Detection of viral infections using ddhc-specific aptamers
The use of ddhC-specific binding members like aptamers for detecting 3'-deoxy-3',4'-didehydro-cytidine addresses the limitations of current viral infection diagnosis methods, providing rapid and accurate differentiation and real-time monitoring of viral infections.
Patent Information
- Application Number
- PCT/GB2025/051690
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-30
- Filing Date
- 2025-07-29
- Publication Date
- 2026-02-05
AI Technical Summary
Current methods for diagnosing viral infections are time-consuming, insensitive, and often lead to inappropriate antimicrobial prescriptions due to similarities in symptoms with bacterial infections, and lack rapid, accurate tools for differentiating between viral and bacterial causes, especially in conditions like viral meningitis, which can be caused by multiple strains.
The use of ddhC-specific binding members, such as aptamers, to detect the viral biomarker 3'-deoxy-3',4'-didehydro-cytidine (ddhC) in fluid samples, which is present in elevated levels during active viral infections, allowing for rapid and accurate diagnosis without the need for labelling or complex equipment.
Enables rapid, cost-effective, and accurate differentiation between viral and non-viral infections, facilitating real-time monitoring and appropriate therapeutic decisions, particularly in cases of viral meningitis and pandemic situations.
Smart Images

Figure GB2025051690_05022026_PF_FP_ABST
Abstract
Description
VIRAL INFECTIONSSEQUENCE LISTINGThe present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled P78016WO Sequence Listing, created on 24 July, 2025, which is 384 kB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases.FIELDThe invention relates generally to the field of viral infections. In particular, the invention is directed to methods for diagnosing viral infections. The invention enables the detection of a viral biomarker and this is useful in diagnosing viral infection. Kits and devices for carrying out such methods are provided. In addition, methods for generating compounds used in the methods, kits, and devices of the invention are provided.BACKGROUNDIt is currently difficult for doctors to rapidly distinguish between patients with viral and bacterial infections due to the similarities in symptoms. Conventional methods for diagnosing viral infection relying on pathogen identification through culture, polymerase chain reaction (PCR) or antigen detection are time-consuming and / or insensitive, leading to diagnostic delays that result in inappropriate antimicrobial prescription and infection transmission. Consequently, antibiotics (which only work on bacterial infections) are frequently overprescribed which drives worsening bacterial resistance to antibiotics.Currently used methods for diagnosing viral infection relying on PCR often take several months to develop (as seen during the COVID-19 pandemic). Viral PCR tests that are commonly relied on by clinicians are also slow and take days to return a result, requirecomplex laboratory set-ups, and can only show a positive result for the specific virus tested (i.e. each virus requires its own specific PCR test). This is particularly problematic in the case of diseases that can be caused by multiple viral strains. Some medical conditions e.g. meningitis (infection of brain lining) can be caused by viruses, but also by bacteria and fungi, all of which should be treated very differently. A rapid test for a biomarker that is common to infections caused by different viral meningitis strains would therefore help diagnose viral meningitis much more rapidly, cover all viral infections in e.g. viral meningitis, and would not require a complicated lab set-up.Current methods of diagnosing viral infections e.g. viral PCR tests detect remnants of old infections, and often display a positive result even when a patient does not have an active viral infection. A method for diagnosing an active viral infection in a subject would therefore have clear advantages over current diagnostic methods.There is a clear need to monitor the recovery of patients suffering from viral infections in real time while undergoing treatment. A method for diagnosing a viral infection that is capable of detecting changes in infection severity in real time would clearly be advantageous.Rapid detection of viral infections in livestock, where separation of subjects from a general population is impractical, would be highly beneficial. Current poor surveillance of viral infection frequently leads to significant viral outbreaks, e.g. avian influenza (bird flu). These outbreaks greatly increase the risk of infection spillover to the human population and increase the risk of pandemics, and results in the culling of large numbers of animals at high economic cost.Metabolomics technologies for large-scale characterisation of low-molecular-weight metabolites have the potential to aid discovery of novel biomarkers of infectious diseases. However, such techniques require complex and expensive technical equipment, e.g. liquid chromatography coupled with mass-spectrometry (LCMS) and nuclear magnetic resonance (NMR), and cannot easily be performed outside of a laboratory by a lay person. Binding members such as aptamers, antibodies, molecularly imprinted polymers (MIPs), small molecules, peptides and peptidomimetics have been considered in recent years for use in diagnostic applications. However, these methods are currently limited to specific, known pathogens and this severely restricts their use.There is therefore a need for novel biomarkers of viral infection and accurate, fast, low- cost assays for the biomarkers that can better guide therapeutic and infection control decisions in real-time.It is an object of the present invention to address one or more of the above problems, by providing a pan-viral diagnostic tool.SUMMARYThe inventors have demonstrated that viral infections may be diagnosed by a method that comprises contacting a sample with a binding member that is specific for the viral biomarker 3'-deoxy-3',4'-didehydro-cytidine (ddhC). Accordingly, the inventors have demonstrated methods for detecting ddhC in fluid samples using a binding member that is specific for ddhC. These methods do not require the modification of ddhC, e.g. labelling of ddhC in order for the ddhC to be detected. ddhC is derived from ddhC-triphosphate (ddhCTP), a product of the enzyme viperin that is involved in antiviral response. ddhC is present in elevated levels in the serum of patients with viral infections. ddhC is more abundant in patients with active viral infections that those without, and is not specific to any particular viral infection. Further, ddhC concentration has been found to rise and fall during the progression of viral infections, so real-time monitoring using the methods of the invention is possible. This greatly aids patient triage and decision-making regarding antimicrobial prescription. The invention also finds useful application in infection prevention and control measures, especially in the context of a viral pandemic, where rapid detection of an acute viral illness, not dependent on nucleotide amplification via PCR, enables prompt patient isolation while awaiting definitive pathogen identification.A variety of binding members may be used in the methods of the invention including those selected from the group consisting of: an aptamer, an antibody or fragment thereof, a molecularly imprinted polymer (MIP), a small molecule, a peptide and a peptidomimetic.The aptamer-based ddhC assays of the present invention are significantly cheaper to run, far easier to perform, and do not require the complex and expensive technical set up of existing methods of detecting ddhC such as e.g. LC-MS and NMR. These assays may be performed using the existing basic set-ups in any clinical laboratory. Advantageously, these assays may also be performed outside of a laboratory by a lay person.Accordingly, the invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with a binding member that is specific for ddhC. Aptamers are particularly preferred binding members. Accordingly, the invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with an aptamer that is specific for ddhC. Said method may not comprise the modification of ddhC (the ddhC within the sample and / or exogenous ddhC). Optionally said modification is labelling the ddhC, such that the method does not comprise the labelling of ddhC (the ddhC within the sample and / or exogenous ddhC).The invention also provides a method for the detection of ddhC in a fluid sample, comprising contacting the sample with a binding member that is specific for ddhC, wherein the method does not comprise the modification of ddhC (the ddhC within the sample and / or exogenous ddhC). The invention also provides a method for the detection of ddhC in a fluidsample, comprising contacting the sample with an aptamer that is specific for ddhC, wherein the method does not comprise the modification of ddhC (the ddhC within the sample and / or exogenous ddhC). Optionally said modification is labelling the ddhC, such that the method does not comprise the labelling of ddhC (the ddhC within the sample and / or exogenous ddhC).The limit of detection of ddhC by a method of the invention may be about 1 M or less, preferably about 0.5pM or less, even more preferably 0.25pM or less. The limit of detection of ddhC by a method of the invention may be about 1 pM or less, preferably about 0.5pM or less, for example about 0.3 pM or less or about 0.09 pM or less.The binding member used in a method of the invention may be selected from an aptamer, an antibody or fragment thereof, a molecularly imprinted polymer (MIP), a small molecule, a peptide and a peptidomimetic. Alternatively or in addition, a binding member used in a method of the invention may be labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye. An aptamer used in a method of the invention may be labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye.The binding member may preferably be an aptamer. Said aptamer may be between about 30 to about 100 nucleic acids in length, preferably between about 35 to about 80 nucleic acids in length.The aptamer may comprise at least one complementary stem structure, optionally two complementary stem structures. The at least one complementary stem structure may be at least about a two-base stem, preferably at least about a three-base stem, more preferably at least about a four-base stem.The aptamer may comprise at least one non-complementary loop structure, preferably at least two non-complementary loop structures.The aptamer may comprise or consist of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no morethan 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.The aptamer may labelled at the 5’ and / or 3’ end. Said label may be a fluorescent label.The aptamer may have a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end. Optionally said aptamer may form part of a double-stranded molecular beacon (dsMB) with a second oligonucleotide with a quencher at the 5’ and / or 3’ end. A method of the invention may further comprise the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end.The aptamer may have a fluorescent label at the 5’ end and a quencher at the 3’ end, or a fluorescent label at the 3’ end and a quencher at the 5’ end.Optionally the fluorescent label (fluorophore) is a fluorescein or fluorescein amidite (FAM) and / or the quencher is a black hole quencher, dabcyl quencher or guanine. Optionally the fluorescent label is selected from a fluorescein amidite (FAM), Cy5, and Alexa647, and / or the quencher is a black hole quencher, dabcyl quencher or guanine.The aptamer may be unlabelled, but which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is thioflavin T. The dye may be selected from thioflavin T, SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751.The method of diagnosing a viral infection according to the invention may be a method for diagnosing an active viral infection.A ddhC concentration of at least 100 ng / mL may be diagnostic of a viral infection in a method of the invention.A method of diagnosing a viral infection of the invention or a method of detecting ddhC of the invention may be used:(a) in disease X testing and pandemic preparedness;(b) for differentiating between a viral infection and a non-viral state;(c) for differentiating between viral and non-viral infections;(d) for differentiating between viral and non-viral meningitis;(e) for identifying the presence of an active viral infection in an animal, particularly livestock, or a population thereof;(f) for identifying the presence of an active viral infection in a plant, or population thereof;(g) for research use;(h) for confirming an active viral infection when a second diagnostic test has detected the presence of a virus and / or one or more viral biomarker; and / or(i) to confirm the presence or absence of viral infection in a subject suspected of having a viral infection when first line diagnostic tests have come back negative.A method of diagnosing a viral infection of the invention may further comprise treating a patient with antiviral therapy. Said patient may be treated with antiviral therapy if a ddhC concentration above a threshold for diagnosing a viral infection (e.g. a ddhC concentration of at least 100 ng / mL) is detected by a method of the invention. Optionally said treatment may be with a broad-spectrum antiviral therapy.The detection of ddhC may be by any appropriate technique, optionally selected from an aptamer-based fluorescence assay, enzyme-linked oligonucleotide assay (ELONA), electrochemical detection, aptamer-nanoparticle (Apt-NP) conjugate assays, Western blotting, immunocytochemistry, immunoprecipitation, affinity chromatography, a biochemical assay, a turbidity assay, isothermal titration calorimetry, ultrafiltration, a cell-based assay, and sequencing-based detection. Preferably said binding member is an aptamer and said technique is an aptamer-based fluorescence assay.A method of the invention may be used with any appropriate sample. Typically the sample is a biological material, optionally selected from blood, plasma, saliva, serum, sputum, urine, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, and stool. The biological material may optionally be selected from blood, plasma, saliva, serum, sputum, urine, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, and stool, interstitial fluid, bile fluid, vaginal fluid, and sweat.The invention further provides a binding member that is specific for ddhC which is as defined herein. The invention further provides an aptamer that is specific for ddhC which is as defined herein.Said binding member may be an aptamer. Optionally said aptamer comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.The binding member of the invention may be a labelled aptamer. Optionally said labelled aptamer may have a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end. Further optionally said aptamer may form part of a double-stranded molecular beacon with a second oligonucleotide with a quencher at the 5’ or 3’ end. Such dsMBs may be used in a method of the invention which further comprises the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end.The aptamer may have a fluorescent label at the 5’ end and a quencher at the 3’ end, or a fluorescent label at the 3’ end and a quencher at the 5’ end.Optionally the fluorescent label (fluorophore) is a fluorescein or fluorescein amidite (FAM) and / or the quencher is a black hole quencher, dabcyl quencher or guanine. Optionallythe fluorescent label is selected from a fluorescein amidite (FAM), Cy5, and Alexa647, and / or the quencher is a black hole quencher, dabcyl quencher or guanine.The binding member may be an unlabelled aptamer which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is thioflavin T. The dye may be selected from thioflavin T, SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751.The invention further provides a kit comprising a binding member of the invention, preferably an aptamer of the invention. Said kit may further comprise one or more of: (a) a buffer; (b) a secondary binding member; (c) a second oligonucleotide comprising a quenching molecule at the 3’ or 5’ end, preferably as defined herein; and / or (d) instructions for use. Said kit may further comprise one or more of: (a) a buffer; (b) a secondary aptamer; (c) a second oligonucleotide comprising a quenching molecule at the 3’ or 5’ end, preferably as defined herein; and / or (d) instructions for use.The invention also provides a device comprising one or more binding member of the invention, wherein optionally said binding member is immobilised to an inert support. The invention also provides a device comprising one or more aptamer of the invention, wherein optionally said binding member is immobilised to an inert support. The device may be a lateral flow device, an electrochemical sensor, or a dipstick. The device is optionally a lateral flow device.The invention further provides a method of generating an aptamer that is specific for unmodified ddhC, said method comprising carrying out capture-SELEX on a library of random oligonucleotides which comprise a complementary stem between the primer binding regions, wherein: (a) the oligonucleotides are immobilised using a capture probe attached to streptavidin-magnetic beads; and / or (b) the oligonucleotides are purified once in each SELEX cycle, preferably following generation of single-stranded DNA.The inventor Ravi Mehta is supported by an MRC Clinical Research Training Fellowship [MR / W023865 / 1],BRIEF DESCRIPTION OF THE FIGURESFIGURE 1 shows Isothermal Calorimetry (ITC) traces for exemplary aptamers of the present invention. FIG. 1A shows the ITC trace for C1435 (SEQ ID NO: 81). FIG. 1 B shows the ITC trace for C141828 (SEQ ID NO: 82). FIG. 1C shows the ITC trace for C141266 (SEQ ID NO:83). FIG. 1 D shows the ITC trace for C 144407 (SEQ ID NO: 84). FIG. 1 E shows the ITC trace for C1411062 (SEQ ID NO: 85). FIG. 1 F shows the ITC trace for C1420247 (SEQ IDNO: 86). FIG. 1G shows the ITC trace for C 144186 (SEQ ID NO: 87). FIG. 1 H shows the ITC trace for C1430591 (SEQ ID NO: 88).FIGURE 2 shows the secondary structures of exemplary aptamers of the present invention. FIG. 2A shows C1435 (SEQ ID NO: 81). FIG. 2B shows C141828 (SEQ ID NO: 82). FIG. 2C shows C141266 (SEQ ID NO:83). FIG. 2D shows C144407 (SEQ ID NO: 84). FIG. 2E shows C1411062 (SEQ ID NO: 85). FIG. 2F shows C1420247 (SEQ ID NO: 86). FIG. 2G shows C144186 (SEQ ID NO: 87). FIG. 2H shows C1430591 (SEQ ID NO: 88).FIGURE 3 shows how the stem length of an aptamer sequence of the invention can be altered whilst retaining ddhC binding activity. Using an exemplary aptamer, FIG. 3A shows the full- length secondary structure. FIG. 3B shows the same aptamer with a 4-base stem. FIG. 3C shows the same aptamer with a 3-base stem. FIG. 3D shows the same aptamerwith a 2-base stem.FIGURE 4 shows a general schematic of a double-stranded molecular beacon (dsMB). This is illustrated with a dsMB comprising an 8-base stem and a 5’ fluorophore (fluorescein), and a capture probe with 13 complementary bases and fluorophore quencher.FIGURE 5 shows a general schematic of a single-stranded molecular beacon (ssMB). This is illustrated with a ssMB comprising a 2-base stem, 5’ fluorophore and 3’ fluorophore quencher.FIGURE 6 shows general schematics of thioflavin T (ThT) assays. This is illustrated with an aptamer comprising a 4-base stem. Binding of ddhC to the aptamer displaces ThT, resulting in a decrease in ThT fluorescence.FIGURE 7 shows a binding curve for the ddhC double stranded molecular (dsMB) beacon assay. A fluorescein fluorophore was conjugated to an exemplary aptamer (SEQ ID NO: 33), and Black Hole Quencher 1 quencher on a separate capture probe. FIG. 7A shows the results of this dsMB assay with fluorescence measured at 519nm following excitation at 495nm at different concentrations of ddhC (0.5-1 OOOpM) in 200ul. The baseline fluorescence (fluorescence with no ddhC) was subtracted from all measured values. FIG. 7B shows a repeat of this dsMB assay using a lower range of ddhC concentrations (0-1 pM). At lower concentrations (0-1 pM), excitation sample volume was increased to 300pl to maximise detection of fluorescence changes. FIG. 7D shows the dsMB assay used to produce the data shown in FIG. 7B using either a 5’-Alexa647 fluorophore or a 5’-Cy5 fluorophore instead of a 5’-FAM fluorophore. The fluorophore-conjugated aptamers (5’-Alexa647 fluorophore and 5’-Cy5) were hybridised with complementary oligonucleotides labelled with a quenching molecule (Iowa and BHQ1 respectively; ex / em 650 / 670 and 648 / 665 respectively). Fluorescence was measured pre- and post-addition of ddhC at different concentrations (1 uM, 10uM, 100uM) and the percentage fluorescence gain calculated.FIGURE 8 shows a binding curve for the ddhC single stranded molecular beacon assay. A fluorescein fluorophore and Black Hole Quencher 1 quencher were conjugated to an exemplary aptamer (SEQ ID NO: 33). Fluorescence was measured at 519nm following excitation at 495nm at different concentrations of ddhC in 200ul. The baseline fluorescence (fluorescence with no ddhC) was subtracted from all measured values.FIGURE 9 shows a binding curve for the ddhC Thioflavin T dye-displacement assay. Thioflavin T was added to an exemplary unmodified aptamer (SEQ ID NO: 33) in 200ul. FIG. 9A shows the results of this dye displacement assay with different concentrations of ddhC (0.5-1 OOOpM) in 200ul, fluorescence decrease was measured at 490nm following excitation at 425nm. The measured fluorescence was subtracted from the baseline fluorescence (fluorescence with no ddhC). FIG. 9B shows a repeat of this dye-displacement assay using the same aptamer and a lower range of ddhC concentrations (0-1 pM). At lower concentrations (0-1 pM), excitation was performed at 449nm, sample volume increased to 300pl to maximise detection of fluorescence changes and results normalised using pre-ddhC fluorescence to maximise accuracy. FIG. 9C-F show a repeat of this dye-displacement assay using further exemplary aptamers (SEQ ID Nos: 83, 84, 86 and 88) and ddhC concentrations (1-500pM). FIG. 9G shows a binding curve for the exemplary unmodified aptamer (SEQ ID NO: 33) dye displacement assay tested using LDS751 instead of Thioflavin T. Unmodified aptamer (SEQ ID NO: 33) and LDS 751 were mixed in a 7pM:15pM ratio. ddhC was added at different concentrations (0.5-1 OOOpM) and fluorescence was measured (ex / em 588 / 685). The measured fluorescence was subtracted from the baseline fluorescence (fluorescence with no ddhC). FIG. 9H shows the exemplary unmodified aptamer (SEQ ID NO: 33) dye displacement assay tested using SYTOX red instead of Thioflavin T. Fluorescence was measured pre- and post-addition of ddhC at different concentrations (1 uM, 10uM, 100uM) and the percentage fluorescence loss calculated.DETAILED DESCRIPTIONDefinitionsUnless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosurebelongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide the skilled person with a general dictionary of many of the terms used in this disclosure.This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognise. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.The headings provided herein are not limitations of the various aspects or embodiments of this disclosure.As used herein, the term “aptamer” refers in general to an oligonucleotide or mixture thereof which is capable of binding specifically to a target. Since the molecule of interest in the present invention is ddhC, the term “aptamer” generally refers to an oligonucleotide that binds specifically to ddhC. Oligonucleotide aptamers will be discussed here, but the skilled reader will appreciate that other aptamers having equivalent binding characteristics can also be used, such as peptide aptamers. Preferably, the aptamer is not present in nature in isolated form. An aptamer of the invention is not an oligonucleotide that has the known physiological function of being bound by ddhC. Aptamers may be single-stranded or double-stranded. Aptamers may comprise one or more single-stranded region (also referred to as “loops”) and / or one or more double-stranded region (also referred to as “stems”). A single-stranded oligonucleotide may comprise regions of nucleotide sequences which are reversecomplementary to each other, such that when the oligonucleotide adopts a particular conformation, those regions of nucleotide sequences are brought into proximity and form a double-stranded region. Intervening regions of nucleotide sequences without a reverse complementary nucleotide sequence form loops. These structures are referred to in the art as “stem-loop” structures, “hairpins” or “hairpin loops”.In general, aptamers may comprise oligonucleotides that are at least 5, at least 10 or at least 15 nucleotides in length. Aptamers may comprise sequences that are up to 30, up to 40, up to 45, up to 50, up to 60, up to 70, up to 80, up to 90, or up to 100 or more nucleotides in length. For example, aptamers may be from 5 to 100 nucleotides, from 10 to 40 nucleotides, from 15 to 45 nucleotides, from 30 to 100 nucleotides or from 40 to 80 nucleotides in length. Where possible, aptamers of shorter length are preferred as these will often lead to less interference by other molecules or materials.Aptamers are generally oligonucleotides that bind a specific target molecule. Aptamers can be engineered completely in vitro and are readily produced by chemical synthesis.The term “binding member" as used herein, refers to a member of a specific binding pair, i.e., two different molecules where the first of the molecules, through chemical or physical means, specifically binds to the second molecule. The first molecule may be described as a binding member for the second molecule. The second molecule may be described as a binding member for the first molecule.The term "chemiluminescent label" refers to any compound that can be attached to a nucleotide capable of causing a chemiluminescence reaction by contact with a target, for example ddhC, thereby generating a detectable optical signal without the need for excitation light.As used herein the term "hair-pin structure" or "hair-pin" refers to a particular secondary structure of a nucleic acid sequence, preferably an aptamer, which comprises two sequence parts that are complementary to each other and form a stem structure. The hair-pin structure comprises an additional sequence, positioned between the two complementary sequences, forming a loop structure.As used herein, the term "capable of when used with a verb, encompasses, or means the action of the corresponding verb. For example, "capable of activating" also means activates, "capable of agonising" also means agonises, "capable of binding" also means binds and "capable of specifically activating..." also means specifically activates.Numeric ranges are inclusive of the numbers defining the range. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that statedrange is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure.As used herein, the articles "a" and “an” may refer to one or to more than one (e.g., to at least one) of the grammatical object of the article. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this application, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including", as well as otherforms, such as "includes" and "included", is not limiting.“About” may generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values. Preferably, the term “about” shall be understood herein as plus or minus (±) 5%, preferably ± 4%, ± 3%, ± 2%, ± 1%, ± 0.5%, ± 0.1%, of the numerical value of the numberwith which it is being used.The term "consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the invention.As used herein the term "consisting essentially of' refers to those elements required for a given invention. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that invention (i.e., inactive, or non- immunogenic ingredients).Embodiments described herein as “comprising” one or more features may also be considered as disclosure of the corresponding embodiments “consisting of’ and / or “consisting essentially of’ such features, of the corresponding embodiments "consisting of' such features.Concentrations, amounts, volumes, percentages and other numerical values may be presented herein in a range format. It is also to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.The term “protein", as used herein, includes proteins, polypeptides, and peptides. As used herein, the term “amino acid sequence” is synonymous with the term “polypeptide” and / or the term “protein”. In some instances, the term “amino acid sequence” is synonymous with the term “peptide”. The terms "protein" and "polypeptide" are used interchangeably herein. Itis understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.The terms “Fab fragment” and “Fab” are used interchangeably herein and contain a single light chain (e.g. a constant domain CL and a VL) and a single heavy chain (e.g. the constant domain CH1 and a VH). The heavy chain of a Fab fragment is not capable of forming a disulfide bond with another heavy chain.A “Fab' fragment” contains a single light chain and a single heavy chain but in addition to the CH1 and the VH, a “Fab' fragment” contains the region of the heavy chain between the CH1 and CH2 domains that is required forthe formation of an inter-chain disulfide bond. Thus, two “Fab' fragments” can associate via the formation of a disulphide bond to form a F(ab')2 molecule.A “F(ab')2 fragment” contains two light chains and two heavy chains. Each chain includes a portion of the constant region necessary forthe formation of an inter-chain disulfide bond between two heavy chains.An “Fv fragment” contains only the variable regions of the heavy and light chain. It contains no constant regions.A “single-domain antibody” is an antibody fragment containing a single antibody domain unit (e.g., VH or VL).A “single-chain Fv” (“scFv”) is antibody fragment containing the VH and VL domain of an antibody, linked together to form a single chain. A polypeptide linker is commonly used to connect the VH and VL domains of the scFv.A “tandem scFv”, also known as a TandAb®, is a single-chain Fv molecule formed by covalent bonding of two scFvs in a tandem orientation with a flexible peptide linker.A“bi-specific T cell engager” (BiTE®) is a fusion protein consisting of two single-chain variable fragments (scFvs) on a single peptide chain. One of the scFvs binds to T cells via the CD3 receptor, and the other to a tumour cell antigen.A “diabody” is a small bivalent and bispecific antibody fragment comprising a heavy (VH) chain variable domain connected to a light chain variable domain (VL) on the same polypeptide chain (VH-VL) connected by a peptide linker that is too short to allow pairing between the two domains on the same chain (Kipriyanov, Int. J. Cancer 77 (1998), 763-772). This forces pairing with the complementary domains of another chain and promotes the assembly of a dimeric molecule with two functional antigen binding sites.As used herein, a “peptidomimetic” is understood to encompass all compounds whose essential elements mimic a natural peptide and which retain the ability to interact with the biological target and exert the natural peptide’s biological activity.As used herein, the terms “polynucleotides”, "nucleic acid" and "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid,deoxyribonucleic acid, or an analogue thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double-stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA. Other examples of nucleic acid molecules are RNA, including siRNA, shRNA, and antisense oligonucleotides. Typically, the methods of the invention relate to the production of oligonucleotides (short DNA or RNA sequences typically less than about 300 bases in length).Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation.The polynucleotides of the present invention may be prepared by any means known in the art. For example, large amounts of the polynucleotides may be produced by replication in a suitable host cell. The natural or synthetic DNA fragments coding for a desired fragment will be incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell. Usually, the DNA constructs will be suitable for autonomous replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to and integration within the genome of a cultured insect, mammalian, plant, or other eukaryotic cell lines.The polynucleotides of the present invention may also be produced by chemical synthesis, e.g., by the phosphoramidite method or the tri-ester method and may be performed on commercial automated oligonucleotide synthesisers. A double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesising the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.When applied to a nucleic acid sequence, the term “isolated” in the context of the present invention denotes that the polynucleotide sequence has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences (but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators), and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment.A “variant” nucleic acid sequence has substantial homology or substantial similarity to a reference nucleic acid sequence (or a fragment thereof). A nucleic acid sequence or fragment thereof is “substantially homologous” (or “substantially identical”) to a reference sequence if, when optimally aligned (with appropriate nucleotide insertions or deletions) with the other nucleic acid (or its complementary strand), there is nucleotide sequence identity inat least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more % of the nucleotide bases. Methods for homology determination of nucleic acid sequences are known in the art.Alternatively, a “variant” nucleic acid sequence is substantially homologous with (or substantially identical to) a reference sequence (or a fragment thereof) if the “variant” and the reference sequence they are capable of hybridising under stringent (e.g., highly stringent) hybridisation conditions. Nucleic acid sequence hybridisation will be affected by such conditions as salt concentration (e.g. NaCI), temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridising nucleic acids, as will be readily appreciated by those skilled in the art. Stringent temperature conditions are preferably employed, and generally include temperatures in excess of 30°C, typically in excess of 37°C and preferably in excess of 45°C. Stringent salt conditions will ordinarily be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. The pH is typically between 7.0 and 8.3. The combination of parameters is much more important than any single parameter.Methods of determining nucleic acid percentage sequence identity are known in the art. By way of example, when assessing nucleic acid sequence identity, a sequence having a defined number of contiguous nucleotides may be aligned with a nucleic acid sequence (having the same number of contiguous nucleotides) from the corresponding portion of a nucleic acid sequence of the present invention. Tools known in the art for determining nucleic acid percentage sequence identity include Nucleotide BLAST (as described below).A “fragment” of a polynucleotide of interest comprises a series of consecutive nucleotides from the sequence of said full-length polynucleotide. By way of example, a “fragment” of a polynucleotide of interest may comprise (or consist of) at least 30 consecutive nucleotides from the sequence of said polynucleotide (e.g., at least 35, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800850, 900, 950 or 1000 consecutive nucleic acid residues of said polynucleotide).The term “deletion” as used herein refers to removal of one or more amino acid residues of a polypeptide without replacement of one or more amino acid residues at the site of deletion. Thus, where one amino acid residue has been deleted from a polypeptide sequence having x number of amino acid residues (for example), the resultant polypeptide has x-1 amino acid residues.The term “indel” as used herein refers to deletion of one or more amino acid residues of a polypeptide and insertion at the deletion site of a different number of amino acid residues (either greater or fewer amino acid residues) when compared to the number of amino acid residues deleted. Thus, for an indel where two amino acid residues have been deleted from a polypeptide sequence having x number of amino acid residues (for example), the resultantpolypeptide has x-1 amino acid residues or x+>1 amino acid residues. The insertion and deletion can be carried out in any order, sequentially or simultaneously.The term “substitution” as used herein refers to replacement of one or more amino acid residues with the same number of amino acid residues at the same site. Thus, for a substitution of a polypeptide sequence having x number of amino acid residues (for example), the resultant polypeptide also has x amino acid residues. Preferably a substitution is a substitution at a single amino acid position.The term “insertion” as used herein refers to addition of one or more amino acid residues of a polypeptide without deletion of one or more amino acid residues of the polypeptide at the site of insertion. Thus, where one amino acid residue has been inserted into a polypeptide sequence having x number of amino acid residues (for example), the resultant polypeptide has x+1 amino acid residues.The terms "decrease", "reduce", "reduction", or "inhibit" are all used herein to mean a decrease by a statistically significant amount. The terms "reduce," "reduction" or "decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, "reduction" or "inhibition" encompasses a complete inhibition or reduction as compared to a reference level. "Complete inhibition" is a 100% inhibition (i.e., abrogation) as compared to a reference level.The terms "increased", "increase", "enhance", or "activate" are all used herein to mean an increase by a statically significant amount. The terms "increased", "increase", "enhance", or "activate" can mean an increase of at least 25%, at least 50% as compared to a reference level, for example an increase of at least about 50%, or at least about 75%, or at least about 80%, or at least about 90%, at least about 95%, or at least about 98%, or at least about 99%, or at least about 100%, or at least about 250% or more compared with a reference level, or at least about a 1 .5-fold, or at least about a 2-fold, or at least about a 2.5-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 1 .5-fold and 10-fold or greater as compared to a reference level.The terms "individual”, "subject”, and "patient”, are used interchangeably herein to refer to a mammalian subject for whom diagnosis, prognosis, disease monitoring, treatment, therapy, and / or therapy optimisation is desired. The mammal can be (without limitation) a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In some preferredembodiments, the individual, subject, or patient is a human. An “individual” may be an adult, juvenile or infant. An “individual” may be male or female.A "subject in need" of treatment for a particular condition can be an individual having that condition, diagnosed as having that condition, or at risk of developing that condition.A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications or symptoms related to such a condition, and optionally, have already undergone treatment for a condition as defined herein or the one or more complications or symptoms related to said condition. Alternatively, a subject can also be one who has not been previously diagnosed as having a condition as defined herein or one or more or symptoms or complications related to said condition. For example, a subject can be one who exhibits one or more risk factors for a condition, or one or more or symptoms or complications related to said condition or a subject who does not exhibit risk factors.As used herein, the term “healthy individual” refers to an individual or group of individuals who are in a healthy state, e.g. individuals who have not shown any symptoms of the disease, have not been diagnosed with the disease and / or are not likely to develop the disease e.g. a viral infection. Preferably said healthy individual(s) is not on antiviral medication and has not been diagnosed with any other disease. The one or more healthy individuals may have a similar sex, age, and / or body mass index (BMI) as compared with the test individual. Application of standard statistical methods used in medicine permits determination of normal levels of expression in healthy individuals, and significant deviations from such normal levels.Herein the terms “control” and “reference population” are used interchangeably.The term “pharmaceutically acceptable” as used herein means approved by a regulatory agency of the Federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia or other generally recognized pharmacopeia.As used herein, the term “sample” refers to a sample of biological materials (cells, tissue, fluid, etc.) obtained from an individual. The sample may be any suitable biological material, for example blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid (CSF), synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like. The suitable biological material may be interstitial fluid, bile fluid, vaginal fluid, and sweat and the like. Typically, the sample may be serum, plasma, CSF or urine. The precise biological sample that is taken from the individual may vary, but the sampling preferably is minimally invasive and is easily performed by conventional techniques.The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto. All documents citedherein are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents. ddhCBy ddhC it is meant 3'-deoxy-3',4'-didehydro-cytidine:ddhC chemical standard may be obtained from LGC Biosearch Technologies (formerly Berry & Associates), product code PY7790. ddhC has the CAS identifier: 1823793-27-6. ddhC is a small molecule derived from ddhC-triphosphate (ddhCTP). ddhCTP is produced by the enzyme viperin that is involved in antiviral response. ddhC is present in elevated levels in the serum of patients with viral infections. ddhC is more abundant in patients with active viral infections that those without, and it is not specific to any particular viral infection. Further, ddhC concentration has been found to rise and fall during the progression of viral infections.Binding membersPrevious attempts to generate binding members to ddhC have largely been unsuccessful. Further, although an antibody to ddhC has been described in WO 2023 / 063331 (herein incorporated by reference), that only proven use of said antibody in WO 2023 / 063331 was in a competitive assay requiring labelled ddhC, and with the lowest level of ddhC detected of 1000ng / ml_ (equivalent to 4.44 pM). Further, an error of + / - 200 ng / mL (equivalent to 0.88 pM) is specified in paragraph
[0062] of WO 2023 / 063331 , meaning that this assay is not sensitive enough to detect viral infections in serum, in which the threshold of ddhC for diagnosing a viral infection is typically about 100 ng / mL (equivalent to 0.44 pM). This significantly reducing the utility of said assay and antibody as a research and clinical tool compared with the binding members of the present invention.As exemplified herein, the present inventors are the first to develop aptamers that specifically bind to ddhC. The use of aptamers as binding members has several benefits over the use of antibodies including reduced cost, simpler synthesis including reduced environmental footprint, easier modification (e.g. incorporating fluorophores, quenchers, biotin and thiol groups for immobilisation, and redox probes for electrochemical assays), and integration with nucleic acid-based detection platforms. Other advantages include thedevelopment of electrochemical assays based on established routes, the ability to incorporate switchable molecular conformations (which is not possible with antibodies), and the ability to make signal-ON lateral flow assays for small molecules with one binding epitope (again, this is not possible with antibodies). Further, the present inventors have demonstrated that these aptamers are capable of binding to unmodified ddhC, including unlabelled ddhC, and can do so in a sample of biofluid. As such, the present inventors are the first to provide a binding member which is capable of specifically binding to ddhC and is amenable for research and clinical use through a non-competitive assay. Further, the binding members of the invention can detect low levels of ddhC, providing a further clinical advantage.Accordingly, the present invention provides a binding member for ddhC. A binding member of the invention is typically specific for ddhC.By specific, it will be understood that a binding member binds to ddhC, with no significant cross- reactivity to any other molecule, such as adenosine triphosphate. Crossreactivity may be assessed by any suitable method. By way of non-limiting example, crossreactivity of an binding member for ddhC with a molecule other than ddhC may be considered significant if the binding member binds to the other molecule at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 100% as strongly as it binds to ddhC. A binding member for ddhC that binds specifically to ddhC may bind to another molecule such as human adenosine triphosphate with an affinity of less than 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25% or 20% the affinity that it binds to ddhC. Preferably, the binding member for ddhC binds to the other molecule at less than 20%, less than 15%, less than 10% or less than 5%, less than 2% or less than 1% of the affinity that it binds to ddhC. Specificity may be determined by comparing the dissociation constant (Kd) of the antibody molecule or binding fragment thereof. Thus, binding member for ddhC that binds specifically to ddhC may bind to another molecule such as adenosine with a Kd which is at least 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25% or 20% greater than its Kd for binding to ddhC. Preferably, the binding member for ddhC binds to the other molecule with a Kd that is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold greater or more compared with the Kd of the binding member for binding to ddhC. Typically, a binding member for ddhC that binds specifically to ddhC will not bind to another molecule with a Kd of 30 pM or less. Preferably, a binding member for ddhC that binds specifically to ddhC will not bind to another molecule with a Kd of 10 pM or less, more preferably 1 pM or less.Binding of a binding member to ddhC can be quantified by the dissociation constant (Kd) of the antibody for said ddhC. Kd is a quantitative measure used to describe the affinity between two molecules, typically a ligand and a receptor or an enzyme and a substrate. It represents the equilibrium constant for the dissociation reaction, where a complex formedbetween the two molecules dissociates into its individual components. A lower dissociation constant indicates a stronger binding affinity between the molecules, meaning that they are more likely to remain in complex form at equilibrium. Conversely, a higher dissociation constant indicates weaker binding and a greater tendency for the complex to dissociate into its individual components. Kd can be measured accurately using known methods such as Surface Plasmon Resonance (SPR) or Bio-Layer Interferometry (BLI). The Kd measurements (binding affinity) may be carried out by any suitable assay known in the art. Suitable assays include an affinity assay performable via a KinExA system (e.g., KinExA 3100, KinExA 3200, or KinExA 4000) (Sapidyne Instruments, Idaho), or ForteBio Octet system.A binding member, particularly an aptamer of the invention, typically binds to ddhC with a Kd of about 100 pM or less, such as about 75 pM or less, about 60 pM or less, about 50 pM or less, about 40 pM or less, about 30 pM or less, about 25 pM or less, about 20 pM or less, about 15 pM or less, about 10 pM or less, about 9 pM or less, about 8 pM or less, about 7 pM or less, about 6 pM or less, about 5 pM or less or about 4 pM or less. Typically a binding member, particularly an aptamer of the invention, typically binds to ddhC with a Kd of about 20 pM or less, about 15 pM or less, about 10 pM or less, about 9 pM or less, about 8 pM or less, about 7 pM or less, about 6 pM or less, about 5 pM or less or about 4 pM or less. Preferably, a binding member, particularly an aptamer of the invention, typically binds to ddhC with a Kd of about 7 pM or less, about 6 pM or less, about 5 pM or less or about 4 pM or less. In some preferred embodiments, said Kd value may be calculated by isothermal calorimetry (ITC), such as using the method described in the Examples.A variety of different types of binding members are encompassed by the present invention. In particular, the binding member may be an aptamer, an antibody or antigenbinding fragment thereof, and complexes thereof including those formed by recombinant DNA methods or peptide synthesis, a molecularly imprinted polymer (MIP), a small molecule, haptens, a peptide and a peptidomimetic. Preferably a binding member of the invention is an aptamer or an antibody or antigen-binding fragment thereof. In some particularly preferred embodiments, a binding member of the invention is an aptamer, particularly an aptamer as described herein.AntibodiesA binding member of the invention may be an antibody or antigen-binding fragment thereof. Such binding members may be described as anti-ddhC antibodies or binding fragments thereof.The anti-ddhC antibodies of the invention or antigen-binding fragments thereof may have any antibody format. In some embodiments, the antibody has the “conventional” format. In other words, an anti-ddhC antibody or antigen-binding fragment thereof may be of anyisotype, i.e. IgA, IgD, IgE, IgG and IgM, or a synthetic multimer of the four-chain immunoglobulin (Ig) structure. In some preferred embodiments, an anti-ddhC antibody or antigen-binding fragment thereof is IgG isotype. An anti-ddhC antibody or antigen-binding fragment thereof can be any IgG subclass, for example lgG1 , lgG2, lgG3, or lgG4 isotype.Alternatively, an anti-ddhC antibody or antigen-binding fragment thereof may be a Fab fragment. An anti-ddhC antibody or antigen-binding fragment thereof can also be a Fab', an Fv, an scFv, an Fd, a V NAR domain, an IgNAR, an intrabody, an IgG CH2, 5 a minibody, a single-domain antibody, an Fcab, an scFv-Fc, F(ab')2, a di-scFv, a bi-specific T-cell engager (BiTE®), a F(ab')3, a tetrabody, a triabody, a diabody, a DVD-lg, an (scFv)2, or a mAb2.PeptidomimeticsA binding member of the invention may be a peptidomimetic.Peptidomimetics are compounds which mimic a natural peptide or protein with the ability to interact with the biological target and produce the same biological effect. Peptidomimetics may have advantages over peptides in terms of stability and bioavailability associated with a natural peptide. Peptidomimetics can have main- or side-chain modifications of the parent peptide designed for biological function. Examples of classes of peptidomimetics include, but are not limited to, peptoids and p-peptides, as well as peptides incorporating D-amino acids.A peptidomimetic may comprise or consist of a non-naturally occurring amino acid sequence. A peptidomimetic typically does not occur in nature. Peptidomimetics may be made by modifying an existing peptide, for example by post-translational processes or chemical modification methods, or by making similar systems that mimic peptides, such as peptoids and b-peptides. Structures and synthesis of peptidomimetics are for instance described in William D. Lubell (ed.), Peptidomimetics I and II, Topics in Heterocyclic Chemistry (Book 48), Springer 1sted., XVI, 310 (2017); Trabocchi A. Chapters - Principles and applications of small molecule peptidomimetics, Small Molecule Drug Discovery Methods, Molecules and Applications, 163-195, Elsevier (2020); Vagner et al., Curr Opin Chem Biol. 12(3): 292-296 (2008), all of which are incorporated herein by reference in their entireties.A peptidomimetic may be a structural mimetic. Structural mimetics, also known as type I mimetics, have analogous structural features to the peptide that they mimic. Functional mimetics, also known as type II mimetics, retain the ability to interact with the biological target and exert the natural peptide’s biological activity without apparent structural analogy to the peptide.A peptidomimetic may be a compound comprising non-peptidic structural elements, for example modifications of one or more existing amino acids, conformational restraints, cyclization of the polypeptide, or isosteric replacement.Molecularly Imprinted Polymers (MIPs)A binding member of the invention may be a molecularly imprinted polymer (Ml P). The molecularly imprinted polymer may be selected from: a cross-linked polyester resin, a non- covalently imprinted molecularly imprinted polymer, a covalently imprinted molecularly imprinted polymer, or a molecular recognition polymer.The MIP may bind with ddhC through non-covalent or covalent means. Preferably, the MIP binds with ddhC through non-covalent means.The MIP may be prepared from one or more polymerizable monomers. Said one or more polymerizable monomers may be selected from acrylate and vinyl monomers. A nonlimiting example of an acrylate monomer is a methacryl monomer. A non-limiting example of a vinyl monomer is a styryl or vinylpyridine.A MIP may take any appropriate form. By way of non-limiting example, a MIP may be in the form of a bead.AptamersPreferably, a binding member of the invention is an aptamer. The aptamer may comprise ribonucleosides (i.e. be an RNA oligonucleotide), deoxyribonucleosides (i.e. be a DNA oligonucleotide), or a combination thereof. Alternatively or in addition, an aptamer of the invention may comprise one or more nucleic acid analogue.Structural featuresAn aptamer of the invention may be at least about 10, at least about 20, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 220, at least about 240, at least about 260, at least about 280, at least about 300, at least about 325, at least about 350, at least about 375, at least about 400, at least about 450, or at least about 500 nucleic acids in length. Typically, an aptamer of the invention may be at least about 30, at least about 35, at least about 40, at least about 45 nucleic acids in length.An aptamer of the invention may be about 30, about 31 , about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41 , about 42, about 43, about 44, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 220, about 240, about260, about 280, about 300, about 325, about 350, about 375, about 400, about 450, or about 500 nucleic acids in length. Typically an aptamer of the invention may be about 39, about 40, about 41 , about 42, about 43 or about 44 nucleic acids in length.An aptamer of the invention may be between about 30 to about 500, between about 30 to about 450, between about 30 to about 400, between about 30 to about 375, between about 30 to about 350, between about 30 to about 325, between about 30 to about 300, between about 30 to about 280, between about 30 to about 260, between about 30 to about 240, between about 30 to about 220, between about 30 to about 200, between about 30 to about 190, between about 30 to about 180, between about 30 to about 170, between about 30 to about 160, between about 30 to about 150, between about 30 to about 140, between about 30 to about 130, between about 30 to about 120, between about 30 to about 110, between about 30 to about 100, between about 35 to about 95, between about 35 to about 90, between about 35 to about 85, between about 40 to about 85, between about 40 to about 80, between about 30 to about 50, between about 30 to about 45, or between about 35 to about 45 nucleic acids in length. Typically an aptamer of the invention may be between about 30 to about 50 nucleic acids in length.An aptamer of the invention may be between about 30 to about 100 nucleic acids in length, preferably between about 35 to about 80 nucleic acids in length.In addition to the nucleotides that are involved in the binding of the aptamer to ddhC, other non-binding nucleotides may be included in the aptamer to improve the performance of the method. Prior to the binding of the aptamer to ddhC, the intramolecular interactions between different nucleotides of the aptamer are favoured relative to intermolecular interactions between nucleotides of different aptamer molecules. These intramolecular molecular interactions are known as secondary structure, and secondary structure is important to the selectivity of the aptamers of the method. The secondary structure is typically temporary and disrupted when the aptamer binds to ddhC.An aptamer may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten secondary structures.An aptamer may comprise one, two, three, four, five, six, seven, eight, nine, or ten secondary structures.A secondary structure may be selected from helix, stem, loop, hair-pin, and pseudoknot, or any combination thereof. Each individual secondary structure may independently be selected from helix, stem, loop, hair-pin, and pseudoknot, or any combination thereof. Preferably, at least one secondary structure is or comprises a complementary structure. Said complementary structure may be a stem structure.An aptamer of the invention may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least tencomplementary stem structures. In some preferred embodiments, the aptamer comprises at least one complementary stem structure.An aptamer of the invention may comprise one, two, three, four, five, six, seven, eight, nine, or ten complementary stem structures. In some preferred embodiments, the aptamer comprises one complementary stem structure. An aptamer of the invention may comprise two or three complementary stem structures.Accordingly, an aptamer of the invention may comprise at least one complementary stem structure, optionally two complementary stem structures.The at least one complementary stem structure may be at least about a one-base, at least about a two-base, at least about a three-base, at least about a four-base, at least about a five-base, at least about a six-base, at least about a seven-base, at least about an eightbase, or at least about a nine-base complementary stem structure. The at least one complementary stem structure may be at least about a two-base complementary stem structure.Accordingly, the at least one complementary stem structure may be at least about a two-base stem, preferably at least about a three-base stem, more preferably at least about a four-base stem.The at least one complementary stem structure may be about a one-base, about a two-base, about a three-base, about a four-base, about a five-base, about a six-base, about a seven-base, about an eight-base, or about a nine-base complementary stem structure. The at least one complementary stem structure may be about a two-base complementary stem structure.Where an aptamer of the invention comprises two or more complementary stem structures, the length of each complementary stem structure may be independent of the length of the other complementary stem structures. Thus, the length of a complementary stem structure within an aptamer of the invention may be the same as or different from the length of any other complementary stem structure within said aptamer. By way of non-limiting example, if an aptamer comprises a first complementary stem structure which is a four-base stem, it may comprise a second complementary stem structure which is a two-base stem. By way of further non-limiting example, if an aptamer comprises a first complementary stem structure which is a six-base stem, it may comprise a second complementary stem structure which is a four-base stem and a third complementary stem structure which is a two-base stem.Alternatively or in addition, the aptamers of the invention may comprise at least one secondary structure, wherein the at least one secondary structure is a non-complementary structure, for example a loop. Advantageously, the incorporation of at least one non- complementary structure, for example a loop, has the effect of fine tuning the binding of the aptamer to itself (intramolecular binding) relative to the binding of the aptamer to ddhC. Theinclusion of non-complementary structure reduces the energy barrier for the aptamer to rehybridize from intramolecular binding to intermolecular binding to ddhC, so the energetic driving force to bind to ddhC is increased, and so too is the binding affinity.The at least one secondary structure may be a non-complementary structure. Typically, the non-complementary structure is a non-complementary loop structure.An aptamer of the invention may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten non-complementary loop structures. In some preferred embodiments, the aptamer may comprise at least two non-complementary loop structures.Accordingly, an aptamer of the invention may comprise at least one non- complementary loop structure, preferably at least two non-complementary loop structures.An aptamer of the invention may comprises one, two, three, four, five, six, seven, eight, nine, or ten non-complementary loop structures. In preferred embodiments, the aptamer comprises two non-complementary loop structures.The at least one non-complementary loop structure may be at least about a one-base, at least about a two-base, at least about a three-base, at least about a four-base, at least about a five-base, at least about a six-base, at least about a seven-base, at least about an eight-base, or at least about a nine-base non-complementary loop structure. The at least one complementary stem structure may be at least about a four-base, at least about a five-base, or at least about an eight-base non-complementary loop structure.The at least one non-complementary loop structure may be about a one-base, about a two-base, about a three-base, about a four-base, about a five-base, about a six-base, about a seven-base, about an eight-base, or about a nine-base non-complementary loop structure. The at least one complementary stem structure may be about a four-base, about a five-base, or about an eight-base non-complementary loop structure.As exemplified herein, wherein an aptamer of the invention comprises at least two non- complementary loop structures, the smaller of these may be at least about a two-base, at least about a three-base, or at least about a four-base non-complementary loop structures. Typically said smaller non-complementary loop structure may be about a three-base or about a four-base non-complementary loop structure.The aptamer may comprise two non-complementary loop structures, wherein the two non-complementary loop structures are about a six-base and about a twelve-base non- complementary loop structure.Where an aptamer of the invention comprises two or more non-complementary loop structures, the length of each non-complementary loop structures may be independent of the length of the other non-complementary loop structures. Thus, the length of a non- complementary loop structure within an aptamer of the invention may be the same as ordifferent from the length of any other non-complementary loop structure within said aptamer. By way of non-limiting example, if an aptamer comprises a first non-complementary loop structure which is a four-base loop, it may comprise a second non-complementary loop structure which is an eight-base loop. By way of further non-limiting example, if an aptamer comprises a first non-complementary loop structure which is a five-base loop, it may comprise a second non-complementary loop structure which is a four-base loop and a third non- complementary loop structure which is an eight-base loop.Accordingly, an aptamers of the invention may comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten hair-pin structures. In preferred embodiments, the aptamer may comprise at least one hair-pin structures.SequencesAs exemplified herein, the inventors have identified a number of exemplary minimal or core oligonucleotide sequences. These sequences are set out in Table 1 as SEQ ID NOs: 1 to 8. In an aptamer of the invention, these sequences are at least partially responsible for specificity for ddhC binding.Accordingly, an aptamer of the invention may comprise or consist of a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8. In some preferred embodiments, the aptamer may comprise or consist of a core nucleic acid sequence comprising or consisting of SEQ ID NO: 1.Typically, an aptamer of the invention may comprise a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8. In some preferred embodiments, the aptamer may comprise a core nucleic acid sequence comprising or consisting of SEQ ID NO: 1.Also provided are variants of the core nucleic acid sequences of SEQ ID NOs: 1 to 8. A variant core nucleic acid sequence may differ from any one of SEQ ID NOs: 1 to 8 by no more than 15, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleic acids. Typically, a variant core nucleic acid sequence differs from any one of SEQ ID NOs: 1 to 8 (preferably SEQ ID NO: 1) by no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleic acids. In some embodiments, the variant core nucleic acid sequence differs from one of SEQ ID NOs: 1 to 8 (preferably SEQ ID NO: 1) by no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid. An aptamer of the invention may comprise or consist of any one of these variant core nucleic acid sequences. The modification at any of the differing nucleic acids may be a nucleic acid deletion, a nucleic acid insertion, a nucleic acid indel, or a nucleic acid substitution. Themodification at each of the differing nucleic acids may be independently selected. By way of non-limiting example, a variant core nucleic acid sequence may comprise a deletion of one nucleic acid, a substitution of two nucleic acids and an insertion of a nucleic acid compared with the core nucleic acid from which it is derived.A variant core nucleic acid sequence may have at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to any one of SEQ ID NOs: 1 to 8 (preferably SEQ ID NO: 1). Typically, a variant core nucleic acid sequence has at least 85% sequence identity (e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity) to any one of SEQ ID NOs: 1 to 8 (preferably SEQ ID NO: 1). In some embodiments, the variant core nucleic acid sequence has at least 90%, at least 91%, at least 94% or at least 97% sequence identity to any one of SEQ ID NOs: 1 to 8 (preferably SEQ ID NO: 1). An aptamer of the invention may comprise or consist of any one of these variant core nucleic acid sequences.A core nucleic acid sequence (or variant thereof) may be between about 30 to about 40 nucleic acids in length. Preferably, a core nucleic acid sequence (or variant thereof) may be between about 35 to about 40 nucleic acids in length, i.e. may be 35, 36, 37, 38, 39 or 40 nucleic acids in length. A core nucleic acid sequence (or variant thereof) may be 36 nucleic acids in length, as in the exemplified aptamers.A core nucleic acid sequence (or variant thereof) preferably further comprises at least one complementary stem structure. Thus, a core nucleic acid sequence preferably further comprises at least a one-base, at least a two-base, at least a three-base, at least a four-base, at least a five-base, at least a six-base, at least a seven-base, at least an eight-base, or at least a nine-base stem. Typically, the core nucleic acid sequence further comprises at least a two-base stem. An aptamer of the invention may comprise or consist of any one of these core nucleic acid sequences (or variants thereof) further comprising a stem (as described herein).In some preferred embodiments, the invention provides an aptamer which comprises or consists of a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414, or 417 to 422 or a sequence which differs from one of SEQID NOs: 25 to 56, 89 to 100, 402 to 414, or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid.In some embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 1 to 414 or 417 to 422 by no more than 40, no more than 30, no more than 20, no more than 15, no more than 10, no more than 5, no more than 3, or no more than 1 nucleic acid.In some embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 1 to 414 or 417 to 422 by no more than 20, no more than 15, preferably no more than 10, more preferably no more than 5, still more preferably no more than 3, or most preferably no more than 1 nucleic acid.In some embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 109, 402 to 414, or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422 by no more than 40, no more than 30, no more than 20, no more than 15, no more than 10, no more than 5, no more than 3, or no more than 1 nucleic acid.In some embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422 by no more than 20, no more than 15, preferably no more than 10, more preferably no more than 5, still more preferably no more than 3, or most preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 109 by no more than 20, no more than 15, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 , 89 to 109 or 402 to 414 (particularly SEQ ID NO: 33, 39, 412 or 413) or a sequence which differs from one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73,81 , 89 to 109 or 402 to 414 (particularly SEQ ID NO: 33, 39, 412 or 413) by no more than 40, no more than 30, no more than 20, no more than 15, preferably no more than 10, more preferably no more than 5, still more preferably no more than 3, or most preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 , 89 to 109 or 402 to 414 (particularly SEQ ID NO: 33, 39, 412 or 413) or a sequence which differs from one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 , 89 to 109 or 402 to 414 (particularly SEQ ID NO: 33, 39, 412 or 413) by no more than 20, no more than 15, no more than 10, no more than 5, preferably no more than 3, or more preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 or 89 to 109 (particularly SEQ ID NO: 33 or 39) or a sequence which differs from one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 or 89 (particularly SEQ ID NO: 33 or 39) to 109 by no more than 40, no more than 30, no more than 20, no more than 15, preferably no more than 10, more preferably no more than 5, still more preferably no more than 3, or most preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 or 89 to 109 (particularly SEQ ID NO: 33 or 39) or a sequence which differs from one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 or 89 (particularly SEQ ID NO: 33 or 39) to 109 by no more than 20, no more than 15, no more than 10, no more than 5, preferably no more than 3, or more preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from any one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 40, no more than 30, no more than 20, no more than 15, preferably no more than 10, more preferably no more than 5, still more preferably no more than 3 nucleic acids, or most preferably no more than 1 nucleic acid.In some preferred embodiments, the invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from any one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 20, no more than 15, no more than 10, more no more than 5, preferably no more than 3 nucleic acids or more preferably no more than 1 nucleic acid.In some preferred embodiments, the invention therefore provides an aptamer which comprises or consists of:(a) a core nucleic acid sequence comprising orconsisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from any one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.The invention provides an aptamer which comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identityto any one of SEQ ID NOs: 1 to 8 and 101 to 109. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem. Preferably said aptamer comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 1 to 8 and 101 to 109, and typically further comprises a at least a two-base stem, preferably at least a three-base stem.The invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identity to any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414, or 417 to 422. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem. Preferably said aptamer comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414, or 417 to 422.The invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identity to any one of SEQ ID NOs: 9 to 24 and 57 to 80. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem. Preferably said aptamer comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 9 to 24 and 57 to 80.The invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identity to any one of SEQ ID NOs: 81 to 88 or 110 to 401 . Preferably said aptamer comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 81 to 88 or 110 to 401.The invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identity to any one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem. Preferably said aptamer comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422. An aptamer of the invention may comprise or consist of any one of SEQ ID NOs: 1 to 109, 402 to 414 or 417 to 422.The invention provides an aptamer which comprises or consists of a nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 70% sequence identity to any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 ,89 to 109 or 402 to 414. Typically said core nucleic acid sequence further comprises at least a two-base stem, preferably at least a three-base stem. Preferably said aptamer comprises or consists of a core nucleic acid sequence comprising or consisting of a nucleic acid sequence which has at least 85%, more preferably at least 90%, even more preferably at least 91%, yet more preferably at least 97% identity to any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 , 89 to 109 or 402 to 414, particularly SEQ ID NO: 33, 39, 412 or 413. An aptamer of the invention may comprise or consist of any one of SEQ ID NOs: 1 , 9, 25, 33, 41 , 49, 57, 65, 73, 81 , 89 to 109 or 402 to 414, particularly SEQ ID NO: 33,39, 412 or 413.An aptamer of the invention may comprise or consist of a nucleic acid sequence comprising or consisting of any one of the SEQ ID NOs of Table 1 .An aptamer of the invention may comprise or consist of a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99% or more identity to any one of the SEQ ID NOs in Tables 1 , 2, 3, 4 or 6. An aptamer of the invention may comprise or consist of a nucleic acid sequence comprising or consisting of any one of the SEQ ID NOs of Table 1 , 2, 3, 4 and 6.In Table 1 , the core nucleic acid sequence of each aptamer is underlined.TABLE 1 : Exemplified aptamer nucleic acid sequencesIn Table 1 , the “C” number refers to a specific aptamer; “-XB” refers to the number of bases (X) in a stem; “core” refers to the core sequence of an aptamer. For example, “C141266 - 9B” refers to a variant of the C141266 comprising a 9-base stem. By way of further example, “C141828 core” refers to the core sequence of the C 141828 aptamer. By way of further example, “C144186” refers to the full-length C144186 aptamer.The invention also provides aptamers comprising or consisting of a variant of any one of the nucleic acid sequences in Table 1. In such variant nucleic acid sequences the corenucleic acid sequence may be modified and / or the non-core nucleic acid sequence (e.g. a complementary stem structure) may be modified.Thus, the invention provides aptamers which comprise or consist of a core nucleic acid sequence selected from SEQ ID NOs 1-8 or a variant thereof. Such an aptamer may be modified at one or more nucleic acid within the core nucleic acid sequence. Whilst specific modifications within the core sequence are exemplified and described further below, the aptamers of the invention are not limited to these specific modifications or combinations thereof.A variant core nucleic acid sequence may comprise one or more amino acid substitutions and / or amino acid deletions, insertions or insertion-deletions (indels) as described herein.The invention provides aptamers in which one or more nucleic acid (e.g. no more than 20, no more than 10, no more than 5, preferably no more than 3, no more than 1 nucleic acid) of the core nucleic acid sequence of an aptamer of the invention is modified. Any nucleic acid of a core nucleic acid sequence may be modified. Where more than one nucleic acid of a core nucleic acid sequence is modified, the position of each nucleic acid to be modified by be independently selected. Each modification may be independently selected from a deletion, an insertion, or a substitution, as defined herein.An aptamer may be modified at position m, wherein position m is defined as the mthnucleotide of the core sequence if the aptamer is arranged in the 5’ to 3’ direction.In some preferred embodiments, a modification may be a deletion. Thus, an aptamer may be modified by a deletion at position m, wherein position m is defined as the mthnucleotide of the core sequence if the aptamer is arranged in the 5’ to 3’ direction.The following illustrates this notation by way of an example:In some embodiments, m = 15 is absent and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401.In this example, the 15thnucleotide of the core sequence is absent. In the case of SEQ ID NO 33:CGACAGTGTAAAGCAGTGATTCTGCATATGTTATTTAGTTGTCGThis means that the 15thresidue of the core sequence, i.e. residue 19 overall, is deleted i.e. absent. The sequence is therefore:CGACAGTGTAAAGCAGTGTTCTGCATATGTTATTTAGTTGTCG (SEQ ID NO: 89). By way of further non-limiting example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 101 .In some embodiments, m = 15 and m = 16 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 91 or 103.In some embodiments, m = 15 and m = 17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 91 or 103.In some embodiments, m = 14 and m = 15 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 92 or 104.In some embodiments, m = 14-16 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 93 or 105.In some embodiments, m = 14, 15 and 17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 93 or 105.In some embodiments, m = 15-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 94 or 106.In some embodiments, m = 13-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 95, 97, 98, 99 or 107.In some embodiments, m = 12, 13 and 15-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 95 or 107.In some embodiments, m = 12-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 96 or 108.In some embodiments, a modification may be a substitution. Thus, an aptamer may be modified by a substitution at position m, wherein position m is defined as the mthnucleotide of the core sequence if the aptamer is arranged in the 5’ to 3’ direction.In some embodiments, a variant core nucleic acid sequence comprises at least two modifications which include at least one deletion and at least one substitution. Thus, an aptamer may be modified by a substitution or a deletion at position m, wherein position m is defined as the mthnucleotide of the core sequence if the aptamer is arranged in the 5’ to 3’ direction.The following illustrates this notation by way of an example:In some embodiments, m = 1 is G, m = 36 is C, m = 15 is absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401.In this example, the 1stnucleotide of the core sequence is G, the 15thnucleotide of the core sequence is absent, and the 36this C. It should be noted that the mthnucleotides are allwith reference to the core nucleic acid sequence, i.e. before any deletions have been made. In the case of SEQ ID NO 33: CGACAGTGTAAAGCAGTGATTCTGCATATGTTATTTAGTTGTCGThis means that the 1stresidue of the core nucleic acid sequence (A) is exchanged for G, and the 36th(T) is exchanged for C. Further, the 15thresidue of the core sequence, i.e. residue 19 overall, is deleted i.e. absent. The sequence is therefore:CGACGGTGTAAAGCAGTGTTCTGCATATGTTATTTAGTCGTCG (SEQ ID NO: 90). By way of further non-limiting example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 102.The use of bold text above illustrates the site(s) of modification.In some embodiments, m = 14 is T, m = 15 and m = 16 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 92 or 104.In some embodiments, m = 14 is T, m = 15-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 93 or 105.In some embodiments, m = 7 is T, m = 13-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 100 or 109.In some embodiments, m = 7 is T, m = 12, 13 and 15-17 are absent, and the sequence is selected from SEQ ID NOs 1-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 100 or 109.Alternatively or in addition to the modification of the core nucleic acid sequence, the non-core nucleic acid sequence of the aptamer may be modified. In particular, the complementary stem structure of an aptamer of the invention may be modified alternatively or in addition to the core nucleic acid sequence. Whilst specific modifications within the non-core nucleic acid sequence are exemplified and described further below, the aptamers of the invention are not limited to these specific modifications or combinations thereof.A variant non-core nucleic acid sequence (e.g. complementary stem structure) may comprise one or more amino acid substitutions and / or amino acid deletions, insertions or insertion-deletions (indels) as described herein.The invention provides aptamers in which one or more nucleic acid (e.g. no more than 20, no more than 10, no more than 5, preferably no more than 3, no more than 1 nucleic acid) of the non-core nucleic acid sequence (e.g. complementary stem structure) of an aptamer of the invention is modified. Any nucleic acid of a non-core nucleic acid sequence (e.g. complementary stem structure) may be modified. Where more than one nucleic acid of a non- core nucleic acid sequence (e.g. complementary stem structure) is modified, the position ofeach nucleic acid to be modified by be independently selected. Each modification may be independently selected from a deletion, an insertion, or a substitution, as defined herein. One or more nucleic acids 5’ or 3’ to the core nucleic acid sequence may be modified.An aptamer may be modified at position p, wherein position p is defined as the pthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 5’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some preferred embodiments, a modification of the non-core nucleic acid sequence (e.g. complementary stem structure) may be a deletion. An aptamer may be modified by a deletion at position p, wherein position p is defined as the pthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 5’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some embodiments, a modification of the non-core nucleic acid sequence (e.g. complementary stem structure) may be a substitution. An aptamer may be modified by a substitution at position p, wherein position p is defined as the pthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 5’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some embodiments, a non-core nucleic acid sequence (e.g. complementary stem structure) comprises at least two modifications which include at least one deletion and at least one substitution. Thus, an aptamer may be modified by a substitution or a deletion at position p, wherein position p is defined as the pthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 5’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.Alternatively or in addition, in some preferred embodiments, an aptamer is modified at position q, wherein position q is defined as the qthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 3’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some preferred embodiments, a modification of the non-core nucleic acid sequence (e.g. complementary stem structure) may be a deletion. An aptamer may be modified by a deletion at position q, wherein position q is defined as the qthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 3’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some embodiments, a modification of the non-core nucleic acid sequence (e.g. complementary stem structure) may be a substitution. An aptamer may be modified by a substitution at position q, wherein position q is defined as the qthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 3’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.In some embodiments, a non-core nucleic acid sequence (e.g. complementary stem structure) comprises at least two modifications which include at least one deletion and at least one substitution. Thus, an aptamer may be modified by a substitution or a deletion at position q, wherein position q is defined as the qthnucleotide of the non-core nucleic acid sequence (e.g. complementary stem structure) 3’ to the core nucleic acid sequence if the aptamer is arranged in the 5’ to 3’ direction.The following illustrates this notation by way of an example:In some embodiments, p = 2 is T, q = 2 is A, m = 13-17 is absent and the sequence is selected from SEQ ID NOs 17-88 and 110 to 401.In this example, the 2nd nucleic acid 5’ to the core nucleic acid is A, which is modified to T, and the 2nd nucleic acid 3’ to the core nucleic acid is T, which is modified to A, and nucleotides 13-17 of the core sequence are absent. In the case of SEQ ID NO 33: CGACAGTGTAAAGCAGTGATTCTGCATATGTTATTTAGTTGTCG This means that the sequence is therefore: CGTCAGTGTAAAGCAGCTGCATATGTTATTTAGTTGACG (SEQ ID NO: 98) The use of bold text above illustrates the site(s) of modification.In some embodiments, p = 2 is C, q = 2 is G, m = 13-17 is absent and the sequence is selected from SEQ ID NOs 17-88 and 110 to 401 . By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 99.In some embodiments, p = 3 is T, q = 3 is A, m = 13-17 is absent and the sequence is selected from SEQ ID NOs 25-88 and 110 to 401. By way of example, a variant nucleic acid sequence modified in this way may comprise or consist of SEQ ID NO: 99.In some embodiments, an aptamer is modified at one or more of positions p, q, and m.In some preferred embodiments, an aptamer of the invention comprises or consists of a core nucleic acid sequence comprising or consisting of any one of the SEQ ID NOs of Table 2 (the core nucleic acid sequences are underlined in Table 2). In some preferred embodiments, an aptamer of the invention comprises or consists of a nucleic acid sequence (core and non- core) comprising or consisting of any one of the SEQ ID NOs of Table 2.TABLE 2: Exemplified variant aptamer nucleic acid sequencesIn Table 2, the “C” number refers to a specific aptamer; “-XB” refers to the number of bases (X) in a stem; “core” refers to the core sequence of an aptamer; “modX” refers to a specific modification. For example, “C1435 -mod23 core” refers to a variant of the C1435 core. By way of further example, “C1435 - 4B mod32” refers to a variant of C1435 with a 4- base stem.As exemplified herein, the invention also provides an aptamer which is a truncated form of SEQ ID NO: 81. This truncated aptamer is provided by SEQ ID NO: 423. For the avoidance of doubt, any and all disclosure herein in relation to the aptamer of SEQ ID NO: 81 applies equally and without reservation to the aptamer of SEQ ID NO: 423. By way of nonlimiting example, the invention provides variants of the aptamer of SEQ ID NO: 423 in which one or more nucleic acid (e.g. no more than 20, no more than 10, no more than 5, preferably no more than 3, no more than 1 nucleic acid) of the core nucleic acid sequence of an aptamerof the invention is modified. Any nucleic acid of a core nucleic acid sequence may be modified. Where more than one nucleic acid of a core nucleic acid sequence is modified, the position of each nucleic acid to be modified by be independently selected. Each modification may be independently selected from a deletion, an insertion, or a substitution, as defined herein. By way of further non-limiting example, a molecular beacon of the invention may comprise an aptamer of SEQ ID NO: 423 or a variant thereof.Molecular beaconsAs discussed above, the aptamers of the invention may advantageously form secondary structure including hair-pin structures. The aptamers may also be labelled, optionally using any label as described herein. In particular, aptamers of the invention may be labelled with a fluorescent label and / or with a quencher. This makes the aptamers ideally suited to applications as aptamer molecular beacons.Molecular beacons are hairpin-shaped molecules, typically oligonucleotides which bind to a target of interest, and which comprise a fluorophore (i.e. a fluorescent label). As will be appreciated by a person of ordinary skill in the art, assays employing double stranded molecular beacons may also be referred to as strand displacement assays. Fluorescence by the fluorophore changes depending on whether the molecular beacon is bound to its target, and so can be used to report the presence and / or amount of the target molecule.A molecular beacon of the invention may comprise an aptamer of the invention, such that the target of said molecular beacon is ddhC. As such, the molecular beacons of the present invention can be used to report the presence of their specific target, ddhC. There are two main types of molecular beacons, which function in different ways - double-stranded molecular beacons (dsMBs) and single-stranded molecular beacons (ssMBs), and these are discussed in more detail below. Both double-stranded molecular beacons and single-stranded molecular beacons, and variations thereof are within the scope of the present invention.As will be appreciated by one of ordinary skill in the art, the fluorescence intensity of a molecular beacon is typically directly proportional or inversely proportional (depending on the nature of the molecular beacon, as described below) to the concentration of the target, (ddhC). This is particularly advantageous because it means that the methods of the invention can determine ddhC concentration quantitatively.It is within the routine practice of one of ordinary skill in the art to select a suitable fluorophore for use in a molecular beacon of the invention. Non-limiting examples are described herein. Thus, a double-stranded molecular beacon or single-stranded molecular beacon of the invention may be labelled with a fluorescent label described herein.In some preferred embodiments, a double-stranded molecular beacon or singlestranded molecular beacon of the invention is labelled with a quencher selected from: blackhole quenchers (BHQ, e.g. BHQ1 or BHQ2), dabcyl quencher, guanine, Iowa Black Quenchers, and TAMRA.Double-stranded molecular beaconsAn aptamer of the invention may form part of a double-stranded molecular beacon (dsMB).A dsMB comprises a first oligonucleotide with a fluorophore at the 5’ or 3’ end and a second oligonucleotide with a quencher at the 5’ or 3’ end. The first oligonucleotide binds to the target. Typically the fluorophore and the quencher are at opposite ends of their respective oligonucleotides. Preferably, the first oligonucleotide has a fluorophore at the 5’ end and the second oligonucleotide has a quencher at the 3’ end.The first oligonucleotide comprises a first region of nucleic acid sequence that is reverse complementary with a second region of nucleic acid sequence comprised in the second oligonucleotide. Thus, in the absence of the target, the first region of nucleic acid sequence in the first oligonucleotide complements the complementary second region of nucleic acid sequence comprised in the second oligonucleotide, such that the first and second oligonucleotides are bound via this complementarity. This brings the fluorophore and the quencher into proximity, such that the quencher prevents the fluorophore from fluorescing. Thus, in the absence of the target, no fluorescent signal is emitted from the dsMB. In the presence of the target, binding of the target to the first oligonucleotide induces a conformational change, such that the second oligonucleotide dissociates from the first oligonucleotide. Thus, the quencher and the fluorophore are no longer in proximity, and the fluorophore emits a fluorescent signal. When dsMBs are used to detect a target of interest, the size of the signal emitted typically increases with the concentration of the target.A dsMB of the invention may comprise an aptamer of the invention as the first oligonucleotide. Thus, a dsMB may comprise an aptamer of the invention with a fluorophore at the 5’ or 3’ end, preferably at the 5’ end.As discussed above, to allow for association of the first oligonucleotide and the second oligonucleotide of a dsMB, the first and second oligonucleotides must comprise regions of nucleic acid sequences which are reverse complementary. These regions must not interfere with the target-binding region of the first oligonucleotide. Therefore, the first oligonucleotide typically has a complementary stem structure.Therefore, a dsMB may comprise an aptamer of the invention with a fluorophore at the 5’ or 3’ end, preferably at the 5’ end, wherein the aptamer has a complementary stem structure, as described herein. Typically a dsMB may comprise an aptamer of the invention with a fluorophore at the 5’ or 3’ end, preferably at the 5’ end, wherein the aptamer has a one-base, at least about a two-base, at least about a three-base, at least about a four-base, at leastabout a five-base, at least about a six-base, at least about a seven-base, at least about an eight-base, or at least about a nine-base complementary stem, as described herein, preferably at least about a two-base stem.The second oligonucleotide of a dsMB (also referred to as the capture probe) comprises a region of nucleic acid sequence that is reverse complementary to a region of nucleic acid sequence in the first oligonucleotide. Typically the second oligonucleotide of a dsMB comprises a region of nucleic acid sequence that is reverse complementary to a region of nucleic acid sequence at the labelled end of the first oligonucleotide. Thus, the second oligonucleotide of a dsMB comprises a region of nucleic acid sequence that is reverse complementary to the labelled end of the primer and comprises a quenching molecule at the 3’ end when the first oligonucleotide is fluorescently labelled at the 5’ end. Alternatively, the second oligonucleotide of a dsMB comprises a region of nucleic acid sequence that is reverse complementary to the labelled end of the primer and comprises a quenching molecule at the 5’ end when the first oligonucleotide is fluorescently labelled at the 3’ end. General schematics of double-stranded molecular beacons are shown in FIG. 4A-C.Thus, where a dsMB of the invention comprises an aptamer of the invention as the first oligonucleotide, the second oligonucleotide typically comprises a region of nucleic acid sequence that is reverse complementary to all or at least part of the stem region of said aptamer.The invention provides a dsMB comprising or consisting of (i) a first oligonucleotide which is an aptamer (e.g. an aptamer of the invention) which has a fluorescent label (fluorophore) at the 5’ and / or 3’ end, preferably at the 5’ end, and (ii) a second oligonucleotide with a quencher at the 5’ or 3’ end. The second oligonucleotide comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end.In other words, the invention provides a dsMB comprising or consisting of (a) an aptamer of the invention comprising a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end; and (b) a second oligonucleotide comprising a region of nucleic acid sequence that is reverse complementary to the labelled end of the aptamer, wherein said second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end.Accordingly, the invention provides an aptamer as described herein which is labelled, wherein optionally the aptamer has a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end, and optionally said aptamer forms part of a double-stranded molecular beacon. Methods of the invention typically then further comprises the use of a second oligonucleotidewhich comprises a region of nucleic acid sequence that is reverse complementary to the labelled end of the aptamer, wherein said second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end. The fluorescent label may be a fluorescein amidite (FAM) and / or the quencher may be a black hole quencher, dabcyl quencher or guanine. The fluorescent label may be selected from Cy5 and Alexa647, and / or the quencher may be a black hole quencher, dabcyl quencher or guanine.It is within the routine practice of one of ordinary skill in the art to select suitable fluorophores and quenchers for use in a molecular beacon of the invention. Non-limiting examples are described herein. By way of non-limiting example, the fluorescent label may be a fluorescein amidite (FAM), Cy5 or Alexa647. Alternatively or in addition, the quencher may be a black hole quencher, dabcyl quencher or guanine. In some preferred embodiments, the fluorescent label may be a fluorescein amidite (FAM) and the quencher may be a black hole quencher. In other embodiments, the fluorescent label is selected from Cy5 and Alexa647, and the quencher may be a black hole quencher.The second oligonucleotide (i.e. the capture probe) may be at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11 , at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 nucleic acids in length.The second oligonucleotide may be about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11 , about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, or about 100 nucleic acids in length.The second oligonucleotide may be between about 3 to about 100, between about 4 to about 90, between about 5 to about 80, between about 6 to about 70, between about 7 to about 60, between about 8 to about 50, between about 9 to about 40, between about 10 to about 30, between about 10 to about 28, or between about 10 to about 26, between about 10 to about 24, between about 10 to about 22, between about 10 to about 20 nucleic acids in length. Typically the second oligonucleotide is between about 10 to about 30 nucleic acids in length. In some preferred embodiments, the second oligonucleotide is between about 10 to about 15 nucleic acids in length, more preferably about 13 nucleic acids in length.As described herein, aptamers of the invention typically comprise at least one complementary stem structure. As one of ordinary skill in the art will appreciate, thecharacteristics of the at least one stem structure described above may apply equally to the structure of the dbMBs of the invention.The 5’ and 3’ ends of the first oligonucleotide of the dsMB (e.g. an aptamer of the invention) may be truncated at different points, such that the 5’ and 3’ ends are of different lengths, creating an overhang. This has the beneficial effect of increasing the size of the complementary region between the first and second oligonucleotides, meaning that the second oligonucleotide preferentially binds to the longer end of the first oligonucleotide (as opposed to the other end of the first oligonucleotide), reducing fluorescent signal in the absence of the target. If the two ends of the first oligonucleotide (e.g. aptamer of the invention) were the same length, these ends would preferentially hybridise instead of binding with the second oligonucleotide. Accordingly, there may be an overhang at the 5’ end when the aptamer is fluorescently labelled at the 5’ end. Alternatively, there may be an overhang at the 3’ end when the aptamer is fluorescently labelled at the 3’ end.The overhang may be at least about 1 , at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11 , at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20 nucleic acids in length.The overhang may be about 1 , about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11 , about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20 nucleic acids in length.The overhang may be between about 1 to about 20, between about 1 to about 18, between about 1 to about 16, between about 1 to about 14, between about 1 to about 12, between about 1 to about 10, between about 1 to about 9, between about 1 to about 8, between about 2 to about 8, between about 3 to about 8, between about 3 to about 7, between about 4 to about 7, between about 4 to about 6 nucleic acids in length. Typically the overhang may be between about 2 to about 8 nucleic acids in length. In some preferred embodiments, the overhang is about 5 nucleic acids in length.Single-stranded molecular beaconsAs described above, the molecular beacons of the present invention can be used to report the presence of a specific target, ddhC. As an alternative to dsMBs, the present invention also relates to single-stranded molecular beacons (ssMBs). Typically, ssMBs comprise a single oligonucleotide comprising a fluorophore. A ssMB may further comprise a quencher. General schemes showing single-stranded molecular beacons are shown in FIG. 5A and 5B. The single oligonucleotide of a ssMB of the invention may be an aptamer, particularly an aptamer as described herein.In ssMBs comprising both a fluorophore and a quencher, in the absence of target (i.e. ddhC in the present invention) the ssMB typically adopts an open configuration, such that the fluorophore and quencher are not in close proximity, allowing the fluorophore to fluoresce. In the presence of the target, a conformational change occurs such that the oligonucleotide forms a stem loop (hair-pin) structure. This brings the fluorophore and quencher into close proximity, such that fluorescence is quenched and not observed. Thus, when ssMBs of this type are used to detect a target of interest, the size of the signal emitted typically decreases with the concentration of the target.Alternatively, ssMBs comprising both a fluorophore and a quencher, in the absence of target (i.e. ddhC in the present invention) the ssMB may form a stem loop (hair-pin) structure, such that the fluorophore and quencher are in close proximity, quenching fluorescence. In the presence of the target, a conformational change occurs such that the oligonucleotide adopts an open structure, allowing the fluorophore to fluoresce. Thus, when ssMBs of this type are used to detect a target of interest, the size of the signal emitted typically increases with the concentration of the target.Thus a ssMB may be labelled with a fluorescent label and a quencher. The label and / or quencher may each be attached at any base of the aptamer. Typically, the label and / or quencher are attached at the ends of the aptamer. Thus, the ssMB may be labelled with a fluorescent label at the 5’ end and a quencher at the 3’ end. The ssMB may be labelled with a fluorescent label at the 3’ end and a quencher at the 5’ end.A ssMB of the invention may comprise an aptamer of the invention as the oligonucleotide. Thus, a ssMB may comprise an aptamer of the invention with (i) a fluorophore at the 5’ or 3’ end, preferably at the 3’ end; and / or (ii) a quencher at the 5’ or 3’ end, preferably at the 5’ end.It is within the routine practice of one of ordinary skill in the art to select suitable fluorophores and quenchers for use in a molecular beacon of the invention. Non-limiting examples are described herein. By way of non-limiting example, the fluorescent label may be a fluorescein amidite (FAM), Cy5 or Alexa647. Alternatively or in addition, the quencher may be a black hole quencher, dabcyl quencher or guanine. In some preferred embodiments, the fluorescent label may be a fluorescein amidite (FAM) and the quencher may be a black hole quencher. In other embodiments, the fluorescent label is selected from Cy5 and Alexa647, and the quencher may be a black hole quencher.In all types of ssMB described above, the oligonucleotide (e.g. an aptamer of the invention) comprises at least one complementary stem structure. As one of ordinary skill in the art will appreciate, the characteristics of the at least one stem structure described above in relation to aptamers of the invention applies equally and without reservation to the structure of the ssMBs of the invention.The invention also provides an aptamer as described herein which is labelled, wherein optionally the aptamer has (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end. Optionally the fluorescent label may be a fluorescein amidite (FAM) or thioflavin T and / or the quencher is black hole quencher, dabcyl quencher or guanine.Thus, the invention provides a ssMB comprising or consisting of (a) an aptamer of the invention comprising (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end. Optionally the fluorescent label may be a fluorescein amidite (FAM) or thioflavin T and / or the quencher is black hole quencher, dabcyl quencher or guanine.Dye DisplacementAs described herein, the binding members, and particularly the aptamers, of the invention may be used in methods of detecting ddhC and method of diagnosing a viral infection.The binding members of the invention may be in the form of molecular beacons as described above for use in such methods. Alternatively, the binding members, and particularly the aptamers, of the invention may be used in methods for detecting ddhC and / or diagnosing viral infections by dye displacement.In dye displacement, a binding member, particularly an aptamer, of the invention may be used with a dye, such as thioflavin T, and no quencher. In dye displacement methods, the aptamer forms a stem loop (hair-pin) in the absence of the target (ddhC according to the invention), and the fluorophore is constrained by the aptamer, resulting in a signal. In the presence of the target (ddhC), ddhC displaces the fluorophore for binding to the aptamer, such that fluorescence decreases.Dye displacement differs from the molecular beacons described above as: (i) the dye is not covalently bound to the aptamer; and (ii) no quencher is involved.The invention therefore also provides an aptamer of the invention for use with a dye and no quencher, wherein the dye binds to the aptamer in the absence of the target (ddhC) and is displaced by ddhC. Optionally the dye may be thioflavin T. Optionally, the dye may be selected from SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751 . For the avoidance of doubt, the term “SYTOX®” as used herein is intended to refer to the family of SYTOX® dyes. A person of ordinary skill in the art will be aware of a number of SYTOX® dyes including SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue.LabelsAs described herein, the binding member of the invention may be labelled. It is within the routine practice of one of ordinary skill in the art to select a suitable label for use with a binding member of the invention. Non-limiting examples are described herein. The label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label, a luminescence label, a radioactivity label, and a dye.Preferably, the label may be a fluorescent label. Non-limiting examples of fluorescent labels include: 5-(and 6)-carboxyfluorescein, 5-or 6-carboxyfluorescein, 6-(fluorescein)-5- (and 6)-carboxamido hexanoic acid, fluorescein isothiocyanate (FITC), rhodamine, tetramethylrhodamine, dyes such as Cy2, Cy3, and Cy5, optionally substituted coumarin including AMCA, PerCP, Texas Red, phycobiliproteins including R-phycoerythrin (RPE) and allophycoerythrin (APC), Princeton Red, Green fluorescent protein (GFP) and analogues thereof, and conjugates of R-phycoerythrin or allophycoerythrin and e. g. Cy5 or Texas Red, and inorganic fluorescent labels based on semiconductor nanocrystals (like quantum dot and nanocrystals), and time-resolved fluorescent labels based on lanthanides like Eu3+and Sm3+, haptens such as DNP, biotin, and digoxiginin, enzymatic labels such as horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase (GAL), glucose-6- phosphate dehydrogenase, beta-N-acetylglucosaminidase, R-glucuronidase, invertase, Xanthine Oxidase, firefly luciferase and glucose oxidase (GO). Preferably, the fluorescent label is selected from fluorescein amidite (FAM) and thioflavin T.The fluorescent label may be a simple fluorescent label selected from: Fluor dyes, Pacific Blue™, Pacific Orange™, Cascade Yellow™, AlexaFluor®(AF), AF405, AF488, AF500, AF514, AF532, AF546, AF555, AF568, AF594, AF610, AF633, AF635, AF647, AF680, AF700, AF710, AF750, AF800, Quantum Dot based dyes, QDot® Nanocrystals, Qdot®525, Qdot®565, Qdot®585, Qdot®605, Qdot®655, Qdot®705, Qdot®800, DyLight™ Dyes (Pierce) (DL), DL549, DL649, DL680, DL800, fluorescein (Flu) or a derivate thereof, Cy-Dyes, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, 5,6,7-trimethyl-1 ,8-naphthyridin-2-amine (ATMND), thiazole orange, fluorescent proteins, RPE, PerCp, APC, green fluorescent proteins, GFP and GFP derived mutant proteins, BFP, CFP, YFP, DsRed, T1 , Dimer2, mRFP1 , MBanana, mOrange, dTomato, tdTomato, mTangerine, mStrawberry, mCherry, tandem dyes, RPE-Cy5, RPE- Cy5.5, RPE-Cy7, RPE-AlexaFluor® tandem conjugates; RPE-Alexa610, RPE-TxRed, APC- Aleca600, APC-Alexa610, APC-Alexa750, APC-Cy5, APC-Cy5.5, multi fluorochrome assemblies, multiple fluorochromes attached to a polymer molecule, such as a peptide / protein, Dextran, polysaccharide.The label may be a luminescence label. Non-limiting examples of luminescence labels include: luminol, isoluminol, acridinium esters, 1 ,2-dioxetanes, and pyridopyridazines.The label may be a radiolabel. Non-limiting examples of radiolabels include: bromine77, carbon14, cobalt57, fluorine8, gallium67, gallium68, hydrogen3(tritium), indium111, indium113™, iodine123™, iodine125, iodine126, iodine131, iodine133, mercury107, mercury203, phosphorous32, rhenium99™, rhenium101, rhenium105, ruthenium95, ruthenium97, ruthenium103, ruthenium105, scandium47, selenium75, sulphur35, technetium99, technetium99™, tellurium121™, tellurium122™, tellurium125™, thulium165, thulium167, thulium168and yttrium199The label may be a chemiluminescent label, for example a biochemiluminescent label. The label may be a redox active label, for example ferrocene or a derivative thereof.Other non-limiting examples of labels include particles, such as latex or carbon particles, metal sol, crystallite, liposomes, cells, etc., which may be further labelled with a dye, catalyst or other detectable group; molecules such as biotin, digoxygenin or 5- bromodeoxyuridine; toxin moieties, such as for example a toxin moiety selected from a group of Pseudomonas exotoxin (PE or a cytotoxic fragment or mutant thereof), Diptheria toxin or a cytotoxic fragment or mutant thereof, a Botulinum toxin A, B, C, D, E or F, ricin or a cytotoxic fragment thereof e.g. ricin A, abrin or a cytotoxic fragment thereof, saporin or a cytotoxic fragment thereof, pokeweed antiviral toxin or a cytotoxic fragment thereof and bryodin 1 or a cytotoxic fragment thereof.Accordingly, the invention provides a binding member selected from an aptamer, an antibody or fragment thereof, a molecularly imprinted polymer (MIP), a small molecule, a peptide and a peptidomimetic; wherein said binding member is labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye.Alternatively, the binding member of the invention is not labelled. In such embodiments, a non-covalently bound dye may be employed, for example ThT, Cy5, Cy7, 5,6,7-trimethyl- 1 ,8-naphthyridin-2-amine (ATMND), thiazole orange, SYBR green I, SYBR green II or SYBR gold (see e.g. FIG 8).MethodsAs described in detail herein, the present inventors are the first to provide binding members that are (i) specific for ddhC and (ii) which are capable of binding to unmodified ddhC. Thus, the present inventors are the first to enable methods of detecting ddhC that do not rely on the direct detection of ddhC using techniques such as mass spectrometry. The binding members of the present invention, therefore, have the potential to facilitate pan-viral detection using techniques which can be readily applied in the clinic, without needing bulky and expensive equipment such as mass spectrometers.Accordingly, the present invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with a binding member that is specific for ddhC.Any binding member of the invention may be used in such a method. For example, the invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with aptamer that is specific for ddhC. The aptamer may be any as described herein.In some preferred embodiments, the invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with aptamer that is specific for ddhC, wherein said aptamer comprises or consists of SEQ ID NOs 1 to 109, or a variant thereof as described herein.The invention provides a method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with aptamer that is specific for ddhC, wherein said aptamer comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109, or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422, or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 30, no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80, or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 , or a sequence which differs from any one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.Said method may not require the modification of ddhC. Typically, the method does not comprise the modification of ddhC. By “modification of ddhC”, it is meant that the ddhC in the sample does not have to have its physical or chemical properties altered in order for it to be detected and / or that the method does not require the addition of modified ddhC. Preferably, the method does not comprise the modification of ddhC in the same and does not comprisethe addition of modified ddhC. By way of non-limiting example, the ddhC does not need to be modified by labelling or by enzymatic digestion. Preferably the ddhC does not need to be labelled in order for it to be detected using a method of the invention. This is a significant advantage because the lack of a need to modify ddhC (either that within the sample, or exogenous ddhC for addition to the sample) greatly simplifies the process, saves time, and reduces costs.Accordingly, the invention also provides a method for the detection of ddhC in a fluid sample, comprising or consisting of contacting the sample with a binding member that is specific for ddhC, wherein the method does not comprise the modification of ddhC. Optionally wherein said modification is labelling the ddhC.Again, any binding member of the invention may be used in such a method. For example, the invention provides a method for the detection of ddhC in a fluid sample, comprising or consisting of contacting the sample with an aptamer that is specific for ddhC, wherein the method does not comprise the modification of ddhC. The aptamer may be any as described herein. Optionally said modification is labelling the ddhC.In some preferred embodiments, the invention provides a method for the detection of ddhC in a fluid sample, comprising or consisting of contacting the sample with a binding member that is specific for ddhC, wherein the method does not comprise the modification of ddhC, wherein said aptamer comprises or consists of SEQ ID NOs 1 to 109.The invention provides a method forthe detection of ddhC in a fluid sample, comprising or consisting of contacting the sample with a binding member that is specific for ddhC, wherein the method does not comprise the modification of ddhC, wherein said aptamer comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109, or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 20, no more than 10, no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422, or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 30, no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80, or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to80 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 , or a sequence which differs from any one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.A significant advantage of the methods of the invention is their high sensitivity and the ability to detect low concentrations of ddhC. This is particularly advantageous in the context of detecting ddhC in biological samples because the concentration is often too low for conventional techniques to detect. Using the methods of the present invention, patients may be diagnosed as presenting with an active viral infection during the early stages of infection, and before symptoms progress significantly. This is beneficial because it means that immunosuppressed subjects, e.g. those suffering from a disease or condition that weakens the immune system, or patients that have recently undergone chemotherapy and / or radiotherapy, may be administered vital antiviral medication before the active viral condition worsens. Further, the methods of the invention are advantageously able to detect concentrations of ddhC in fluid samples from patients during recovery from viral infections. As will be apparent to those of ordinary skill in the art, ddhC concentrations decrease during the recovery process so having methods with low limits of detection is particularly important.The methods of the invention may advantageously have a limit of detection of ddhC below that of conventional ddhC detection methods described in the art.As exemplified herein, the limit of detection of ddhC using a binding member of the invention is about 10 pM or less, about 9 pM or less, about 8 pM or less, about 7 pM or less, about 6 pM or less, about 5 pM or less, about 4 pM or less, about 3 pM or less, about 2 pM or less, about 1 pM or less, about 0.95 pM or less, about 0.90 pM or less, about 0.85 pM or less, about 0.8 pM or less, about 0.75 pM or less, about 0.70 pM or less, about 0.65 pM or less, about 0.60 pM or less, about 0.55 pM or less, about 0.50 pM or less, about 0.45 pM or less, about 0.40 pM or less, about 0.35 pM or less, about 0.30 pM or less, about 0.25 pM or less, about 0.20 pM or less, about 0.15 pM or less, about 0.10 pM or less, or about 0.05 pM or less.Preferably, the limit of detection of ddhC is about 1 pM or less, more preferably about 0.5pM or less, for example about 0.30 pM or less or about 0.09 pM or less. Different methods of the invention may have different limits of detection. As exemplified herein, the limit of detection of ddhC using a binding member of the invention in a molecular beacon method disclosed herein is about 10 pM or less, about 9 pM or less, about 8 pM or less, about 7 pM or less, about 6 pM or less, about 5 pM or less, about 4 pM or less, about 3 pM or less, about 2 pM or less, about 1 pM or less, about 0.95 pM or less, about 0.90 pM or less, about 0.85 pM or less, about 0.8 pM or less, about 0.75 pM or less, about 0.70 pM or less, about 0.65pM or less, about 0.60 pM or less, about 0.55 pM or less, about 0.50 pM or less, about 0.45 pM or less, about 0.40 pM or less, about 0.35 pM or less, or about 0.30 pM or less. Preferably, the limit of detection of ddhC using a binding member of the invention in a molecular beacon method disclosed herein is about 0.3 pM.As exemplified herein, the limit of detection of ddhC using a binding member of the invention in a dye displacement method disclosed herein is about 10 pM or less, about 9 pM or less, about 8 pM or less, about 7 pM or less, about 6 pM or less, about 5 pM or less, about 4 pM or less, about 3 pM or less, about 2 pM or less, about 1 pM or less, about 0.95 pM or less, about 0.90 pM or less, about 0.85 pM or less, about 0.8 pM or less, about 0.75 pM or less, about 0.70 pM or less, about 0.65 pM or less, about 0.60 pM or less, about 0.55 pM or less, about 0.50 pM or less, about 0.45 pM or less, about 0.40 pM or less, about 0.35 pM or less, about 0.30 pM or less, about 0.25 pM or less, about 0.20 pM or less, about 0.15 pM or less, about 0.10 pM or less, or about 0.09 pM or less. Preferably, the limit of detection of ddhC using a binding member of the invention in a dye displacement method disclosed herein is about 0.09 pM.A variety of different binding members may be used in the methods of the invention. As described herein, the binding member, through chemical or physical means, specifically binds to ddhC. The binding member may be selected from: an aptamer, an antibody or fragment thereof, and complexes thereof including those formed by recombinant DNA methods or peptide synthesis, a molecularly imprinted polymer (MIP), a small molecule, haptens, a peptide and a peptidomimetic. Preferably, a binding member of the invention is an aptamer, such as those described in detail herein.ApplicationsThe binding member and methods of the invention, and particularly the aptamers and molecular beacons of the invention, are particularly useful for diagnosing viral infections because ddhC is present in elevated levels in the serum of subjects with viral infections.Importantly, the presence of ddhC in a subject indicates an active viral infection, and is not specific to any particular viral infection. Therefore ddhC can be used as a pan-viral marker for active viral infections.Therefore, a method for diagnosing a viral infection according to the invention is typically a method for diagnosing an active viral infection. ddhC is a non-specific viral biomarker, so the methods of the present invention may be used to diagnose a broad range of different viral infections.The viral infection may be selected from: respiratory viral diseases; flu; common cold; respiratory syncytial virus infection; adenovirus infection; parainfluenza virus infection; severe acute respiratory syndrome (SARS); gastrointestinal viral diseases; norovirus; rotavirus;astrovirus; exanthematous viral diseases; measles; rubella; shingles; roseola; smallpox; fifth disease; chikungunya virus infection; hepatic viral diseases; hepatitis A, B, C, D, E; cutaneous viral diseases; warts; oral herpes; genital herpes; molluscum contagiosum; hemorrhagic viral diseases; ebola; lassa fever; coronavirus; dengue fever; yellow fever; marburg hemorrhagic fever; Crimean-Congo hemorrhagic fever; neurologic viral diseases; polio; meningitis (viral meningitis); viral encephalitis; rabies; HIV / AIDS; Zika virus; enterovirus; respiratory syncytial virus (RSV); adenovirus; mpox; cytomegalovirus (CMV) and sexually transmitted infections. In some preferred embodiments, the viral infection may be meningitis or a respiratory virus, such as SARS-CoV-2.The subject may be suffering from more than one active viral infection.In some preferred embodiments, a method of the invention is used to diagnose an active virus infection, wherein the precise nature of the viral infection is not required or not essential. In other words, by diagnosing an active viral infection (irrespective of the nature of said infection), a clinician may then be able to treat a subject with antiviral therapy, preferably broad-spectrum antiviral therapy, reducing viral load and disease burden, even without the nature of the viral infection being known.Advantageously, the low limit of detection of ddhC means that patients may be diagnosed as having a viral condition before symptoms progress significantly. This has many important applications, for example it means that immunosuppressed subjects may be administered vital antiviral medication before the active viral condition worsens. In some embodiments, the patient suffering from an active viral condition is asymptomatic.Accordingly, the subject to be diagnosed may be immunosuppressed. The immunosuppressed subject may have recently undergone chemotherapy and / or radiotherapy. The immunosuppressed subject may be taking or has recently taken medication that suppresses the immune system, for example immunosuppressants, corticosteroids, and / or tumor necrosis factor (TNF) inhibitorsThe immunosuppressed subject may suffer from or be at risk of a disease or condition that weakens the immune system, for example rheumatoid arthritis, lupus e.g. systemic lupus erythematosus, inflammatory bowel disease, multiple sclerosis, type 1 diabetes, Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy, psoriasis, Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, vasculitis, Crohn's disease, HIV, AIDS, liver disease, kidney disease, multiple myeloma, common variable immunodeficiency, and / or BENTA disease.Alternatively or in addition, the immunosuppressed subject may be pregnant or have undergone an organ transplant.As one of ordinary skill in the art will appreciate, in order to diagnose a viral infection, particularly an active viral infection, there is typically a comparison of the ddhC concentrationdetermined by the methods of the present invention with standard values i.e. ddhC concentrations commonly found in samples from patients suffering from a viral infection, and those found in samples from patients that are not suffering from a viral infection.Thus, determination of ddhC concentrations above a relevant clinical threshold may be diagnostic of an active viral infection. The threshold level of ddhC for diagnosing a viral infection may depend on the sample type in question. Accordingly, a ddhC concentration of at least 50 ng / mL, at least 75 ng / mL, or at least 100 ng / mL, preferably at least 100 ng / mL may be diagnostic of a viral infection, particularly an active viral infection. In particular, a ddhC concentration of at least 50 ng / mL, at least 75 ng / mL, or at least 100 ng / mL, preferably at least 100 ng / mL, in serum, plasma, blood and / or CSF may be diagnostic of a viral infection, particularly an active viral infection.A ddhC concentration of at least 0.25 pmol / L, at least 0.30 pmol / L, at least 0.40 pmol / L, or 0.44 pmol / L may be diagnostic of a viral infection, particularly an active viral infection. In particular, a ddhC concentration of at least 0.25 pmol / L, at least 0.30 pmol / L, at least 0.40 pmol / L, or 0.44 pmol / L, in serum, plasma, blood and / or CSF may be diagnostic of a viral infection, particularly an active viral infection.In view of the ability of the methods and binding members of the invention to detect low levels of ddhC, the invention may be used to diagnose early-stage viral infections, whilst a subject is asymptomatic, or exhibiting only minor symptoms or symptoms not unique to / definitive of a viral infection. Thus, subjects with a viral infection can be detected rapidly and at an early stage, allowing them to be treated before they spread the virus or minimising the number of further individuals infected on contact with the infected subject. As such, methods of the invention may be of particular use in an epidemic. Thus, the methods may be used in epidemic preparedness. Alternatively or in addition, methods of the invention may be of particular use in a pandemic. Thus, the methods may be used in pandemic preparedness.Method of the invention may also be used for differentiating between viral and non- viral infections. In particular, the methods may be used for differentiating between viral and non-viral meningitis.As well as having valuable clinical applications in humans, the methods of the invention may be used for identifying the presence of an active viral population in an animal or population of animal. The animal may be livestock. Non-limiting example of livestock include: horse, cow, donkey, deer, yak, water buffalo, sheep, goat, reindeer, camel, llama, pig, chicken, boar, rabbit, guinea pig, duck, turkey, and quail. Alternatively or in addition, the animal may be a companion animal. Non-limiting examples of companion animals include: dog, cat, rabbit, guinea pig, monkey, ferret, fox, bird, reptile, fish, and horse.The viral infection to be diagnosed may be any of those recited above or any combination thereof. Preferably, a method of the invention is used to diagnose a viral infectionwherein the precise nature of the viral infection is not required or not essential. The methods and binding members of the invention may be combined with one or more additional diagnostic test. In particular, having identified an active viral infection using a method or binding member of the invention, one or more further diagnostic test to determine the precise nature of the viral infection may be carried out. In this way, a subject may be treated with antiviral therapy (particularly broad-spectrum antiviral therapy) at the earliest opportunity, and subsequently treated with more targeted antiviral therapy once the precise nature of the viral infection is known.The methods of the invention may be used for identifying the presence of an active viral population in a plant or population of plants.The methods and binding members of the invention may be used for research. By research use, it is meant any application which does not result in a clinical diagnosis of a viral infection. Clinical diagnoses are typically those that are then relied upon by a clinician to decide a treatment plan.The methods of the invention may be used for confirming an active viral infection when a second diagnostic test has detected the presence of a virus and / or one or more viral biomarker. The second diagnostic test may be carried out sequentially (before or after) or simultaneously with a method of the invention. The second diagnostic test may be a PCR, an antigen test, a serology test, a lateral flow test, an electrochemical sensor, or a dipstick. The second diagnostic test may be the same format as that used in the method of the invention. Alternatively, the second diagnostic test is not the same as the method used for confirming an active viral infection.The methods and binding members of the invention may be used to confirm the presence or absence of viral infection in a subject suspected of having a viral infection when one or more first line diagnostic tests have come back negative. The first line diagnostic test may be PCR, an antigen test, a serology test, a lateral flow test, an electrochemical sensor, or a dipstick. The first line diagnostic test may be the same format as that used in the method of the invention. Alternatively, the first line diagnostic test may not the same as the method used for confirming the presence or absence of an active viral infection.Accordingly, the method of diagnosing a viral infection can be used:(a) in disease X testing and pandemic preparedness;(b) for differentiating between a viral infection and a non-viral state (e.g. non-virus mediated inflammation; a bacterial or fungal infection, a healthy control);(c) for differentiating between viral and non-viral infections;(d) for differentiating between viral and non-viral meningitis;(e) for identifying the presence of an active viral infection in an animal, particularly livestock, or population thereof;(f) for identifying the presence of an active viral infection in a plant, or population thereof;(g) for research use;(h) for confirming an active viral infection when a second diagnostic test has detected the presence of a virus and / or one or more viral biomarker; and / or(i) to confirm the presence or absence of viral infection in a subject suspected of having a viral infection when first line diagnostic tests have come back negative.A method of diagnosing a viral infection in a subject according to the invention may further comprise or consist of treating said subject with antiviral therapy, optionally with broadspectrum antiviral therapy.Any appropriate antiviral therapy may be used. By way of non-limiting example, the antiviral therapy may be selected from: 5-substituted 2’-deoxyuridine analogues, nucleoside analogues, pyrophosphate analogues, nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, protease inhibitors, integrase inhibitors, entry inhibitors, acyclic guanosine analogues, acyclic nucleoside phosphonate analogues, HCV NS5A / NS5B inhibitors, influenza virus inhibitors, interferons, immunostimulators, oligonucleotides, antimitotic inhibitors, and combinations thereof.By way of further non-limiting example, the antiviral therapy may be selected from: azidouridine, anasmycin, amantadine, bromovinyldeoxusidine, chlorovinyldeoxusidine, cytarbine, didanosine, deoxynojirimycin, dideoxycitidine, dideoxyinosine, dideoxynucleoside, desciclovir, deoxyacyclovir, edoxuidine, enviroxime, fiacitabine, foscamet, fialuridine, fluorothymidine, floxuridine, hypericin, interferon, interleukin, isethionate, nevirapine, pentamidine, ribavirin, rimantadine, stavirdine, sargrarnostin, suramin, trichosanthin, tribromothymidine, trichlorothymidine, vidarabine, zidoviridine, zalcitabine and 3-azido-3- deoxythymidine, and combinations thereof.The antiviral therapy may be an HIV antiviral therapy selected from: HIV protease inhibitors, HIV reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or allosteric) integrase inhibitors, HIV entry (fusion) inhibitors, HIV maturation inhibitors, latency reversing agents, capsid inhibitors, immune-based therapies, PI3K inhibitors, HIV antibodies, and bi specific antibodies, “antibody-like” therapeutic proteins, and combinations thereof.The antiviral therapy may be an influenza antiviral therapy selected from: influenza virus adsorption inhibitors, M2 inhibitors, IMP dehydrogenase inhibitors, RNA polymerase inhibitors, influenza-specific interfering oligonucleotides, neuraminidase inhibitors, and combinations thereof.By way of non-limiting example, the viral infection may be meningitis and the antiviral therapy may be pleconaril, acyclovir, valaciclovir, ganciclovir and / or foscarnet.As a person of ordinary skill in the art will appreciate, the sample used in the method originates from the subject. A sample may be selected from: blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid (CSF), synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like. A sample may be selected from interstitial fluid, bile fluid, vaginal fluid, and sweat and the like.Accordingly, the sample is a biological material, optionally selected from blood, plasma, saliva, serum, sputum, urine, CSF, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, and stool. The biological material may be selected from interstitial fluid, bile fluid, vaginal fluid, and sweat.By way of non-limiting example, the sample may be CSF and the viral infection may be meningitis, for example viral meningitis or non-viral meningitis.By way of further non-limiting example, the sample may be serum and the viral infection may be RSV. ddhC detectionUsing the methods and / or binding members of the invention, a viral infection may be diagnosed by detecting the presence of ddhC. Using the methods and / or binding members of the invention, the presence of ddhC can be detected.Accordingly, the invention provides a method of detecting ddhC using a binding member as described herein.A technique is used to detect ddhC in the method of the present invention. Many different techniques are compatible with the methods of the present invention as will be apparent to those of ordinary skill in the art.Accordingly, the detection of ddhC may be by any appropriate technique, optionally selected from an aptamer-based fluorescence assay, enzyme-linked oligonucleotide assay (ELONA), electrochemical detection, aptamer-nanoparticle (Apt-NP) conjugate assays, Western blotting, immunocytochemistry, immunoprecipitation, affinity chromatography, a biochemical assay, a turbidity assay, isothermal titration calorimetry, ultrafiltration, a cell-based assay, and sequencing-based detection; wherein preferably said binding member is an aptamer and said technique is an aptamer-based fluorescence assay.In preferred embodiments, the binding member is an aptamer and the technique is an aptamer-based fluorescence assay.KitsThe invention provides a kit comprising a binding member of the invention, particularly an aptamer of the present invention.A kit of the invention may optionally comprise one or more additional component useful for performing a method of the invention. By way of non-limiting example, a kit may comprise a buffer, a secondary binding member, a reagent for obtaining a sample from a subject, a control sample, one or more sample compartments, an antiviral therapy, an instructional material which describes performance of a method of the invention, and sample specific controls / standards, or any combination thereof. When a kit of the invention comprises a dsMB of the invention, the kit may further comprise a second oligonucleotide (capture probe) as described herein.The reagents for isolating a sample from a subject can comprise one or more reagents that can be used to obtain a fluid or tissue from a subject, such as means for obtaining a saliva, blood, or CSF sample. For the avoidance of doubt, the one or more reagents that can be used to obtain a fluid or tissue from a subject comprise means for obtaining any of the biological material samples disclosed herein.The kit may comprise a buffer. The buffer may be a salt prepared from an organic acid or base. The buffer may be selected from organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid, tris, trimethamine hydrochloride, and phosphate buffers e.g. PBS, or combinations thereof.The kit may comprise a secondary binding member. The secondary binding member may an aptamer, an antibody or fragment thereof, and complexes thereof including those formed by recombinant DNA methods or peptide synthesis, a molecularly imprinted polymer (MIP), a small molecule, haptens, a peptide and a peptidomimetic.The kit may comprise a nucleic acid comprising a quenching molecule at the 3’ or 5’ end. In preferred embodiments, the nucleic acid comprising a quenching molecule is as defined above. Thus, when a kit of the invention comprises a dsMB of the invention, the kit may further comprise a second oligonucleotide (capture probe) as described herein.The kit may comprise a dye (e.g. thioflavin T). The dye may also be selected from SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751. When the kit provides the components for a dye displacement assay as described herein, it may comprise a binding member (e.g. an aptamer) of the invention and may further comprise a dye as described herein.The kit may further comprise instructions for use. The instructions may be printed instructions.In some preferred embodiments, the kit may be designed for use when the subject is human.Accordingly, the invention provides a kit comprising a binding member, wherein optionally said kit further comprises one or more of:(a) a buffer;(b) a secondary binding member;(c) a nucleic acid comprising a quenching molecule at the 3’ or 5’ end, preferably as defined herein (particularly when the kit comprises a dsMB); and / or(d) instructions for use.Also provided is a method of manufacturing a kit comprising a binding member of the present invention.DevicesThe binding members of the present invention may be provided in a device.Accordingly, also provided is a device comprising one or more binding member of the invention. In some preferred embodiments, a device of the invention comprises an aptamer as described herein. The binding member is immobilised to an inert supportThe device may be in any appropriate format. By way of non-limiting example, the device may be a lateral flow device, an electrochemical sensor, or a dipstick.The device may be an electrochemical sensor. An electrochemical sensor may comprise a binding member of the invention attached to an electrode. Preferably, an electrochemical sensor comprises an aptamer of the invention in which either the 5’ or 3’ end is attached to an electrode, and the other (3’ or 5’) end is redox active, for example wherein it is labelled with a redox active label such as ferrocene or a derivative thereof. The electrode may have a shape which is, for example, circular, square, or triangular.The device may be a lateral flow device. The lateral flow device may be a signal-ON lateral flow device. For the avoidance of doubt, a “signal-ON” lateral flow device is intended to refer to any lateral flow device where a positive result, i.e. the detection of ddhC, is indicated by the appearance of a test signal, e.g. the appearance of a coloured band or line. Non-limiting examples of such test signals can include lines, circles, rectangles, squares, triangles, and the like.The lateral flow device may comprise a complementary capture probe. The complementary capture probe may be conjugated to e.g. nanoparticles, quantum dots, carbon nanotubes, latex such as latex labelled with one or more fluorescent dyes, small molecule dyes, microbeads such as paramagnetic microbeads, and the like, and combinations thereof, via a first conjugation means.The nanoparticles may be gold nanoparticles. The gold nanoparticles may have a z- average mean diameter of about 1 to about 1000 nm, about 5 to about 800 nm, about 5 to about 600 nm, about 5 to about 400 nm, about 5 to about 200 nm, about 5 to about 100 nm, about 5 to about 80 nm, about 10 to about 70 nm, about 20 to about 60 nm, about 30 to about 50 nm, about 35 to about 45 nm, such as about 40 nm. The z-average mean diameter may be about 1000 nm, about 800 nm, about 600 nm, about 400 nm, about 300 nm, about 200 nm, about 100 nm, about 90 nm, about 80 nm, about 70 nm, about 60 nm, about 50 nm, about 40 nm, about 30 nm, about 20 nm, about 10 nm, about 5 nm, or about 1 nm. Preferably the z- average mean diameter is about 40 nm. For the avoidance of doubt, “z-average mean diameter” is intended to refer to the intensity weighted mean hydrodynamic size of the ensemble collection of particles of a sample, as determined by dynamic light scattering. It will be appreciated by a person of ordinary skill in the art that nanoparticles are often prepared or sourced commercially with a range or distribution of diameters.The first conjugation means may be an ester group, amide group, thioester group, “click” azide / alkyne chemistry, or a thiol group. Preferably the first conjugation means is a thiol group. Other first conjugation means will be known to those of ordinary skill in the art such as non-covalent methods. Examples of these non-covalent methods include biotin-streptavidin e.g. streptavidin conjugated to gold nanoparticles and the biotinylated end conjugatedto the complementary capture probe.The lateral flow device may comprise an aptamer of the present invention. The aptamer may be conjugated to the gold nanoparticle-complementary capture probe conjugates. The lateral flow device may comprise a test probe that is complementary to the complementary capture probe. The test probe may be biotinylated. The test probe may be conjugated with streptavidin via a second conjugation means. A person of ordinary skill in the art will be aware of a number of suitable conjugation methods for the second conjugation means such as the use of ester groups, amide groups, thioester groups, “click” azide / alkyne chemistry, nucleophilic substitution methods, and coupling methods e.g. Sonogashira coupling.The lateral flow device may comprise a membrane. The membrane may be a cellulose membrane (e.g. a nitrocellulose membrane) or a polymer membrane (e.g. a polyethylene terephthalate) (PET) membrane, a poly(methyl methacrylate) (PMMA) membrane, or a cyclic olefin copolymer (COC) membrane). The membrane is preferably a nitrocellulose membrane. The membrane may be the membrane of the lateral flow test strip.The test probe may be fixed to the lateral flow device, for example by spraying onto the membrane of the lateral flow test strip. The test probe may be conjugated to the membrane via a third conjugation means. A person of ordinary skill in the art will be aware of a number of suitable conjugation methods for the third conjugation means such as the use of ester groups,amide groups, thioester groups, “click” azide / alkyne chemistry, nucleophilic substitution methods, and coupling methods e.g. Sonogashira coupling. Futher, a person of ordinary skill in the art will be aware of other conjugaton methods e.g. those disclosed in Bioconjugate Techniques, G. Hermanson, Academic Press, San Diego, CA, 3rd Edition, 2013. Advantageously, the third conjugation means enables the test probe to be sufficiently tighly conjugated to the membrane of the lateral flow test strip that it does not wash away on exposure to the sample. The third conjugation means does not interfere with ddhC binding, and the linker between the probe and the membrane does not introduce sites for non-specific binding.The device may be dipstick, optionally a dipstick for urine.Use of the device typically provides an output. The output may be a binary output, for example “YES” or “NO”, a change of colour, or the appearance of a marking such as one or more lines. The output may be a quantitative output. Non-limiting examples of quantitative outputs include ddhC concentrations and a numerical scale such as a 5-point, 10-point or 100- point scale. The device may be configured to transmit data to a computer such as a wearable device.Also provided is a method of manufacturing a device comprising one or more binding members (e.g. aptamers) of the present invention.Methods of generating aptamersBinding members of the present invention, particularly aptamers of the present invention, can be produced using a method called Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Example 1 shows aptamer generation using a capture- SELEX method of the invention.In such a method, the concentration of ddhC is lower in a later SELEX cycle relative to that used in an earlier cycle. The concentration of ddhC used in at least one later SELEX cycle may be lower than that used in at least one earlier cycle. The concentration of ddhC may be independently decreased by about 0.1%, about 0.5%, about 1%, about 5%, about 10%, or about 20% in one or more successive SELEX cycles. The concentration of ddhC may be decreased by about 0.1%, about 0.5%, about 1%, about 5%, about 10%, or about 20% in one or more successive SELEX cycles. The concentration of ddhC may be independently decreased by about 0.1%, about 0.5%, about 1%, about 5%, about 10%, or about 20% in each successive SELEX cycle. The concentration of ddhC may be decreased by about 0.1%, about 0.5%, about 1%, about 5%, about 10%, or about 20% in each successive SELEX cycle. The concentration of ddhC may be gradually reduced from XX to YY from the first to last SELEX cycle. The concentration of ddhC may be reduced only each of the last three SELEX cycles, each of the last two SELEX cycles or in the last SELEX cycle. A method may comprise morethan one SELEX cycle which use the same concentration of ddhC. In particular, all SELEX cycles in a method may use the same concentration of ddhC. Alternatively, a method may comprise decreasing the concentration of ddhC over one or more SELEX cycle. By way of non-limiting example, as exemplified herein, a method may comprise multiple SELEX cycles wherein the same concentration of ddhC is used for except for the final two cycles in which the ddhC concentration is decreased by 50% each time.The capture oligonucleotide may be functionalised with a biotin.The capture oligonucleotide may be anchored to the bottom of a 96 well plate. The capture oligonucleotide may be attached to a streptavidin-magnetic bead. The capture oligonucleotide may be functionalised with biotin and attached to a streptavidin-magnetic bead.The oligonucleotides may be immobilised using a capture oligonucleotide. The oligonucleotides may be immobilised using a capture oligonucleotide attached to streptavidinmagnetic beads.The length of the capture oligonucleotide may be increased during one or more SELEX cycles. The length of the capture oligonucleotide may be increased during each successive SELEX cycle.The oligonucleotides may be purified at least once, for example twice, in each SELEX cycle. The oligonucleotides may be purified once in each SELEX cycle, preferably following generation of single-stranded DNA. Advantageously, purification once in each SELEX cycle, preferably following generation of single-stranded DNA, enables greater yield of oligonucleotide at the end of each cycle.As one of ordinary skill in the art will appreciate, the stage of attaching the library of oligonucleotides to the capture oligonucleotide - magnetic beads is known as hybridisation. The hybridisation time may be at least about 1 h, at least about 2 h, at least about 5 h, at least about 10 h, at least about 15 h, or overnight. Preferably, the hybridisation time is performed overnight. Advantageously, longer hybridisation times were found to increase the yield of the process. The hybridisation time may be overnight, and the library of random oligonucleotides is as described in Yang et al (Methods (2016) 106:58-65, which is herein incorporated by reference in its entirety).The immobilisation and / or hybridisation steps may be performed at room temperature. Amplification may comprise PCR. Said PCR may be asymmetric PCR. Amplification may comprise asymmetric PCR and lambda exonuclease. This combination advantageously enables the generation of single stranded oligonucleotides from double stranded oligonucleotides, assisted with the removal of PCR primers, and afforded increased yields of single stranded oligonucleotides.Purification may be achieved using a commercially available purification kit. Nonlimiting examples of such kits include the Monarch NEB DNA purification kit. In some embodiments, about 180 pL of ethanol is used in the purification stage. In some embodiments, for about 50 pL sample, about 200 pL “bind&cleanup” reagent (from the Monarch NEB DNA purification kit) was added followed by about 180 pL of ethanol, then about 450 pL wash. Advantageously, this modified protocol was found to afford increased oligonucleotide yield without bringing through primersA counter selection round may be employed in said method. In Said counter selection round may use a counter target. The counter target may be ATP. The counter selection round may use a similar target to ddhC, for example ATP. Advantageously, the use of a counter selection round may remove unspecific binders and increase the specificity of the aptamer pool for the desired target, i.e. ddhC.Accordingly, provided is a method of generating an aptamer that is specific for unmodified ddhC, said method comprising carrying out capture-SELEX on a library of random oligonucleotides which comprise a complementary stem between the primer binding regions, wherein:(a) the oligonucleotides are immobilised using a capture oligonucleotide attached to streptavidin-magnetic beads; and / or(b) the oligonucleotides are purified once in each SELEX cycle, preferably following generation of single-stranded DNA.EXAMPLESThe invention is now described with reference to the Examples below. These are not limiting on the scope of the invention, and a person skilled in the art would be appreciate that suitable equivalents could be used within the scope of the present invention. Thus, the Examples may be considered component parts of the invention, and the individual aspects described therein may be considered as disclosed independently, or in any combination.Example 1 - Aptamer generation using capture-SELEXAptamers were produced in this Example by a modified capture-SELEX (systematic evolution of ligands by exponential enrichment) method. As will be known to those of ordinary skill in the art, capture-SELEX is a method for developing aptamers that bind to small molecules (Lyu et al. 2022).An oligonucleotide ‘library’ of ~1015individual oligonucleotides (short strands of singlestranded DNA a.k.a. aptamers) that have a central randomised section was provided by combining a specific type of oligonucleotide library developed by Yang et al. (Methods (2016) 106:58-65) which features complimentary primer binding regions on both ends, withstreptavidin-magnetic beads partitioning. To the best of our knowledge this has not been done before. Previously, with this type of library, immobilisation has commonly been performed using streptavidin-agarose columns.The oligonucleotides were then immobilised via a biotinylated ‘capture probe’. The target, ddhC was added to the mix. Oligonucleotides that bound to ddhC became dissociated from their immobilised platform, were isolated, amplified by PCR, and digested back into single-stranded DNAto produce an amplified sub-library. A bespoke DNA purification protocol was used based on the New England Biolabs Monarch PCR & DNA Cleanup kit, but the procedure differed in that per 50 I of sample, 200p I of DNA Cleanup Binding buffer and 180 p I of ethanol was added. Increased single-stranded DNA yield was obtained by only purifying DNA once, after removal of the second strand (the DNA purification step that is usually performed after the PCR step was omitted) .The amplified sub-library was then fed into another cycle of the same process, and oligonucleotides that bind to ddhC with greater specificity were obtained. The process was repeated between approximately 5 and 25 cycles and the sub- library was fed into a gene sequencer. As a person of ordinary skill in the art will appreciate, the gene sequencer provided the DNA code of the specific oligonucleotides that bound to ddhC. The results from cycle 14 are provided in Table 3, below, with the aptamers arranged by how frequently each aptamer was seen:Table 3: 300 aptamer sequences with highest counts in the final SELEX cycle.Example 2 - Aptamer generation and characterisationSelect aptamers generated by the capture-SELEX method of Example 1 were then synthesised and tested using isothermal titration calorimetry (ITC) to evaluate binding to ddhC. ITC measures heat released or absorbed during a binding event, thus demonstrating both whether binding exists or not as well as the strength of binding. The ITC conditions used were: total injections - 20, cell temperature - 21 °C, initial delay - 60s, volume - 2.0ul, duration - 4.0s, spacing - 150s, filter - 5s, ddhC concentration - 312pM, aptamer concentration - 20pM, stirring speed - 750rpm. The heat of dilution (heat changes from adding ddhC in the absence of aptamer) was subtracted from each sample trace to generate the final binding data. All exemplary aptamers demonstrated binding to ddhC, the results are shown in Figure 1 , and the Kd value provided in Table 4 below. When ATP was used as the ligand instead of ddhC, no evidence of binding was shown. Thus, these ITC data demonstrate that aptamers identified using the SELEX method of Example 1 are capable of binding to ddhC. Whilst for practical expediency, a shortlist ofeight of the aptamers identified in Example 1 was characterised by ITC, this provides proof of concept that the other identified aptamers have ddhC binding potential.The secondary structure of these eight aptamers was also determined, as shown in Figure 2. By way of proof of concept, one of the aptamers was selected for modification by sequential shortening of the complementary stem structure. The secondary structures of these modified aptamers are shown in Figure 3.Table 4: Kd values of shortlisted aptamers for binding to ddhCExample 3 - Aptamer modification and further characterisationAn exemplary aptamer from Example 2 was selected to investigate the effect of modifications to the core aptamer sequence and stem sequences.Modifications were introduced to the native core sequence and stem of the aptamers in order to shorten the sequence and improve binding affinity, based on predicted secondary structure and potential binding sites. Modifications included combinations of base deletions, insertions and substitutions. The newly modified aptamers were synthesised and tested for binding affinity using ITC. The results are shown in Table 5. Binding affinity was retained even with deletion of 5 bases. In some cases, modifications increased binding affinity, even whilst decreasing aptamer length.A further aptamer from Example 2 (SEQ ID NO. 81) was modified to shorten the sequence to produce an aptamer with the sequence:CTCTCGGGACGACAGTGTAAAGCAGTGATTCTGCATATGTTATTTAGTTGTCGTCCC (SEQ ID NO. 423) which was used in later examples (see Examples 4 and 8).Example 4 - Aptamers generated by SELEX are capable of use in double-stranded molecular beacons which specifically binding to ddhC in a concentration dependent mannerCandidate aptamers from the SELEX results in Example 1 and 2 were synthesised with a 5’-FAM fluorophore, and a 13-base secondary complimentary strand (capture probe) -GTCGTCCCGAGAG (SEQ ID NO: 415) was synthesised with a 3’-BHQ1 quencher, as shown in Figure 4. The aptamer and secondary strand were hybridised by heating to 95°C for 5 minutes and subsequently cooled to room temperature. The hybridised molecular beacon was added to different concentrations of ddhC, ranging from 0.5-1 OOOpM, the samples were excited at 495nm and the resultant fluorescence measured at 519nm. A binding curve was generated, as shown in in Figure 7A using an exemplary unmodified aptamer sequence of SEQ ID NO: 423 with a 5’-FAM fluorophore. The ratio of aptamer:capture probe was determined by finding the lowest concentration of capture probe that would quench the aptamer’s fluorescence by at least 80%. A ratio of 0.5pM aptamer: 1 pM capture probe was used.As shown in Figure 7A, the dsMB was able to specifically bind to ddhC in a concentration-dependent manner, and was able to detect ddhC with a lower limit of detection of 0.5pM.This dsMB experiment was repeated using a lower range of ddhC concentrations (from 0-1 pM). The experimental protocol was the same as for the higher ddhC concentration range, except that the excitation sample volume was increased to 300pl to maximise detection of fluorescence changes. As shown in Figure 7B, the dsMB was able to specifically bind to ddhC in a concentration-dependent manner, and was able to detect ddhC with a lower limit of detection of 0.1 pM.A further dsMB experiment was conducted using the same exemplary aptamer (SEQ ID NO: 423) and a 12-base capture probe (TCGTCCCGAGAG - SEQ ID NO: 416). Again, the aptamer and secondary strand were hybridised by heating to 95°C for 5 minutes and subsequently cooled to room temperature. The hybridised molecular beacon was added to different concentrations of ddhC, ranging from 0.5-1 OOOpM, the samples were excited at 495nm and the resultant fluorescence measured at 519nm. A ratio of 0.5pM aptamer:4pM capture probe was used. As shown in Figure 7C, this dsMB was able to specifically bind to ddhC in a concentration-dependent manner.The dsMB experiment that was used above to produce the data shown in Figure 7B (using SEQ ID NO: 423) was then performed using either a 5’-Alexa647 fluorophore or a 5’- Cy5 fluorophore instead of a 5’-FAM fluorophore. The fluorophore-conjugated aptamers (5’- Alexa647 fluorophore and 5’-Cy5) were hybridised with 13-base complementary oligonucleotides labelled with a quenching molecule (Iowa and BHQ1 respectively; ex / em 650 / 670 and 648 / 665 respectively). Fluorescence was measured pre- and post-addition of ddhC at different concentrations (1 uM, 10uM, 100uM) and the percentage fluorescence gain calculated. The results are shown in Figure 7D.residues are substitutions; dotted-underlined residues are residue additions.Example 5 - Aptamers generated by SELEX are capable of use in single-stranded molecular beacons which specifically binding to ddhC in a concentration dependent mannerCandidate aptamers from SELEX results in Example 1 and 2 were synthesised with a 5’-FAM fluorophore, and a 3’-BHQ1 quencher, as exemplified in Figure 5. Several ssMB variants were synthesised, with a differing number of complimentary bases in the stem, ranging from 1 (AT base pair originating from core sequence) to 5. The 1-base stem was selected to demonstrate proof of concept by binding curve evaluation with ddhCThe aptamer was heated to 95°C for 5 minutes and subsequently cooled to room temperature. The single-stranded molecular beacon was added to different concentrations of ddhC, ranging from 0.5-1 OOOpM, the samples were excited at 495nm and the resultant fluorescence measured at 519nm. A binding curve was generated, as shown in Figure 8 using an exemplary unmodified aptamer sequence of SEQ ID NO: 33. As shown in Figure 8, the ssMB was able to specifically bind to ddhC in a concentration-dependent manner.Example 6 - Aptamers generated by SELEX are capable of use in dye-displacement assays, where they specifically binding to ddhC in a concentration dependent mannerCandidate aptamers from SELEX results were synthesised in unmodified form. Thioflavin T dye was added to a selected aptamer, as shown in Figure 6, which resulted in fluorescence when excited at 425nm and measured at 490nm. No fluorescence was seen in the absence of the aptamer. The aptamer-dye mixture was added to different concentrations of ddhC, ranging from 0.5-1 OOOpM, and fluorescence measured. The ratio of aptamer to Thioflavin T concentration was optimised by adding different concentrations of Thioflavin T to a fixed concentration of aptamer and measuring fluorescence at 490nm following excitation at 425nm. A ratio of 1 pM aptamer:8pM Thioflavin T was selected for the binding curve generation. The aptamer-dye mixture was incubated for 1 minute in the dark, prior to addition of ddhC. Following addition of ddhC, the samples were incubated for a further 5 minutes in the dark.A binding curve was generated, as shown in Figure 9A. As shown in Figure 9A, the exemplary aptamer (SEQ ID NO: 33) was able to specifically bind to ddhC in a concentrationdependent manner, and was able to detect ddhC with a lower limit of detection of 0.5pM.This dye displacement experiment was repeated using a lower range of ddhC concentrations (from 0-1 pM). The experimental protocol was the same as for the higher ddhC concentration range, except that excitation was performed at 449nm and the excitation sample volume was increased to 300pl to maximise detection of fluorescence changes. Also, the results were normalised using pre-ddhC fluorescence to maximise accuracy. As shown in Figure 9B, thedsMB was able to specifically bind to ddhC in a concentration-dependent manner, and was able to detect ddhC with a lower limit of detection of 0.1 pM.As further proof of concept, dye displacement assay were carried out using further exemplary aptamers (SEQ ID Nos: 83, 84, 86 and 88) and ddhC concentrations in the range of 1-500pM. Again, as shown in Figures 9C to 9F, these exemplary aptamers were able to specifically bind to ddhC in a concentration-dependent manner.The dye displacement assay using the exemplary aptamer (SEQ ID NO: 33) was tested using LDS751 instead of Thioflavin T. Unmodified aptamer (SEQ ID NO: 33) and LDS 751 were mixed in a 7pM:15pM ratio. ddhC was added at different concentrations (0.5- 1000pM) and fluorescence was measured (ex / em 588 / 685). The measured fluorescence was subtracted from the baseline fluorescence (fluorescence with no ddhC). The results are shown in Figure 9G.The dye displacement assay using the exemplary aptamer (SEQ ID NO: 33) was tested using SYTOX red instead of Thioflavin T. Unlabeled aptamer was mixed with SYTOX red. Fluorescence was measured pre- and post-addition of ddhC at different concentrations (1 uM, 10uM, 100uM) and the percentage fluorescence loss calculated. The results are shown in Figure 9H.The dye displacement assay using the exemplary aptamer (SEQ ID NO: 33) was tested using propidium iodide instead of Thioflavin T. Unmodified aptamer (SEQ ID NO: 33) and propidium iodide were mixed in a 1 M:5pM ratio. Fluorescence was measured (ex / em 588 / 685). Fluorescence decreased by 13.5% after addition of 75pM ddhC (results not shown).Example 7 - Design and in silico characterization of further modified aptamersIn silico modelling was used to assess the effect of base deletions in several of the shortlisted aptamer candidates. For each tested sequence, the 2D structure was obtained using the mfold server (http: / / www.unafold.org / mfold / applications / dna-folding-form.php). The RNA Composer program was used to convert the 2D structure into a 3D RNA structure (https: / / rnacomposer.cs.put.poznan.pl). RNA was converted to DNA by substituting uracil for thymine bases, and converting the sugar backbone to deoxyribose using Discovery Studio Visualizer software (https: / / discover.3ds.com / discovery-studio-visualizer-download), exporting in .pdb format. Autodock Tools software (https: / / autodock.scripps.edu) was used to prepare the DNA, exporting in .pdbqt format as the input for molecular docking. Autodock Vina software (https: / / autodock.scripps.edu) was used to perform grid-based molecular docking, resulting in predicted binding affinities.Examples of these further modified aptamers are given in Table 6 below. In each of these exemplified modified aptamers 1 or 2 bases was removed from the top loop.Table 6: Further examples of modified aptamers derived from other shortlisted aptamers generated by SELEXThe maximum predicted binding affinity remained similar in the modified aptamers compared with the corresponding native (unmodified) aptamers (see Table 7 below).Table 7: Maximum binding affinity of modified aptamers compared with the corresponding unmodified aptamersExample 8 - Preparation of a lateral flow assay A signal-ON lateral flow assay was developed using a ddhC aptamer of Example 3 (CTCTCGGGACGACAGTGTAAAGCAGTGATTCTGCATATGTTATTTAGTTGTCGTCCC - SEQ ID NO: 423). A complementary capture probe was conjugated to 40nm gold nanoparticles via a thiol group. The aptamer was then hybridised with the gold nanoparticle-complementary capture probe conjugates. A biotinylated test probe complementary to the complementary capture probe was conjugated with streptavidin and fixed by being sprayed onto the nitrocellulose membrane of the lateral flow test strip. Without ddhC, the aptamer remained attached to the gold nanoparticle and blocked binding to the test probe, resulting in lack of a red line. In the presence of ddhC, the aptamer bound to ddhC and dissociated from thecomplementary capture probe, which was then free to bind the test probe. A red line formed and signified a positive result. The lateral flow test was run with aptamer and with ddhC. As a control, the lateral flow assay was run without the aptamer. The lateral flow assay was also run with aptamer and without ddhC. (Images of lateral flow tests from this Example are not shown).Numbered embodiments1. A method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with a binding member that is specific for ddhC.2. The method of embodiment 1 wherein the method does not comprise the modification of ddhC, optionally wherein said modification is labelling the ddhC.3. A method for the detection of ddhC in a fluid sample, comprising contacting the sample with a binding member that is specific for ddhC, wherein the method does not comprise the modification of ddhC, optionally wherein said modification is labelling the ddhC.4. The method of any one of the preceding embodiments, wherein the limit of detection of ddhC is about 1 M or less, preferably about 0.5pM or less.5. The method of any one of the preceding embodiments, wherein the binding member is:(a) selected from an aptamer, an antibody or fragment thereof, a molecularly imprinted polymer (MIP), a small molecule, a peptide and a peptidomimetic; and / or(b) labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye.6. The method of embodiment 5, wherein the binding member is an aptamer, wherein optionally the aptamer is between about 30 to about 100 nucleic acids in length, preferably between about 35 to about 80 nucleic acids in length.7. The method of embodiment 5 or 6, wherein said aptamer comprises at least one complementary stem structure, preferably two complementary stem structures.8. The method of embodiment 7, wherein the at least one complementary stem structure is at least about a two-base stem, preferably at least about a three-base stem, more preferably at least about a four-base stem.9. The method of any one of embodiments 5 to 8, wherein said aptamer comprises at least one non-complementary loop structure, preferably at least two non- complementary loop structures.10. The method of any one of embodiments 5 to 9, wherein the aptamer comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.11 . The method of any one of any one of embodiments 5 to 10, wherein said aptamer is:A. unlabelled, but which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is thioflavin T;B. labelled with a fluorophore, wherein optionally:(a) the aptamer has a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end, and optionally said aptamer forms part of a double-stranded molecular beacon with a second oligonucleotide with a quencher at the 5’ or 3’ end, such that the method further comprises the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end; or(b) the aptamer has (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end; wherein further optionally the fluorescent label is a fluorescein amidite (FAM) and / or the quencher is a black hole quencher, dabcyl quencher or guanine. The method of diagnosing a viral infection of any one of embodiments 1 , 2 or 4 to 11 , which is a method for diagnosing an active viral infection. The method of diagnosing a viral infection according to any one of embodiments 1 , 2 or 4 to 12, wherein a ddhC concentration of at least 100 ng / mL is diagnostic of a viral infection. The method of diagnosing a viral infection according to any one of embodiments 1 , 2 or 4 to 13, wherein said method can be used:(a) in disease X testing and pandemic preparedness;(b) for differentiating between a viral infection and a non-viral state;(c) for differentiating between viral and non-viral infections;(d) for differentiating between viral and non-viral meningitis;(e) for identifying the presence of an active viral infection in an animal, particularly livestock, or a population thereof;(f) for identifying the presence of an active viral infection in a plant, or population thereof;(g) for research use;(h) for confirming an active viral infection when a second diagnostic test has detected the presence of a virus and / or one or more viral biomarker; and / or(i) to confirm the presence or absence of viral infection in a subject suspected of having a viral infection when first line diagnostic tests have come back negative.15. The method of diagnosing a viral infection according to any one of embodiments 1 , 2 or 4 to 14, which further comprises treating a patient with antiviral therapy, optionally with broad-spectrum antiviral therapy.16. The method of any one of the preceding embodiments, wherein the detection of ddhC may be by any appropriate technique, optionally selected from an aptamerbased fluorescence assay, enzyme-linked oligonucleotide assay (ELONA), electrochemical detection, aptamer-nanoparticle (Apt-NP) conjugate assays, Western blotting, immunocytochemistry, immunoprecipitation, affinity chromatography, a biochemical assay, a turbidity assay, isothermal titration calorimetry, ultrafiltration and a cell-based assay; wherein preferably said binding member is an aptamer and said technique is an aptamer-based fluorescence assay.17. The method of any one of the preceding embodiments, wherein the sample is a biological material, optionally selected from blood, plasma, saliva, serum, sputum, urine, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, and stool.18. A binding member that is specific for ddhC which is as defined in any one of embodiments 5 to 11.19. The binding member of embodiment 18, which is an aptamer, and wherein the aptamer optionally comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.20. The binding member of embodiment 18 or 19, which is:A. unlabelled, but which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is thioflavin T:B. the aptamer is labelled, and optionally:(a) has a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end, and optionally said aptamer forms part of a double-stranded molecular beacon with a second oligonucleotide with a quencher at the 5’ or 3’ end, such that the method further comprises the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end; or(b) the aptamer has (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end; wherein further optionally the fluorescent label is a fluorescein amidite (FAM) and / or the quencher is a black hole quencher, dabcyl quencher or guanine.21 . A kit comprising a binding member as defined in any one of embodiments 18 to 20, wherein optionally said kit further comprises one or more of:(a) a buffer;(b) a secondary binding member;(c) a second oligonucleotide comprising a quenching molecule at the 3’ or 5’ end, preferably as defined in embodiment 20; and / or(d) instructions for use.22. A device comprising one or more binding member as defined in any one of embodiments 18 to 20, wherein optionally said binding member is immobilised to an inert support.23. The device of embodiment 22, which is a lateral flow device, an electrochemical sensor, or a dipstick.24. A method of generating an aptamer that is specific for unmodified ddhC, said method comprising carrying out capture-SELEX on a library of random oligonucleotides which comprise a complementary stem between the primer binding regions, wherein:(a) the oligonucleotides are immobilised using a capture probe attached to streptavidin-magnetic beads; and / or(b) the oligonucleotides are purified once in each SELEX cycle, preferably following generation of single stranded DNA.
Claims
CLAIMS1. A method for diagnosing a viral infection in a subject, said method comprising contacting a sample from the subject with an aptamer that is specific for ddhC.
2. The method of claim 1 wherein the method does not comprise the modification of ddhC, optionally wherein said modification is labelling the ddhC.
3. A method for the detection of ddhC in a fluid sample, comprising contacting the sample with an aptamer that is specific for ddhC, wherein the method does not comprise the modification of ddhC, optionally wherein said modification is labelling the ddhC.
4. The method of any one of the preceding claims, wherein the limit of detection of ddhC is about 1 pM or less, preferably about 0.5pM or less, for example about 0.3 pM or less or about 0.09 pM or less.
5. The method of any one of the preceding claims, wherein the aptamer is labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye.
6. The method of claim 5, wherein the aptamer is between about 30 to about 100 nucleic acids in length, preferably between about 35 to about 80 nucleic acids in length.
7. The method of claim 5 or 6, wherein said aptamer comprises at least one complementary stem structure, preferably two complementary stem structures.
8. The method of claim 7, wherein the at least one complementary stem structure is at least about a two-base stem, preferably at least about a three-base stem, more preferably at least about a four-base stem.
9. The method of any one of claims 5 to 8, wherein said aptamer comprises at least one non-complementary loop structure, preferably at least two non-complementary loop structures.
10. The method of any one of claims 5 to 9, wherein the aptamer comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs: 81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.11 . The method of any one of any one of claims 5 to 10, wherein said aptamer is:A. unlabelled, but which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is selected from thioflavin T, SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751 ;B. labelled with a fluorophore, wherein optionally:(a) the aptamer has a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end, and optionally said aptamer forms part of a double-stranded molecular beacon with a second oligonucleotide with a quencher at the 5’ or 3’ end, such that the method further comprises the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenchingmolecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end; or(b) the aptamer has (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end; wherein further optionally the fluorescent label is selected from a fluorescein amidite (FAM), Cy5, and Alexa647, and / or the quencher is a black hole quencher, dabcyl quencher or guanine.
12. The method of diagnosing a viral infection of any one of claims 1 , 2 or 4 to 11 , which is a method for diagnosing an active viral infection.
13. The method of diagnosing a viral infection according to any one of claims 1 , 2 or 4 to 12, wherein a ddhC concentration of at least 100 ng / mL is diagnostic of a viral infection.
14. The method of diagnosing a viral infection according to any one of claims 1 , 2 or 4 to 13, wherein said method can be used:(a) in disease X testing and pandemic preparedness;(b) for differentiating between a viral infection and a non-viral state;(c) for differentiating between viral and non-viral infections;(d) for differentiating between viral and non-viral meningitis;(e) for identifying the presence of an active viral infection in an animal, particularly livestock, or a population thereof;(f) for identifying the presence of an active viral infection in a plant, or population thereof;(g) for research use;(h) for confirming an active viral infection when a second diagnostic test has detected the presence of a virus and / or one or more viral biomarker; and / or(i) to confirm the presence or absence of viral infection in a subject suspected of having a viral infection when first line diagnostic tests have come back negative.
15. The method of diagnosing a viral infection according to any one of claims 1 , 2 or 4 to 14, which further comprises treating a patient with antiviral therapy, optionally with broad-spectrum antiviral therapy.
16. The method of any one of the preceding claims, wherein the detection of ddhC may be by any appropriate technique, optionally selected from an aptamer-based fluorescence assay, enzyme-linked oligonucleotide assay (ELONA), electrochemical detection, aptamer-nanoparticle (Apt-NP) conjugate assays, Western blotting, immunocytochemistry, immunoprecipitation, affinity chromatography, a biochemical assay, a turbidity assay, isothermal titration calorimetry, ultrafiltration, a cell-based assay, and sequencing-based detection; wherein preferably said technique is an aptamer-based fluorescence assay.
17. The method of any one of the preceding claims, wherein the sample is a biological material, optionally selected from blood, plasma, saliva, serum, sputum, urine, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, stool, interstitial fluid, bile fluid, vaginal fluid, and sweat.
18. An aptamer that is specific for ddhC which is as defined in any one of claims 5 to 11.
19. The aptamer of claim 18, wherein the aptamer optionally comprises or consists of:(a) a core nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 1 to 8 and 101 to 109 or a sequence which differs from one of SEQ ID NOs: 1 to 8 and 101 to 109 by no more than 10, preferably no more than 5, more preferably no more than 3, yet more preferably no more than 1 nucleic acid, preferably wherein said core nucleic acid sequence further comprises at least a two-base complementary stem region;(b) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 or a sequence which differs from one of SEQ ID NOs: 25 to 56, 89 to 100, 402 to 414 or 417 to 422 by no more than 20, no more than 10, no more than 5, preferably no more than 3, more preferably no more than 1 nucleic acid;(c) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 9 to 24 and 57 to 80 or a sequence which differs from one of SEQ ID NOs: 9 to 24 and 57 to 80 by no more than 10, preferably no more than 5, more preferably no more than 3, still more preferably no more than 1 nucleic acid; and / or(d) a nucleic acid sequence comprising or consisting of any one of SEQ ID NOs: 81 to 88 or 110 to 401 or a sequence which differs from one of SEQ ID NOs:81 to 88 or 110 to 401 by no more than 30, no more than 20, no more than 10, preferably no more than 5, more preferably no more than 3 nucleic acids.
20. The aptamer of claim 18 or 19, which is:A. unlabelled, but which binds to a fluorescent dye in the absence of ddhC, wherein said dye is displaced on binding of the aptamer to ddhC, wherein optionally said dye is selected from thioflavin T, SYTOX® (e.g. SYTOX® red, SYTOX® deep red, SYTOX® green, SYTOX® orange, and SYTOX® blue), SYTO, TOTO, TO-PRO, propidium iodide, Cy7, and LDS751 :B. the aptamer is labelled, and optionally:(a) has a fluorescent label at the 5’ and / or 3’ end, preferably at the 5’ end, and optionally said aptamer forms part of a double-stranded molecular beacon with a second oligonucleotide with a quencher at the 5’ or 3’ end, such that the method further comprises the use of the second oligonucleotide which comprises a nucleic acid sequence that is reverse complementary with a region of nucleic acid sequence comprised in the aptamer, wherein the second oligonucleotide comprises a quenching molecule at the 3’ end when the aptamer is labelled at the 5’ end, or the 5’ end when the aptamer is labelled at the 3’ end; or(b) the aptamer has (i) a fluorescent label at the 5’ end and a quencher at the 3’ end, or (ii) a fluorescent label at the 3’ end and a quencher at the 5’ end; wherein further optionally the fluorescent label is selected from a fluorescein amidite (FAM), Cy5, and Alexa647, and / or the quencher is a black hole quencher, dabcyl quencher or guanine.
21. A kit comprising an aptamer as defined in any one of claims 18 to 20, wherein optionally said kit further comprises one or more of:(a) a buffer;(b) a secondary aptamer;(c) a second oligonucleotide comprising a quenching molecule at the 3’ or 5’ end, preferably as defined in claim 20; and / or(d) instructions for use.
22. A device comprising one or more aptamer as defined in any one of claims 18 to 20, wherein optionally said aptamer is immobilised to an inert support.
23. The device of claim 22, which is a lateral flow device, an electrochemical sensor, or a dipstick, optionally wherein the device is a lateral flow device.
24. A method of generating an aptamer that is specific for unmodified ddhC, said method comprising carrying out capture-SELEX on a library of random oligonucleotides which comprise a complementary stem between the primer binding regions, wherein:(a) the oligonucleotides are immobilised using a capture probe attached to streptavidin-magnetic beads; and / or(b) the oligonucleotides are purified once in each SELEX cycle, preferably following generation of single stranded DNA.
Citation Information
Patent Citations
Device and method for characterizing spheroids
WO2001023865A1
Means and methods for diagnosing a viral infection
EP4443159A1
Anti-3'4'-didehydro-3'-deoxycytidine antibody
WO2023063331A1