a novel radiosensitizer.
[0283] To discover TDP1 inhibitors as radiosensitizers, an oxynitidine TDP1 inhibitor library was screened through colony formation assays in HCT116 cells using PT33 as a positive control (FIG 2A). Ten active compounds were found (FIG. 2C). Among them, NTD119B showed the highest potency to enhance the sensitivity of HCT116 cells to IR (2 GY) at 1.0 pM concentration, and weak cytotoxicity alone (FIG. 2B and FIG. 2C). NTD119B is a novel TDP1 inhibitor with good potency (IC50 = 6.9 ± 2.2 pM, FIG. 2D). Further studies indicated that NTD119B showed strong radiosensitizing effect in a dose-dependent manner in HCT116 cells, as well as two other CRC cell lines RKO and SW480 (FIG. 2E to FIG. 2G). About 36% of cells were killed by IR (2 GY) alone and about 93% of cells were killed by the combination of IR with 1.0 pM NTD119B in HCT116 cells, and 32% vs 98% (IR alone / combination) in RKO cells and 26% vs 92% (IR alone / combination) in SW480 cells.The combination index (CI) values also indicated the strong effects, and there were two doses in HCT116 cells, one dose in RKO cells and two doses in SW480 cells showing strong synergistic effects (CI < 0.3).
[0284] Twelve synthesized analogs (37 (QC-12), 39 (QC-4), 41 (QC-13), 45 (NTD119B, TWL-119B), 50 (QC-D10), 51 (QC-53), 49 (QC-D29), 64 (QC-D28), 2 (QC-C10), 4 (QC- 13), 6 (QC-C12) and 8 (QC-C1 l))with strong TDP1 inhibitory activity (IC50 < 10 pM) weretested for their radiosensitizing activity through colony formation assay in HCT116 cells. As shown in Figure 2H, after being treated by IR (2 GY), about 35% HCT116 cells were killed. Ten of the tested TDP1 inhibitors (37 (QC-12), 39 (QC-4), 41 (QC-13), 45 (NTD119B, TWL-119B), 50 (QC-D10), 51 (QC-53), 49 (QC-D29), 2 (QC-C10), 6 (QC-C12) and 8 (QC- C11)) could enhance the ability of IR to kill the cancer cells at the tested concentration. Among them, compounds 45 (NTD119B, TWL-119B) and 49 (QC-D29) exhibited strong radiosensitizing activity. And they exhibited low cytotoxicity at the tested concentration, with about 11% of cells killed by 45 (0.5 pM) alone and 19% cells killed by 49 (0.1 pM) alone (Figure 21). Surprisingly, the most potent TDP1 inhibitor 64 (IC50 = 1.6 pM) had no radiosensitizing activity possibly due to the low cellular permeability.
[0285] As noted above, 45 exhibited strong radiosensitizing effect in HCT116 cells in a dosedependent manner, as well as two other colorectal cancer (CRC) cell lines RKO and SW480 (Figure 2E, 2F and 2G). About 35% of cells were killed by IR (2 GY) alone and about 93% of cells were killed by the combination of IR (2 GY) with 1.0 pM 18 in HCT116 cells, and 32% vs 98% (IR alone / combination) in RKO cells and 26% vs 92% (IR alone / combination) in SW480 cells. The combination index (CI) values of compound 45 with IR indicated that there were two doses in HCT116 and SW480 cells, respectively, and one dose in RKO cells showing strong synergistic effects (CI < 0.3, Figure 2L). Interestingly, compound 45 exhibited weak radiosensitizing potency with IR (2 GY) in normal intestinal epithelial NCM460 cells (Figure 2J) and human A549 lung cancer cells, and almost no radiosensitizing potency in human HGC-27 gastric cancer cells and Hela cervical cancer cells, implying that the novel benzophenanthridinone TDP1 inhibitors showed radiosensitizing activity selectively in CRC cell lines. Similarly, compound 49 also exhibited radiosensitizing effect in HCT116 cells in a dose-dependent manner (Figure 2K). Although about 93% of cells were killed by the combination of IR (2 GY) with 0.2 pM 23 in HCT116, compound 49 exhibited high toxicity, and 72% of cells were killed by 0.2 pM 23 alone. There was no CI value lower than 0.3, implying that compound showed medium synergistic effects with IR (Figure 2L).
[0286] These results indicated that the TDP1 inhibitor NTD119B can selectively and effectively sensitize CRC cells to IR.
[0287] Example 6: NTD119B has significant radiosensitizing effect in vivo.
[0288] To study the radiosensitization of NTD119B in vivo, its acute toxicity and pharmacokinetic (PK) were first conducted. Acute toxicity experiments in Kunming malemice indicated low acute toxicity given all mice survived after 7 days of administration with NTD119B at 150, 300 and 600 mg / kg doses (n = 3) (FIG. 3A).
[0289] The PK parameters of NTD119B in Sprague-Dawley (SD) rats are summarized in Table 9. Following intravenous administration (n = 1), the 71 / 2 was 2.86 h and AUCiast was 247 h-ng / mL. After oral administration (n = 3), the Tmax, Cmax, AUCiast and T\n were 4 ±1.7 h, 70.3 ± 20 ng / mL, 779 ± 200 h-ng / mL, and 4.64 ± 0.32 h, respectively. The bioavailability (F) was 63.1%.Table 9. Pharmacokinetic Parameters of 45 (NTD119B) mean ± SD L aramCICr J , , <IV (1 mg / kg)aig (5 mg / kg)bTmax(h) 0.083 4 ± 1.7Cmax(ng / mL) 221 70.3 ± 20AUCiast (h-ng / mL) 247 779 ± 200AUCINF (h- ng / mL) 291 735 ± 230MRTINF (h) 3.33 7.06 ± 1TI / 2 (h) 2.86 4.64 ± 0.32F (%) 63.1 ± 16 aiv means intravenous injection.big means intragastrical administration.
[0290] To test the activity of NTD119B, nude mice bearing HCT116 xenografts were randomly divided into six groups (n = 6) and treated with saline, NTD119B (1 and 10 mg / kg) and X-ray radiation (1 GY) alone, or combination of X-ray radiation with NTD119B. Saline and NTD119B were administered by intraperitoneal (ip) injection daily, and IR was conducted every two days for 14 days (FIG. 3B). Following administrations, the tumor volume in the IR group increased slower than that in the control group, being about 6-fold its initial volume at fourteenth day post dose. NTD119B alone did not have anti-tumor effects. The combined treatment showed significant tumor growth inhibition. Especially, in the high- dose combination group of IR with NTD119B (10 mg / kg), the tumor volume began to decrease at the sixth day post dose (FIG. 3C). The tumor weights in the IR alone group, combination groups with 1 mg / kg and 10 mg / kg dose were reduced by 35%, 60% and 77%, respectively, compared to the control group (FIG. 3D).
[0291] Under these conditions, IR treatment caused only a slight the loss of body weight, and there was not obvious difference between the combination and IR groups. NTD119B alone did not affect the mice body weight obviously (FIG. 3E). Moreover, there was not obviouseffects to the organs, including heart, liver, spleen, lung, and kidney in these six groups (FIG. 3F).
[0292] Example 7: NTD119B targets cellular TDP1.
[0293] To confirm whether NTD119B can target TDP1 in cells, Cellular Thermal Shift Assays (CETSA) were conducted. The results (FIG. 4A) indicated that the thermal melting curve of TDP1 protein shifted left after incubation with NTD119B, implying the binding of NTD119B to TDP1 protein in cells. Moreover, the co-incubation of NTD119B with IR caused further left shift. Not to be bound by theory, but it likely that IR increased intracellular DNA damage, which recruited more TDP1 binding to DNA breaks, resulting in more interaction of NTD119B to TDPlcc.
[0294] Immunocomplex of enzyme to DNA (ICE) experiments confirmed the hypothesis. NTD119B alone could stabilize and increase the formation of cellular TDPlcc (FIG. 4B). Co-incubation of NTD119B with IR resulted in more TDPlcc formation. These results imply that NTD119B can target and stabilize cellular TDPlccs.
[0295] Molecular modeling (FIG. 4C) indicated that the skeleton of NTD119B can be inserted at a certain angle into a large hydrophobic pocket closing the DNA binding groove, with the 5-side chain extending towards the narrow catalytic center of TDP1 and being close to the key amino acids His493 and Asn283. The 9-side chain crossed with the DNA substrate, and the oxygen atom of morpholine end formed a strong hydrogen bond with Ser536 (2.5 A). A hydrogen bond was also observed between the oxygen of 8-methoxy group and Asn516 (2.9 A), which might contribute to TDP1 inhibition.
[0296] To verify whether the radiosensitization of NTD119B is related to intracellular TDP1, colony formation assays in SgTDPl-HCT116 cells were conducted. As shown in FIG. 4D, although SgTDPl-HCTl 16 cells were more sensitive to IR than parental wild-type HCT116, the radiosensitizing effect of NTD119B decreased significantly compared with that in HCT116 cells, indicating that the radiosensitization of NTD119B is TDP 1 -dependent.
[0297] Example 8: NTD119B suppresses NHEJ repair resulting in enhanced IR-induced DNA damage.
[0298] To investigate the effect of NTD119B on DNA repair, a NHEJ reporter plasmid and a NH reporter plasmid were constructed for detection through flow cytometry (FIG. 5A). The results indicated that NTD119B reduced the intracellular NHEJ repair level significantly in dose-dependent manner (FIG. 5B). After incubation with 1.0 pM NTD119B, NHEJ repairlevel in HCT116 cells decreased by approximately 72%. The NHEJ repair level could also be significantly suppressed by the knockout of TDP1, and the level in SgTDPl-HCTl 16 cells was 14% of that in HCT116 cells. After incubation with NTD119B (1.0 pM), NHEJ activity decreased from 14% to 7% in SgTDPl-HCTl 16 cells (FIG. 5B). Conversely, NTD119B did not suppress HR repair activity in HCT116 cells (FIG. 5C).
[0299] Although the cellular level of NHEJ repair can be reduced by inhibition of TDP1, the specific mechanism remains unclear. To explore the molecular mechanism of TDP1 functional inhibition in reducing NHEJ repair levels, the expression levels of the mRNA and the major proteins involving in NHEJ repair pathway were detected through qRT-PCR and western blotting. The results showed that NTD119B could slightly down-regulate the mRNA and the protein expression of XRCC4 in both cells treated with and without IR (FIG. 5D, FIG. 5E), but had no obvious effect on Ku70 / 80 and Lig4 (FIG. 5E).
[0300] It has been reported that TDP1 is able to regulate the recruitment of XRCC4 to the DNA break sites through its phosphorylation function. The fluorescence co-localization experiment indicated that NTD119B could obviously reduce the recruitment of XRCC4 at the damage sites after incubation for 3 hours in HCT116 cells (FIG. 5F and FIG. 5G), which is possibly the reason that NTD119B suppressed cellular NHEJ activity.
[0301] Western blotting showed that the levels of Y-H2AX protein increased slightly in HCT116 cells incubated with NTD119B alone (FIG. 5D). As expected, IR-induced DSBs, resulted in a significantly increased of Y-H2AX protein level, and NTD119B further increased the Y-H2AX levels induced by IR (FIG. 5D), implying its potency to enhance IR-induced xDNA damage. Similarly, immunofluorescence results also confirmed that NTD119B could increase the Y-H2AX foci in HCT116 cells (FIG. 5H).
[0302] These results indicated that NTD119B could block XRCC4 recruiting to DNA damage sites and suppress NHEJ activity possibly due to its inhibition of TDP1 function, resulting in the enhancement of IR-induced DNA damage.
[0303] Example 9: NTD119B can significantly increase cellular PIG3 expression.
[0304] To explore other cellular effects of NTD119B in cells, RNA-seq analysis was conducted in HCT116 cells treated with NTD119B (5 pM). The data for over 30,000 genes were aligned and a key differentially expressed gene, PIG3, (FIG. 6A) was identified. PIG3 is a gene induced by the tumor suppressor p53 and involved in p53-mediated cell apoptosis. The protein encoded by this gene shows oxidoreductase activity, involved in cellularresponses to oxidative stresses and IR. Downregulation of PIG3 results in radioresistance. KEGG analysis indicated that the differentially expressed genes were mainly concentrated in the upregulation of the p53 signaling pathway and downregulation of the cell cycle pathway (FIG. 6B and FIG. C). Gene set enrichment analysis (GSEA) demonstrated that the p53 signaling pathway was activated upon NTD119B treatment (FIG. 6D). Subsequently, the effects of NTD119B on PIG3 transcription and translation were detected by qRT-PCR and western blotting experiments. The transcript level of PIG3 increased significantly in HCT116 cells after NTD119B treatment both with and without IR (FIG. 6E). Western blotting experiments showed that the upregulation of PIG3 by NTD119B was dose-dependent both in the absence and presence of IR (FIG. 6F). IHC experiments also confirmed that NTD119B increased the expression of PIG3 significantly in tumor tissues (FIG. 6G). These results revealed that PIG3 may be another factor for NTD119B to sensitize CRC radiotherapy.
[0305] Example 10: NTD119B induced ROS-mediated mitochondrial dysfunction, cell cycle arrest and apoptosis by activation of p53 initiated PIG3 transcription.
[0306] PIG3 possesses NAPDH-dependent reductase activity and promotes oxidative stress and reactive oxygen species (ROS) production in cells exposed to strong damage stimuli, such as radiation, which leads to cell death. The generation of intercellular ROS was detected by a enzyme linked immunosorbent assay (ELISA) and flow cytometry using a dichlorodihydrofluorescein diacetate (DCFH-DA) probe. As shown in FIG. 7A, NTD119B alone did not induce ROS under normal condition. Yet, NTD119B increased ROS production significantly under X-ray radiation (4 GY) conditions. The ROS level increased to 1.7-fold and 2.1 -fold after drug treatment at 5 pM and 10 pM concentration for 90 min, respectively. Flow cytometry experiments also confirmed that NTD119B could increase ROS production, and the ROS ratio increased from 7.2% to 27.6% after combined treatment with IR (4 GY) for 24 hours (FIG. 7B).
[0307] Excessive ROS production causes changes of mitochondrial membrane potential (A / m), and mitochondrial dysfunction. The effects of NTD119B on mitochondrial functions was investigated by fluorescence using JC-1 probe. The dissipated Ai / / mwere observed after combined treatment of 10 pM NTD119B with IR (FIG. 7D). This result was confirmed by flow cytometry experiments (FIG. 7C). These results suggested that NTD119B could induce mitochondrial dysfunction by increasing intercellular IR-induced ROS.
[0308] PIG3 can regulate the distribution of cells in G2 / M phase, where they remain sensitive to IR. GSEA demonstrated that the cell cycle pathway was suppressed upon NTD119B treatment (FIG. 7E). Flow cytometry experiments showed that the cell proportion at G2 / M phase increased from 15.8% to 25.6% after treatment with 10 pM of NTD119B, and from 20.5% to 66.1% after co-treatment of NTD119B (10 pM) with IR (4 GY, FIG. 7F). These results indicate that NTD119B combination with IR can induce cell cycle arrest at the G2 / M phase, resulting in cancer cells more sensitive to IR.
[0309] In addition, GSEA demonstrated that the apoptosis pathway was activated by NTD119B (FIG. 7G). Indeed, flow cytometry assays indicated that NTD119B could induce apoptosis in HCT116 cells in a dose-dependent manner (FIG. 7H). The apoptotic ratio increased from 31.8% to 42. 9% after co-treatment of NTD119B (10 pM) with IR. TUNEL assays also confirmed that NTD119B enhanced the IR-induced cells apoptosis significantly in a dose-dependent manner in the tumor tissues (FIG. 71). Western blotting experiments also showed that NTD119B increased the expression of IR-induced apoptotic proteins, including cleaved-PARP, cleaved-Caspase9, cleaved-Caspase7, and cleaved-Caspase3 (FIG. 7J).
[0310] These results indicate that NTD119B can induce the IR-induced cancer cell apoptosis and sensitize cancer cells to radiotherapy possibly due to activating the p53 pathway and upregulating PIG3, resulting in ROS-mediated mitochondrial dysfunction and inducing cell cycle arrest at the G2 / M phase.
[0311] Methods
[0312] General
[0313] The major chemical reagents for synthesis were purchased from Alfa Aesar, Sigma Aldrich Co. or Aladdin Reagent Database Inc. (Shanghai), and were used without further purification unless otherwise indicated. Chemical reaction courses were monitored by silica gel GF254 thin layer chromatography (TLC). Nuclear magnetic resonance spectra were recorded on a Bruker AVANCE III 400 MHz spectrometer using tetramethylsilane as an internal reference. Mass spectra were analyzed on an Agilent 6120 (Quadrupole LC-MS) mass spectrometer. The high-resolution mass spectra were analyzed on a SHIMADZU LCMS-IT-TOF mass spectrometer. All compounds tested for biological activities were analyzed by HPLC and their purities were more than 95%. The analysis condition was detection at 220 nm, 1.0 ml / min flow rate, a linear gradient of 50% to 15% PBS buffer (pH 3) and 50% to 85% MeOH in 35 min.
[0314] Method 1: TDP1 inhibition assay.
[0315] Fluorescence assay. A linear oligonucleotide labeled with FAM (donor fluorophore, 6-carboxyfluorescein) and BHQ (Black Hole Quencher), 5'-FAM- AGGATCTAAAAGACTT-BHQ-3' (SEQ ID NO: 1) was designed as a linear quenched fluorescent substrate. TDP1 solution (20 pL / well, 0.02 pL purified TDP1 (100 nM) in 10 mM Tris-HCl, pH 7.5, 50 mM KC1, 1 mM EDTA, 1 mM DTT) was dispensed into wells of a white 384-well plate (NEST). The tested compound solution in DMSO (5 pL) was pinned into assay plates and incubated at room temperature for 30 min. During this time, the plates were read by a Flash multimode reader (Molecular Devices) at Ex485 / Emsio nm to identify false-positive compounds that had autofluorescence. The linear oligonucleotide substrate (25 pL, 35 nM) was dispensed into the wells to start the reaction. The whole plate was immediately read five times using a kinetic read on the Flash multimode reader (Molecular Devices) (Ex485 / Eni5io nm). TDP1 percentage inhibition of the tested compounds was calculated by comparing the rate of increase in fluorescence throughout time for the compound-treated wells to that of DMSO control wells.
[0316] Gel-based assay. Methods for identifying TDP1 inhibitors have been described previously, for example by Marchand, et al., in Molecular Cancer Therapeutics (2009) 8: 240-248. The gel-based assay of Marchand, et al., is based on the cleavage by TDP1 of the 14-mer 5'-32P-labeled 3'-phosphotyrosyl DNA substrate N14Y (5'-GATCTAAAAGACTT- pY-3'; SEQ ID NO: 2) to a 14-mer 5'-32P -labeled 3'-phosphate DNA product N14P. A 5'- [32P]-labeled single-stranded DNA oligonucleotide containing a 3 '-phosphotyrosine (N14Y) was incubated at 1 nM with 0.02 nM or 10 pM recombinant human TDP1 in the absence or presence of inhibitor for 15 min at room temperature in buffer containing 50 mM Tris HC1, pH 7.5, 80 mM KC1, 2 mM EDTA, 1 mM DTT, 40 (E°g / mL BSA, and 0.01% Tween-20. Reactions were terminated by the addition of 1 volume of gel loading buffer [99.5% (v / v) formamide, 5 mM EDTA, 0.01% (w / v) xylene cyanol, and 0.01% (w / v) bromophenol blue]. Samples were subjected to a 16% denaturing PAGE. Gels were dried and exposed to a Phosphorlmager screen (GE Healthcare). Gel images were scanned using a Typhoon FLA 9500 scanner (GE Healthcare), and densitometry analyses were performed using the ImageQuant software (GE Healthcare).
[0317] Method 2: TOPl-mediated cleavage assay.
[0318] Approximately 2 nM radiolabeled DNA substrate was incubated with recombinant TOPI in 20 mL of reaction buffer (10 mM Tris-HCl pH 7.5, 50 mM KC1, 5 mM MgCl2, 0.1 mM EDTA, and 15 mg / mL BSA) at 25 °C for 20 min in the presence of various concentrations of test compounds. The reactions were terminated by adding SDS (0.5% final concentration) followed by the addition of two volumes of loading dye (80% formamide, 10 mM sodium hydroxide, 1 mM sodium EDTA, 0.1% xylene cyanol, and 0.1% bromophenol blue). Aliquots of each reaction mixture were subjected to 20% denaturing PAGE. Gels were dried and visualized by using a phosphoimager and ImageQuant software (Molecular Dynamics). Cleavage sites are numbered to reflect actual sites on the 117-bp oligonucleotide.
[0319] Method 2: Cell lines and animals.
[0320] Human colorectal cancer cell lines (HCT116, SW480, RKO), lung cancer cell line (A549), gastric cancer cell line (HGC-27), cervical cancer cell line (Hela), normal human colonic epithelial cell line (NCM460) and 293 T cell line were purchased from Laboratory Animal Center of Sun Yat-sen University (Guangzhou, China). SW480, A549, Hela and 293T cells were grown in DMEM medium with 10% FBS, and RKO, HGC-27 and NCM460 cells in RPMI-1640 medium with 10% FBS, and HCT116 cells in McCoy’s 5a Medium with 10% FBS. Cells were maintained at 37 °C in a 5% CO2incubator.
[0321] All animals were purchased from the Laboratory Animal Center of Sun Yat-sen University (Guangzhou, China). The Institutional Animal Care and Use Committee of Sun Yat-sen University approved all the experimental procedures (Approval No. SYSU-IACUC- 2022-B1727).
[0322] Method 3: Colony formation assay.
[0323] Cells were plated 2000 cells per well in 6-well plates. After incubation for 24 hours (“h”), the cells were treated with drug alone or with IR using an X-ray linear accelerator (Rad Source, RS2000Lite). The treated cells were cultured for 10-14 days, and then rinsed with PBS, fixed with methanol and stained with crystal violet. Colonies containing more than 50 cells were counted as surviving clones and normalized to the plating efficiency of each sham- treated tumor cell line.
[0324] Method 4: CRISPR editing of TDP1.
[0325] The sgRNAs were designed according to the Massachusetts Institute of Technology CRISPR design software. Oligos corresponding to the sgRNAs were synthesized and clonedinto lentiCRISPR v2 vector, following lentiCRISPRv2 and lentiGuide oligo cloning protocol (Addgene, plasmid #52961). To minimize the possibility of nonspecific targeting, three sgRNA oligos of each targeting gene were synthesized and tested. The sgRNA with the best knockout efficiency was chosen for subsequent experiments. The sgRNA sequences were used for human cells as follows:
[0326] TDPlSgRNA F: CACCGAGGTGTGTATGACAACCCGG (SEQ ID NO:3)
[0327] TDPlSgRNA R: AAACCCGGGTTGTCATACACACCTC (SEQ ID NO:4)
[0328] The lentiviral particles were generated using 293T cells. HCT116 cells were plated1 x 105cells per well in 6-well plates. After being incubated for 12 h, 1 mL of virus-containing supernatant with 10 ng polybrene was added to the cells followed by incubation for 6 h.Then, 1 mL additional regular medium containing 10% heat-inactivated FBS was added, and the resulting cells were further cultured for overnight. The infection medium was replaced with 2 mL fresh medium with 10% FBS and cultured for 72 h. Cells were passaged to 60 mm tissue culture dishes and selected by culturing in 0.3 pg / mL puromycin for 3 days. The knockout of the targeted gene was verified by western blotting.
[0329] Method 5: NHEJ and HR reporter assays.
[0330] The structures and functions of the NHEJ and HR reporters are presented in FIG. 5 A. For NHEJ and HR reporter assays, HCT116 (WT and SgTDPl) cells were cotransfected with NHEJ or HR reporter and pCMV-NLS-I-Scel for 48 h. After incubation with drug for 48 h, the cells were harvested to assess the proportion of GFP+cells using a CytoFLEX flow cytometer (Beckman). The NHEJ- or HR-mediated DNA repair efficiency was presented as the percentage of GFP+cells normalized to the respective control.
[0331] Method 6: Cellular Thermal Shift Assay (CETSA).
[0332] The CETSA was performed as follows. Briefly, mid log phase HCT116 cells (2 x 105cells / mL) were incubated with drug alone or with IR for 1 h, and then harvested and aliquoted to 8 PCR tubes, followed by heating at 37.0, 37.8, 39.4, 42.0, 45.1, 47.3, 48.9, 50 °C for 3 min (Bio-Rad T100 Thermal Cycler). After being cooled to room temperature, the cells were lysed with a freeze-thawed method using liquid nitrogen. The cell lysates were centrifuged at 14000 rpm for 20 min at 4 °C. The supernatants were collected, and equal amounts of proteins were analyzed by western blotting analysis.
[0333] Method 7: Immunodetection of Cellular TDPlcc.
[0334] HCT116 cells (2* 105cells / mL) were incubated with drug alone or with IR for 1 h, and then lysed with DNAzol reagent (1 mL) at 25 °C for 30 min. Ethanol (0.5 mL, 100%) was subsequently added and mixed with the lysate. The solution was incubated at -20 °C overnight. The genomic DNA was collected by centrifugation (12000 rpm) at 25 °C for 10 min and washed with 75% ethanol. The precipitated DNA was dissolved in NaOH (8 mM, 0.2 mL). The pH value was adjusted to 7.2 by adding HEPES (1 M). After centrifugation, supernatant was used to quantify the DNA concentration. DNA (2 pg) was dissolved in 30 L of NaH2PO4 buffer (25 mM, pH 6.5) and then loaded onto nitrocellulose membranes. Membranes were incubated with anti-TDPl (1 3000, #ab227144, Abeam) at 4 °C overnight, and then incubated with the appropriate HRP conjugated secondary antibodies (1:5000, #7074; Cell Signaling Technology) at room temperature for 1 h. Reactive dots were detected using Immobilon Western Chemiluminescent HRP substrate (Millipore).
[0335] Method 8: Immunofluorescence.
[0336] After being incubated with drug alone or with IR at 37 °C, HCT116 cells (2x 105cells / mL) were fixed with 4% paraformaldehyde for 10 min, then permeabilized with 0.5% Triton X-100 / PBS at 37 °C for 30 min, and finally blocked with 5% goat serum / PBS at 37 °C for 1 h. The cells were then incubated with anti-y-^AX (1 :400, #ab81299; Abeam) or anti- XRCC4 (1:400, #ab97351; Abeam) at 4 °C overnight, followed by incubating with antirabbit Alexa Fluor™ 488 conjugated antibody (1: 1000, A21206, Invitrogen) or anti-mouse Alexa Fluor™ 633 conjugated antibody (1 : 1000, A21050, Invitrogen) for 1 h at room temperature in dark. The samples were costained with DAPI (1 pg / mL, D1306, Invitrogen) and recorded using an FV3000 microscope (Olympus, Japan) and analyzed with FV31 S-SW software and Image J.
[0337] Method 9: Western blotting analysis.
[0338] HCT116 cells (2* 105cells / mL) were collected and lysed in RIPA lysis buffer (Pierce) supplemented with protease and phosphatase inhibitor cocktail (Cell Signaling Technology) after treatment with drug alone or with IR. Protein concentration was determined using the BCA assay (#WB6501, NCM Biotech). Lysates were then denatured and samples containing 20 pg proteins were subjected to electrophoresis in 10% SDS-poly- acrylamide gel, followed by transfer to polyvinylidene difluoride membranes (Bio-Rad). After blocking with 3% nonfat dry milk, the membranes were incubated at 4 °C overnight with the primary antibody, followed by labeling with HRP conjugated secondary antibodies(1:5000, #7074; Cell Signaling Technology) at room temperature for 1 h. Blots were detected using Immobilon Western Chemiluminescent HRP substrate (Millipore) and quantified with ImageJ.
[0339] Method 10: Quantitative real-time reverse transcription PCR.
[0340] HCT116 cells (2x 105cells / mL) were inoculated in 6-well plates and treated with drug alone or with IR. After incubation for 24 h, the cells were lysed and the lysates were centrifuged. Total RNA was isolated using the TRIzol reagent (#15596026; Invitrogen) and reverse-transcribed using NovoScript® Plus 1st Strand cDNA Synthesis SuperMix (#E047- 01A; NovoScript, China). The resulting cDNA was subjected to qRT-PCR analysis, performed in triplicate, using the NovoStart® SYBR qPCR SuperMix Plus (#E096-01A; NovoScript, China) on a lightCycler480II Real-Time System (Roche, USA). PCR product specificity was confirmed by melting-curve analysis. The relative mRNA expression was calculated as 2'AACt(GAPDH was used as an internal control) after normalization to the control group. The primer sequences used in the PCR reactions are listed in Table 10:
[0341] Method 11: RNA-seq and bioinformatic analysis.
[0342] HCT116 cells (2x 105cells / mL) were inoculated in a 10 cm culture dish and treated with drugs at the indicated doses. After incubation for 24 h, the cells were lysed by TRIzol reagent (#15596026; Invitrogen) and the samples were tested for RNA sequencing (Shanghai DIATRE Biotechnology). Differentially expressed genes (DEGs) were defined as genes withfold change >2 or <0.5 and P < 0.05. DEGs were used for Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis by using the clusterProfiler package and GSEA. Statistical significance was assessed by comparing the enrichment score to enrichment results generated from 1000 random permutations of gene set to obtain P-values.
[0343] Method 12: Intracellular ROS detection.
[0344] HCT116 cells (2 x io5cells / mL) were incubated with drug alone or with IR, and then washed with PBS and stained with 2,7-dichlorodihydrofluorescein diacetate probe (10 pM) for 20 min. Fluorescence intensity were acquired using a ELIASA (Flex Station 3; ex / em: 485 / 525 nm) and flow cytometer, respectively.
[0345] Method 13: Mitochondrial membrane potential.
[0346] HCT116 cells (2x 105cells / mL) were incubated with drug alone or with IR for 24 h and then collected and washed with PBS, followed by incubation with JC-1 according to the manufacturer’s instruction. Image and fluorescence intensity were acquired using a fluorescence microscope and the flow cytometer, respectively.
[0347] Method 14: Cell cycle analysis with flow cytometry.
[0348] HCT116 cells (2* 105cells / mL) were incubated with drug alone or with IR for 24 h and then collected and washed with cold PBS three times. Then, the cells were re-suspended with 200 pL of PBS and added dropwise to 70% ethanol. The samples were stored at -20 °C overnight. The RNA in the samples was eliminated by RNase A at 37 °C for 30 min. Finally, the samples were stained with propidium iodide (PI) for 30 min at 4 °C, and detected by flow cytometer.
[0349] Method 15: Apoptosis analysis with flow cytometry.
[0350] HCT116 cells (2 105cells / mL) were incubated with drug alone or with IR for 24 h and then collected and washed with cold PBS three times. The cells were stained with the Annexin V-FITC / PI apoptosis kit (#ATI0I; MUTIL SCIENCES, China) according to the manufacturer protocol and analyzed by a flow cytometer within 1 h.
[0351] Method 16: Pharmacokinetic study in rat.
[0352] Male SD rats (220-250 g) were treated with drug predissolved in 10% DMA and 10% Kolliphor HS15 (a nonionic solubilizer) by intravenous (iv; 1 mg / kg, n = 1) and by intragastric administration (ig; 5 mg / kg, n = 5), respectively. Blood samples (200 pL) were collected into heparinized tubes via the jugular vein at the following times: 0.083, 0.25, 0.5,1, 2, 5, 7, and 24 h postdose. Plasma samples (100 pL) were obtained after centrifugation for 10 min at 3000 rpm and stored at -20 °C for analysis. The plasma was detected through LC- MS-MS.
[0353] Method 17: In vivo acute toxicity.
[0354] The Kunming male mice (4-5 weeks, 20-25 g) were randomly divided into four groups (n = 3) and administered by intraperitoneal (ip) injection. The control group was treated with an equivalent volume of saline. The testing groups were treated with drug in a single dose 600, 300 and 100 mg / kg, respectively. The mice were kept under observation for 7 days postdose in order to check for any behavioral (poisoning symptoms and body weight) and death. All animals were euthanized by cervical dislocation at the end of the experiments.
[0355] Method 18: Radiosensitization in vivo.
[0356] Male BALB / c nude mice (4-5 weeks, 15-18 g) were randomly divided into 6 groups (n = 6) and used to generate xenograft models via subcutaneous transplant of tumor sections (approximately 5 mm3) from HCT116 xenografts into the right flank. When the xenograft volume reached approximately 120 mm3, the mice were treated with drug (1 and 10 mg / kg) every day by ip injection or / and IR (1 GY) every two days for 14 days. Tumor volume was calculated using the following formula: V= length x width x width / 2. At the end of the experiment, all of the mice were euthanized by cervical dislocation. The tumors were removed and weighed, and sliced for further pathologic analysis.
[0357] Method 19: Statistical analysis.
[0358] All of the experimental data obtained from in vitro cellular studies and animal tests are presented as mean ± SD, analyzed using the two-tailed Student t-test for two groups or ANOVA for multiple groups. The statistical significance of Kaplan-Meier survival curves was assessed with a Mann-Whitney test. The number of independent experiments and the replicates were indicated in the figure legends, / ’-values < 0.05 were considered to be significant and are indicated by asterisks as follows: *P < 0.05, ** < 0.01, ***P < 0.001, ****? < 0.0001.
[0359] Various embodiments and aspects of the disclosure are provided by the following non-limiting enumerated embodiments, which can be combined in any number and in any combination that is not logically or technically inconsistent.Embodiment 1. A compound of Formula I or a pharmaceutically acceptable salt thereof, wherein Formula I is represented by the following structure:(Formula I), wherein the groupwhich RYis selected from-LYA-RYA,-LYA-CyYA,-methyl, -ethyl, and-Ca-Cgalkyl, which Ca-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, in which each LYAis independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, andRYAis selected from -NRYD2, -NHRYD, -NH2, -NHBoc, -ORYD, -OH, -SRYD, - SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl, andCyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or moresubstituents selected from Ci-Chalkyl which Ci-Cialkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; or the groupwhich Rxis selected from-AX-LXA-RXA,-Ax-LXA-CyXA’-Ax-Ci-C8alkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, and can be substituted by oxo,-CyXA, and-RXA, in which each Axis independently O, NH or absent, each LXAis independently Ci-Csalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBoc, -0RXD, -OH, -SRXD, -SH, cyano, and -C02RXIJ, in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R1is selected fromCy1A-L1A-,R1A-L1A-,Cy1B-L1B-Cy1A-L1A-,RiB.LiB_CyIA_LIA_,Ci-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, andH, wherein each L1Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy1Ais independently or selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl;Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Bis selected from R1E2N-, R1EHN-, H2N-, BocHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,R2is selected fromCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo,Cy2A-L2A-,R2A-L2A-,R2B_L2B_Cy2A_L2A_,Cy2B-L2B-Cy2A-L2A-, andH, wherein each L2Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy2Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Cralkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl;Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Chalkyl which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R2Bis selected from R2E2N-, R2EHN-, H2N-, BocHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R3is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R4is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl ;R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy;R6is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R7is selected fromH,Cy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.;Cy7B-L7B-Cy7A-L7A-A7-,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A7is independently O, NH or absent each L7Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS- and -CN, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R8is selected fromH,Cy8A-L8A-A8-,R8A_L8A_A8_,R8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8A-L8A-A8-, andC1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A8is O, NH, -O(O)C- or absent; each L8Ais independently a bond or Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo or hydroxy, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci- C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R8Ais selected from H, R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, -CN and halo (e.g., Cl or F), in which each R8Dis independently Ci- Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-CFalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently a bond or Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; andR9is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl,with the proviso that at least one of R1, R2, R7, R8, and R9is other than H or C1-C4 alkyl.Embodiment 2. The compound or pharmaceutically-acceptable salt of Embodiment 1, wherein the groupwhich RYis selected from-LYA-RYA,-LYA-CyYA,-methyl,-ethyl, and-Ca-Csalkyl, which Ca-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CJE groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, in which each LYAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, andRYAis selected from -NRYD2, -NHRYD, -NH2, -NHBoc, -ORYD, -OH, -SRYD, - SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl, andCyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; or the groupwhich Rxis selected from-AX-LXA-RXA,-Ax-LXA-CyXA’-Ax-Ci-C8alkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, and can be substituted by oxo,-CyXA, and-RXA, in which each Axis independently O, NH or absent, each LXAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBoc, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2RXIJ, in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R1is selected fromCy1A-L1A-,R1A-L1A-,Cy1B-L1B-Cy1A-L1A-,RiB.LiB_CyIA_LIA_,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, andH, wherein each L1Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,each Cy1Ais independently or selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl;Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Cbalkyl which Ci-Cbalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Bis selected from R1E2N-, R1EHN-, H2N-, BocHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,R2is selected fromCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo,Cy2A-L2A-,R2A-L2A-,R2B_L2B_Cy2A_L2A_,Cy2B-L2B-Cy2A-L2A-, andH, wherein each L2Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy2Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substitutedwith one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl;Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Chalkyl which Ci-Chalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R2Bis selected from R2E2N-, R2EHN-, H2N-, BocHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R3is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R4is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl ;R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy;R6is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R7is selected fromH,Cy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7_,Cy7B-L7B-Cy7A-L7A-A7-,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A7is independently O, NH or absenteach L7Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS-, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-CCalkyl which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R8is selected fromH,Cy8A-L8A-A8-,RSA.LSA.AS.,R8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8A-L8A-A8-, andC1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A8is O, NH, -O(O)C- or absent;each L8Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, in which each R8Dis independently Ci-Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-CCalkyl which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; andR9is H, with the proviso that at least one of R1, R2, R7, R8, and R9is other than H or C1-C4 alkyl.Embodiment 3. The compound or pharmaceutically-acceptable salt of Embodiment 1 or Embodiment 2, wherein at least one of R1, R2, R7and R8is other than H or C1-C4 alkyl.Embodiment 4. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 1-3, wherein theEmbodiment 5. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 1-4, wherein RYis -LYARYAEmbodiment 6. The compound or pharmaceutically-acceptable salt of Embodiment 5, wherein RYAis -NRYD2, -NHRYDor -NEE.Embodiment 7. The compound or pharmaceutically-acceptable salt of Embodiment 5, wherein RYAis RYD2N-, for example, dimethylamino, diethylamino, or dipropylaminoEmbodiment 8. The compound or pharmaceutically-acceptable salt of Embodiment 5, wherein RYAis dimethylamino.Embodiment 9. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-4, wherein RYis LYACyYA.Embodiment 10. The compound or pharmaceutically-acceptable salt of Embodiment 9, wherein CyYAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl or Ci-Csfluoroalkoxy.Embodiment 11. The compound or pharmaceutically-acceptable salt of Embodiment 9, wherein CyYAis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LYAthrough a nitrogen atom thereof.Embodiment 12. The compound or pharmaceutically-acceptable salt of Embodiment 9, wherein CyYAis unsubstituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LYAthrough a nitrogen atom thereof.Embodiment 13. The compound or pharmaceutically-acceptable salt of any of Embodiments 5-12, wherein LYAis -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-.Embodiment 14. The compound or pharmaceutically-acceptable salt of any of Embodiments 5-12, wherein LYAis -CH2CH2-.Embodiment 15. The compound or pharmaceutically-acceptable salt of any of Embodiments 5-12, wherein LYAis -CH2CH2CH2-.Embodiment 16. The compound or pharmaceutically-acceptable salt of any of Embodiments 5-12, wherein LYAis Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-Embodiment 17. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-4, wherein LYis methyl.Embodiment 18. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-4, wherein LYis ethyl.Embodiment 19. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-4, wherein RYis C3-Csalkyl, which C3-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more GEE groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4 lkyl.Embodiment 20. The compound or pharmaceutically-acceptable salt of Embodiment 19, wherein RYis Ci-Csalkyl having the formula -CnH(2n+i) in which n is in the range of 3-8, e.g., 4-8 or 5-8.Embodiment 21. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-4, wherein RYis selected from -LYARYAand -LYACyYA, wherein LYAis -CH2CH2- or -CH2CH2CH2-; and RYAis selected from -NRYD2, in which each RYDis independently Ci-C3alkyl; or CyYAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.Embodiment 22. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 1-4, wherein the groupEmbodiment 23. The compound or pharmaceutically-acceptable salt of Embodiments 1- 3 and 22, wherein Axis O or NH.Embodiment 24. The compound or pharmaceutically-acceptable salt of Embodiments 1- 3 and 22, wherein Axis O.Embodiment 25. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis -AX-LXARXA.Embodiment 26. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis -RXA.Embodiment 27. The compound or pharmaceutically-acceptable salt of Embodiment 25 or Embodiment 26, wherein RXAis -NRXD2, -NHRXD, or -NH2.Embodiment 28. The compound or pharmaceutically-acceptable salt of Embodiment 25 or Embodiment 26, wherein RXAis -NRXD2, for example, dimethylamino, diethylamino, or dipropylamino.Embodiment 29. The compound or pharmaceutically-acceptable salt of Embodiment 25 or Embodiment 26, wherein RXAis dimethylamino.Embodiment 30. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis -Ax-LXACyXA.Embodiment 31. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis -CyXA.Embodiment 32. The compound or pharmaceutically-acceptable salt of Embodiment 30 or Embodiment 31, wherein CyXAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from C, -Chalky I which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, or Ci-Csfluoroalkoxy.Embodiment 33. The compound or pharmaceutically-acceptable salt of Embodiment 30 or Embodiment 31, wherein CyXAis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LXAthrough a nitrogen atom thereofEmbodiment 34. The compound or pharmaceutically-acceptable salt of Embodiment 30 or Embodiment 31, wherein CyXAis unsubstituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to LXAthrough a nitrogen atom thereof.Embodiment 35. The compound or pharmaceutically-acceptable salt of Embodiment 30 or Embodiment 3 Iwherein CyXAis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 36. The compound or pharmaceutically-acceptable salt of any of Embodiments 22-35, wherein LXAis -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-.Embodiment 37. The compound or pharmaceutically-acceptable salt of any of Embodiments 22-35, wherein LXAis -CH2CH2-.Embodiment 38. The compound or pharmaceutically-acceptable salt of any of Embodiments 22-35, wherein LXAis -CH2CH2CH2-.Embodiment 39. The compound or pharmaceutically-acceptable salt of any of Embodiments 22-35, wherein LXAis Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.Embodiment 40. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 41. The compound or pharmaceutically-acceptable salt of Embodiment 40, wherein Rxis Ci-Csalkyl having the formula -CnH(2n+i) in which n is in the range of 1-8.Embodiment 42. The compound or pharmaceutically-acceptable salt of Embodiment 40, wherein Rxis Ci-Csalkyl having one or two double bonds.Embodiment 43. The compound or pharmaceutically-acceptable salt of Embodiment 40, wherein Rxis methyl or ethyl, e.g., methyl.Embodiment 44. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-3 and 22-24, wherein Rxis selected from -AX-LXA-RXAand -Ax-LXA-CyXA, whereinAxis O;LXAis -CH2CH2- or -CH2CH2CH2-;RXAis -NRXD2, in which each RXDis independently Ci-Csalkyl; andCyXAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.Embodiment 45. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-44, whereinR1is selected fromCy1A-L1A-,R1A-L1A-,RlB.LlB_CylA_LlA_5 andCy1B-L1B-Cy1A-L1A-; andR2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H.Embodiment 46. The compound or pharmaceutically-acceptable salt of Embodiment 45, wherein R2is methyl, trifluorom ethyl or ethyl.Embodiment 47. The compound or pharmaceutically-acceptable salt of Embodiment 45, wherein R2is methyl.Embodiment 48. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-47, wherein each of R3, R4, R5, R6, R7, R8and R9is H.Embodiment 49. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-47, wherein at least 5 of R3, R4, R5, R6, R7, R8and R9is H, e g., at least 6 of R3, R4, R5, R6, R7, R8and R9.Embodiment 50. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-49, wherein R1is Cy1A-L1A-.Embodiment 51. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 52. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof.Embodiment 53. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof.Embodiment 54. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1- nitrogen atom thereof.Embodiment 55. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais selected from C4-Ciocycloalkyl, optionally substituted with one or moresubstituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 56. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 57. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Cialkyl which Ci- alkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 58. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 59. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci -Chalky I which Ci-Caalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 60. The compound or pharmaceutically-acceptable salt of Embodiment 50, wherein Cy1Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 61. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-49, wherein R1is R1A-L1A-.Embodiment 62. The compound or pharmaceutically-acceptable salt of Embodiment 61, wherein R1Ais R1D2N-, R1DHN-, H2N-, or BocHN-.Embodiment 63. The compound or pharmaceutically-acceptable salt of Embodiment 61, wherein R1Ais R1D2N- in which each R1Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 64. The compound or pharmaceutically-acceptable salt of Embodiment 61, wherein R1Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or buty propyl amino.Embodiment 65. The compound or pharmaceutically-acceptable salt of Embodiment 61, wherein R1Ais R1D-O-, HO-, R1D-S-, HS- in which each R1Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 66. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-.Embodiment 67. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais -CH2CH2-.Embodiment 68. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais -CH2CH2CH2-.Embodiment 69. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais Ci-Csalkyl with a single CH2substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.Embodiment 70. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais Ci-Csalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.Embodiment 71. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais Ci-Csalkyl with one or more (e.g., one) CH2replaced by -O-, -NH- or -NR10.Embodiment 72. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 50-65, wherein L1Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 73. The compound or pharmaceutically-acceptable salt of any of Embodiments 50-65, wherein L1Ais -SChNH-Ci-Cealkyl- or -SO2NR10-Ci-C6alkyl, for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-Embodiment 74. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-49, wherein R1is Cy1B-L1B-Cy1A-L1A-.Embodiment 75. The compound or pharmaceutically-acceptable salt of Embodiment 74, wherein Cy1Ais as defined in any of Embodiments 51-60.Embodiment 76. The compound or pharmaceutically-acceptable salt of Embodiment 74 or Embodiment 75, wherein L1Ais as defined in any of Embodiments 66-73.Embodiment 77. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci-C3fluoroalkoxy.Embodiment 78. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof.Embodiment 79. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L1Athrough a nitrogen atom thereof.Embodiment 80. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis a 4-(Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1 -nitrogen atom thereof.Embodiment 81. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis selected from C4-Ciocycloalkyl, optionally substitutedwith one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 82. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e g , unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 83. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Cfalkyl which Ci-Cialkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Caalkoxy, Ci-Cafluoroalkyl, Ci-Cafluoroalkoxy.Embodiment 84. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 85. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy.Embodiment 86. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-76, wherein Cy1Bis optionally-substituted phenyl, e g., tolyl, or unsubstituted phenyl.Embodiment 87. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-49, wherein R1is R1B-L1B-Cy1A-L1A-.Embodiment 88. The compound or pharmaceutically-acceptable salt of Embodiment 85, wherein Cy1Ais as defined in any of Embodiments 51-60.Embodiment 89. The compound or pharmaceutically-acceptable salt of Embodiment 85 or Embodiment 88, wherein L1Ais as defined in any of Embodiments 66-73.Embodiment 90. The compound or pharmaceutically-acceptable salt of any of Embodiments 87-89, wherein R1Bis R1E2N-, R1EHN-, H2N-, or BocHN-.Embodiment 91. The compound or pharmaceutically-acceptable salt of any of Embodiments 87-89, wherein R1Bis R1E2N- in which each R1Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 92. The compound or pharmaceutically-acceptable salt of any of Embodiments 87-89, wherein R1Bis dimethylamino, diethylamino, dipropylamino, dibutylamino butylmethylamino, butylethylamino or buty propyl amino.Embodiment 93. The compound or pharmaceutically-acceptable salt of any of Embodiments 87-89, wherein R1Bis R1E-O-, HO-, R1E-S-, HS- in which each R1Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 94 The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-.Embodiment 95. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis -CH2CH2-.Embodiment 96. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis -CH2CH2CH2-.Embodiment 97. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.Embodiment 98. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 99. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis -O-Ci-Csalkyl-, -NH-Ci-Caalkyl, or NR10-Ci-C3alkyl, e g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 100. The compound or pharmaceutically-acceptable salt of any of Embodiments 74-93, wherein L1Bis -SO2NH-Ci-C3alkyl- or -SO2NR10-Ci-C3alkyl, e g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 101. The compound or pharmaceutically-acceptable salt of any of Embodiments 45-49, wherein R1is selected from R1A-L1A- and Cy1A-L1A- , whereinL1Ais -CH2CH2- or -CH2CH2CH2-;R1Ais R1D2N-, in which each R1Dis independently Ci-Caalkyl; andCy1Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.Embodiment 102. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 45-101, wherein the groupEmbodiment 102. The compound or pharmaceutically-acceptable salt of Embodiment102, wherein the groupdefined in any of Embodiments 5-21.Embodiment 104. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 45-101, wherein the groupEmbodiment 105. The compound or pharmaceutically-acceptable salt of Embodiment104, wherein the groupdefined in any of Embodiments 23-44.Embodiment 106. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-44, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR2is selected fromCy2A-L2A-,R2A-L2A_,R2B_L2B_Cy2A_L2A_5 andCy2B-L1B-Cy2A-L2A-.Embodiment 107. The compound or pharmaceutically-acceptable salt of Embodiment106, wherein R1is methyl, trifluoromethyl or ethyl.Embodiment 108. The compound or pharmaceutically-acceptable salt of Embodiment106, wherein R1is methyl.Embodiment 109. The compound or pharmaceutically-acceptable salt of any of Embodiments 104-106, wherein each of R3, R4, R5, R6, R7, R8and R9is H.Embodiment 110. The compound or pharmaceutically-acceptable salt of any of Embodiments 106-108, wherein at least 5 of R3, R4, R5, R6, R7, R8and R9is H, e.g., at least 6 of R3, R4, R5, R6, R7, R8and R9.Embodiment 111. The compound or pharmaceutically-acceptable salt of any of Embodiments 106-110, wherein R2is Cy2A-L2A-.Embodiment 112. The compound or pharmaceutically-acceptable salt of Embodiment111, wherein Cy2Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one ormore substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 113. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereofEmbodiment 114. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof.Embodiment 115. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L2Athrough the 1- nitrogen atom thereof.Embodiment 116. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 117. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 118. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Cafluoroalkoxy.Embodiment 119. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 120. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Cafluoroalkoxy.Embodiment 121. The compound or pharmaceutically-acceptable salt of Embodiment 111, wherein Cy2Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 122. The compound or pharmaceutically-acceptable salt of any of Embodiments 106-110, wherein R2is R2A-L2A-.Embodiment 123. The compound or pharmaceutically-acceptable salt of Embodiment 122, wherein R2Ais R2D2N-, R2DHN-, H2N-, or BocHN.Embodiment 124. The compound or pharmaceutically-acceptable salt of Embodiment 122, wherein R2Ais R2D2N- in which each R2Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 125. The compound or pharmaceutically-acceptable salt of Embodiment 122, wherein R2Ais dimethylamino, diethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or buty propyl amino.Embodiment 126. The compound or pharmaceutically-acceptable salt of Embodiment 122, wherein R2Ais R2D-O-, HO-, R2D-S-, or HS- in which each R2Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 127. The compound or pharmaceutically-acceptable salt of any of Embodiments 111-126, wherein L2Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-.Embodiment 128. The compound or pharmaceutically-acceptable salt of any of Embodiments 111-126, wherein L2Ais -CH2CH2-.1Embodiment 129. The compound or pharmaceutically-acceptable salt of any of Embodiments 111-126, wherein L2Ais -CH2CH2CH2-.Embodiment 130. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 111-126, wherein L2Ais Ci-Csalkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.Embodiment 131. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 111-126, wherein L2Ais Ci-Csalkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.Embodiment 132. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 111-126, wherein L2Ais Ci-Csalkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 133. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 111-126, wherein L2Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 134. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 111-126, wherein L2Ais -SChNH-Ci-Cealkyl- or -SChNRH-Ci-Cealkyl, e g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 135. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 106-110, wherein R2is Cy2B-L2B-Cy2A-L2A-.Embodiment 136. The compound or pharmaceutically-acceptable salt of Embodiment134, wherein Cy2Ais as defined in any of Embodiments 112-121.Embodiment 137. The compound or pharmaceutically-acceptable salt of Embodiment135 or Embodiment 136, wherein L2Ais as defined in any of Embodiments 127-134.Embodiment 138. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 135-137, wherein Cy2Bis selected from C4-Cioheterocycloalkyl, optionallysubstituted with one or more substituents selected from Ci-Csalkyl (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 139. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof.Embodiment 140. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L2Athrough a nitrogen atom thereof.Embodiment 141. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1 -nitrogen atom thereof.Embodiment 142. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 143. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 144. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci- Chfluoroalkoxy.Embodiment 145. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 146. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci- alkyl (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 147. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-137, wherein Cy2Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 148. The compound or pharmaceutically-acceptable salt of any of Embodiments 106-110, wherein R2is R2B-L2B-Cy2A-L2A-.Embodiment 149. The compound or pharmaceutically-acceptable salt of Embodiment 148, wherein Cy2Ais as defined in any of Embodiments 112-121.Embodiment 150. The compound or pharmaceutically-acceptable salt of Embodiment 148 or Embodiment 149, wherein L2Ais as defined in any of Embodiments 127-134.Embodiment 151. The compound or pharmaceutically-acceptable salt of any of Embodiments 148-150, wherein R2Bis R2E2N-, R2EHN-, H2N-, or BocHN.Embodiment 152. The compound or pharmaceutically-acceptable salt of any of Embodiments 148-150, wherein R2Bis R2E2N- in which each R2Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 153. The compound or pharmaceutically-acceptable salt of any of Embodiments 148-150, wherein R2Bis dimethylamino, diethylamino, dipropylamino, dibutylamino butylmethylamino, butylethylamino or buty propyl amino.Embodiment 154. The compound or pharmaceutically-acceptable salt of any of Embodiments 148-150, wherein R2Bis R2E-O-, HO-, R2E-S-, or HS- in which each R2Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 155 The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-.Embodiment 156. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis -CH2CH2-.Embodiment 157. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis -CH2CH2CH2-.Embodiment 158. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-Embodiment 159. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis Ci-C4alkyl with one or more (e.g., one) CH2replaced by -O-, -NH- or -NR10.Embodiment 160. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis -O-Ci-Csalkyl-, -NH-Ci-Caalkyl, or NR10-Ci-C3alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 161. The compound or pharmaceutically-acceptable salt of any of Embodiments 135-154, wherein L2Bis -SO2NH-Ci-C3alkyl- or -SO2NR10-Ci-C3alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 162. The compound or pharmaceutically-acceptable salt of any of Embodiments 106-161, wherein R2is selected from R2A-L2A- and Cy2A-L2A- , wherein L2Ais -CH2CH2- or -CH2CH2CH2-; R2Ais R2D2N-, in which each R2Dis independently Ci-Csalkyl; and Cy2Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.Embodiment 163. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 106-162, wherein the groupEmbodiment 164. The compound or pharmaceutically-acceptable salt of Embodiment163, wherein the groupdefined in any of Embodiments 5-21.Embodiment 165. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 106-162, wherein the groupEmbodiment 166. The compound or pharmaceutically-acceptable salt of Embodiment164, wherein the groupdefined in any of Embodiments 23-44.Embodiment 167. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 1-44, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H;R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR7is selected fromCy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.5Cy7B-L7B-Cy7A-L7A- A7- .Embodiment 168. The compound or pharmaceutically-acceptable salt of Embodiment 167, wherein each A7is independently O, NH or absent each L7Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS-, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Galkyl which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 169. The compound or pharmaceutically-acceptable salt of Embodiment 167 or Embodiment 168, wherein each of R1and R2is methyl, trifluoromethyl or ethyl.Embodiment 170. The compound or pharmaceutically-acceptable salt of Embodiment 167 or Embodiment 168, wherein each of R1and R2is methyl.Embodiment 171. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-170, wherein each of R3, R4, R5, R6, R8and R9is H.Embodiment 172. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-170, wherein at least 4 of R3, R4, R5, R6, R8and R9is H, e g., at least 5 ofR3, R4, R5, R6, R8and R9.Embodiment 173. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-172, wherein A7is O.Embodiment 174. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-172, wherein A7is NH.Embodiment 175. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-172, wherein A7is absent.Embodiment 176. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-175, wherein R7is Cy7A-L7A-A7-.Embodiment 177. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from C i -CAal ky 1 (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 178. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L7Athrough a nitrogen atom thereof.Embodiment 179. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L7Athrough a nitrogen atom thereof.Embodiment 180. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L7Athrough the 1- nitrogen atom thereof.Embodiment 181. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 182. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 183. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci-Cafluoroalkoxy.Embodiment 184. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 185. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Cafluoroalkoxy.Embodiment 186. The compound or pharmaceutically-acceptable salt of Embodiment 176, wherein Cy7Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 187. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-174, wherein R7is R7A-L7A-A7-.Embodiment 188. The compound or pharmaecutically-acceptable salt of Embodiment 187, wherein R7Ais selected from R^N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S- and HS-.Embodiment 189. The compound or pharmaecutically-acceptable salt of Embodiment 187, wherein R7Ais -CN.Embodiment 190. The compound or pharmaceutically-acceptable salt of Embodiment 187, wherein R7Ais R7D2N-, R7DHN-, H2N-, or BocHN.Embodiment 191. The compound or pharmaceutically-acceptable salt of Embodiment 187, wherein R7Ais R7D2N- in which each R7Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 191. The compound or pharmaceutically-acceptable salt of Embodiment 187, wherein R7Ais dimethylamino, di ethylamino, dipropylamino, dibutylamino, butylmethylamino, butylethylamino or buty propyl amino.Embodiment 192. The compound or pharmaceutically-acceptable salt of Embodiment 187, wherein R7Ais R7D-O-, HO-, R7D-S-, HS- in which each R7Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 193. The compound or pharmaceutically-acceptable salt of any of Embodiments 174-189, wherein L7Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, - CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-.Embodiment 194. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais -CH2CH2-.Embodiment 195. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais -CH2CH2CH2-.Embodiment 196. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais Ci-C?Alkyl with a single CH2substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.Embodiment 197. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais Ci-C?Alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-Embodiment 198. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais Ci-C?alkyl with one or more (e g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 199. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais -O-Ci-C?alkyl-, -NH-Ci-C?alkyl, or NR10-Ci-C7alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 200. The compound or pharmaceutically-acceptable salt of any of Embodiments 176-193, wherein L7Ais -SChNH-Ci-Cealkyl- or -SO2NR10-Ci-C6alkyl, e g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 201. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-174, wherein R7is Cy7B-L7B-Cy7A-L7A-A7-.Embodiment 202. The compound or pharmaceutically-acceptable salt of Embodiment 201, wherein Cy7Ais as defined in any of Embodiments 176-186.Embodiment 203. The compound or pharmaceutically-acceptable salt of Embodiment 201 or Embodiment 202, wherein L7Ais as defined in any of Embodiments 193-200.Embodiment 204. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl (which Ci-C3alkyl can be substituted by oxo), halogen, cyano, nitro, Ci-C3alkoxy, Ci-C3fluoroalkyl, and Ci- C3fluoroalkoxy.Embodiment 205. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis an optionally-substituted pyrrolidine, morpholine,piperidine, piperazine, azepane or azocane, for example, bound to L7Bthrough a nitrogen atom thereof.Embodiment 206. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L7Bthrough a nitrogen atom thereof.Embodiment 207. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L7Bthrough the 1 -nitrogen atom thereof.Embodiment 208. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci- Cifluoroalkoxy.Embodiment 209. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 210 The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Csalkyl (which Ci-Csalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Caalkoxy, Ci-Cafluoroalkyl, and Ci- Cafluoroalkoxy.Embodiment 211. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 212. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis selected from Cs-Cioaryl, optionally substituted withone or more substituents selected from Ci- alkyl (which Ci-Caalkyl can be substituted by oxo), halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, and Ci-Csfluoroalkoxy.Embodiment 213. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-203, wherein Cy7Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 214. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-174, wherein R7is R7B-L7B-Cy7A-L7A-A7-Embodiment 215. The compound or pharmaceutically-acceptable salt of Embodiment 214, wherein Cy7Ais as defined in any of Embodiments 176-186.Embodiment 216. The compound or pharmaceutically-acceptable salt of Embodiment 214 or Embodiment 215, wherein L7Ais as defined in any of Embodiments 193-200.Embodiment 217. The compound or pharmaceutically-acceptable salt of any of Embodiments 214-216, wherein R7Bis R7E2N-, R7EHN-, H2N-, or BocHN.Embodiment 218. The compound or pharmaceutically-acceptable salt of any of Embodiments 214-216, wherein R7Bis R7E2N- in which each R7Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 219. The compound or pharmaceutically-acceptable salt of any of Embodiments 214-216, wherein R7Bis dimethylamino, diethylamino, dipropylamino, dibutylamino butylmethylamino, butylethylamino or buty propyl amino.Embodiment 220 The compound or pharmaceutically-acceptable salt of any of Embodiments 214-216, wherein R7Bis R7E-O-, HO-, R7E-S-, or HS- in which each R7Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 221. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-.Embodiment 222. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis -CH2CH2-.Embodiment 223. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis -CH2CH2CH2-.Embodiment 224. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-Embodiment 225. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 226. The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis -O-Ci-Csalkyl-, -NH-Ci-Caalkyl, or NR10-Ci-C3alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 227 The compound or pharmaceutically-acceptable salt of any of Embodiments 201-220, wherein L7Bis -SCENH-Ci-Caalkyl- or -SO2NR10-Ci-C3alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 228. The compound or pharmaceutically-acceptable salt of any of Embodiments 167-227, wherein R7is selected from Cy7A-L7A-A7- and R7A-L7A-A7-, whereinA7is O;L7Ais -CH2CH2- or -CH2CH2CH2-;R7Ais R7D2N-, in which each R7Dis independently Ci-Csalkyl; andCy7Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.Embodiment 229. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 167-228, wherein the groupEmbodiment 230. The compound or pharmaceutically-acceptable salt of Embodiment229, wherein the groupdefined in any of Embodiments 5-21.Embodiment 231. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 167-228, wherein the groupEmbodiment 232. The compound or pharmaceutically-acceptable salt of Embodiment231, wherein the groupdefined in any of Embodiments 23-44.Embodiment 233. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 1-44, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H;R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR8is selected fromR8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8 A-L8 A- A8- .Embodiment 234. The compound or pharmaceutically-acceptable salt of Embodiment 233, wherein each A8is O, NH, -O(O)C- or absent; each L8Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, in which each R8Dis independently Ci-Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from C 1 -C?al ky 1 which Ci-Cealkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 235. The compound or pharmaceutically-acceptable salt of Embodiment 253 or Embodiment 254, wherein each of R1and R2is methyl, trifluoromethyl or ethyl.Embodiment 236. The compound or pharmaceutically-acceptable salt of Embodiment 253 or Embodiment 254, wherein each of R1and R2is methyl.Embodiment 237. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-236, wherein each of R3, R4, R5, R6, R7and R9is H.Embodiment 238. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-236, wherein at least 4 of R3, R4, R5, R6, R7and R9is H, e g., at least 5 ofR3, R4, R5, R6, R7and R9.Embodiment 239. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-238, wherein A8is O.Embodiment 240. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-238, wherein A8is NH.Embodiment 241. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-238, wherein A8is -O(O)C-.Embodiment 242. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-238, wherein A8is absent.Embodiment 243. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-242, wherein R8is Cy8A-L8A-A8-.Embodiment 244. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, or Ci-Csfluoroalkoxy.Embodiment 245. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof.Embodiment 246. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof.Embodiment 247. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais an 4-(Ci-C4alkyl)-substituted piperazine, bound to L8Athrough the 1- nitrogen atom thereofEmbodiment 248 The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais selected from C4-Ciocycloalkyl, optionally substituted with one or more substituents selected from Ci-Cialkyl which Ci-Qalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy.Embodiment 249. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais optionally-substituted cyclohexane or optionally-substituted adamantane, e.g., unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 250. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Cialkyl which Ci-Qalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 251. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 252. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci -Chalky I which Ci-Caalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 253. The compound or pharmaceutically-acceptable salt of Embodiment 240, wherein Cy8Ais optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 254. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-242, wherein R8is R8A-L8A-A8-.Embodiment 255. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S- and HS-, in which each R8Dis independently Ci-Cealkyl.Embodiment 256. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais H.Embodiment 257. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais -CN.Embodiment 258. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais halo (e g., Cl or F).Embodiment 259. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais R8D2N-, R8DHN-, H2N-, or BocHN.Embodiment 260. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais R8D2N- in which each R8Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 261. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais dimethylamino, diethylamino, dipropylamino, dibutylamino butylmethylamino, butylethylamino or buty propyl amino.Embodiment 262. The compound or pharmaceutically-acceptable salt of Embodiment 254, wherein R8Ais R8D-O-, HO-, R8D-S-, HS- in which each R8Dis independently selected from methyl, ethyl, propyl and butyl.Embodiment 263. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo or hydroxy, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 264. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 265. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais a bond.Embodiment 266. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2-, -CH2CH2CH2CH2CH2-, or -CH2CH2CH2CH2CH2CH2-Embodiment 267. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -CH2CH2-.Embodiment 268. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -CH2CH2CH2-.Embodiment 269. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais Ci-CsAlkyl with a single CH2 substituted by NH, NR10or N+(R10)2, for example, -CH2CH2N+(CH3)2CH2CH2-.Embodiment 270. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -Ci-Csalkyl- with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-.Embodiment 271. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -Ci-Csalkyl- with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 272. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -O-Ci-Csalkyl-, -NH-Ci-Csalkyl-, or NR10-Ci- Csalkyl-, e g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 273. The compound or pharmaceutically-acceptable salt of any of Embodiments 243-262, wherein L8Ais -SCENH-Ci-Cealkyl- or -SO2NR10-Ci-C6alkyl, e g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 274. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-242, wherein R8is Cy8B-L8B-Cy8A-L8A-A8-.Embodiment 275. The compound or pharmaceutically-acceptable salt of Embodiment 274, wherein Cy8Ais as defined in any of Embodiments 244-253.Embodiment 276. The compound or pharmaceutically-acceptable salt of Embodiment 274 or Embodiment 275, wherein L8Ais as defined in any of Embodiments 263-273.Embodiment 277. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-C3alkyl which Ci-C3alkyl can be substituted by oxo, halogen, cyano, Ci-C3alkoxy, Ci-C3fluoroalkyl, or Ci-C3fluoroalkoxy.Embodiment 278. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis an optionally-substituted pyrrolidine, morpholine, piperidine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof.Embodiment 279. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis unsubstituted pyrrolidine, morpholine, piperazine, azepane or azocane, for example, bound to L8Athrough a nitrogen atom thereof.Embodiment 280. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis an 4-(Ci-C4alkyl)-substituted piperazine, bound to L1Athrough the 1 -nitrogen atom thereof.Embodiment 281. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis selected from C4-Ciocycloalkyl, optionallysubstituted with one or more substituents selected from Ci-Csalkyl which C i -Chalky 1 can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 282. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis optionally-substituted cyclohexane or optionally- substituted adamantane, e g , unsubstituted cyclohexane or unsubstituted adamantane.Embodiment 283. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis selected from Cs-Cioheteroaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Csalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy.Embodiment 284. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.Embodiment 285. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis selected from Cs-Cioaryl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, nitro, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy.Embodiment 286. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-276, wherein Cy8Bis optionally-substituted phenyl, e.g., tolyl, or unsubstituted phenyl.Embodiment 289. The compound or pharmaceutically-acceptable salt of any of Embodiments 233-242, wherein R8is R8B-L8B-Cy8A-L8A-A8-.Embodiment 290. The compound or pharmaceutically-acceptable salt of Embodiment 289, wherein Cy8Ais as defined in any of Embodiments 244-253.Embodiment 291. The compound or pharmaceutically-acceptable salt of Embodiment 289 or Embodiment 290, wherein L8Ais as defined in any of Embodiments 263-273.Embodiment 292. The compound or pharmaceutically-acceptable salt of any of Embodiments 289-291, wherein R8Bis R1E2N-, R1EHN-, H2N-, or BocHN.Embodiment 293. The compound or pharmaceutically-acceptable salt of any of Embodiments 289-291, wherein R8Bis R8E2N- in which each R8Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 294. The compound or pharmaceutically-acceptable salt of any of Embodiments 289-291, wherein R8Bis dimethylamino, di ethylamino, dipropylamino, dibutylamino butylmethylamino, butylethylamino or buty propyl amino.Embodiment 295. The compound or pharmaceutically-acceptable salt of any of Embodiments 289-291, wherein R8Bis R8E-O-, HO-, R8E-S-, or HS- in which each R8Eis independently selected from methyl, ethyl, propyl and butyl.Embodiment 296. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl.Embodiment 297. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis a bond.Embodiment 298. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis -CH2CH2-, -CH2CH2CH2-, or -CH2CH2CH2CH2-.Embodiment 299. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis -CH2CH2-.Embodiment 300. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis -CH2CH2CH2-.Embodiment 301. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis Ci-C4alkyl with a single oxo substituent, for example, -C(O)CH2- or -C(O)CH2CH2-Embodiment 302. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis Ci-C4alkyl with one or more (e.g., one) CH2 replaced by -O-, -NH- or -NR10.Embodiment 303. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis -O-Ci-Csalkyl-, -NH-Ci-Csalkyl, or NR10-Ci-C3alkyl, e.g., for example, -NHCH2CH2- or -NHCH2CH2CH2-.Embodiment 304. The compound or pharmaceutically-acceptable salt of any of Embodiments 274-295, wherein L8Bis -SCENH-Ci-Caalkyl- or -SO2NR10-Ci-C3alkyl, e.g., for example, -SO2NHCH2CH2- or -SO2N(CH3)CH2CH2-.Embodiment 305. The compound or pharmaceutically-acceptable salt of any of Embodiments 253-304, wherein R8is selected from Cy8A-L8A-A8-, R8A-L8A-A8-, R8B-L8B- Cy8A-L8A-A8-, and Cy8B-L8B-Cy8A-L8A-A8-, whereinA8is O or NH;L8Ais -CH2CH2-, -CH2CH2CH2- or -CH2CH2CH2CH2-;R8Ais R8D2N-, in which each R8Dis independently Ci-Csalkyl;Cy8Ais selected from piperazine, pyrrolidine, piperidine, morpholine, thiazinane, azepane and azocane;L8Bis -CH2CH2- or -CH2CH2CH2-;R8Bis R8D2N-, in which each R8Dis independently Ci-Csalkyl; andCy8Bis selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.Embodiment 306. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 253-305, wherein theEmbodiment 307. The compound or pharmaceutically-acceptable salt of Embodiment306, wherein the groupdefined in any of Embodiments 5-21.Embodiment 308. The compound or pharmaceutically-acceptable salt of any ofEmbodiments 253-305, wherein the groupEmbodiment 309. The compound or pharmaceutically-acceptable salt of Embodiment308, wherein the groupdefined in any of Embodiments 23-44.Embodiment 310. The compound or pharmaceutically-acceptable salt of any of Embodiments 1-309, wherein R9is H.Embodiment 311. A compound selected from:QC-39WM-C23or a pharmaceutically-acceptable salt thereof.Embodiment 312. A compound selected from:(Compound 216), or(Compound 204). or a pharmaceutically-acceptable salt thereof.Embodiment 313. A compound selected from compounds XXP-J3, XXP-J57, XXP-J58, XXP-J64, XXP-J87, XXP-J93, XXP-J95, XXP-J97, XXP-J98, XXP-J101, and XXP-K3, or a pharmaceutically-acceptable salt thereofEmbodiment 314. A compound selected from the compounds of any of Tables 1-8, or a pharmaceutically-acceptable salt thereof.Embodiment 315. A compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 100 micromolar, or a pharmaceutically-acceptable salt thereof.Embodiment 316. A compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 50 micromolar, or a pharmaceutically-acceptable salt thereof.Embodiment 317. A compound selected from the compounds of any of Tables 1-8 exhibiting an IC50 for TDP1 inhibition that is no more than 25 micromolar, or a pharmaceutically-acceptable salt thereof.Embodiment 318. A pharmaceutical composition comprising a compound or salt of any one of Embodiments 1-317 together with a pharmaceutically acceptable carrier.Embodiment 319. A method of inhibiting TDP1 and / or TOPI in vivo or in vitro comprising contacting a cell nucleus with a compound or salt of any of Embodiments 1-317.Embodiment 320. A method of treating cancer in a patient comprising administering a therapeutically effective amount of a compound or salt according to any of Embodiments 1- 317 to the patient.Embodiment 321. A method of treating cancer in a patient comprising administering therapeutically effective amount of a compound or salt according to any of Embodiments 1- 317 in combination with and a Topi inhibitor that is not a compound or salt of any of Embodiments 1-317 to the patient.Embodiment 322. The method of Embodiment 321, wherein the TOPI inhibitor is camptothecin or a camptothecin derivative, an indolocarbazole, a dibenzonaphthyridinone, or an indenoisoquinoline.Embodiment 323. A method of treating cancer in a patient comprising administering therapeutically effective amount of a compound or salt according to any of Embodiments 1- 317 in combination with a therapeutically effective amount of ionizing radiation.Embodiment 324. The method of Embodiment 323, further comprising administering a Topi inhibitor that is not a compound or salt of any of Embodiments 1-317 to the patient.Embodiment 325. The method of Embodiment 324, wherein the TOPI inhibitor is camptothecin or a camptothecin derivative, an indolocarbazole, a dibenzonaphthyridinone, or an indenoisoquinoline.
Claims
What is claimed is:
1. A compound of Formula I or a pharmaceutically acceptable salt thereof, wherein Formula I is represented by the following structure:(Formula I), wherein the groupwhich RYis selected from-LYA-RYA,-LYA-CyYA,-methyl,-ethyl, and-Ca-Csalkyl, which Ca-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, in which each LYAis independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, andRYAis selected from -NRYD2, -NHRYD, -NH2, -NHBoc, -ORYD, -OH, -SRYD, - SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl, andCyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Cwcycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; or the groupwhich Rxis selected from-AX-LXA-RXA,-Ax-LXA-CyXA’-Ax-Ci-C8alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, and can be substituted by oxo,-CyXA, and-RXA, in which each Axis independently O, NH or absent, each LXAis independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBoc, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2I!XI), in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R1is selected fromCy1A-L1A-,R1A-L1A-,Cy1B-L1B-Cy1A-L1A-,RiB.LiB_CyIA_LIA_,Ci-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, andH, wherein each L1Ais independently Ci-Cgalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy1Ais independently or selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl;Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Bis selected from R1E2N-, R1EHN-, H2N-, BocHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,R2is selected fromCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo,Cy2A-L2A-,R2A_L2A_,R2B_L2B_Cy2A_L2A_,Cy2B-L2B-Cy2A-L2A-, andH, wherein each L2Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy2Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Cralkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl;Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R2Bis selected from R2E2N-, R2EHN-, H2N-, BocHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R3is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R4is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl ;R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy;R6is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R7is selected fromH,Cy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.;Cy7B-L7B-Cy7A-L7A-A7-,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A7is independently O, NH or absent each L7Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Cg-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS- and -CN in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R8is selected fromH,Cy8A-L8A-A8-,R8A_L8A_A8_,R8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8A-L8A-A8-, andC1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A8is O, NH, -O(O)C- or absent; each L8Ais independently a bond or Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo or hydroxy, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci- C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Cg-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R8Ais selected from H, R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, -CN and halo (e.g., Cl or F), in which each R8Dis independently Ci- Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently a bond or Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; andR9is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl,with the proviso that at least one of R1, R2, R7, R8, and R9is other than H or C1-C4 alkyl.
2. The compound or pharmaceutically-acceptable salt of Embodiment 1, wherein the groupwhich RYis selected from-LYA-RYA,-LYA-CyYA,-methyl,-ethyl, and-Ca-Csalkyl, which Ca-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, in which each LYAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4 lkyl, andRYAis selected from -NRYD2, -NHRYD, -NH2, -NHBoc, -ORYD, -OH, -SRYD, - SH, cyano, and -CO2RYD, in which each RYDis independently Ci-Cealkyl, andCyYAis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Cafluoroalkoxy; or the groupwhich Rxis selected from-AX-LXA-RXA,-Ax-LXA-CyXA’-Ax-Ci-C8alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, and can be substituted by oxo,-CyXA, and-RXA, in which each Axis independently O, NH or absent, each LXAis independently Ci-Cgalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, and each RXAis independently selected from -NRXD2, -NHRXD, -NH2, -NHBoc, -ORXD, -OH, -SRXD, -SH, cyano, and -CO2RXIJ, in which each RXDis independently Ci-Cealkyl, and each CyXAis independently selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci- Cafluoroalkyl, Ci-Cafluoroalkoxy;R1is selected fromCy1A-L1A-,R1A-L1A-,Cy1B-L1B-Cy1A-L1A-,RiB.LiB_CyIA_LIA_,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, andH, wherein each L1Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,each Cy1Ais independently or selected from C4-Cioheterocycloalkyl, Cj-Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cwaryl, each optionally substituted with one or more substituents selected from Ci-Csalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Ais selected from R1D2N-, R1DHN-, H2N-, BocHN, R1D-O-, HO-, R1D-S-, HS-, in which each R1Dis independently Ci-Cealkyl;Cy1Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci-Csfluoroalkoxy;R1Bis selected from R1E2N-, R1EHN-, H2N-, BocHN, R1E-O-, HO-, R1E-S-, HS-, in which each R1Eis independently Ci-Cealkyl; each L1Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl,R2is selected fromCi-C4alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen, and oxo,Cy2A-L2A-,R2A-L2A-,R2B_L2B_Cy2A_L2A_,Cy2B-L2B-Cy2A-L2A-, andH, wherein each L2Ais independently Ci-Csalkyl, which Ci-Cgalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy2Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substitutedwith one or more substituents selected from Ci-Csalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R2Ais selected from R2D2N-, R2DHN-, H2N-, BocHN, R2D-O-, HO-, R2D-S-, HS-, in which each R2Dis independently Ci-Cealkyl;Cy2Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R2Bis selected from R2E2N-, R2EHN-, H2N-, BocHN, R2E-O-, HO-, R2E-S-, HS-, in which each R2Eis independently Ci-Cealkyl; and each L2Bis independently Ci-C4alkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R3is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R4is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl ;R5is H, halogen, Ci-C4alkyl, Ci-C4fluoroalkyl, or Ci-C4alkoxy;R6is H, halogen, cyano, Ci-C4alkyl which Ci-C4alkyl can contain one or more double or triple bonds, or Ci-C4fluoroalkyl;R7is selected fromH,Cy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.3Cy7B-L7B-Cy7A-L7A-A7-,C1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A7is independently O, NH or absenteach L7Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy7Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R7Ais selected from R7D2N-, R7DHN-, H2N-, BocHN, R7D-O-, HO-, R7D-S-, HS-, in which each R7Dis independently Ci-Cealkyl;Cy7Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R7Bis selected from R7E2N-, R7EHN-, H2N-, BocHN, R7E-O-, HO-, R7E-S-, HS-, in which each R7Eis independently Ci-Cealkyl; and each L7Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl;R8is selected fromH,R8B_L8B_Cy8A_L8A_A8_5Cy8B-L8B-Cy8A-L8A-A8-, andC1-C4 alkyl, which can contain one or more double or triple bonds, and is optionally substituted with one or more substituents independently selected from hydroxyl, amino, cyano, halogen and oxo, wherein each A8is O, NH, -O(O)C- or absent;each L8Ais independently Ci-Csalkyl, which Ci-Csalkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl, each Cy8Ais independently selected from C4-Cioheterocycloalkyl, C5- Cioheteroaryl, C4-Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Csalkoxy, Ci- Cafluoroalkyl, Ci-Csfluoroalkoxy;R8Ais selected from R8D2N-, R8DHN-, H2N-, BocHN, R8D-O-, HO-, R8D-S-, HS-, in which each R8Dis independently Ci-Cealkyl;Cy8Bis selected from C4-Cioheterocycloalkyl, Cs-Cioheteroaryl, C4- Ciocycloalkyl, and Ce-Cioaryl, each optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Caalkyl can be substituted by oxo, halogen, nitro, cyano, Ci-Caalkoxy, Ci-Csfluoroalkyl, Ci- Cafluoroalkoxy;R8Bis selected from R8E2N-, R8EHN-, H2N-, BocHN, R8E-O-, HO-, R8E-S-, HS-, in which each R8Eis independently Ci-Cealkyl; and each L8Bis independently Ci-C4alkyl, which Ci-C4alkyl can contain one or more double or triple bonds, can be substituted by oxo, and can have one or more CH2 groups independently replaced by N, NH, NR10, N+R102, S, SO2, or O, in which each R10is independently H or Ci-C4alkyl; andR9is H, with the proviso that at least one of R1, R2, R7, R8, and R9is other than H or C1-C4 alkyl.
3. The compound or pharmaceutically-acceptable salt of claim 1, wherein the group4. The compound or pharmaceutically-acceptable salt of claim 3, whereinRYis -LYARYAand RYAis RYD2N-, for example, dimethylamino, diethylamino, or dipropylamino.
5. The compound or pharmaceutically-acceptable salt of claim 3, wherein RYis LYACyYA, wherein CyYAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Csalkoxy, Ci-Cafluoroalkyl or Ci-Csfluoroalkoxy.
6. The compound or pharmaceutically-acceptable salt of claim 5, wherein LYAis -CH2CH2- -or CH2CH2CH2-.
7. The compound or pharmaceutically-acceptable salt of claim 3, wherein RYis selected from -LYARYAand -LYACyYA, wherein LYAis -CH2CH2- or -CH2CH2CH2-; and RYAis selected from -NRYD2, in which each RYDis independently Ci-Caalkyl; or CyYAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.
8. The compound or pharmaceutically-acceptable salt of claim 1, wherein the group9. The compound or pharmaceutically-acceptable salt of claim 8, wherein Axis O or NH.
10. The compound or pharmaceutically-acceptable salt of claim 8, wherein Rxis -Ax- LXARXA,wherein RXAis -NRXD2, -NHRXD, or -NH2.
11. The compound or pharmaceutically-acceptable salt of claim 8, wherein Rxis -Ax- LXACyXA, wherein CyXAis selected from C4-Cioheterocycloalkyl, optionally substituted with one or more substituents selected from Ci-Caalkyl which Ci-Csalkyl can be substituted by oxo, halogen, cyano, Ci-Caalkoxy, Ci-Cafluoroalkyl, or Ci-Csfluoroalkoxy.
12. The compound or pharmaceutically-acceptable salt of claim 11, wherein LXAis -CH2CH2- or -CH2CH2CH2-.
13. The compound or pharmaceutically-acceptable salt of claim 8, wherein Rxis selected from -Ax-LXA-RXAand -Ax-LXA-CyXA, whereinAxis O;LXAis -CH2CH2- or -CH2CH2CH2-;RXAis -NRXD2, in which each RXDis independently Ci-Csalkyl; andCyXAis selected from pyrrolidine, piperidine, morpholine, azepane and azocane.
14. The compound or pharmaceutically-acceptable salt of claim 1, whereinR1is selected fromCy1A-L1A-,R1A-L1A-,RiB.LiB_CyiA_LiA_5 andCy1B-L1B-Cy1A-L1A-; andR2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H.
15. The compound or pharmaceutically-acceptable salt of claim 14, wherein R1is Cy1A- L1A-, wherein Cy1Ais optionally-substituted imidazole, pyrrole, or pyrazole, e.g., unsubstituted imidazole, pyrrole, or pyrazole.
16. The compound or pharmaceutically-acceptable salt of claim 14, wherein R1is R1A- L1A- wherein R1Ais R1D2N-, R1DHN-, H2N-, or BocHN-.
17. The compound or pharmaceutically-acceptable salt of claim 14, wherein L1Ais - CH2CH2- or -CH2CH2CH2-.
18. The compound or pharmaceutically-acceptable salt of claim 1, wherein R1is selected from R1A-L1A- and Cy1A-L1A- , whereinL1Ais -CH2CH2- or -CH2CH2CH2-;R1Ais R1D2N-, in which each R1Dis independently Ci-Caalkyl; andCy1Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
19. The compound or pharmaceutically-acceptable salt of claim 1, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR2is selected fromCy2A-L2A-,R2A-L2A-,R2B_L2B_Cy2A_L2A_,andCy2B-L1B-Cy2A-L2A-.
20. The compound or pharmaceutically-acceptable salt of claim 19, wherein R2is selected from R2A-L2A- and Cy2A-L2A- , wherein L2Ais -CH2CH2- or -CH2CH2CH2-; R2Ais R2D2N-, in which each R2Dis independently Ci-Csalkyl; and Cy2Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
21. The compound or pharmaceutically-acceptable salt of claim 1, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H;R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR7is selected fromCy7A-L7A-A7-,R7A-L7A-A7-,R7B.L7B_Cy7A.L7A_A7.5Cy7B-L7B-Cy7A-L7A- A7- .
22. The compound or pharmaceutically-acceptable salt of claim 21, wherein R7is selected from Cy7A-L7A-A7- and R7A-L7A-A7-, whereinA7is O;L7Ais -CH2CH2- or -CH2CH2CH2-;R7Ais R7D2N-, in which each R7Dis independently Ci-Csalkyl; andCy7Ais selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
23. The compound or pharmaceutically-acceptable salt of claim 1, whereinR1is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H;R2is -Ci-C4alkyl, Ci-C4fluoroalkyl, or H; andR8is selected fromR8B.L8B-Cy8A-L8A-A8-, Cy8B-L8B-Cy8A-L8A-A8-.
24. The compound or pharmaceutically-acceptable salt of claim 23, wherein R8is selected from Cy8A-L8A-A8-, R8A-L8A-A8-, R8B-L8B-Cy8A-L8A-A8-, and Cy8B-L8B-Cy8A-L8A-A8-, whereinA8is O or NH;L8Ais -CH2CH2-, -CH2CH2CH2- or -CH2CH2CH2CH2-;R8Ais R8D2N-, in which each R8Dis independently Ci-Caalkyl;Cy8Ais selected from piperazine, pyrrolidine, piperidine, morpholine, thiazinane, azepane and azocane;L8Bis -CH2CH2- or -CH2CH2CH2-;R8Bis R8D2N-, in which each R8Dis independently Ci-Caalkyl; andCy8Bis selected from pyrrolidine, piperidine, piperazine, morpholine, thiazinane, azepane and azocane.
25. A compound selected from:(Compound 216), oror a pharmaceutically-acceptable salt thereof.
26. A pharmaceutical composition comprising a compound or salt of any one of claims 1- 15 together with a pharmaceutically acceptable carrier.
27. A method of inhibiting TDP1 and / or TOPI in vivo or in vitro comprising contacting a cell nucleus with a compound or salt of any of claims 1-25.
28. A method of treating cancer in a patient comprising administering a therapeutically effective amount of a compound or salt according to any of claims 1-25 to the patient.
29. A method of treating cancer in a patient comprising administering therapeutically effective amount of a compound or salt according to any of claims 1-25 in combination with and a Topi inhibitor that is not a compound or salt of any of claims 1-25 to the patient.
30. A method of treating cancer in a patient comprising administering therapeutically effective amount of a compound or salt according to any of claims 1-24 in combination with a therapeutically effective amount of ionizing radiation.