Treating lung cancer by blocking a 28s ribosomal RNA region
By delivering 28S ribosomal RNA binding molecules like antisense oligonucleotides to block the 28S rRNA, the patent addresses the lack of effective lung cancer treatments and markers, achieving reduced proliferation and fragment levels in lung cancer cells.
Patent Information
- Application Number
- PCT/EP2025/071796
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-30
- Filing Date
- 2025-07-29
- Publication Date
- 2026-02-05
AI Technical Summary
Current treatments for lung cancer lack effective options, and existing markers for risk stratification and therapeutic guidance are not sensitive enough, necessitating the development of new therapeutic approaches targeting the 28S ribosomal RNA region.
Delivery of 28S ribosomal RNA binding/interfering molecules, such as antisense oligonucleotides, to block the 28S rRNA, reducing lung cancer cell proliferation and lowering the levels of the 28S rRNA fragment in both intracellular and extracellular spaces.
The 28S rRNA serves as both a diagnostic marker and therapeutic target, effectively reducing lung cancer cell proliferation and lowering the 28S rRNA fragment levels, providing a novel treatment approach for lung cancer.
Smart Images

Figure IMGF000042_0001 
Figure IMGF000042_0002 
Figure IMGF000043_0001
Abstract
Description
[0001] TREATING LUNG CANCER BY BLOCKING A 28S RIBOSOMAL RNA REGION
[0002] The present invention relates to a 28S ribosomal RNA (rRNA) region binding molecule for use in medicine, preferably for use in the treatment of lung cancer.
[0003] BACKGROUND OF THE INVENTION
[0004] Cancer is the uncontrolled growth of abnormal cells anywhere in a body. The abnormal cells are termed cancer cells, malignant cells, or tumor cells. Cancer cells can proliferate uncontrollably and form a mass of cancer cells.
[0005] The most common types of cancer in males are lung cancer, prostate cancer, colorectal cancer, and stomach cancer. In females, the most common types are breast cancer, colorectal cancer, lung cancer, and cervical cancer.
[0006] Lung cancer or bronchogenic carcinoma refers to tumors originating in the lung parenchyma or within the bronchi. It is one of the leading causes of cancer-related deaths in Europe and in the United States. Since 1987, lung cancer has been responsible for more deaths in women than breast cancer. It is estimated that there are 225,000 new cases of lung cancer in the United States annually, and approximately 160,000 die because of lung cancer. It is interesting to note that lung cancer was a relatively rare disease at the beginning of the 20th century. Its dramatic rise in later decades is attributable primarily to the increase in smoking among both males and females.
[0007] Historically, markers such as age, performance status and disease stage have been used to risk-stratify cancer patients and guide therapeutic decisions. These parameters provide some useful information, but more sensitive markers are clearly needed. Molecular and genetic studies have identified several such markers, which appear to play critical roles in carcinogenesis and affect patient outcomes. However, their prognostic and predictive value for cancer medicine has been low so far.
[0008] Recently, the present inventors identified a 28S ribosomal RNA (rRNA) fragment which has diagnostic power for the detection of lung cancer, acting as a biomarker found in blood. They demonstrated that high levels of the 28S rRNA fragment are indicative for lung cancer. The present inventors further showed that the 28S rRNA fragment can be used for the diagnosis as well as monitoring of lung cancer. At present, there is still a lack of treatment options for patients suffering from lung cancer. Thus, the provision of new lung cancer drugs is highly desirable.
[0009] The present inventors now disclose a new therapeutic approach based on the delivery of 28S rRNA binding / interfering molecules such as antisense oligonucleotides (ASOs) to block the 28S rRNA from which the 28S rRNA fragment is derived. Specifically, the present inventors showed that lung cancer cells transfected with antisense oligonucleotides against the 28S rRNA from which the 28S rRNA fragment is derived showed a reduction in lung cancer cell proliferation, while the levels of the 28S rRNA fragment dropped significantly in both the intracellular and extracellular spaces.
[0010] Thus, the 28S rRNA is both, a diagnostic marker for lung cancer in form of a 28S rRNA fragment derived therefrom, and a therapeutic target for lung cancer treatment.
[0011] SUMMARY OF THE INVENTION
[0012] In a first aspect, the present invention relates to a 28 S ribosomal RNA (rRNA) region binding molecule for use in medicine, preferably for use in the treatment of lung cancer, wherein the 28S rRNA region comprises a nucleotide sequence according to SEQ ID NO: 1, and wherein the 28 S rRNA region binding molecule binds or at least partially binds to the nucleotide sequence.
[0013] In a second aspect, the present invention relates to a combination comprising a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and a drug different from the 28 S rRNA region binding molecule.
[0014] In a third aspect, the present invention relates to a combination of the second aspect for use in medicine, preferably for use in the treatment of lung cancer.
[0015] In a fourth aspect, the present invention relates to a conjugate comprising a 28s ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and another molecule.
[0016] In a fifth aspect, the present invention relates to a conjugate of the fourth aspect for use in medicine, preferably for use in the treatment of lung cancer.
[0017] In a sixth aspect, the present invention relates to a conjugate of the fourth aspect for use in targeted therapy, preferably for use in targeted lung cancer therapy.
[0018] In a seventh aspect, the present invention relates to a pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect, the combination of the second aspect, or the conjugate of the fourth aspect and a pharmaceutical acceptable carrier.
[0019] In an eighth aspect, the present invention relates to a pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect, the combination of the second aspect, or the conjugate of the fourth aspect and a pharmaceutical acceptable carrier for use in medicine, preferably for use in the treatment of lung cancer.
[0020] In a ninth aspect, the present invention relates to a method of determining whether a patient responds to a lung cancer treatment comprising the step of: determining the level of a 28S ribosomal RNA (rRNA) fragment in a biological sample isolated from the patient, wherein the patient is a patient to whom at least once at least one drug to be used in the lung cancer treatment is, has, or had been administered, and wherein the at least one drug is a 28S ribosomal RNA (rRNA) region binding molecule.
[0021] This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description.
[0022] DETAILED DESCRIPTION OF THE INVENTION
[0023] Definitions
[0024] Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.
[0025] Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).
[0026] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.
[0027] The term “comprise” or variations such as “comprises” or “comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term “consisting essentially of’ according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of’ or variations such as “consists of’ according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers.
[0028] The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.
[0029] As used herein, the term “about” indicates a certain variation from the quantitative value it precedes. In particular, the term “about” allows a ±5% variation from the quantitative value it precedes, unless otherwise indicated or inferred. The use of the term “about” also includes the specific quantitative value itself, unless explicitly stated otherwise. For example, the expression “about 80°C” allows a variation of ±4°C, thus referring to range from 76°C to 84°C.
[0030] The term “RNA molecule”, as used herein, refers to a polymeric molecule essential in various biological roles in coding, decoding, regulation, and expression of genes. RNA and deoxyribonucleic acid (DNA) are nucleic acids. Along with lipids, proteins, and carbohydrates, nucleic acids constitute one of the four major macromolecules essential for all known forms of life. Like DNA, RNA is assembled as a chain of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded onto itself, rather than a paired double strand. Cellular organisms use messenger (mRNA) to convey genetic information (using the nitrogenous bases of guanine, uracil, adenine, and cytosine, denoted by the letters G, U, A, and C) that directs synthesis of specific proteins. Some RNA molecules play an active role within cells by catalysing biological reactions, controlling gene expression or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis, a universal function in which RNA molecules direct the synthesis of proteins on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then links amino acids together to form coded proteins.
[0031] The term “ribosomal ribonucleic acid (rRNA)”, as used herein, refers to a type of noncoding RNA which is the primary component of ribosomes, essential to all cells. rRNA is a ribozyme which carries out protein synthesis in ribosomes. Ribosomal RNA is transcribed from ribosomal DNA (rDNA) and then bound to ribosomal proteins to form small and large ribosome subunits. rRNA is the physical and mechanical factor of the ribosome that forces transfer RNA (tRNA) and messenger RNA (mRNA) to process and translate the latter into proteins. Ribosomal RNA is the predominant form of RNA found in most cells; it makes up about 80% of cellular RNA despite never being translated into proteins itself. Ribosomes are composed of approximately 60% rRNA and 40% ribosomal proteins by mass.
[0032] Mammalian cells have 2 mitochondrial (12S and 16S) rRNA molecules and 4 types of cytoplasmic rRNA molecules (the 28S, 5.8S, 18S, and 5S subunits). The 28S, 5.8S, and 18S rRNAs are encoded by a single transcription unit (45 S) separated by 2 internally transcribed spacers. The first spacer corresponds to the one found in bacteria and archaea, and the other spacer is an insertion into what was the 23 S rRNA in prokaryotes. The 45 S rDNA is organized into 5 clusters (each has 30-40 repeats) on chromosomes 13, 14, 15, 21, and 22. These are transcribed by RNA polymerase I. The DNA for the 5S subunit occurs in tandem arrays (~200- 300 true 5S genes and many dispersed pseudogenes), the largest one on the chromosome 1 q41 - 42. 5S rRNA is transcribed by RNA polymerase III. The 18S rRNA in most eukaryotes is in the small ribosomal subunit, and the large subunit contains three rRNA species (the 5S, 5.8S, and 28S).
[0033] Recently, the present inventors identified a 28S ribosomal RNA (rRNA) fragment which has diagnostic power for the detection of lung cancer, acting as a biomarker found in blood. They demonstrated that high levels of the 28S rRNA fragment are indicative for lung cancer. The present inventors further showed that the 28S rRNA fragment can be used for the diagnosis as well as monitoring of lung cancer. The present inventors now disclose a new therapeutic approach based on the delivery of 28S rRNA binding / interfering molecules such as antisense oligonucleotides (ASOs) to block the (region of the) 28 S rRNA from which the 28 S rRNA fragment is derived. Specifically, the present inventors showed that lung cancer cells transfected with antisense oligonucleotides against the (region of the) 28S rRNA from which the 28S rRNA fragment is derived showed a reduction in lung cancer cell proliferation while the levels of the 28S rRNA fragment dropped significantly in both the intracellular and extracellular spaces. Thus, the 28S rRNA is both, a diagnostic marker for lung cancer in form of a 28S rRNA fragment derived therefrom, and a therapeutic target for lung cancer treatment.
[0034] The term “28 S ribosomal RNA (rRNA)”, as used herein, refers to a structural ribosomal RNA (rRNA) for the large subunit (LSU) of eukaryotic cytoplasmic ribosomes, and thus, to one of the basic components of all eukaryotic cells. The 28S rRNA is a transcript of RNA polymerase I. As part of the ribosome, it performs catalytic functions and is, therefore, also known as a ribozyme. Specifically, the RNA polymerase I transcribes a 45S pre-rRNA transcript, from which a 5.8S rRNA, 18S rRNA, and 28S rRNA transcript is produced by a 90S pre-ribosome. The 80S ribosome is composed of a 60S ribosomal subunit and 40S ribosomal subunit. The 28S rRNA is a component of the large 60S ribosomal subunit, where it functions as a peptidyltransferase. This enables the N-terminal attack of the amino acid, which is bound to the tRNA at the A-site, on the C-terminal end of the peptide chain at the P-site. This creates a new peptide bond. In contrast to mRNA, 28S rRNA is a catalytic RNA and not a coding RNA. It, therefore, does not serve as a transcript for protein biosynthesis. It has a size of 28S in mammals, hence the name. The 28S rRNA is typically 5070 nucleotides long.
[0035] The term “28 S rRNA fragment”, as described herein, has the following nucleotide sequence: 5’-GCCGCCGGUGAAAUACCACUAC-3’ (SEQ ID NO: 1). It is derived from / part of the 28 S rRNA. When locating the nucleotide sequence according to SEQ ID NO: 1 in the tertiary structure of the 80S ribosome, it specifically resides in a protrusion between the large (60S) and the small (40S) subunits, as part of the Ll-stalk. This mobile Ll-stalk structure is functionally important for the movement of tRNAs on the translocating ribosome. As to the exact location / position of the nucleotide sequence according to SEQ ID NO: 1 in the nucleotide sequence of the 28S rRNA, it is referred to FIGURE 1.
[0036] The term “28 S ribosomal RNA (rRNA) region binding molecule”, as used herein, refers to any molecule which is able to bind or at least partially bind to the nucleotide sequence according to SEQ ID NO: 1, a sequence which is comprised in / part of the 28S rRNA. Specifically, the 28S ribosomal RNA (rRNA) region binding molecule hinders the function of the 28 S rRNA, the processing of the 28 S rRNA, the folding of the 28 S rRNA, the interaction of the 28S rRNA with other RNAs, and / or the interaction of the 28S rRNA with proteins. More specifically, the 28 S rRNA region binding molecule hinders the interaction of the bound part of the 28S rRNA with other RNAs and / or the interaction of the bound part of the 28S rRNA with proteins. The other RNAs may be tRNAs or 18S rRNAs and the like. The proteins may be the proteins RPL10A, RNaseL or other RNases, and the like. Alternatively or additionally, the 28 S rRNA region binding molecule inhibits or prevents the release of the nucleotide sequence according to SEQ ID NO: 1 from the 28S rRNA in the final (processed) form or in the form of precursors, preferably in the form of precursors having a nucleotide sequence according to SEQ ID NO: 4 (5’-
[0037] GCGGGCCGCCGGUGAAAUACCACUACUCUGAUC-3 ) or any shorter version thereof For example, the shorter precursor version may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 1 Inucleotides shorter than the nucleotide sequence according to SEQ ID NO: 4.
[0038] It is preferred that the 28S ribosomal RNA (rRNA) region binding molecule is an antisense oligonucleotide, a small molecule, such as a small molecule inhibitor, DNA aptamer, peptide, or protein. It is more preferred that the antisense oligonucleotide is reverse complementary to the nucleotide sequence according to SEQ ID NO: 1 or at least to a part of the nucleotide sequence according to SEQ ID NO: 1.
[0039] Particularly, the antisense oligonucleotide is reverse complementary to between 10 and 22 nucleotides, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0040] More particularly, the antisense oligonucleotide is reverse complementary to between 12 and 22 nucleotides, e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0041] Even more particularly, the antisense oligonucleotide is reverse complementary to between 15 and 22 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0042] Alternatively, the antisense oligonucleotide is reverse complementary to at least 10 nucleotides, particularly to at least 12 nucleotides, more particularly to at least 15 nucleotides, even more particularly to at least 18 nucleotides and still even more particularly to at least 20 nucleotides, e.g. at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0043] As mentioned above, the 28 S rRNA region binding molecule binds or at least partially binds to the nucleotide sequence according to SEQ ID NO: 1. In this respect, the term “binding” means a physical interaction that impacts on the structure, function or interaction potential of the SEQ ID NO: 1. Whether a molecule binds or at least partially binds to the nucleotide sequence according to SEQ ID NO: 1 can easily be tested by the skilled person using e.g. an RNase protection assay, which uses the inability of RNases to cleave RNAs bound by phosphorotioate bonds-containing antisense oligonucleotide. In addition, the binding can be determined by pull-down assays, wherein the antisense oligonucleotide will enrich RNAs with the sequences containing SEQ ID NO: 1 as determined by e.g. next generation sequencing.
[0044] The antisense oligonucleotide may be composed of deoxyribonucleotides and / or ribonucleotides, preferably deoxyribonucleotides. The antisense oligonucleotide may further comprise one or more modified nucleotides such as locked nucleotides (LNAs), 2’ -orthomethylated RNA nucleotides, and / or have phosphorotioate bonds that confer resistance against intracellular nucleases.
[0045] The term “locked nucleic acids (LNAs)”, as used herein, refers to modified nucleotides, specifically ribonucleotides, in which the 2’-0 and 4’-C atoms of the ribose are joined through a methylene bridge. This additional bridge limits the flexibility normally associated with the ring, essentially locking the structure into a rigid conformation. These nucleic acid analogs are also referred to in some circles as “inaccessible ribonucleotides”. LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotides / polynucleotides (specifically in the antisense oligonucleotides as described herein), in effect hybridizing with DNA or RNA according to Watson-Crick base-pairing rules. The inflexible nature of these molecules greatly enhances hybridization stability. Further, oligonucleotides / polynucleotides containing LNAs offer tremendous discriminatory power, allowing these molecules to distinguish between exact match and mismatched complementary target sequences with very little difficulty.
[0046] The term “methylated RNA”, as used herein, refers to RNA which has been post- transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2'-ortho-methylated nucleotide (2'-O- m)). The methylation of RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3- methyluridine (m3U), 1 -methyladenosine (nflA), and 1 -methyl guanosine (nflG), or is a combination thereof.
[0047] The 2'-O-methylation of the backbone ribose is the most common and conserved type of RNA modification. The methylation of RNA occurring at a ribose ring is selected from the group consisting of 3 '-end 2'-O-methyladenosine (Am), 2 '-O-m ethyluridine (Um), 2'-O- methylguanosine (Gm), and 2'-O-methyl cytidine (Cm), or is a combination thereof. Preferably, the RNA is rRNA and the methylation is 2’-ortho-methylation (2'-0-Me).
[0048] The term “phosphorothioate bond containing oligonucleotide”, as used herein, refers to an oligonucleotide which is resistant to nuclease degradation. Specifically, phosphorothioate oligonucleotides differ from normal in that one of the non-bridging oxygens in the phosphate group is replaced by a sulfur. The resulting compound is negatively charged, chiral at each phosphorothioate, and much more resistant to nucleases than a phosphodiester oligonucleotide.
[0049] Exemplarily antisense oligonucleotides used / usable herein comprise or consist of the nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 14 to SEQ ID NO: 30 (e.g. SEQ ID NO: 14 to SEQ ID NO: 26 or SEQ ID NO: 27 to SEQ ID NO: 30).
[0050] The 28S ribosomal RNA (rRNA) region binding molecule is used in medicine, specifically for the treatment of lung cancer in a patient.
[0051] The term “cancer”, as used herein, refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell growth. The cancer described herein is lung cancer. Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV. The term “cancer”, as used herein, also encompasses cancer metastases.
[0052] The term “lung cancer”, as used herein, refers to a disease which consists of uncontrolled cell growth in tissues of the lung. This growth may lead to metastasis, which is the invasion of adjacent tissue and infiltration beyond the lungs. The vast majority of primary lung cancers are carcinomas of the lung, derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, coughing (including coughing up blood), and weight loss.
[0053] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0054] The term “lung cancer”, as used herein, also encompasses lung cancer metastases.
[0055] Lung cancer can be staged as follows:
[0056] Stage I means that the cancer is small. It hasn’t spread to the lymph nodes or other distant organs. Stage I belongs to the early lung cancer stages. Stage I can be divided into IA and IB.
[0057] Stage IA means the cancer is 3 cm or smaller.
[0058] Stage IB means the cancer is between 3 cm and 4 cm. It might also be growing into structures such as: the main airway of the lung (main bronchus) or the membrane covering the lung (visceral pleura).
[0059] Stage II still belongs to the early lung cancer stages. Stage II can be divided into stage IIA and IIB. Part of the affected lung might have collapsed. Stage IIA means that the cancer is between 4 cm and 5 cm in size but there are no cancer cells in any lymph nodes.
[0060] Stage IBB means that the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes close to the affected lung. Alternatively, it is between 5 cm and 7 cm but there are no cancer cells in any lymph nodes. Alternatively, the cancer is not in any lymph nodes but has spread into one or more of the following areas: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer is less than 7 cm but there is more than one tumor in the same lobe of the lung.
[0061] Stage III can be divided into stage IIIA, IIBB and IIIC. It is sometimes called locally advanced lung cancer.
[0062] In stage IIIA, the cancer is up to 5cm in size and has spread to the lymph nodes in the center of the chest on the same side as the tumor. Alternatively, the cancer it is between 5 cm and 7 cm and there is more than one tumor in the same lobe of the lung. Alternatively, the cancer has spread into one or more of the following areas just outside the lung: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), the layers that cover the heart (mediastinal pleura and parietal pericardium), or lymph nodes in the lung or close to the lung. Alternatively, the cancer is larger than 7 cm. It hasn't spread into lymph nodes but has spread into one or more of the following areas: the muscle under the lung (diaphragm), the center area of the chest (mediastinum), the heart, a main blood vessel, the wind pipe (trachea), the nerve that goes to the voice box (larynx), the food pipe (oesophagus), a spinal bone, or the area where the wind pipe divides (the carina). Alternatively, the cancer is in more than one lobe of the same lung and there might also be cancer cells in lymph nodes close to the affected lung.
[0063] Stage IIBB can also mean different things. The cancer is less than 5 cm and has spread into lymph nodes in one of these places: the opposite side of the chest from the affected lung, the neck, or above the collarbone. Alternatively, the cancer is between 5 cm to 7 cm and has spread into lymph nodes in the center of the chest. Alternatively, the cancer is any size, has spread into lymph nodes in the center of the chest, and has spread into one or more of the following areas: the chest wall, the muscle under the lung (diaphragm), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer has spread into the lymph nodes in the center of the chest. The lung tumor is more than 7 cm or it has spread into a major structure in your chest such as: the heart, the wind pipe (trachea), the food pipe (oesophagus), or a main blood vessel. Stage IIIC means the cancer is between 5c m and 7 cm in size or has spread into one or more of the following: the nerve close to the lung (phrenic nerve) or the covering of the heart (parietal pericardium) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there is more than one tumor in a different lobe of the same lung. Alternatively, stage IIIC can mean the cancer is bigger than 7 cm or it has spread into one of the following: the muscle under the lung (the diaphragm), the center of the chest (mediastinum), the heart, a major blood vessel, the wind pipe (trachea), the nerve going to the voice box (the recurrent laryngeal nerve), the food pipe (oesophagus), a spinal bone, or the area where the windpipe divides (the carina) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there are tumors in more than one lobe of the lung.
[0064] Stage IV means that the lung cancer has spread. It can be designated as advanced lung cancer. It is divided into stage IVA and IVB.
[0065] Stage IVA can mean any of the following: there is cancer in both lungs, the cancer is in the covering of the lung (the pleura) or the covering of the heart (pericardium), or there is fluid around the lungs or the heart that contains cancer cells. Alternatively, it can mean that there is a single area of cancer that has spread outside the chest to a lymph node or to an organ such as the liver or bone.
[0066] Stage IVB means that the cancer has spread to several areas in one or more organs.
[0067] The term “early stage lung cancer”, as used herein, covers stages I and II. The term “late stage lung cancer”, as used herein, covers stage IV.
[0068] The term “small-cell lung carcinoma (SCLC)”, as used herein, refers to a disease where the cells contain dense neurosecretory granules (vesicles containing neuroendocrine hormones), which give this tumor an endocrine / paraneoplastic syndrome association. Most cases arise in the larger airways (primary and secondary bronchi). 60% to 70% of the patients have an extensive disease (which cannot be targeted within a single radiation therapy field) at presentation.
[0069] The term “non-small-cell lung carcinoma (NSCLC)”, as used herein, refers to any type of epithelial lung cancer other than small cell lung carcinoma (SCLC). NSCLC accounts for about 85% of all lung cancers. As a class, NSCLCs are relatively insensitive to chemotherapy, compared to small cell carcinoma. When possible, they are primarily treated by surgical resection with curative intent, although chemotherapy is increasingly being used both pre- operatively (neoadjuvant chemotherapy) and post-operatively (adjuvant chemotherapy). The most common types of NSCLC are squamous cell carcinoma (SQCC), large cell carcinoma, and adenocarcinoma (ADC).
[0070] The term “(therapeutic) treatment / therapy”, as used herein, relates to any treatment / therapy which improves the health status and / or prolongs (increases) the lifespan of a patient. Said treatment / therapy may eliminate the disease in a patient, arrest, inhibit, or slow the development of a disease in a patient, decrease the frequency or severity of symptoms in a patient, and / or decrease the recurrence in a patient who currently has or who previously has had a disease.
[0071] As used herein, the term “lung cancer therapy” refers to any protocol, method, and / or agent that can be used in the prevention, management, treatment, and / or amelioration of lung cancer. In particular, the term “lung cancer therapy”, as used herein, means accomplishing one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction of tumor marker(s), (iii) reduction of tumor lesions and metastases, (iv) reduction of tumor burden as evidenced by imaging studies (e.g. computer tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction of tumor burden as evidenced by clinical appraisal or self-report by the patient.
[0072] Specifically, lung cancer therapy includes, but is not limited to, drug therapy, supportive therapy, and / or other therapy useful in the prevention, management, treatment, and / or amelioration of cancer known to one of skill in the art, such as medical personnel. More specifically, lung cancer therapy includes, but is not limited to, surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic viral therapy, vaccination therapy, radiotherapy, laser therapy, hyperthermia therapy, and administration of a drug, or is a combination thereof, e.g. a combination of chemotherapy and immunotherapy.
[0073] The drug administered to a patient in need thereof is preferably selected from the group consisting of an immunomodulatory agent, an immunotherapeutic agent, an immunosuppressive agent, an oncolytic virus, a vaccine, and an antibody.
[0074] The term “immunotherapy” refers to any therapy in which one or more components of a human’s or animal’s immune system is (are) deliberately modulated in order to directly or indirectly achieve some therapeutic benefit, including systemic and / or local effects, and preventative and / or curative effects. Immunotherapy can involve administering one or more immunotherapeutic drugs or agents, either alone or in any combination, to a human or animal subject by any route (e.g. orally, intravenously, dermally, by injection, by inhalation, etc.), whether systemically, locally or both. Immunotherapy can involve provoking, increasing, decreasing, halting, preventing, blocking or otherwise modulating the production of cytokines, and / or activating or deactivating cytokines or immune cells, and / or modulating the levels of immune cells, and / or delivering one or more therapeutic or diagnostic substances to a particular location in the body or to a particular type of cell or tissue, and / or destroying particular cells or tissue. Immunotherapy can be used to achieve local effects, systemic effects, or a combination of both. Immunotherapy can also be used to reduce or eliminate side effects that may have been caused by other anti -cancer therapies.
[0075] Immunotherapies designed to elicit or amplify an immune response are classified as activation immunotherapies, while immunotherapies that reduce or suppress an immune response are classified as suppression immunotherapies.
[0076] An antitumor immunotherapy has broad potential and can be used to treat many different types of advanced-stage cancer owing to the durable and robust responses it elicits across a diverse spectrum of malignancies.
[0077] Immunotherapy encompasses the administration of an immunotherapeutic agent.
[0078] The term “immunotherapeutic agent”, as used herein, refers to any drug, compound, or biologic that indirectly or directly restores, enhances, stimulates, or increases the body's immune response against cancer cells and / or that decreases the side effects of other anticancer therapies. Examples of common immunotherapeutic agents known in the art include, but are not limited to, checkpoint inhibitors, cytokines, cancer vaccines, antibodies such as monoclonal antibodies, and / or non-cytokine adjuvants. Alternatively, or additionally, the immunotherapeutic treatment comprises the administration of immune cells (e.g. T cells, NK, cells, dendritic cells, B cells, etc.) to the patient. Especially, said immune cells are antigen- presenting cells and / or chimeric antigen receptor T cells.
[0079] The terms “antibody”, “immunoglobulin”, “Ig” and “Ig molecule” are used interchangeably herein. They refer to Y-shaped proteins that are produced by the immune system to help stop intruders from harming the body. When an intruder enters the body, the immune system springs into action. These invaders, which are called antigens, can be viruses, bacteria, or other chemicals. When an antigen is found in the body, the immune system will create antibodies to mark the antigen for the body to destroy. The terms are used in their broadest sense and include monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, single chain antibodies, and multispecific antibodies (e.g. bispecific antibodies). The term “antibody fragment”, as used herein, refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a specific antigen. An antibody fragment can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. An antibody fragment can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy (H) chain variable region and a light (L) chain variable region. An antibody may include two heavy (H) chain variable regions and two light (L) chain variable regions. The term “antibody fragment” encompasses antigen-binding fragments of antibodies such as single chain antibodies, Fab fragments, F(ab')2, Fv fragments and scFv. An antibody can have the structural features of IgA, IgG, IgE, IgD, IgM (as well as subtypes and combinations thereof). Antibodies can be from any source, including mouse, rabbit, pig, rat, and primate (human and non-human primate), whereby the antibodies have to be humanized before administered to a patient. Methods to humanize antibodies are well known in the art.
[0080] The term “small molecule”, as used herein, refers to an organic compound of low molecular weight (< 1000 dalton). It may regulate a biological process, with a size of the order of 1 nm. Many drugs are small molecules; the terms are equivalent in the literature. Larger structures such as nucleic acids and proteins and many polysaccharides are not small molecules, although their constituent monomers (ribo- or deoxyribonucleotides, amino acids, and monosaccharides, respectively) are often considered small molecules. Small molecules are often therapeutic agents. Some can inhibit a specific function of a protein or disrupt proteinprotein interactions.
[0081] The term “response”, as used herein, refers to an alteration in a patient’s condition that occurs as a result of or correlates with lung cancer treatment. In some embodiments, a response is or comprises a beneficial response. In some embodiments, a beneficial response may include stabilization of the condition (e.g. prevention or delay of deterioration expected or typically observed to occur in the absence of treatment), amelioration (e.g. reduction in frequency and / or intensity) of one or more symptoms of the condition, and / or improvement in the prospects for cure of the condition, etc. Particularly, the response is the response of the patient suffering from lung cancer to lung cancer therapy.
[0082] Specifically, a lung cancer patient or (control) subject suffering from lung cancer who has been treated with a lung cancer therapy is considered to “respond”, have a “response”, have “a positive response” or be “responsive” to the lung cancer therapy, if the individual shows evidence of an anti-cancer effect according to an art-accepted set of objective criteria or reasonable modification thereof, including a clinically significant benefit, such as the prevention, or reduction of severity, of symptoms, or a slowing of the progression of the lung cancer. By contrast, a lung cancer patient or (control) subject suffering from lung cancer who has been treated with a lung cancer therapy is considered “not to respond”, “to lack a response”, to have “a negative response” or be “non-responsive” to the lung cancer therapy, if the therapy provides no clinically significant benefit, such as the prevention or reduction of the severity of symptoms, or the rate of progression of lung cancer.
[0083] The term “remission”, as used herein, means that a treatment reduced or eliminated the symptoms and / or signs of a disease, such as lung cancer. Remission may last for months, years, or the rest of life of a patient. In case of cancer, remission includes complete remission and partial remission. Cancer is considered in complete remission when there isn’t any evidence of cancer on physical exam, blood work, or imaging tests. For example, if a patient has lung cancer that’s in complete remission, the patient’s symptoms will have improved and a computed tomography (CT) scan will show the cancer has disappeared. Complete remission doesn’t mean cancer is gone forever. Cancer can come back (recur). In addition, cancer is considered in partial remission, if imaging and blood tests show cancerous tumors are at least 50% smaller than they were before treatment and / or tumor cells don’t appear to be growing.
[0084] A patient is considered cured from cancer, if the patient has no signs or symptoms of cancer for at least 5 years after finishing treatment.
[0085] The term “recurrence”, as used herein, means that symptoms and / or signs of a disease, such as cancer like lung cancer, came back. In other words, if a disease such as cancer like lung cancer is found after treatment and after a period of time when the diseases such as cancer like lung cancer couldn’t be detected, it is called recurrence of a disease such as cancer like lung cancer recurrence. Local recurrence, in the case of cancer, means that the cancer is in the same place as the original cancer or very close to it. Regional recurrence, in case of cancer, means that the tumor has grown into lymph nodes or tissues near the original cancer. Distant recurrence, in case of cancer, means the cancer has spread to organs or tissues far from the original cancer.
[0086] The term “progression”, as used herein, means that the symptoms and / or signs of a disease, such as cancer like lung cancer, become worse or increase over time. In case of cancer, the cancer (further) spreads in the body. To indicate the progression of cancer, the cancer is usually assigned to different stages with the lowest stage describing early and small cancer / tumor forms and with the higher stages categorizing the cancer that has progressed and / or spread. Most cancers are assigned one of 4 stages, ranging from I to IV, e.g. lung cancer of stage I, II, III, or IV. The term “stable disease”, as used herein, refers to a disease, such as cancer like lung cancer, that is neither decreasing nor increasing in extent or severity. In addition, the term “stable disease, as used herein, refers to a disease, such as cancer like lung cancer, that is neither worsening nor improving over time. In a stable patient, the patient's condition is constant. Stable” preferably means a change over time which does not exceed 10% or 20%, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20%. A minor change over time may be a variation which is within the accuracy of a measurement. The accuracy of a measurement depends on the measurement method used. More preferably, the level is constant over time.
[0087] The term “patient”, as used herein, refers to any subject known to suffer from / being affected by lung cancer, i.e. diseased. The lung cancer is treated in the patient. In the context of the present invention, the lung cancer is treated in the patient with a 28S ribosomal RNA (rRNA) region binding molecule, alone or in combination / conjunction with another lung cancer drug.
[0088] The term “patient”, as used herein, further refers to a subject suffering from / being affected by lung cancer for whom it is desired to know whether she or he responds to lung cancer therapy. The patient may be identified as patient who responds to lung cancer therapy. In this case, the therapeutic treatment of cancer is continued. Specifically, the dose of the drug administered during therapeutic treatment of cancer is adjusted, e.g. decreased, and / or the numbers of administration of the drug during therapeutic treatment of cancer is adjusted, e.g. decreased. The patient may also be identified as patient who does not respond to lung cancer therapy. In this case, the administration schema is changed or the therapeutic treatment of cancer is changed. Specifically, the dose of the drug administered during therapeutic treatment of cancer is adjusted, e.g. increased, and / or the numbers of administration of the drug during therapeutic treatment of cancer is adjusted, e.g. increased.
[0089] The patient may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human individuals are particularly preferred.
[0090] The term “(control) subject”, as used herein, refers to a subject known to be not affected by lung cancer (negative control), i.e. healthy, or known to be affected by lung cancer (positive control), i.e. diseased.
[0091] It should be noted that a (control) subject which is known to be healthy, i.e. not suffering from cancer, may possibly suffer from another disease or condition not tested / known.
[0092] The (control) subject may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human healthy individuals are particularly preferred. The term “blood sample”, as used herein, encompasses whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. In particular the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. More preferably, the blood cell fraction is a fraction of leukocytes or a mixture of erythrocytes, leukocytes, and thrombocytes.
[0093] It is preferred that the blood sample has a volume of between 0.01 and 20 ml, more preferably of between 0.1 and 10 ml, even more preferably of between 0.5 and 8 ml and most preferably of between 1 and 5 ml.
[0094] Said blood sample may be provided by removing blood from a patient or (control) subject, but may also be provided by using a previously isolated sample. For example, a blood sample may be taken from a patient or (control) subject by conventional blood collection techniques.
[0095] The blood sample may further be obtained from a patient or (control) subject prior to the initiation of a therapeutic treatment, during the therapeutic treatment, and / or after the therapeutic treatment. If the blood sample is obtained from at least one (control) subject, e.g. from at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or 1,000 (control) subject(s), it is designated as “reference blood sample”. Preferably, the reference blood sample is from the same source than the blood sample of the patient to be tested, e.g. both are whole blood samples or blood cell fractions. It is further preferred that both are from the same species, e.g. from a human. It is also (alternatively or additionally) preferred that the measurements of the reference blood sample of the (control) subject and the blood sample of the patient to be tested are identical, e.g. both have an identical volume. It is particularly preferred that the reference blood sample and the blood sample are from (control) subjects / patients of the same sex and similar age.
[0096] The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA- tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g. Norgen cfDNA / cfRNA preservation tube), and others.
[0097] The blood sample, in particular whole blood sample, as used herein, may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 pl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. the RNA molecule as described herein, are extracted from the dried blood spots into a supernatant which is then further analyzed. In this way, the level of the RNA molecule is determined. This technique is suitable for monitoring patients having cancer at home (on a home care / home sampling basis) or for screening purposes.
[0098] In the method described herein, the level of 28S ribosomal RNA (rRNA) fragment is determined in a blood sample of a patient. The term “level”, as used herein, refers to an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads per million (RPM) or NGS counts) of the RNA molecule. The term “level”, as used herein, also comprises scaled, normalized, or scaled and normalized amounts or values (e.g. RPM). In particular, the level of the RNA molecule is determined by sequencing, preferably next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g. microarray or beads), nucleic acid amplification (e.g. PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g. LUMINEX), or any combination thereof. Specifically, the RNA molecule whose level is detected herein is the 28S rRNA fragment.
[0099] Those of skill in the art will appreciate that, in many embodiments described herein, the determined RNA molecule level is compared with an appropriate RNA molecule “reference level”. Specifically, the level of the RNA molecule is compared to a reference level of said RNA molecule. More specifically, the reference level of a RNA molecule is determined in a blood sample of (control) subjects, e.g. subject known to suffer from lung cancer. Even more specifically, the reference level is determined empirically by measuring a number of reference blood samples from subjects suffering from cancer known to be responders or non-responders to cancer therapy or by measuring a number of reference blood samples from subjects suffering from cancer having a known good or poor survival prognosis. Typically, as would be understood by those skilled in the art, the reference level is determined under conditions comparable to those utilized to determine or analyze the RNA molecule level in a blood sample of a patient. Specifically, the RNA molecule whose reference level is detected herein is the 28S rRNA fragment.
[0100] The reference level may also be a cut-off or threshold level. Typically, a cut-off or threshold level can be determined experimentally, empirically, or theoretically. A cut-off or threshold level can also be arbitrarily selected based upon the existing experimental and / or clinical conditions, as would be recognized by a person of ordinary skilled in the art. The cut-off or threshold level must be determined in order to obtain the optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical consequences of false positive and false negative). Typically, the optimal sensitivity and specificity (and so the threshold level) can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data. For example, after determining the RNA molecule level in a group of a reference, one can use algorithmic analysis for the statistic treatment of the measured RNA molecule level in samples to be tested, and thus obtain a classification standard having significance for sample classification. The full name of ROC curve is receiver operator characteristic curve, which is also known as receiver operation characteristic curve. It is mainly used for clinical biomarker tests. The ROC curve is a comprehensive indicator that reflects the continuous variables of true positive rate (sensitivity) and false positive rate (1 -specificity). It reveals the relationship between sensitivity and specificity with the image composition method. A series of different cut-off or threshold levels are set as continuous variables to calculate a series of sensitivity and specificity values. Then sensitivity is used as the vertical coordinate and specificity is used as the horizontal coordinate to draw a curve. The higher the area under the curve (AUC), the higher the accuracy of a prediction / prognosis / diagnosis. On the ROC curve, the point closest to the far upper left of the coordinate diagram is a critical point having both high sensitivity and high specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. When AUC > 0.5, the predicted / prognosed / diagnosed result gets better and better as AUC approaches 1.
[0101] Residues in two or more polypeptides are said to “correspond” to each other if the residues occupy an analogous position in the polypeptide structures. It is well known in the art that analogous positions in two or more polypeptides can be determined by aligning the polypeptide sequences based on amino acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art and can be, for example, obtained on the World Wide Web, e.g., ClustalW (www.ebi.ac.uk / clustalw) or Align (http: / / www.ebi.ac.uk / emboss / align / index.html) using standard settings, preferably for Align EMBOSS: rneedle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. The pharmaceutical composition according to the present invention is generally applied in a “pharmaceutically effective amount”. The term “pharmaceutically effective amount”, as used herein, refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In case of the treatment of a particular disease, the desired reaction preferably relates to an inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease may also be a delay of the onset or a prevention of the onset of the disease. An effective amount of the compounds or compositions described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size, and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration, and similar factors. Accordingly, the doses of the compounds or compositions described herein may depend on various of such parameters. In case that a reaction in the patient / subject is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.
[0102] The pharmaceutical composition of the present invention may further comprise pharmaceutical acceptable carriers, diluents, and / or excipients.
[0103] The term “excipient”, as used herein, is intended to indicate all substances in a pharmaceutical composition which are not active ingredients such as binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or colorants.
[0104] The term “diluent”, as used herein, relates to a diluting and / or thinning agent. Moreover, the term “diluent” includes a solution, suspension (e.g. liquid or solid suspension) and / or media.
[0105] The term “carrier”, as used herein, relates to one or more compatible solid or liquid fillers, which are suitable for an administration, e.g. to a human. The term “carrier” relates to a natural or synthetic organic or inorganic component which is combined with an active component in order to facilitate the application of the active component. Preferably, carrier components are sterile liquids such as water or oils, including those which are derived from mineral oil, animals, or plants, such as peanut oil, soy bean oil, sesame oil, sunflower oil, etc. Salt solutions and aqueous dextrose and glycerin solutions may also be used as aqueous carrier compounds.
[0106] Pharmaceutically acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985). Examples of suitable carriers include, for example, magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. Examples of suitable diluents include ethanol, glycerol, and water.
[0107] Pharmaceutical carriers, diluents, and / or excipients can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions of the present invention may comprise as, or in addition to, the carrier(s), excipient(s) or diluent(s) any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), and / or solubilising agent(s). Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, com sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose, and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Preservatives, stabilizers, dyes, and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid, and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.
[0108] The components of the combination or the components of the pharmaceutical composition comprising the 28S rRNA region binding molecule as described herein can be administered simultaneously, separately, or sequentially. The 28S rRNA region binding molecule as described herein, the combination comprising the 28S rRNA region binding molecule as described herein, the conjugate comprising the 28S rRNA region binding molecule as described herein, or the pharmaceutical composition comprising the 28S rRNA region binding molecule as described herein can also be administered together with another anti-lung cancer-agent. This administration can take place simultaneously, separately, or sequentially.
[0109] The term “simultaneously”, as used herein, means occurring or being performed simultaneously, unless otherwise specified, and the term “separately”, as used herein, means keeping separate from each other, unless otherwise specified. Further, the term “sequentially”, as used herein, means, unless otherwise specified, being characterized by a regular sequence or order, and the sequential dosing regimen may include administering one compound before, simultaneously with, or after administration of the other compound, however, both compounds will be administered in a regular sequence or order. The sequential administration refers to the temporally separate administration of the compounds / compositions described herein. Embodiments of the invention
[0110] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary.
[0111] Recently, the present inventors identified a 28 S ribosomal RNA (rRNA) fragment which has diagnostic power for the detection of lung cancer, acting as a biomarker found in blood. They demonstrated that high levels of the 28S rRNA fragment are indicative for lung cancer. The present inventors further showed that the 28S rRNA fragment can be used for the diagnosis and monitoring of lung cancer.
[0112] The present inventors now disclose a new therapeutic approach based on the delivery of 28S rRNA binding / interfering molecules such as antisense oligonucleotides (ASOs) to block the 28S rRNA from which the 28S rRNA fragment is derived. Specifically, the present inventors showed that lung cancer cells transfected with antisense oligonucleotides against the 28S rRNA from which the 28S rRNA fragment is derived showed a reduction in lung cancer cell proliferation while the levels of the 28S rRNA fragment dropped significantly in both the intracellular and extracellular spaces.
[0113] Accordingly, the 28S rRNA is both, a diagnostic marker for lung cancer in form of a 28 S rRNA fragment derived therefrom, and a therapeutic target for lung cancer treatment
[0114] Thus, in a first aspect, the present invention relates to a 28 S ribosomal RNA (rRNA) region binding molecule for use in medicine, preferably for use in the treatment of lung cancer, wherein the 28S rRNA region comprises a nucleotide sequence according to SEQ ID NO: 1, and wherein the 28 S rRNA region binding molecule binds or at least partially binds to the / said nucleotide sequence.
[0115] Whether a molecule binds or at least partially binds to the nucleotide sequence according to SEQ ID NO: 1 can easily be tested by the skilled person using e.g. an RNase protection assay, which uses the inability of RNases to cleave RNAs bound by phosphorotioate bonds-containing antisense oligonucleotide. In addition, the binding can be determined by pull-down assays, wherein the antisense oligonucleotide will enrich RNAs with the sequences containing SEQ ID NO: 1 as determined by e.g. next generation sequencing.
[0116] Specifically, the 28 S ribosomal RNA (rRNA) region binding molecule hinders the function of the 28 S rRNA, the processing of the 28 S rRNA, the folding of the 28 S rRNA, the interaction of the 28S rRNA with other RNAs, and / or the interaction of the 28S rRNA with proteins.
[0117] More specifically, the 28 S rRNA region binding molecule hinders the interaction of the bound part of the 28S rRNA with other RNAs and / or the interaction of the bound part of the 28S rRNA with proteins.
[0118] The other RNAs may be tRNAs or 18S rRNAs and the like. The proteins may be the proteins RPL10A, RNaseL or other RNases, and the like.
[0119] Alternatively or additionally, the 28 S rRNA region binding molecule inhibits or prevents the release of the nucleotide sequence according to SEQ ID NO: 1 from the 28 S rRNA in the final (processed) form (as 28 S rRNA fragment) or in the form of precursors (as 28 S rRNA fragment precursors), preferably in the form of precursors having a nucleotide sequence according to SEQ ID NO: 4 or any shorter version thereof. For example, the shorter precursor version may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11, nucleotide(s) shorter than the nucleotide sequence according to SEQ ID NO: 4. For example, the shorter precursor version may be 1, 2, 3, 4, 5, 6, or 7 nucleotide(s) shorter from the 5’end and / or 1, 2, 3, 4, 5, 6, or 7 nucleotide(s) shorter from the 3’end than the nucleotide sequence according to SEQ ID NO: 4. For example, the shorter precursor version may be 1 nucleotide shorter from the 5’ and 3’end, 2 nucleotides shorter from the 5’ and 3’end, 3 nucleotides shorter from the 5’ and 3’end, 4 nucleotides shorter from the 5’ and 3’end, 5 nucleotides shorter from the 5’ and 3’end, or 6 nucleotides shorter from the 5’ and 3’end.
[0120] The 28S rRNA has a length of 5070 nucleotides and is part of the 80S ribosome. The nucleotide sequence according to SEQ ID NO: 1 is part of / comprised in the 28S rRNA. When locating the nucleotide sequence according to SEQ ID NO: 1 in the tertiary structure of the 80S ribosome, it specifically resides in a protrusion between the large (60S) and the small (40S) subunits, as part of the LI -stalk. This mobile LI -stalk structure is functionally important for the movement of tRNAs on the translocating ribosome. Thus, it might be that the 28 S rRNA region binding molecule hinders the movement of tRNAs on the translocating ribosome. As to the exact location / position of the nucleotide sequence according to SEQ ID NO: 1 in the nucleotide sequence of the 28S rRNA, it is referred to FIGURE 1.
[0121] It is preferred that the 28S ribosomal RNA (rRNA) region binding molecule is an antisense oligonucleotide, a small molecule, such as a small molecule inhibitor, DNA aptamer, peptide, or protein. It is more preferred that the antisense oligonucleotide has a length of between 15 and 60 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.
[0122] It is even more preferred that the antisense oligonucleotide has a length of between 15 and 30 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
[0123] It is still even more preferred that the antisense oligonucleotide is reverse complementary to the nucleotide sequence according to SEQ ID NO: 1 or at least to a part of the nucleotide sequence according to SEQ ID NO: 1.
[0124] Particularly, the antisense oligonucleotide is reverse complementary to between 10 and 22 nucleotides (specifically to between 10 and 22 contiguous nucleotides), e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0125] More particularly, the antisense oligonucleotide is reverse complementary to between 12 and 22 nucleotides (specifically to between 12 and 22 contiguous nucleotides), e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0126] Even more particularly, the antisense oligonucleotide is reverse complementary to between 15 and 22 nucleotides (specifically to between 15 and 22 contiguous nucleotides), e.g. 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0127] Particularly, the antisense oligonucleotide has a length of between 15 and 30 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and is reverse complementary to between 10 and 22 nucleotides (specifically to between 10 and 22 contiguous nucleotides), e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0128] More particularly, the antisense oligonucleotide has a length of between 15 and 30 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and is reverse complementary to between 12 and 22 nucleotides (specifically to between 12 and 22 contiguous nucleotides), e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0129] Even more particularly, the antisense oligonucleotide has a length of between 15 and 30 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and is reverse complementary to between 15 and 22 nucleotides (specifically to between 15 and 22 contiguous nucleotides), e.g. 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1. In one alternative, the antisense oligonucleotide is reverse complementary to at least 10 nucleotides, particularly to at least 12 nucleotides, more particularly to at least 15 nucleotides, even more particularly to at least 18 nucleotides and still even more particularly to at least 20 nucleotides, e.g. to at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0130] In one another alternative, the antisense oligonucleotide has a length of between 15 and 30 nucleotides, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, and is reverse complementary to at least 10 nucleotides, particularly to at least 12 nucleotides, more particularly to at least 15 nucleotides, even more particularly to at least 18 nucleotides and still even more particularly to at least 20 nucleotides, e.g. to at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides, of the nucleotide sequence according to SEQ ID NO: 1.
[0131] Also encompassed is an embodiment, wherein an antisense oligonucleotide is used having a sequence identity of at least 50%, particularly of at least 60%, more particularly of at least 70%, even more particularly of at least 80%, still even more particularly of at least 90%, or most particularly of 100%, e.g. 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, to the nucleotide sequence according to SEQ ID NO: 12 (5’-GUAGUGGUAUUUCACCGGCGGC-3’). In this respect, it should be noted that the nucleotide sequence according to SEQ ID NO: 12 is reverse complementary to the nucleotide sequence according to SEQ ID NO: 1 (5’-GCCGCCGGUGAAAUACCACUAC- 3’)-
[0132] The antisense oligonucleotide may be composed of deoxyribonucleotides and / or ribonucleotides, preferably deoxyribonucleotides. The antisense oligonucleotide may further comprise one or more modified nucleotides such as locked nucleotides (LNAs), 2’ -orthomethylated RNA nucleotides, and / or have phosphorotioate bonds that confer resistance against intracellular nucleases.
[0133] Exemplarily antisense oligonucleotides used / usable herein comprise or consist of the nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 14 to SEQ ID NO: 30 (e.g. SEQ ID NO: 14 to SEQ ID NO: 26 or SEQ ID NO: 27 to SEQ ID NO: 30).
[0134] As mentioned above, the 28 S ribosomal RNA (rRNA) region binding molecule binds or at least partially binds to the nucleotide sequence according to SEQ ID NO: 1 (5’- GCCGCCGGUGAAAUACCACUAC-3’). Preferably, the 28 S ribosomal RNA (rRNA) region binding molecule is reverse complementary or reverse complementary to at least to a part of the nucleotide sequence according to SEQ ID NO: 1. The nucleotide sequence according to SEQ ID NO: 1, which is finally released from the ribosome, is designated as 28S rRNA fragment. When the 28 S rRNA region binding molecule only partially binds to the nucleotide sequence according to SEQ ID NO: 1 (5’-GCCGCCGGUGAAAUACCACUAC-3’), it preferably also binds to sequences downstream and / or upstream of the nucleotide sequence according to SEQ ID NO: 1 (5’-GCCGCCGGUGAAAUACCACUAC-3’). These sequences belong to the 28 S RNA fragment precursor molecule having the nucleotide sequence according to SEQ ID NO: 4 (5’-GCGGGCCGCCGGUGAAAUACCACUACUCUGAUC-3’). Thus, any additional antisense oligonucleotide can easily be determined / generated by the skilled person considering the nucleotide sequence according to SEQ ID NO: 4 (5’- GCGGGCCGCCGGUGAAAUACCACUACUCUGAUC-3’) or SEQ ID NO: 1 (5’- GCCGCCGGUGAAAUACCACUAC-3’). This additional antisense oligonucleotide should be reverse complementary to at least 10 nucleotides, preferably to at least 15 nucleotides, to the nucleotide sequence according to SEQ ID NO: 1 (= core sequence, 5’- GCCGCCGGUGAAAUACCACUAC-3’).
[0135] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0136] Lung cancer of stages I and II can also be designated as early lung cancer and lung cancer of stage IV can also be designated as late lung cancer.
[0137] This aspect can also be worded as follows: In a first aspect, the present invention relates to the use of the 28S ribosomal RNA (rRNA) region binding molecule for the manufacture of a medicament for the treatment of a disease, preferably for the treatment of lung cancer, wherein the 28S rRNA region comprises a nucleotide sequence according to SEQ ID NO: 1, and wherein the 28 S rRNA region binding molecule binds or at least partially binds to the / said nucleotide.
[0138] Alternatively, the present invention relates in a first aspect to a method for treating a disease, preferably lung cancer, comprising the step of: administering (an effective amount of) a 28S ribosomal RNA (rRNA) region binding molecule to a patient in need thereof, wherein the 28S rRNA region comprises a nucleotide sequence according to SEQ ID NO: 1, and wherein the 28 S rRNA region binding molecule binds or at least partially binds to the / said nucleotide sequence. In a second aspect, the present invention relates to a combination comprising a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and a drug different from the 28 S rRNA region binding molecule.
[0139] Preferably, the drug different from the 28S rRNA region binding molecule is a drug against lung cancer cells / lung cancer cell drug.
[0140] More preferably, the drug different from the 28S rRNA region binding molecule, specifically the drug against lung cancer cells / lung cancer cell drug, is an immunomodulatory agent, an immune cell therapeutic agent (CAR-T), a targeted anti -cancer agent, an antibody, an antibody drug conjugate (ADC), an anti -cancer virus or an anti-cancer vaccine.
[0141] Even more preferably, the immunomodulatory agent is a checkpoint inhibitor, specifically a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, or CTLA-4, or an intrinsic checkpoint blockade, the targeted anticancer agent is selected from the group consisting of trastuzumab, pertuzumab, panitumumab, cetuximab, bevacizumab, ramucirumab, aflibercept, rituximab, obinutuzumab, daratumumab, denosumab, dasatinib, nilotinib, imatinib, bosutinib, osimertinib, erlotinib, gefitinib, nintedanib, sunitinib, sorafenib, cabozantinib, lenvatinib, regorafenib, axitinib, pazopanib, cabozantinib, trametinib, dabrafenib, abemaciclib, palbociclib, lenalidomide, ruxolitinib, alectinib, crizotinib, olaparib and venetoclax, the immune cell therapeutic agent is tisagenlecleucel or axicabtagene ciloleucel, the antibody drug conjugate is gemtuzumab-ozogamicin, brentuximab vedotin, trastuzumab emtansine, inotuzumab ozogamicin or eribulin mesylate, the anticancer virus is talimogene laherparepvec, or the anticancer vaccine is sipuleucel-T.
[0142] For example, the checkpoint inhibitor may be a PD-1 antibody, PD-L1 antibody, CTLA- 4 antibody, TIM3 antibody or LAG3 antibody. The PD-1 antibody may be pembrolizumab, nivolumab or cemiplimab, and the PD-L1 antibody may be atezolizumab, avelumab or durvalumab, but they are not limited thereto. Further, the CTLA-4 antibody may be ipilimumab or tremelimumab, the TIM3 antibody may be MBG452, and the LAG3 antibody may be BMS- 986016 or LAG525, but they are not limited thereto.
[0143] In a third aspect, the present invention relates to a combination of the second aspect for use in medicine, preferably for use in the treatment of lung cancer.
[0144] The combination is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.
[0145] The components of the combination, i.e. the 28S rRNA region binding molecule and the drug different from the 28S rRNA region binding molecule, may be administered together (e.g. at the same time) or independent from each other (e.g. one after the other). In other words, the components of the combination, i.e. the 28S rRNA region binding molecule and the drug different from the 28S rRNA region binding molecule, may be administered simultaneously, separately, or sequentially.
[0146] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0147] This aspect can also be worded as follows: In a third aspect, the present invention relates to the use of a combination of the second aspect for the manufacture of a medicament for the treatment of a disease, preferably for the treatment of lung cancer.
[0148] Alternatively, the present invention relates in a third aspect to a method for treating a disease, preferably lung cancer, comprising the step of: administering (an effective amount of) a combination of the second aspect to a patient in need thereof.
[0149] In a fourth aspect, the present invention relates to a conjugate comprising a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and another molecule.
[0150] Preferably, the other molecule is covalently linked to the 28S rRNA region binding molecule, e.g. via the 5’end and / or via the 3’end of the 28S rRNA region binding molecule. The linkage of the other molecule to the 28 S rRNA region binding molecule can be direct or via a linker molecule, e.g. a linker molecule comprising between 5 and 15 nucleotides, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. More preferably, the other molecule is a molecule against lung cancer cells. Even more preferably, the other molecule, specifically the molecule against lung cancer cells, is an antibody or a toxin. Still even more preferably, the antibody binds a cell surface antigen of a lung cell, preferably of a lung cancer cell.
[0151] A conjugate comprising a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and an antibody is specifically preferred. The conjugate composed of a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect and an antibody can also be designated as antibody-drug conjugate (ADC). Usually, ADCs combine the targeting properties of antibodies, specifically monoclonal antibodies, with the cancerkilling capabilities of cytotoxic drugs, designed to discriminate between healthy and diseased tissue.
[0152] In particular, the antibody is a monoclonal antibody which is conjugated to the 28S rRNA region binding molecule. It binds to specific proteins or receptors found on lung cells, including lung cancer cells. The linked 28S rRNA region binding molecule enters these cells and performs its function in these cells (e.g. kills these cells) without harming other cells.
[0153] More particularly, the 28 S ribosomal RNA (rRNA) region binding molecule is coupled to an antibody that targets a specific tumor antigen (or protein) that, ideally, is only found in or on the lung cancer tumor cells. Antibodies attach themselves to the antigens on the surface of cancerous cells. The biochemical reaction that occurs upon attaching triggers a signal in the tumor cell, which then absorbs, or internalizes, the antibody together with the linked 28S rRNA region binding molecule. After the ADC is internalized, the 28S rRNA region binding molecule exerts its function within the cell (stops proliferation and, thus, kills the cancer cell). Preferred antibodies are antibodies recognizing tumor-specific antigens at the surface of cancer cells.
[0154] In a fifth aspect, the present invention relates to a conjugate of the fourth aspect for use in medicine, preferably for use in the treatment of lung cancer.
[0155] The conjugate is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.
[0156] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0157] This aspect can also be worded as follows: In a fifth aspect, the present invention relates to the use a conjugate of the fourth aspect for the manufacture of a medicament for the treatment of a disease, preferably for the treatment of lung cancer. Alternatively, the present invention relates in a fifth aspect to a method for treating a disease, preferably lung cancer, comprising the step of administering (an effective amount of) a conjugate of the fourth aspect to a patient in need thereof.
[0158] In a sixth aspect, the present invention relates to a conjugate of the fourth aspect for use in targeted therapy, preferably for use in targeted lung cancer therapy.
[0159] The conjugate is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.
[0160] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0161] This aspect can also be worded as follows: In a sixth aspect, the present invention relates to the use of a conjugate of the fourth aspect for the manufacture of a medicament for targeted therapy, preferably for targeted lung cancer therapy.
[0162] Alternatively, the present invention relates in a sixth aspect to a method for targeted therapy, preferably targeted lung cancer therapy, comprising the step of administering (an effective amount of) a conjugate of the fourth aspect to a patient in need thereof.
[0163] In a seventh aspect, the present invention relates to a pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect, the combination of the second aspect, or the conjugate of the fourth aspect and a pharmaceutical acceptable carrier.
[0164] The pharmaceutical composition may be formulated for local administration or systemic administration. In particular, the local administration is by parenteral administration, e.g. by intravenous administration, subcutaneous administration, intradermal administration, intramuscularly administration, and the systemic administration is by intraarterial administration. In particular the composition is administered subcutaneously, intradermally, or intramuscularly. In addition to the pharmaceutical acceptable carrier, a diluent, and / or excipient may be comprised in the pharmaceutical composition. In an eighth aspect, the present invention relates to a pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect, the combination of the second aspect, or the conjugate of the fourth aspect and a pharmaceutical acceptable carrier for use in medicine, preferably for use in the treatment of lung cancer.
[0165] The pharmaceutical composition may be formulated for local administration or systemic administration. In particular, the local administration is by parenteral administration, e.g. by intravenous administration, subcutaneous administration, intradermal administration, intramuscularly administration, and the systemic administration is by intraarterial administration. In particular the composition is administered subcutaneously, intradermally, or intramuscularly. The composition may further comprise one or more pharmaceutically acceptable carriers, diluents, and / or excipients.
[0166] The pharmaceutical composition may be administered in a pharmaceutically effective amount. It is apparent to those skilled in the art that a suitable total (daily, weekly, or monthly) amount of the pharmaceutical composition may be determined by a treating physician within the scope of sound medical judgment.
[0167] For the purposes of the present invention, a specific pharmaceutically effective amount for a specific patient is preferably applied differently depending on various factors including: type and extent of the response to be achieved, whether or not other agents are used if necessary, specific composition, patient's age, weight general health status, sex, diet, administration time, administration route, secretion rate of the composition, treatment period, drug used together or concurrently with the specific composition, as well as similar factors well known in the pharmaceutical field.
[0168] The pharmaceutical composition may be accompanied by an instruction associated with packaging in a form instructed by a government agency in charge of the manufacture, use and sale of drugs if necessary. The instruction indicates the approval of a private interest organization in regard to the form of a composition or administration to human or animals, and may be, for example, a label approved by the US Food and Drug Administration for the prescription of the drugs.
[0169] The pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents against lung cancer, and may be administered simultaneously, separately or sequentially with the conventional therapeutic agents against lung cancer. In addition, it may be administered in single or multiple doses. Taking all of the above factors into consideration, it is important to administer the pharmaceutical composition in an amount that can achieve maximum effects with a minimum amount without side effects, which may be easily determined by those skilled in the art. Specifically, the combination as described in the second aspect or the conjugate as described in the fourth aspect of the present invention can be, as form or as part of a pharmaceutical composition administered to the patient.
[0170] Preferably, the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). More preferably, the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0171] This aspect can also be worded as follows: In an eighth aspect, the present invention relates to the use of a pharmaceutical composition of the seventh aspect for the manufacture of a medicament for the treatment of a disease, specifically for the treatment of lung cancer.
[0172] Alternatively, the present invention relates in an eighth aspect to a method for the treatment of a disease, specifically for the treatment of lung cancer, comprising the step of: administering (an effective amount of) a pharmaceutical composition of the seventh to a patient in need thereof.
[0173] In a ninth aspect, the present invention relates to a method of determining whether a patient responds to a lung cancer treatment comprising the step of: determining the level of a 28S ribosomal RNA (rRNA) fragment in a biological sample isolated from the patient, wherein the patient is a patient to whom at least once at least one drug to be used in the lung cancer treatment is, has, or had been administered, and wherein the at least one drug is a 28S ribosomal RNA (rRNA) region binding molecule.
[0174] The 28S rRNA region binding molecule is preferably a molecule as defined in the first aspect.
[0175] As mentioned above, the patient is a patient to whom at least once (e.g. once, twice, or thrice / 1, 2, or 3 times) at least one drug (e.g. 1, 2, 3, or 4 drug(s)) to be used in said treatment is / are administered or has / had been administered. The way of administration may be oral, nasal, rectal, parenteral, vaginal, or topical. Parental administration includes subcutaneous, intracutaneous, intramuscular, intravenous or intraperitoneal administration.
[0176] It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly preferred that the biological sample is isolated from the patient in a time period of between 12 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly more preferred that the biological sample is isolated from the patient in a time period of between 6 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly even more preferred that the biological sample is isolated from the patient in a time period of between 1 month and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly most preferred that the biological sample is isolated from the patient in a time period of between 1 week and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. For example, the biological sample is isolated from the patient 1, 2, 3, 4, 5, 6, day(s), 1, 2, 3 week(s), 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 month(s) after at least the first (e.g. first, second, or third) administration of the at least one drug.
[0177] It is also preferred that the level of the 28S rRNA fragment is compared to a reference level of said 28 S rRNA fragment. Thus, in one particular embodiment, the present invention relates to a method of determining whether a patient responds to a lung cancer treatment comprising the step of:
[0178] (i) determining the level of a 28S rRNA fragment in a biological sample isolated from the patient, and
[0179] (ii) comparing the level of the 28S rRNA fragment to a reference level of said 28S rRNA fragment, wherein the patient is a patient to whom at least once at least one drug to be used in the lung cancer treatment is, has, or had been administered, and wherein the at least one drug is a 28S rRNA region binding molecule.
[0180] As mentioned above, it is preferred that the patient is a patient to whom at least once (e.g. once, twice, or thrice / 1, 2, or 3 times) a drug to be used in said treatment is administered or has / had been administered. It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug.
[0181] The reference level may be any level which allows to determine whether the patient suffering from lung cancer responds to the lung cancer treatment. It is preferred that the reference level is the level determined by measuring at least one reference biological sample, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 reference biological sample(s), from at least one subject, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 subject(s), suffering from lung cancer. It is practicable to take one reference biological sample per subject for analysis. If additional reference biological samples are required, e.g. to determine the reference level in different reference biological samples, the same subject may be (re)tested. Said reference level may be an average reference level. It may be determined by measuring reference levels and calculating the “average” value (e.g. mean, median or modal value) thereof.
[0182] It is also (alternatively or additionally) preferred that the reference level is the level determined in a reference biological sample isolated from the (same) patient prior to the administration of the at least one drug. It is particularly preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 months and immediately prior to the administration of the at least one drug. It is particularly more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 month and immediately prior to the administration of the at least one drug. It is particularly even more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 weeks and immediately prior to the administration of the at least one drug. It is particularly most preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 day and immediately prior to the administration of the at least one drug or between 1 hour and immediately prior to the administration of the at least one drug. For example, the reference biological sample is isolated from the (same) patient immediately, 10, 20, 30, 40, 50 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hour(s), 1, 2, 3, 4, 5, 6 day(s), 1, 2, 3 week(s), 1, 2, or 3 month(s) prior to the administration of the at least one drug.
[0183] It is of advantage if the patients / subjects from which the biological samples / reference biological samples are taken have undergone a wash-out period to remove any pharmaceutical substances from the body. For example, the patients that receive or have / had received a drug for therapeutic treatment have undergone a 3-month was-out period prior to the administration of the drug.
[0184] It is more preferred that the level of the 28 S rRNA fragment below the reference level indicates that the patient responds to said lung cancer treatment, the level of the 28S rRNA fragment comparable with the reference level indicates that the patient does not respond to said lung cancer treatment, or the level of the 28 S rRNA fragment above the reference level indicates that the patient does not respond to said lung cancer treatment. A level which is “comparable with” the reference level in this respect means that the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above the reference level or the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above / below the reference level. Alternatively, a level which is comparable with the reference level in this respect means that the detected level variation is within the accuracy of a measurement. The accuracy of a measurement depends on the measurement method used.
[0185] Preferably, the level of the 28S rRNA fragment is at least 0.6-fold or 0.7-fold, more preferably at least 0.8-fold or 0.9-fold, even more preferably at least 1.2-fold or 1.5-fold, and most preferably at least 2.0-fold or 3.0-fold below and / or above the reference level. For example, the level of the 28S rRNA fragment is at least 0.6-fold, at least 0.7-fold, at least 0.8- fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9- fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold below and / or above the reference level.
[0186] It is particularly preferred that the lung cancer is non-small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). It is more particularly preferred that the lung cancer is lung cancer of stage I, II, III, or IV, e.g. NSCLC of stage I, II, III or IV, or small-cell lung carcinoma (SCLS) of stage I, II, III or IV.
[0187] The patient may be a mammal, preferably a human or a rodent.
[0188] The determination of the level of 28 S rRNA fragment may be carried out by any convenient means for determining the level of a nucleotide sequence such as rRNA. For this purpose, qualitative, semi -quantitative and quantitative detection methods can be used. Quantitative detection methods are preferred. A variety of techniques are well known to the person skilled in the art. For example, the level of the 28S rRNA fragment can be determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectroscopy or any combination thereof.
[0189] The blood sample may be whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. More preferably, the blood cell fraction comprises erythrocytes, leukocytes, and / or thrombocytes.
[0190] As mentioned above, the at least one drug is a 28S ribosomal RNA (rRNA) region binding molecule. The administration of the 28S rRNA region binding molecule can be accompanied by the administration of another (different) lung cancer / lung cancer cell drug. Preferably, the lung cancer / lung cancer cell drug different from the 28 S rRNA region binding molecule is an immunomodulatory agent, an immune cell therapeutic agent (CAR-T), a targeted anti-cancer agent, an antibody, an antibody drug conjugate (ADC), an anti-cancer virus or an anti -cancer vaccine.
[0191] Even more preferably, the immunomodulatory agent is a checkpoint inhibitor, specifically a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, or CTLA-4, or an intrinsic checkpoint blockade, the targeted anticancer agent is selected from the group consisting of trastuzumab, pertuzumab, panitumumab, cetuximab, bevacizumab, ramucirumab, aflibercept, rituximab, obinutuzumab, daratumumab, denosumab, dasatinib, nilotinib, imatinib, bosutinib, osimertinib, erlotinib, gefitinib, nintedanib, sunitinib, sorafenib, cabozantinib, lenvatinib, regorafenib, axitinib, pazopanib, cabozantinib, trametinib, dabrafenib, abemaciclib, palbociclib, lenalidomide, ruxolitinib, alectinib, crizotinib, olaparib and venetoclax, the immune cell therapeutic agent is tisagenlecleucel or axicabtagene ciloleucel, the antibody drug conjugate is gemtuzumab-ozogamicin, brentuximab vedotin, trastuzumab emtansine, inotuzumab ozogamicin or eribulin mesylate, the anticancer virus is talimogene laherparepvec, or the anticancer vaccine is sipuleucel-T.
[0192] For example, the checkpoint inhibitor may be a PD-1 antibody, PD-L1 antibody, CTLA- 4 antibody, TIM3 antibody or LAG3 antibody. The PD-1 antibody may be pembrolizumab, nivolumab or cemiplimab, and the PD-L1 antibody may be atezolizumab, avelumab or durvalumab, but they are not limited thereto. Further, the CTLA-4 antibody may be ipilimumab or tremelimumab, the TIM3 antibody may be MBG452, and the LAG3 antibody may be BMS- 986016 or LAG525, but they are not limited thereto.
[0193] The combination of the second aspect or the conjugate of the fourth aspect can alternatively be administered to check whether the patient responds to the lung cancer treatment.
[0194] In a further aspect, the present invention relates to a method of treating lung cancer in a patient comprising the step of administering a 28S ribosomal RNA (rRNA) region binding molecule as defined in the first aspect, a combination of the second aspect, a conjugate of the fourth aspect, or a pharmaceutical composition of the sevenths aspect to a patient in need thereof.
[0195] The 28S ribosomal RNA (rRNA) region binding molecule may be administered in a pharmaceutically effective amount. It is apparent to those skilled in the art that a suitable total (daily, weekly, or monthly) amount of the 28S ribosomal RNA (rRNA) region binding molecule may be determined by a treating physician within the scope of sound medical judgment.
[0196] For the purposes of the present invention, a specific pharmaceutically effective amount for a specific patient is preferably applied differently depending on various factors including: type and extent of the response to be achieved, whether or not other agents are used if necessary, specific composition, patient's age, weight general health status, sex, diet, administration time, administration route, secretion rate of the composition, treatment period, drug used together or concurrently with the specific composition, as well as similar factors well known in the pharmaceutical field.
[0197] The 28 S ribosomal RNA (rRNA) region binding molecule may be formulated for local administration or systemic administration. In particular, the local administration is by parenteral administration, e.g. by intravenous administration, subcutaneous administration, intradermal administration, intramuscularly administration, and the systemic administration is by intraarterial administration. In particular the composition is administered subcutaneously, intradermally, or intramuscularly.
[0198] Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention.
[0199] BRIEF DESCRIPTION OF THE FIGURES
[0200] The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way.
[0201] Figure 1: Shows a detailed mapping of the 28 S ribosomal RNA (rRNA) fragment. (A) The rRNA fragment was mapped to the 28S rRNA. To pinpoint the exact location, the 5070 nucleotides of the 28 S rRNA were partitioned into 25 nt bins. The fragment’s 5 ’end mapped to bin 162, encompassing positions 4036 to 4057 (or to positions corresponding thereto). (B) Tertiary folding of the ribosome indicates that the fragment (see arrow) maps to the LI -stalk protrusion between the small and large ribosomal subunits. Figure 2: Shows the number of live A-549 cells 48h after antisense oligonucleotide (ASO) transfection as determined by counting using Biirker chamber and methylene blue method. Sc (Scrambled-ASO (SEQ ID NO: 5) at lOOnM), 15nt (15nt-long-ASO (SEQ ID NO: 2) at lOOnM), and 22nt (22nt-long-ASO (SEQ ID NO: 3) at lOOnM). Duplicated measurements of two independent wells for each are shown.
[0202] Figure 3: Shows an MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)- 2-(4-sulfophenyl) -2H-tetrazolium) assay indicating percentage of viable cells relative to Scrambled oligo treated control cells. Doxorubicin, an inhibitor of cell proliferation, was added to the cells at different concentrations and serves as positive control for viability testing. Four independent wells were measured for each treatment.
[0203] Figure 4: Shows a scratch wound healing assay with % of scratch surface over time (Oh, 5h, 24h, 30h, 48h, 72h) in untreated cells, doxorubicin-treated cells, Sc (Scrambled-ASO (SEQ ID NO: 5) at lOOnM), 15nt (15nt-long-ASO (SEQ ID NO: 2) at lOOnM), and 22nt (22nt-long- ASO (SEQ ID NO: 3) at lOOnM).
[0204] Figure 5: Shows expression of 28S rRNA fragment (miLung#l, SEQ ID NO: 1) 48h after ASOs transfection in conditioned medium used for A-549 or HCC-827, as determined by digital PCR. Duplicated measurements of two independent wells for each are shown.
[0205] Figure 6: Shows expression of intracellular 28S rRNA fragment (miLung#l, SEQ ID NO: 1) 48h after ASOs transfection in A-549 cells, as determined by digital PCR. Duplicated measurements of two independent wells for each are shown.
[0206] Figure 7: Shows 28S rRNA fragment (miLung#l, SEQ ID NO: 1) levels found in conditioned media after adding the ASOs at a final concentration of 1 pM and 1 fM, as determined by digital PCR.
[0207] Figure 8: Extracellular 28S rRNA fragment (miLung#l, SEQ ID NO: 1) expression 48 hours after TSB and PTSB transfection in A549 cells at 20 nM and 75 nM concentrations, measured by dPCR.
[0208] EXAMPLES
[0209] The examples given below are for illustrative purposes only and do not limit the invention described above in any way. Previously, the present inventors showed that the determination of the 28 S ribosomal RNA (rRNA) fragment 5’-GCCGCCGGUGAAAUACCACUAC-3’ (SEQ ID NO: 1) level in a blood sample of a patient allows the diagnosis and monitoring of lung cancer.
[0210] Here, the present inventors show a new approach for the treatment of lung cancer using antisense oligonucleotides (ASOs) which target the 28S rRNA from which the 28S rRNA fragment (SEQ ID NO: 1) is derived. They demonstrate that transfecting antisense oligonucleotides (ASOs) in lung cancer cell lines significantly reduced cell proliferation and levels of the 28S rRNA fragment (SEQ ID NO: 1). Thus, as derived from effects on proliferation of lung cancer cells lines in vitro, blocking 28S rRNA fragment (SEQ ID NO: 1) containing sequences on ribosomal RNA has a curative effect.
[0211] Example 1:
[0212] Materials & Methods
[0213] Cell culture
[0214] HCC-827 and A-549 cells were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ). HCC-827 were cultured in RPMI medium supplemented with 20% fetal bovine serum. A-549 were cultured in DMEM medium supplemented with 10% fetal bovine serum. Both media contained 1% penicillin / streptomycin.
[0215] ASOs transfection
[0216] Two different versions of ASOs (IDT) were designed against miLung#l : 15nt-oligo (SEQ ID NO: 2) and 22nt-oligo (SEQ ID NO: 3). Also, a third scrambled ASO was used as a negative control (SEQ ID NO: 5). ASOs were transfected using Lipofectamine 3000 (ThermoFisher Scientific) in HCC-827 and A-549 cells at 100 nM final concentration in media. Cells were washed twice with PBS and media was exchanged 24h post-transfection.
[0217] MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl) -2H- tetrazolium) assay
[0218] A-549 cells were seeded in 96-plates (7000 cells per well) and cultured in DMEM supplemented with 10% fetal bovine serum. Next day, cells were washed with PBS and ASOs were transfected with Lipofectamine 3000 as explained below:
[0219] 1. Untreated cells: no transfection, just media exchange with fresh DMEM. 2. Ctrl, doxorubicin: cells were treated with doxorubicin at a concentration of lOOnM, 1 pM and 2 pM in DMEM.
[0220] 3. ASOs were transfected using Lipofectamine 3000 at concentrations of 100 nM, 1 pM and 2pM.
[0221] All treatments were performed in duplicates. In the following day, 20 pl of MTS reagent was added to the wells containing 100 pL of medium. After 2 hours of incubation at 37°C, absorbance of the media was measured at 490 nM. Cell viability was calculated by the following formula: V = (A / A0)* 100, where A is the absorbance of the sample, A0 is the absorbance of the untreated control cells, and V is the viability in %.
[0222] Scratch wound healing assay
[0223] A-549 cells were seeded in 6-well plates (2.2xl05cells per well) and cultured in DMEM supplemented with 10% fetal bovine serum. Next day a scratch wound was created using a sterile 200pl tip in each 6-well. Cells were washed with PBS twice to discard detached cells, followed by different treatments in duplicates:
[0224] 1. Ctrl, untreated cells: exchange to fresh DMEM.
[0225] 2. Ctrl, doxorubicin: cells were treated with doxorubicin at a concentration of 1 pM in DMEM.
[0226] 3. ASOs were transfected using Lipofectamine 3000 at concentrations of 100 nM.
[0227] Microscopic images were captured at defined time points (Oh, 5h, 24h, 3 Oh, 48h, and 72h) using lOx magnification. Data analysis was performed using ImageJ with a specific wound healing assay plug-in (Tseng et al., 2012) to quantify the percentage of wound area for all samples over time.
[0228] RNA isolation from conditioned medium
[0229] RNA was isolated using Zymo Research Quick-cfRNA Serum & Plasma Kit following the manufacturer’s instructions and eluted in 20 pl.
[0230] Digital PCR
[0231] First, specific adapters for the rRNA fragment are denatured and renatured such that they form required stem loop-like structures. The source RNA is denatured separately, treated with the polynucleotide kinase (to restore the 5’ phosphate), mixed with adapters and used for the ligation by T4 RNA ligase 2. Subsequently, RT primer aligning to the 3’ adapter is used for the cDNA production. Next, diluted cDNA is used for the digital PCR with a reverse primer aligning to the 5’ end of first strand cDNA and forward primer complementary to the 3’ end of the first strand cDNA. Finally, a TaqMan probe is used for the detection of the specific signal in digital PCR.
[0232] 1. Adapter preparation
[0233] Heat the mixture to 82°C for 2 min
[0234] - Ramp-down rate of 0. l°C / sec to 4°C
[0235] Store at -20°C
[0236] 5 ’adapter: CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 6)
[0237] 3 ’adapter:
[0238] / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 7)
[0239] 2. RNA denaturation
[0240] Denature RNA for 2 min at 70°C
[0241] - Immediately place on ice
[0242] 3. PNK treatment of the RNA
[0243] Incubate 20 min @37°C Denature at 65°C for 10 min
[0244] 4. Ligation of the adapters to RNA
[0245] - Incubate 1 hour at 37°C with the lid heated to 45°C
[0246] Store at -20°C
[0247] 5. Reverse transcription
[0248] - Prepare the RT reaction:
[0249] - Incubate 5 min at 65°C and cool immediately on ice
[0250] LunaScript RT
[0251] - Add following to the previous mixture
[0252] - Incubate at 50°C for 60 min, followed by 15 min incubation at 70°C and store at 4°C
[0253] Store at -20°C
[0254] RT primer: CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 8) 6. QIAcuity digital PCR
[0255] - Dilute cDNA accordingly
[0256] - Prepare the following mixture for each per well
[0257] Transfer 12 pl to the 96-well-plate for digital PCR
[0258] Taqman Probe: / 6-FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-l / (SEQ ID
[0259] NO: 9)
[0260] Forward primer: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 10)
[0261] Reverse primer: GTGCGAATACCTCGGACC (SEQ ID NO: 11)
[0262] Statistical testing
[0263] Significance testing was done using two-way unpaired Student’s t-test. As significant results were considered those with p<0.05.
[0264] Sequence summary
[0265] The following Table 1 summarizes the sequences used in this method.
[0266] Table 1: ASOs, adapters, primers, and probes (5' — >3' orientation) used in this method.
[0267] *denotes phosphonothioate bond, +N denotes LNA nucleotide, rN denotes RNA nucleotide
[0268] Results
[0269] To study the effect of the antisense oligonucleotides (ASOs) against the 28S rRNA fragment (miLung#l, SEQ ID NO: 1), cell proliferation and 28S rRNA fragment levels were examined in human lung cancer cell lines A-549 and HCC-827.
[0270] A-549 cells transfected with both the 15nt- and 22nt- versions of miLung#l-ASOs (SEQ ID NOs: 2 and 3) showed a significant reduction in cell proliferation compared to those transfected with scrambled-ASO (p<0.01) (SEQ ID NO: 5) (FIGURE 2).
[0271] Subsequently, an MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl) -2H-tetrazolium) assay was used on A-549 cells, a reliable colorimetric method to study cell proliferation. Significantly lower cell viability was detected when transfecting cells with 100 nM of the 15nt-ASO (SEQ ID NO: 2), and 100 nM of the 22nt-ASO (SEQ ID NO:3) as compared to the Scrambled-ASO (SEQ ID NO: 5) (FIGURE 3). As expected, doxorubicin, a positive control reagent inducing cells’ apoptosis, showed effect on proliferation.
[0272] Furthermore, a scratch wound healing assay was conducted to investigate cell migration and wound healing in vitro. Reduced cell proliferation in cells transfected with the 22nt-ASO targeting miLung#l compared to cells transfected with scrambled ASO could be shown (FIGURE 4)
[0273] Based on the results from these assays, it can be concluded that using ASOs to block miLung#l lowers cell proliferation.
[0274] Small RNAs, such as miLung#l, are actively secreted into the peripheral blood (Sikosek et al., 2023) or, in this case, into the conditioned cell medium. Since the aim was to neutralize miLung#l using ASOs, a reduction in miLung#l levels in cell medium could be expected. Therefore, miLung#l presence in conditioned medium from A-549 and HCC-827 cells was investigated by using digital PCR for quantification. As shown in FIGURE 5, the presence of miLung#l significantly decreased by a minimum of 9-fold (P<0.001) in both A-549 and HCC- 827 cells, suggesting that it was possible to reduce the secretion of miLung#l from cells to extracellular environment.
[0275] In addition, miLung#l expression intracellularly was investigated. A similar pattern, where miLung#l significantly decreased by a baseline of 7.5-fold (P<0.001) in A-549 cells upon treatment with ASOs was observed (FIGURE 6). In this respect, please note that the levels of intracellular miLung#l are much lower than the levels of extracellular miLung#l (as reported in Sikosek et al, 2023).
[0276] To ensure that antisense oligonucleotides (ASOs) do not interfere with the miLung#l -specific digital PCR process and thus affect the results, a control experiment was conducted. Typically, RNA is extracted from HCC-827 cell medium 48 hours post-transfection with ASOs, followed by digital PCR to quantify the number of copies of miLung#l. However, for this experiment, conditioned cell media was used to which ASOs were added directly at concentrations of IpM and IfM. dPCR analysis showed no significant difference in miLung#l detection between samples containing 1 pM or 1 fM of ASOs (FIGURE 7). These results confirm that the ASOs do not interfere with the dPCR assay. Consequently, the observed effects are due to the biological interactions of ASOs with miLung#l rather than technical artifacts.
[0277] The following alternative antisense oligonucleotides (ASOs) can be used in the above assay: Scrambled ASO: GATTGACGTGCCGGATTCGCTG (SEQ ID NO: 13), 15nt-ASO: TATTTCACCGGCGGC (SEQ ID NO: 14), or
[0278] 22nt-ASO: GTAGTGGTATTTCACCGGCGGC (SEQ ID NO: 15).
[0279] These antisense oligonucleotides (ASOs) can also be used:
[0280] TATTTCACCGGCGGCCCGC (SEQ ID NO: 16), GTATTTCACCGGCGGCCCG (SEQ ID NO: 17), GGTATTTCACCGGCGGCCC (SEQ ID NO: 18), TGGTATTTCACCGGCGGCC (SEQ ID NO: 19), GTGGTATTTCACCGGCGGC (SEQ ID NO: 20), AGTGGTATTTCACCGGCGG (SEQ ID NO: 21), TAGTGGTATTTCACCGGCG (SEQ ID NO: 22), GTAGTGGTATTTCACCGGC (SEQ ID NO: 23), AGTAGTGGTATTTCACCGG (SEQ ID NO: 24),
[0281] GAGTAGTGGTATTTCACCG (SEQ ID NO: 25), or
[0282] AGAGTAGTGGTATTTCACC (SEQ ID NO: 26).
[0283] The above antisense oligonucleotides may further comprise one or more modified nucleotides such as locked nucleotides (LNAs), 2’ -ortho-methylated RNA nucleotides, and / or have phosphorotioate bonds that confer resistance against intracellular nucleases.
[0284] Example 2:
[0285] A new therapeutic strategy for lung cancer by using antisense oligonucleotides (ASOs) targeting the 28S rRNA fragment (miLung#l, SEQ ID NO: 1) intracellularly is described herein. Using A-549 cells as a model, this approach led to a significant reduction in the 28S rRNA fragment (miLung#l, SEQ ID NO: 1) levels and decreased cell viability, demonstrating its effectiveness in lowering carcinogenic potential (see example 1).
[0286] In addition to ASOs, two other types of oligonucleotides with identical sequences but differing chemical modifications were evaluated: Target Site Blockers (TSBs) and Power Target Site Blockers (PTSBs). TSBs incorporate 2'-O-methyl modifications and Locked Nucleic Acids (LNAs) distributed throughout their sequence. PTSBs contain a phosphorothioated backbone and LNAs (Table 2).
[0287] Table 2. Sequences of TSBs and PTSBs used to assess miLung#l blocking efficacy. “22 nt” denotes the antisense sequence complementary to miLung#l, while “Sc” refers to scrambled controls — randomized versions of the miLung#l antisense sequence. LNAs are indicated by “+”, 2'-O-methyl modifications by “m”, and phosphorothioated bases by an asterisk Transfection of both TSBs and PTSBs into A549 cells at two concentrations (20 nM and 75 nM) resulted in a marked reduction of miLung#l expression, as quantified by digital PCR (dPCR; FIGURE 8). In contrast, scrambled control oligonucleotides had no measurable effect. These findings further support the therapeutic potential of oligonucleotide-based inhibition of miLung#l in lung cancer.
[0288] REFERENCES
[0289] 1. Tseng, Q., Wang, X., Duchemin-Pelletier, E., Azioune, A., Carpi, N., Gao, J., Filhol, O., Piel, M., Thery, M., & Balland, M. (2012). An ImageJ plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS ONE, 7(7).
[0290] 2. Sikosek T, Horos R, Trudzinski F, Jehn J, Frank M, Rajakumar T, Klotz LV, Mercaldo N, Kahraman M, Heuvelman M, Taha Y, Gerwing J, Skottke J, Daniel- Moreno A, Sanchez -Delgado M, Bender S, Rudolf C, Hinkfoth F, Tikk K, Schenz J, Weigand MA, Feindt P, Schumann C, Christopoulos P, Winter H, Kreuter M, Schneider MA, Muley T, Walterspacher S, Schuler M, Darwiche K, Taube C, Hegedus B, Rabe KF, Rieger-Christ K, Jacobsen FL, Aigner C, Reck M, Bankier AA, Sharma A, Steinkraus BR. Early Detection of Lung Cancer Using Small RNAs. J Thorac Oncol. 2023 Nov;18(l l):1504-1523. doi: 10.1016 / j.jtho.2023.07.005. Epub 2023 Jul 16.
Claims
1. CLAIMS1. A 28S ribosomal RNA (rRNA) region binding molecule for use in medicine, preferably for use in the treatment of lung cancer, wherein the 28S rRNA region comprises a nucleotide sequence according to SEQ ID NO: 1, and wherein the 28 S rRNA region binding molecule binds or at least partially binds to the nucleotide sequence.
2. The 28S rRNA region binding molecule of claim 1, wherein the molecule is an antisense oligonucleotide, a small molecule, preferably a small molecule inhibitor, DNA aptamer, peptide, or protein.
3. The 28S rRNA region binding molecule of claim 2, wherein the antisense oligonucleotide is reverse complementary to the nucleotide sequence according to SEQ ID NO: 1 or at least to a part of the nucleotide sequence according to SEQ ID NO: 1.
4. The 28S rRNA region binding molecule of claim 3, wherein the antisense oligonucleotide comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 14 to SEQ ID NO: 30.
5. The 28 S rRNA region binding molecule of any one of claims 1 to 4, wherein the molecule hinders the function of the 28 S rRNA, the processing of the 28 S rRNA, the folding of the 28S rRNA, the interaction of the 28S rRNA with other RNAs, and / or the interaction of the 28 S rRNA with proteins.
6. The 28S rRNA region binding molecule of any one of claims 1 to 5, wherein the molecule inhibits or prevents the release of the nucleotide sequence according to SEQ ID NO: 1 from the 28S rRNA in the final (processed) form or in the form of precursors, preferably in the form of precursors having a nucleotide sequence according to SEQ ID NO: 4 or any shorter version thereof.
7. The 28S rRNA region binding molecule of any one of claims 1 to 6, wherein the lung cancer is non-small-cell lung carcinoma (NSCLC) or small cell carcinoma (SCLC).
8. A combination comprising a 28S ribosomal RNA (rRNA) region binding molecule as defined in any one of claims 1 to 7 and a drug different from the 28 S rRNA region binding molecule.
9. The combination of claim 8, wherein the drug different from the 28S rRNA region binding molecule is a drug against lung cancer cells.
10. The combination of claims 8 or 9, wherein the drug different from the 28S rRNA region binding molecule, preferably the drug against lung cancer cells, is selected from the group consisting of an immunomodulatory agent and an antibody.
11. The combination of claim 10, wherein the immunomodulatory agent is a checkpoint inhibitor, preferably a checkpoint inhibitor targeting PD-1, PD-L1, PD-L2, or CTLA-4, or an intrinsic checkpoint blockade.
12. A combination of any one of claims 8 to 11 for use in medicine, preferably for use in the treatment of lung cancer.
13. A conjugate comprising a 28s ribosomal RNA (rRNA) region binding molecule as defined in any one of claims 1 to 7 and another molecule.
14. The conjugate of claim 13, wherein the other molecule is covalently linked to the 28S rRNA region binding molecule.
15. The conjugate of claims 13 or 14, wherein the other molecule is a molecule against lung cancer cells.
16. The conjugate of any one of claims 13 to 15, wherein the other molecule, preferably the molecule against lung cancer cells, is an antibody or a toxin.
17. The conjugate of claim 16, wherein the antibody binds a cell surface antigen of a lung cell, preferably of a lung cancer cell.
18. A conjugate of any one of claims 13 to 17 for use in medicine, preferably for use in the treatment of lung cancer.
19. A conjugate of any one of claims 13 to 17 for use in targeted therapy, preferably for use in targeted lung cancer therapy.
20. A pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in any one of claims 1 to 7, the combination of any one of claims 8 to 11, or the conjugate of any one of claims 13 to 17 and a pharmaceutical acceptable carrier.
21. A pharmaceutical composition comprising the 28S ribosomal RNA (rRNA) region binding molecule as defined in any one of claims 1 to 7, the combination of any one of claims 8 to 11, or the conjugate of any one of claims 13 to 17 and a pharmaceutical acceptable carrier for use in medicine, preferably for use in the treatment of lung cancer.
22. A method of determining whether a patient responds to a lung cancer treatment comprising the step of: determining the level of a 28 S ribosomal RNA (rRNA) fragment in a biological sample isolated from the patient, wherein the patient is a patient to whom at least once at least one drug to be used in the lung cancer treatment is, has, or had been administered, and wherein the at least one drug is a 28S ribosomal RNA (rRNA) region binding molecule.
23. The method of claim 22, wherein the 28S rRNA region binding molecule is a molecule as defined in any one of claims 1 to 7.
24. The method of claims 22 or 23, wherein the biological sample is isolated from the patient after at least the first administration of the at least one drug.
25. The method of any one of claims 22 to 24, wherein the level of the 28 S rRNA fragment is compared to a reference level of said 28S rRNA fragment.
26. The method of claim 25, wherein the reference level is the level determined by measuring at least one reference biological sample from at least one subject suffering from lung cancer.
27. The method of claims 25 or 26, wherein the reference level is the level determined in a reference biological sample isolated from the (same) patient prior to the administration of the at least one drug.
28. The method of any one of claims claims 25 to 27, wherein the level of the 28 S rRNA fragment below the reference level indicates that the patient responds to said lung cancer treatment the level of the 28 S rRNA fragment comparable with the reference level indicates that the patient does not respond to said lung cancer treatment, or the level of the 28 S rRNA fragment above the reference level indicates that the patient does not respond to said lung cancer treatment.
29. The method of any one of claims 22 to 28, wherein the lung cancer is non-small-cell lung carcinoma (NSCLC) or small cell lung cancer (SCLC).
30. The method of any one of claims 22 to 29, wherein the patient is a mammal, preferably a human or a rodent.
31. The method of any one of claims 22 to 30, wherein the level of the 28S rRNA fragment is determined by sequencing, preferably next generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectroscopy or any combination thereof.
32. The method of any one of claims 22 to 31, wherein the blood sample is whole blood or a blood fraction.
33. The method of claim 32, wherein the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum.
34. The method of claim 33, wherein the blood cell fraction comprises erythrocytes, leukocytes, and / or thrombocytes.
35. A method of treating lung cancer in a patient comprising the step of administering a 28S ribosomal RNA (rRNA) region binding molecule as defined in any one of claims 1 to 7, a combination as defined in 8 to 11, a conjugate of any one of claims 13 to 17, or a pharmaceutical composition of claim 20 to a patient in need thereof.
Citation Information
Patent Citations
Probe set, kit and application thereof, method for removing ribosome RNA in sample and method for extracting nucleic acid in biological sample
CN116262918A
Amplification of mRNA for distinguishing fetal cells in maternal blood
US5858649A
Background-reducing compounds for probe-mediated in-situ fluorimetric assays
WO1994002642A1
Compositions and methods for treatment of uncontrolled cell growth
WO2008131348A2
Methods to capture and / or remove highly abundant RNAS from a heterogeneous RNA sample
WO2015117163A2