Small nucleic acid interference drugs used to treat lung cancer, pancreatic cancer, liver cancer, and colorectal cancer.

By using small nucleic acid interference drugs targeting GPC3 and/or TGF-β1, combined with RNAi mechanisms and nanoparticle delivery systems, the problems of drug resistance and side effects of existing treatments have been solved, achieving effective treatment for lung cancer, pancreatic cancer, liver cancer, and colorectal cancer.

CN116983322BActive Publication Date: 2026-04-07SIRNAOMICS BIOPHARMACEUTICALS (SUZHOU) CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202311114415.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-09-15
Filing Date
2023-08-31
Publication Date
2026-04-07
Estimated Expiration
2043-08-31

AI Technical Summary

Technical Problem

Existing drugs for treating lung cancer, pancreatic cancer, liver cancer, and colorectal cancer suffer from drug resistance, and traditional treatment methods have a significant impact on patients' quality of life. There is a lack of effective dual-target combination therapy.

Method used

Develop small nucleic acid interference drugs targeting GPC3 and/or TGF-β1, including siRNA molecules, which bind to and degrade the corresponding mRNA through the RNAi mechanism, blocking protein translation, and fabricate nanoparticles using pharmaceutically acceptable delivery carriers such as peptide polymers for the treatment of the aforementioned cancers.

Benefits of technology

It effectively inhibits tumor growth and reduces toxic side effects, showing promising application prospects in the treatment of lung cancer, pancreatic cancer, liver cancer, and colorectal cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses a small nucleic acid interference drug for the treatment of lung cancer, pancreatic cancer, liver cancer, and colorectal cancer. Targeting two tumor-related targets (GPC3 and TGF-β1), this invention designs and screens a dual-target GPC3 / TGF-β1 small nucleic acid interference drug composition, comprising an active ingredient and a pharmaceutically acceptable delivery carrier. The active ingredient includes siRNA molecules targeting the GPC3 gene and siRNA molecules targeting the TGF-β1 gene, or a combination thereof. Experimental data show that the small nucleic acid drug targeting GPC3 alone or in combination with GPC3 and TGF-β1 can effectively knock down the expression levels of related target genes in multiple types of tumor cells and exhibits corresponding tumor growth inhibition effects in in vivo tumor models (lung cancer, pancreatic cancer), demonstrating potential application prospects in the field of tumor treatment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a small nucleic acid interference drug for treating lung cancer, pancreatic cancer, liver cancer and colorectal cancer. BACKGROUND

[0002] Lung cancer, pancreatic cancer, liver cancer and colorectal cancer: incidence and treatment

[0003] Lung cancer (LC) is a common type of cancer worldwide. Lung cancer is mainly divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), of which about 85% is NSCLC; and about 55% of NSCLC is lung adenocarcinoma (LUAD), about 25% is lung squamous cell carcinoma (LUSC), and the rest is large cell carcinoma.

[0004] Early NSCLC mainly relies on surgical treatment, but most NSCLC patients are in the middle and late stages at the time of initial diagnosis, and can only be treated mainly by chemotherapy drugs or radiotherapy; SCLC mainly relies on combined chemotherapy or combined radiotherapy. Targeted drugs represented by tyrosine kinase inhibitors (TKI) are gradually replacing traditional chemotherapy drugs as first-line drugs, but the biggest problem of such drugs is their drug resistance. Currently, the first, second and third generations of TKI targeting EGFR have all shown drug resistance; three drugs approved by FDA in 2021 are only for limited patient types, such as MET exon mutation in advanced NSCLC patients, or PD-L1 high expression (tumor proportion score [TPS] > 50%), and no EGFR, ALK or ROS1 mutation in advanced NSCLC patients, or ALK-positive metastatic non-small cell lung cancer patients; in March 2022, FDA approved a new adjuvant therapy for the first time, Nivolumab (Opdivo, Bristol-Myers Squibb, Chinese name: Nivolumab, PD-1 monoclonal antibody) combined with platinum doublet chemotherapy for neoadjuvant therapy in adult patients with resectable NSCLC. At present, in view of the drug resistance of targeted therapy and the great impact of traditional radiotherapy and chemotherapy on the quality of life of patients, there is an urgent need to develop new types of drugs for treating NSCLC patients without affecting the quality of life of patients.

[0005] Pancreatic cancer is one of the common gastrointestinal malignancies, known as the "King of Cancer". Data shows that the five-year survival rate of pancreatic cancer patients after diagnosis is only about 10%, which is one of the worst prognostic tumors. According to the 2021 statistical data, among all cancers in the United States, the incidence of pancreatic cancer accounts for the 10th in men and the 9th in women, and the mortality rate is the 4th. Although with the development of medicine, imaging, pathology and other disciplines in recent years, the level of diagnosis of pancreatic cancer has improved, but the current treatment methods are still extremely limited, mainly including surgical treatment, radiotherapy, chemotherapy, interventional therapy and best supportive care. Surgery is still the preferred treatment for pancreatic cancer and is generally considered the most effective treatment, such as pancreaticoduodenectomy. Non-surgical treatment techniques are mainly radiotherapy, chemotherapy, targeted therapy, etc., which are commonly used in the treatment of pancreatic cancer. The special challenge of pancreatic cancer treatment is its natural resistance to conventional radiotherapy, chemotherapy and other local regional therapies. Emerging immunotherapy methods including adoptive T cell therapy (ACT), immune checkpoint inhibitors (ICIs) and cancer vaccines have great potential, but their application is severely limited due to the challenges of technology scale-up and standardization.

[0006] Liver cancer is generally divided into two categories: primary and secondary. Primary liver cancer originates from the epithelial or mesenchymal tissue of the liver. The former is called primary liver cancer, which is a highly malignant and extremely dangerous malignant tumor. The latter is called sarcoma, which is less common compared to primary liver cancer. Secondary or metastatic liver cancer refers to malignant tumors originating from multiple organs invading the liver. The main treatment methods currently are surgery, radiotherapy and chemotherapy, biological therapy and traditional Chinese medicine treatment.

[0007] Colorectal cancer is the third most common cancer worldwide in 2020, with over 1.93 million new cases diagnosed globally, accounting for 9.7% of all new cancer cases. The main cause of death in patients is cancer invasion and metastasis. Due to the lack of early diagnosis and efficient screening methods, most patients are diagnosed at an advanced or locally advanced stage, with poor prognosis. The steps of tumor metastasis are multiple and multi-stage, involving many genes and a complex process. For example, the tumor has detached from the primary site and fused with the surrounding stroma, tumor cells have entered the circulatory and lymphatic systems, adhered to the endothelial cell wall, gradually extended to the blood vessels, and formed new metastatic foci. According to the Clinical Practice Guidelines for Colorectal Cancer 2021 released by the Chinese Society of Clinical Oncology (CSCO) in 2021, the current treatment for colorectal cancer is still mainly surgical treatment, combined with adjuvant chemotherapy, monoclonal antibody therapy (such as cetuximab targeting EGFR, bevacizumab targeting VEGF), etc. For patients with postoperative recurrence, only chemotherapy with oxaliplatin or palliative treatment can be used. There is currently no good dual-targeted therapy.

[0008] TGFβ

[0009] The transforming growth factor-β (TGF-β) signaling pathway has a complex mechanism in the body. In advanced cancer, TGF-β is associated with cancer cell proliferation, immune suppression, angiogenesis, and tumor microenvironment. In a study of lung cancer, researchers found that the TGF-β pathway was highly activated in adenocystic tumors, and inhibition of the signaling pathway could inhibit the formation of adenocystic tumors. Studies have shown that the transcription of lncRNA in the nonhomologous end joining (NHEJ) pathway 1 (LINP1) is inhibited by TGF-β1 in a SMAD4-dependent manner, and LINP1 inhibits the epithelial-mesenchymal transition (EMT) of lung cancer cells, which is a key intracellular property of tumor cell migration, invasion, and stemness acquisition during cancer metastasis, thereby controlling cancer cell migration, invasion, and stem cell-free. In addition, studies have shown that in KRAS-mutated NSCLC, KRAS G12V mutation can induce PD-L1 expression and promote immune escape through the TGF-β / EMT signaling pathway, thus targeting the TGF-β / EMT signaling pathway provides a potential treatment for NSCLC patients with KRAS mutations.

[0010] In various cancers, including hepatocellular carcinoma (HCC), TGF-β plays a dual role as both a tumor suppressor and a tumor promoter. Ligand binding to the TGF-β receptor activates its kinase activity, leading to phosphorylation of SMAD proteins and adaptor proteins (such as β2-Spectrin). Once phosphorylated, SMAD proteins form heterodimers, which translocate to the nucleus and regulate the expression of fibrosis-related genes (E-cadherin, integrins, and collagen). In addition to the SMAD cascade, TGF-β can activate multiple pathways, such as MAPK or PI3K. In a genomic analysis of a cohort of 488 HCC patients, 40% showed genomic alterations in the TGF-β signaling pathway. Subsequent assessment of pathways associated with patients exhibiting TGF-β activation revealed that the activated pathways were characterized by a high concentration of genes regulating collagen synthesis, growth factors, cytokines, and matrix metalloproteinases, demonstrating a microenvironmental activation response.

[0011] Currently, several treatment strategies that block TGF-β signal transduction have been put into clinical trials. International pharmaceutical giants such as GSK, Merck, Pfizer, Eli Lilly, Sanofi, and Novartis have all made investments in this area. The results of related clinical trials have also shown that blocking TGF-β is safe and effective in treating refractory cancers such as advanced non-small cell lung cancer, gastric cancer, HPV-related cervical cancer, triple-negative breast cancer, prostate cancer, and cholangiocarcinoma.

[0012] GPC3

[0013] Gypican-3 (GPC3) is a member of the heparan sulfate proteoglycan (HSPG) family. It is an HSPG glycoprotein anchored to the cell membrane by glycosylphosphatidylinositol (GPI). GPC3 is highly expressed in normal embryonic tissues (including the liver and placenta), but its expression is very low or absent in normal adult tissues. Numerous studies have found that GPC3 is specifically highly expressed in liver cancer tissues and is closely related to the prognosis of liver cancer. Related studies have shown that GPC3 is lowly expressed in ovarian cancer, mesothelioma, and breast cancer; upregulation of GPC3 significantly inhibits the proliferation and metastasis of breast cancer cells, indicating that GPC3 plays a tumor suppressor gene role in breast cancer. Conversely, GPC3 is highly expressed in other tumors, such as hepatocellular carcinoma (HCC), Wilms' tumor and neuroblastoma, hepatoblastoma and melanoma, and pulmonary sclerotherapy (SCC). However, the expression pattern of GPC3 in lung cancer remains controversial. Some studies suggest that GPC3 levels in NSCLC are lower than in adjacent or normal lung tissue; other studies indicate that GPC3 is overexpressed in lung adenocarcinoma (LUSC) but low or absent in lung squamous cell carcinoma (LUAD). Current pathway studies suggest that β-catenin, GOLM1, and FOXM1 are directly related to the GPC3 pathway and are associated with chemotherapy sensitivity, poor prognosis, and tumor cell invasion in NSCLC patients.

[0014] Overall, the role of GPC3 in the development and progression of lung cancer remains unclear, and there are currently no GPC3-targeted drugs on the market globally. Targeted therapies against the GPC3 protein mainly include antibodies, antibody-drug conjugates (ADCs), immunotoxins, tumor vaccines, targeting peptides, chimeric antigen receptors, and gene therapy. In recent years, researchers have conducted extensive drug development and cell therapy research targeting GPC3, some of which have entered clinical trials, such as the humanized GPC3 monoclonal antibody GC33, GPC3 peptide vaccines, and chimeric antigen receptor-modified T cells (CAR-T) targeting GPC3. In 2021, the American Society of Clinical Oncology (ASCO) published the first abstract of a fourth-generation CAR-T therapy targeting GPC3 for second-line treatment of liver cancer, with a disease control rate of 50%. This study was the first to report that 4G-CAR-GPC3 T cell therapy alone or in combination with TKIs has manageable safety and shows potential anti-tumor activity in patients with advanced HCC who have received multiple therapies. Summary of the Invention

[0015] The purpose of this invention is to provide a small nucleic acid interference drug for treating one or more types of lung cancer, pancreatic cancer, liver cancer, or colorectal cancer.

[0016] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0017] A small nucleic acid interference drug for treating one or more of lung cancer, pancreatic cancer, liver cancer, or colorectal cancer, wherein the small nucleic acid interference drug comprises a small nucleic acid molecule capable of targeting a single GPC3 target, or the small nucleic acid interference drug comprises a small nucleic acid molecule composition capable of targeting both GPC3 and TGF-β1 targets.

[0018] Preferably, the type of small nucleic acid molecule or the small nucleic acid molecule composition includes one or more of shRNA, ASO, siRNA, miRNA or lncRNA.

[0019] More preferably, the small nucleic acid molecule capable of targeting a single GPC3 target is an siRNA molecule capable of targeting and binding to the mRNA encoding the GPC3 protein and inhibiting its expression.

[0020] More preferably, the small nucleic acid molecule composition capable of targeting both GPC3 and TGF-β1 includes an siRNA molecule capable of targeting and binding to mRNA encoding GPC3 protein and inhibiting its expression, and an siRNA molecule capable of targeting and binding to mRNA encoding TGF-β1 protein and inhibiting its expression.

[0021] Preferably, the lung cancer includes squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and small cell carcinoma; the pancreatic cancer includes pancreatic head carcinoma, pancreatic body carcinoma, pancreatic tail carcinoma, pancreatic cancer, ductal adenocarcinoma, acinar cell carcinoma, serous cystadenocarcinoma, pancreatoblastoma, and mucinous cystadenocarcinoma; the liver cancer includes hepatocellular carcinoma, intrahepatic cholangiocarcinoma, mixed-type liver cancer, and metastatic liver cancer; the colorectal cancer includes ascending colon cancer, descending colon cancer, transverse colon cancer, sigmoid colon cancer, and rectal cancer.

[0022] According to some implementation methods, the siRNA molecule targeting the GPC3 gene is one or more of the following oligonucleotides: The siRNA molecule targeting the GPC3 gene is one or more of the following oligonucleotides:

[0023] GPC3-009#Chain of Justice: GACGUGACCUGAAAGUAUU

[0024] GPC3-009#Answer chain: AAUACUUUCAGGUCACGUC;

[0025] GPC3-019#Chain of Justice: GAGCAGACGUGACCUGAAAGUAUU

[0026] GPC3-019#Answer chain: AAUACUUUCAGGUCACGUCUUGCUC;

[0027] GPC3-050#Chain of Justice: GACGUGACCUGAAAGUAUU

[0028] GPC3-050#Answer chain: AAUACUUUCAGGUCACGUCUU;

[0029] GPC3-051#Chain of Justice: GACGUGACCUGAAAGUAUU

[0030] GPC3-051#Answer chain: AAUACUUUCAGGUCACGUCUU;

[0031] GPC3-052#Chain of Justice: AAGACGUGACCUGAAAGUA

[0032] GPC3-052#Answer chain: UACUUUCAGGUCACGUCUUGC;

[0033] GPC3-053#Chain of Justice: CAAGACGUGACCUGAAAGU

[0034] GPC3-053#Answer chain: ACUUUCAGGUCACGUCUUGCU;

[0035] GPC3-054#Chain of Justice: AAGACGUGACCUGAAAGUAUU

[0036] GPC3-054#Answer chain: AAUACUUUCAGGUCACGUCUUGC;

[0037] GPC3-055#Chain of Justice: CAAGACGUGACCUGAAAGUAU

[0038] GPC3-055#Answer chain: AUACUUUCAGGUCACGUCUUGCU;

[0039] GPC3-056#Chain of Justice: GCAAGACGUGACCUGAAAGUA

[0040] GPC3-056#Answer chain: UACUUUCAGGUCACGUCUUGCUC;

[0041] GPC3-057#Chain of Justice: AGCAAACGUGACCUGAAAGU

[0042] GPC3-057#Answer chain: ACUUUCAGGUCACGUCUUGCUCC;

[0043] GPC3-058#Chain of Justice:

[0044] GmAmGmCmAmAmGmAmCmGmUmGmAfCfCfUmGmAmAmAmGmUmAmUmUm

[0045] GPC3-058# Antichain:

[0046] AmAfUmAmCmUmUmUmCmAmGmGmUmCfAmCmGmUmCmUmUmGmCmUmCm;

[0047] GPC3-059# Justice Chain: GmAmCmGmUmGmAfCfCfUmGmAmAmAmGmUmAmUmUm GPC3-059# Antisense Chain:

[0048] AmAfUmAmCmUmUmUmCmAmGmGmUmCfAmCmGmUmCmUmUm;

[0049] GPC3-060# Justice Chain: AmGmAmCmGmUmGfAfCfCmUmGmAmAmAmGmUmAmUm GPC3-060# Antisense Chain:

[0050] AmUfAmCmUmUmUmCmAmGmGmUmCmAfCmGmUmCmUmUmGm;

[0051] GPC3-061# Justice Chain: AmAmGmAmCmGmUfGfAfCmCmUmGmAmAmAmGmUmAm GPC3-061# Antisense Chain:

[0052] UmAfCmUmUmUmCmAmGmGmUmCmAmCfGmUmCmUmUmGmCm;

[0053] GPC3-063#Chain of Justice:

[0054] AmAmGmAmCmGmUmGmAfCfCfUmGmAmAmAmGmUmAmUmUm

[0055] GPC3-063# Antichain:

[0056] AmAfUmAmCmUmUmUmCmAmGmGmUmCfAmCmGmUmCmUmUmGmCm;

[0057] GPC3-064#Chain of Justice:

[0058] CmAmAmGmAmCmGmUmGfAfCfCmUmGmAmAmAmGmUmAmUm

[0059] GPC3-064# Escape Chain:

[0060] AmUfAmCmUmUmUmCmAmGmGmUmCmAfCmGmUmCmUmUmGmCmUm;

[0061] GPC3-065#Chain of Justice:

[0062] GmCmAmAmGmAmCmGmUfGfAfCmCmUmGmAmAmAmGmUmAm

[0063] GPC3-065# Antichain:

[0064] UmAfCmUmUmUmCmAmGmGmUmCmAmCfGmUmCmUmUmGmCmUmCm;

[0065] GPC3-067#Chain of Justice: GmAmCmGmUmGmAfCfCfUmGmAmAmAmGmUmAmUmUm

[0066] GPC3-067#Answer chain: AmAfUmAmCmUmUmUmCmAmGmGmUmCfAmCmGmUmCm.

[0067] According to some implementation methods, the siRNA molecule targeting the TGF-β1 gene is one or more of the following oligonucleotides:

[0068] TF1-013#Chain of Justice: CCCAAGGGCUACCAUGCCAACUUCU

[0069] TF1-013#Answer chain: AGAAGUUGGCAUGGUAGCCCUUGGG;

[0070] TF1-029#Chain of Justice: AACUAUUGCUUCAGCUCCAdTdT

[0071] TF1-029#Answer chain: UGGAGCUGAAGCAAUAGUUdTdT;

[0072] TF1-043#Chain of Justice: AmAmCmUmAmUmUfGfCfUmUmCmAmGmCmUmCmCmAmdTdT

[0073] TF1-043# Antisense Chain: UmGfGmAmGmCmUmGmAmAmGmCmAmAfUmAmGmUmUmdTdT; TF1-039# Justice Chain: AmGmGmGmCmUmAmCmCfAfUfGmCmCmAmAmCmUmUmCmUm TF1-039# Antisense Chain:

[0074] AmGfAmAmGmUmUmGmGmCmAmUmGmGfUmAmGmCmCmCmUmUmGm.

[0075] Where m represents 2'-OME modification and f represents 2'-F modification.

[0076] Preferably, the small nucleic acid interference drug further includes a pharmaceutically acceptable delivery carrier.

[0077] More preferably, the delivery carrier is one or more of a pharmaceutically acceptable polypeptide polymer, lipid carrier, or cationic polymer.

[0078] More preferably, the polypeptide polymer comprises a histidine-lysine branched polypeptide polymer.

[0079] Specifically, the delivery carrier is an H3K4b type histidine-lysine polymer.

[0080] According to some embodiments, the polypeptide polymer includes H3K4b having four molecules R, R = KHHHKHHHKHHHKHHHK, abbreviated as HKP.

[0081] According to some embodiments, the polypeptide polymer comprises H3K(+H)4b having four branches R1, R1=KHHHKHHHKHHHHKHHHK, abbreviated as HKP(+H).

[0082] Preferably, the mass ratio of the siRNA molecule targeting the GPC3 gene to the siRNA molecule targeting the TGF-β1 gene is 1:(0.8-1.2), for example, 1:0.8, 1:0.9, 1:1, 1:1.1, 1:1.2.

[0083] Preferably, the N / P value of the delivery vector and the small nucleic acid molecule or the small nucleic acid molecule composition is 2 / 1 to 6 / 1, for example 2 / 1, 3 / 1, 4 / 1, 5 / 1, 6 / 1.

[0084] Preferably, the small nucleic acid interference drug is a nanoparticle.

[0085] Furthermore, the size of the nanoparticles is 50–200 nm, for example, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm, 190 nm, 195 nm, and 200 nm.

[0086] Preferably, the dosage form of the small nucleic acid interference drug is a lyophilized agent.

[0087] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0088] The GPC3 single-target small nucleic acid interference drug and the GPC3 and TGF-β1 small nucleic acid interference drug developed in this invention can effectively inhibit tumor growth and have no obvious toxic side effects. They can be used to treat lung cancer, pancreatic cancer, liver cancer and colorectal cancer, and have great application prospects. Attached Figure Description

[0089] Figure 1 Figure A shows the expression of the GPC3 gene in human and mouse cell lines, while Figure B shows the expression of the GPC3 gene in human cell lines.

[0090] Figure 2 For the preparation of siGPC3 drug formulations, the left figure shows the lyophilized formulation, and the right figure shows the reconstituted formulation;

[0091] Figure 3 The silencing effect of siRNA on target genes after being loaded onto different delivery vectors;

[0092] Figure 4 The inhibitory effect of siGPC3 drug formulation on the growth of mouse lung cancer cell (A549) xenograft volume;

[0093] Figure 5 The effect of siGPC3 drug formulation on the inhibition of tumor weight growth in mouse lung cancer cells (A549);

[0094] Figure 6 The effect of siGPC3 drug formulation on body weight in A549 tumor-bearing mice;

[0095] Figure 7The inhibitory effect of siGPC3+siTGF-β1 drug formulation on the growth of mouse lung cancer cell (A549) xenograft volume;

[0096] Figure 8 The inhibitory effect of siGPC3+siTGF-β1 drug formulation on the growth of tumor weight in mouse lung cancer cells (A549);

[0097] Figure 9 The effect of the siGPC3+siTGF-β1 drug formulation on the body weight of A549 tumor-bearing mice;

[0098] Figure 10 The inhibitory effect of the siGPC3+siTGF-β1 drug formulation on the growth of mouse pancreatic cancer cell (PANC-1) xenograft volume;

[0099] Figure 11 The inhibitory effect of the siGPC3+siTGF-β1 drug formulation on the growth of tumor weight in mouse pancreatic cancer cells (PANC-1);

[0100] Figure 12 The effect of siGPC3+siTGF-β1 drug formulation on body weight of PANC-1 tumor-bearing mice;

[0101] Figure 13 The inhibitory effect of the siGPC3-212 / siTGFβ1 drug formulation on the growth of mouse pancreatic cancer cell (PANC-1) xenograft volume;

[0102] Figure 14 The effect of the siGPC3-212 / siTGFβ1 drug formulation on the body weight of PANC-1 tumor-bearing mice. Detailed Implementation

[0103] The present invention will be further described below with reference to embodiments. However, the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific applications, and the implementation conditions not specified are conventional conditions in the industry. The technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other.

[0104] After extensive research and experimental verification, the inventors proposed a single-target small nucleic acid interference drug that can target the tumor microenvironment target (GPC3) and a dual-target small nucleic acid interference drug that simultaneously targets the tumor microenvironment target (GPC3) and the tumor transformation and metastasis-related target (TGF-β1).

[0105] Specifically, the small nucleic acid interference drug composition comprises an active ingredient and a pharmaceutically acceptable delivery carrier, wherein the active ingredient comprises an siRNA molecule targeting the GPC3 gene, or simultaneously comprises an siRNA molecule targeting the GPC3 gene and an siRNA molecule targeting the TGF-β1 gene.

[0106] Among them, the siRNA sequence targeting the GPC3 gene can theoretically bind to and degrade GPC3 mRNA in target cells through the RNAi mechanism, thereby blocking the translation level of its protein and inhibiting the expression of GPC3 protein.

[0107] Theoretically, siRNA sequences targeting the TGF-β1 gene can bind to and degrade TGF-β1 mRNA in target cells through the RNAi mechanism, thereby blocking the translation of the protein and inhibiting the expression of TGF-β1.

[0108] This invention employs a specific algorithm and programming containing several parameters to design a series of siRNA sequences targeting the TGF-β1 and GPC3 genes. The siRNA molecules targeting the GPC3 gene and the siRNA molecules targeting the TGF-β1 gene are oligonucleotide sequences with a length of 19 to 25 base pairs.

[0109] Preferably, the siRNA molecules targeting the GPC3 gene and the siRNA molecules targeting the TGF-β1 gene are 21 to 25 base pairs in length, respectively.

[0110] Specifically, the delivery carrier is HKP or HKP(+H).

[0111] Specifically, using PNP technology, siRNA molecules targeting the GPC3 gene and siRNA molecules targeting the TGF-β1 gene are encapsulated into HKP or HKP+H (histidine-lysine polymer) carriers to prepare nanoparticle formulations.

[0112] Specifically, the molar ratio of the siRNA molecule targeting the GPC3 gene to the siRNA molecule targeting the TGF-β1 gene is 1:0.8 to 1.2, and the N / P value of the active ingredient and the delivery vector is 1 / 3 to 1 / 2.

[0113] This invention utilizes PNP technology to encapsulate and deliver siRNA targeting GPC3, or delivers siRNA targeting both GPC3 and TGF-β1 (TF1) in combination, which can significantly inhibit the growth of lung cancer and pancreatic cancer tumors in mice, showing potential application prospects in the treatment of lung cancer and pancreatic cancer.

[0114] The technical solutions and effects of the present invention are illustrated in detail below through specific examples.

[0115] In this invention, the delivery carrier PNP technology is described in the patent: Composition and Method of Controllable Coupled Peptide Nanoparticle Delivery System for Nucleic Acid Therapy (Patent No.: CN 112703196 A).

[0116] Example 1:

[0117] siRNA sequences were designed targeting two sites (GPC3 and TGF-β1).

[0118] A specific algorithm and programming with several parameters were used to design a series of siRNA sequences targeting the GPC3 and TGF-β1 genes. These sequences included siRNA sequences of 25, 21, and 19 base pairs in length, as shown in Table 1. The characteristics of these sequences include, but are not limited to, targeting the gene coding sequence, reasonable thermodynamic stability, and low expected toxicity. Theoretically, the siRNA sequence targeting the GPC3 gene can bind to and degrade GPC3 mRNA in target cells through an RNAi mechanism, thereby blocking the translation of the protein and inhibiting GPC3 protein expression. Similarly, the siRNA sequence targeting the TGF-β1 gene can theoretically bind to and degrade TGF-β1 mRNA in target cells through an RNAi mechanism, thereby blocking the translation of the protein and inhibiting TGF-β1 protein expression.

[0119] Table 1. siRNA sequences targeting GPC3 and TGF-β1

[0120]

[0121]

[0122]

[0123] Example 2:

[0124] In vitro screening of cell lines with high GPC3 gene expression

[0125] The expression of the GPC3 gene in various human and mouse cell lines was identified using qPCR. The results of GPC3 gene expression in the cell lines are shown below. Figure 1 The specific candidate cell lines selected include human (Homo spp.) Figure 1-A): BxPC3, PANC-1, HepG2, Hep3B, SK-Hep-1, Huh7, A549, H292, H460, U87, Hela, KU7, MCF7, MDA-MB-231, HeyA8, sk-ov-3, ES-2, A431, DLD-1; mouse source (Mus, Figure 1 -B): B16F0, B16F10, RM-1, DC24, PANC-02, MC38, 4T1, RM-1, Hepa 1-6, LLC, ID8. Candidate cell lines with Ct values ​​less than 30 were selected for subsequent in vitro screening, based on... Figure 1 The results shown indicate that the cell lines ultimately used for subsequent screening were: hepatocellular carcinoma cell lines (HepG2, Hep3B, and Hepa1-6), breast cancer cell lines (MCF7, MDA-MB-231), human lung cancer cell lines (A549, H292), human colorectal cancer cell lines (DLD-1), and human pancreatic cancer cell lines (PANC-1, BxPC3). Figure 1 The absence of bar chart markers in some cell lines indicates that the expression level of the GPC3 gene in these cell lines is extremely low and does not reach the range of qPCR detection.

[0126] Example 3:

[0127] In vitro screening of siRNA sequences targeting the GPC3 gene (cell-level screening)

[0128] For the GPC3 target gene, some cell lines (Hep3B, Hepa1-6, MCF7, A549, DLD-1, PANC-1) selected in Example 2 were used for in vitro screening of siRNA. Specifically, 20 nM GPC3 siRNA was transfected into cells using a transfection reagent (Lipo2000). After 24 h, total RNA was collected for reverse transcription, and the mRNA expression level of the target gene was detected using qPCR. The knockdown effect of GPC3 siRNA on the initial screening of GPC3 mRNA expression level is shown in Table 2.

[0129] Table 2. Preliminary screening of GPC3 siRNA in related experiments (detection of relative expression levels of GPC3 mRNA)

[0130]

[0131]

[0132]

[0133] Note: Hepa1-6 is a mouse cell line, and only human-mouse homologous sequences were screened.

[0134] According to Table 2, GPC3-006# and GPC3-007# achieved a knockdown effect of over 80% on GPC3 mRNA in the Hep3B liver cancer cell line; GPC3-009#, GPC3-029#, and GPC3-032# also achieved a knockdown effect of nearly 80% on GPC3 mRNA in the Hepa1-6 liver cancer cell line; while in the A549 lung cancer cell line and the PANC-1 pancreatic cancer cell line, most GPC3 siRNA sequences showed similarly good knockdown effects; GPC3-019#, GPC3-023#, and GPC3-028# achieved a knockdown effect of over 70% on GPC3 mRNA in the DLD-1 colorectal cancer cell line; and GPC3-003# and GPC3-009# achieved a knockdown effect of over 70% on GPC3 mRNA in the MCF7 human breast cancer cell line. Finally, based on the knockdown effect, GPC3 siRNAs of different lengths were selected as candidate sequences. For the murine hepatocellular carcinoma cell line Hepa1-6, the selected sequences were GPC3-009#, GPC3-029#, and GPC3-032#; for the human hepatocellular carcinoma cell line Hep3B, the selected sequences were GPC3-006#, GPC3-007#, and GPC3-019#; and for the human lung cancer cell line A549, the selected sequences were GPC3-002#, GPC3-006#, GPC3-009#, GPC3-017#, GPC3-019#, GPC3-020#, GPC3-023#, and GPC3-023#. The sequences selected for screening the human pancreatic cancer cell line PANC-1 are GPC3-007#, GPC3-008#, GPC3-009#, GPC3-019#, GPC3-020#, GPC3-031#, and GPC3-032#; the sequences selected for screening the human colon cancer cell line DLD-1 are GPC3-019#, GPC3-023#, and GPC3-028#; and the sequences selected for screening the human breast cancer cell line MCF7 are GPC3-003# and GPC3-009#.

[0135] EC50 assays were performed on the candidate GPC3 siRNAs. 100 nM was used as the high-concentration experimental group, and 5-fold serial dilutions were performed. Seven concentration gradient experimental groups were set up for cell transfection. After 24 h, total RNA from cells was collected and subjected to reverse transcription and qPCR to obtain the effective concentration (EC50) of the half-maximal target gene knockdown effect. The results are shown in Table 3.

[0136] Table 3. EC50 data in different cell lines

[0137]

[0138]

[0139] Table 3 shows that the EC50 values ​​of all candidate sequences were less than or equal to 10 nM in all six cell lines. GPC3-009# and GPC3-019# showed the best EC50 values ​​in hepatocellular carcinoma cells, with GPC3-009# having an EC50 value of 2.19 nM in Hepa1-6 and GPC3-019# having an EC50 value of 2.64 nM in Hep3B. Furthermore, GPC3-009# and GPC3-019# demonstrated good knockdown effects in the other four cell lines. No EC50 value was detected for GPC3-019# in the MCF7 cell line, and this cell line will not be used for further analysis.

[0140] Example 4:

[0141] EC50 assay of optimized and modified GPC3 siRNA and TGF-β1 siRNA sequences

[0142] siRNA sequences (GPC3-009# and GPC3-019#) that showed good knockdown effects in various cell lines (Hepa1-6, Hep3B, A549, PANC-1, and DLD-1) were selected and their sequences were optimized and modified. For TGF-β1 siRNA, the sequences selected in previous experiments (21-mer TF1-029# and 25-mer TF1-013#) were further modified as shown in Table 4. Specifically, for GPC3-009#, the modified sequence is (GPC3-067#); for GPC3-019#, the optimized sequence includes GPC3-(050#-057#), and the optimized and modified sequence includes GPC3-(058#-066#); for TF1-029#, the modified sequence is TF1-039#, and for TF1-013#, the modified sequence is TF1-043#.

[0143] Table 4. Optimized and modified GPC3 siRNA and TGF-β1 siRNA

[0144]

[0145]

[0146] Note: m indicates 2'-OME modification, and f indicates 2'-F modification.

[0147] The EC50 values ​​(siRNA concentration at which GPC3 mRNA silencing effect reaches 50%) of the above-mentioned optimized and modified GPC3 siRNA sequences in A549 cells are shown in Table 5.

[0148] Table 5. EC50 values ​​of sequences before and after GPC3 optimization and modification

[0149]

[0150] Table 5 shows that the EC50 values ​​of many optimized or modified sequences were lower than those of the original sequences, indicating better knockdown effects. Specifically, the EC50 values ​​of GPC050# and GPC3-051# were lower than those of the original sequences in all five cell lines, and the EC50 values ​​of GPC3-059#, GPC3-060#, GPC3-063#, and GPC3-064# were all less than 1 nM. The gene knockdown effects of GPC3-062# and GPC3-066# were poor, and their EC50 values ​​were not recorded in Table 5.

[0151] The EC50 values ​​(concentrations of siRNAs that achieve a 50% silencing effect on TGF-β1 mRNA) of the screened and modified TGF-β1 siRNA sequences against SK-Hep1 are shown in Table 6.

[0152] Table 6. EC50 values ​​of TGF-β1 sequences before and after optimization and modification

[0153] Number EC50 values in SK-Hep1 (nM) TF1-013# 2.11 TF1-039# (modified sequence of TF1-013#) 3.84 TF1-029# 0.24 TF1-043# (modified sequence of TF1-029#) 0.3

[0154] Table 6 shows that the knockdown effect of the target gene before and after the two sequences were similar. Therefore, the combination of unmodified siRNA (TF1-029# or TF1-013#) and GPC3 siRNA was preferred for subsequent in vivo animal experiments.

[0155] Example 5:

[0156] Preparation and Identification of Nanomedicine Formulations

[0157] GPC3-019# was selected and mixed with the peptide carrier (HKP(+H)) to form a stable nanoparticle formulation, denoted as siGPC3; GPC3-019# and TF1-013# were selected and mixed in a 1:1 ratio (mass ratio) with the peptide carrier (HKP(+H)) to form a stable nanoparticle formulation, denoted as siGPC3+siTGF-β1; GPC3-051# and TF1-029# were selected and mixed in a 1:1 ratio (mass ratio) with the peptide carrier (HKP(+H)) to form a stable nanoparticle formulation, denoted as siGPC3-212 / siTGF-β1, for in vivo pharmacodynamic validation. In this embodiment, information on raw materials, excipients, and formulation parameters is shown in Tables 7 and 8. The finished product is shown below. Figure 2 The images show the GPC3 siRNA lyophilized formulation (left) and the reconstituted formulation (right).

[0158] Table 7. Information on small nucleic acids and vectors used in in vivo pharmacodynamic validation

[0159]

[0160] Table 8. Key parameter information of small nucleic acid drug formulations used in in vivo pharmacodynamic validation

[0161]

[0162]

[0163] Example 6:

[0164] The silencing effect of siRNA on target genes by different delivery vectors (cellular level)

[0165] Figure 3 The knockdown effects of different delivery vectors on the GPC3 gene in lung cancer A549 cells were investigated. We used lipo2000 as a positive control delivery vector; lipo2000 is only used for in vitro cell transfection and not for in vivo use. Liposome LNP and peptide vector HKP(+H) were used as two different delivery systems to deliver siRNA into the cells. Total RNA was collected from the cells after 24 hours, and the qPCR results are shown below. Figure 3 Both the LNP / siGPC3 and HKP(+H) / siGPC3+siTGF-β1 groups showed significant knockdown of GPC3 gene expression. Specifically, the 100nM LNP / siGPC3 group achieved a 90% knockdown of GPC3 gene expression, while the 400nM HKP(+H) / siGPC3+siTGF-β1 group achieved a 70% knockdown of GPC3 gene expression.

[0166] Example 7:

[0167] In vivo pharmacodynamic validation (mouse model of lung cancer A549 cell xenograft tumor)

[0168] The pharmacodynamic activity of siGPC3 in inhibiting tumor growth was verified through pharmacodynamic experiments using a mouse xenograft tumor model (lung cancer cells A549). The experiment involved subcutaneous inoculation of BALB / c Nude mice with A549 cells (5 × 10⁻⁶ cells per cell line). 6 Modeling was performed in groups of 8 mice, with siGPC3 nanoparticles administered via tail vein injection (iv) at a dose of 2 mg / kg, every 3 days for 8 doses. Results showed that, compared to the control group, after multiple administrations, siGPC3 nanoparticles significantly inhibited the growth of lung cancer xenografts in mice. The tumor volume (tumor volume = 1 / 2 × major axis × minor axis) in the single-drug group was significantly higher than that in the model control group. 2 There is a decrease () Figure 4 -); The tumor weight decreased in the single-drug group, with a statistically significant difference (**P<0.01)( Figure 5 The mice's own body weight did not differ significantly from the control group (vehicle) during the experiment, indicating that the siGPC3 nanoparticle drug had no significant toxic side effects. Figure 6 ).

[0169] Example 8:

[0170] In vivo pharmacodynamic validation (mouse model of lung cancer A549 cell xenograft tumor)

[0171] The pharmacodynamic activity of siGPC3+siTGF-β1 in inhibiting tumor growth was verified using a mouse xenograft tumor model (lung cancer cells A549). The experiment involved subcutaneous inoculation of BALB / c Nude mice with A549 cells (5 × 10⁻⁶ cells per cell line). 6 In a modeling study, eight mice were administered the drug via tail vein injection (iv) at a dose of 2 mg / kg, every three days for eight administrations. Results showed that, compared to the control group, after multiple administrations, the siGPC3+siTGFβ1 nanoparticle drug significantly inhibited the growth of xenografts in mouse lung cancer. The tumor volume in the siGPC3+siTGFβ1-treated group was significantly smaller than that in the model control group (vehicle). Figure 7 It was significantly superior to the positive control drug gemcitabine (GemZar), and the tumor growth inhibition rate (TGItv) reached over 40% from day 9 (Table 9); the tumor weight was reduced in the siGPC3+siTGFβ1 treatment group, with a statistically significant difference (*P<0.05). Figure 8 The tumor weight inhibition rate (TGItw) reached 40% (Table 10). The mouse body weight showed no significant difference compared to the control group (vehicle) during the experiment, indicating that the siGPC3+siTGFβ1 nanoparticle drug had no significant toxic side effects.Figure 9 Relevant calculation formulas:

[0172]

[0173]

[0174] Vnt: Tumor volume of mouse numbered n on day t;

[0175] Vn0: Tumor volume of mouse numbered n on day 0;

[0176] RTVn: Relative tumor volume of mouse number n on day t;

[0177] meanRTVtreat: The average RTV in the treatment group;

[0178] meanRTVvehicle: The average RTV of the Vehicle group.

[0179]

[0180] meanTW treat: The average tumor weight of mice in the treatment group at the endpoint treatment;

[0181] meanTW vehicle: The average tumor weight of mice in the Vehicle group at the endpoint treatment.

[0182] Table 9. Inhibition rate of drug on A549 tumor volume initiation

[0183]

[0184] Table 10. Inhibition rate of drug on A549 tumor weight

[0185]

[0186] Example 9:

[0187] In vivo pharmacodynamic validation (mice model of pancreatic cancer PANC-1 cell xenograft tumor)

[0188] Pharmacodynamic experiments were conducted using a mouse xenograft tumor model (pancreatic cancer cells PANC-1) to verify the inhibitory activity of siGPC3 and siGPC3+siTGFβ1 on tumor growth. The experiment involved subcutaneous inoculation of PANC-1 cells (1×10⁻⁶ cells) into BALB / c Nude mice. 7In a modeling study, eight mice were used in each group. The mice were administered the drug via tail vein injection (iv), 3 mg / kg, every 3 days for 8 doses, followed by a period of observation. Results showed that, compared to the control group, after multiple administrations, the siGPC3+siTGFβ1 nanoparticle drug significantly inhibited the growth of pancreatic cancer xenografts in mice. Compared to the model control group (vehicle), tumor growth was slower in both the siGPC3 monotherapy and siGPC3+siTGFβ1 treatment groups. Figure 10 After the last dose on day 22, the drug was discontinued. Six days after discontinuation (day 28), the tumor growth inhibition rate of siGPC3 monotherapy reached 35%, and that of the siGPC3+siTGFβ1 group reached 40%. The efficacy decreased slightly on days 9 (day 31) and 12 (day 34) after discontinuation (Table 11), but still showed inhibitory effects. The average tumor weight in the siGPC3 monotherapy and siGPC3+siTGFβ1 groups was lower than that in the control group. Figure 11 After 12 days of drug withdrawal, the tumor weight inhibition rate in the siGPC3+siTGFβ1 group was 31% (Table 12). The mouse body weight showed no significant difference compared to the control group (vehicle) during the experiment, indicating that the siGPC3+siTGFβ1 nanoparticle drug had no significant toxic side effects. Figure 12 ).

[0189] Table 11. Inhibition rate of drug on PANC-1 tumor volume growth

[0190]

[0191] Table 12. Inhibition rate of drug on PANC-1 tumor weight

[0192]

[0193] Example 10:

[0194] In vivo pharmacodynamic validation (mice model of pancreatic cancer PANC-1 cell xenograft tumor)

[0195] The pharmacodynamic activity of siGPC3-212 / siTGFβ1 in inhibiting tumor growth was verified by using a mouse xenograft model (pancreatic cancer cells PANC-1). The experiment involved subcutaneous inoculation of PANC-1 cells (5 × 10⁻⁶ cells) into BALB / c Nude mice. 6 Modeling was performed on 8 mice per group, and the tumors were allowed to grow to an average volume of 150 mm². 3At approximately 3:00 PM, siGPC3-212 / siTGFβ1 and siNC were injected via the tail vein at a dose of 3 mg / kg. siNC is a sequence that does not induce any gene silencing; the sense strand of the siNC sequence is 5'-UUCUCCGAACGUGUCACGUdTdT, and the antisense strand is ACGUGACACGUUCGGAGAAdTdT. The positive control, gemcitabine (GemZar), was administered intraperitoneally (ip) at a dose of 60 mg / kg. All drugs were administered every 3 days for a total of 8 doses. Results showed that, compared to the control group, after multiple administrations, the siGPC3-212 / siTGFβ1 nanoparticle drug inhibited the growth of pancreatic cancer xenografts in mice. Compared to the model control group (vehicle) and the negative control group (siNC), tumor growth was slower in the siGPC3-212 / siTGFβ1 and GemZar groups. Figure 13 The inhibitory effect of siGPC3-212 / siTGFβ1 on PANC-1 tumors was comparable to that of GemZar. Mouse body weight showed no significant difference relative to the control group (vehicle) during the experiment, while the GemZar group showed a decrease in relative body weight. The results indicate that the siGPC3-212 / siTGFβ1 nanoparticle drug had no significant toxic side effects. Figure 14 ).

[0196] Based on the experimental data above, it can be seen that encapsulating and delivering single-target (siGPC3) or dual-target (siGPC3+siTGFβ1, siGPC3-212 / siTGFβ1) small nucleic acid drugs using PNP technology has potential application prospects in the treatment of various solid tumors.

[0197] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A small nucleic acid interference drug for treating lung cancer, characterized in that, It includes an siRNA molecule capable of targeting and binding to mRNA encoding the GPC3 protein and inhibiting its expression, and a pharmaceutically acceptable delivery vector, wherein the siRNA molecule includes GPC3-051#, the sense strand of GPC3-051# being the nucleotide sequence shown in SEQ ID No. 98, and the antisense strand of GPC3-051# being the nucleotide sequence shown in SEQ ID No.

118.

2. The small nucleic acid interference drug according to claim 1, characterized in that, It also includes an siRNA molecule capable of targeting and binding to the mRNA encoding TGF-β1 protein and inhibiting its expression. The siRNA molecule capable of targeting and binding to the mRNA encoding TGF-β1 protein and inhibiting its expression is TGF-029#. The sense strand of TGF-029# is the nucleotide sequence shown in SEQ ID No. 48, and the antisense strand of TGF-029# is the nucleotide sequence shown in SEQ ID No.

96.

3. The small nucleic acid interference drug according to claim 1, characterized in that, The lung cancers mentioned include squamous cell carcinoma, adenocarcinoma, large cell carcinoma, and small cell carcinoma.

4. The small nucleic acid interference drug according to claim 1, characterized in that, The delivery carrier is a pharmaceutically acceptable polypeptide polymer, including histidine-lysine branched polypeptide polymers.

5. The small nucleic acid interference drug according to claim 4, characterized in that, The polypeptide polymers include H3K4b with four branches R, R=KHHHKHHHKHHHKHHHK, and / or H3K(+H)4b with four branches R1, R1=KHHHKHHHKHHHKHHHK.

6. The small nucleic acid interference drug according to claim 2, characterized in that, The mass ratio of the siRNA molecule that can target and bind to the mRNA encoding GPC3 protein and inhibit its expression to the siRNA molecule that can target and bind to the mRNA encoding TGF-β1 protein and inhibit its expression is 1:(0.8~1.2).

7. The small nucleic acid interference drug according to claim 1, characterized in that, The N / P value of all small nucleic acid molecules in the delivery carrier and the small nucleic acid interference drug is 2 / 1 to 6 / 1.

8. The small nucleic acid interference drug according to claim 1, characterized in that, The small nucleic acid interference drug is a nanoparticle, and / or the dosage form of the small nucleic acid interference drug is a lyophilized agent.

Citation Information

Patent Citations

  • Composition and methods of controllable co-coupling polypeptide nanoparticle delivery system for nucleic acid therapeutics

    CN112703196A

  • Methods and compositions for combination rnai therapeutics

    CN101044152A

  • Composition for treating eye diseases by double-target / multi-target small nucleic acid and applications of composition

    CN103007291A

  • Silencing TGF-BETA 1 and COX2 to treat cancer using siRNA delivered in combination with immune checkpoint inhibitors

    CN114144423A

  • Double-stranded molecule inhibiting the expression of GPC3

    WO2010113507A1