Delivery vehicles expressing engineered antigens and uses thereof
The engineered antigen delivery system enhances tumor sensitivity to immunotherapies by using a cell surface-localized antigen with a viral vector, addressing resistance issues and improving treatment efficacy for various cancers.
Patent Information
- Application Number
- PCT/CA2025/051042
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-08
- Filing Date
- 2025-08-07
- Publication Date
- 2026-02-12
AI Technical Summary
Cancer therapies, particularly targeted immunotherapies, face challenges due to resistance caused by target absence or antigen shedding, limiting their efficacy and excluding tumors from candidacy.
A combination of a delivery vehicle, such as a vesicle, nanoparticle, or viral vector, expressing an engineered antigen with a cell surface localization and lacking a functional intracellular domain, along with an antibody or antigen-binding fragment, is used to enhance tumor sensitivity to immunotherapies.
The engineered antigen delivery system increases tumor susceptibility to immunotherapies, enabling effective treatment of resistant cancers like lung, colorectal, endometrial, ovarian, breast, and melanoma.
Smart Images

Figure CA2025051042_12022026_PF_FP_ABST
Abstract
Description
[0001] 147222-000022
[0002] 1
[0003] DELIVERY VEHICLES EXPRESSING ENGINEERED ANTIGENS AND USES THEREOF
[0004] CROSS REFERENCE TO RELATED APPLICATIONS
[0005] The present application claims the benefit of U.S. provisional patent application serial No. 63 / 680,672, filed on August 8, 2024, which is incorporated herein by reference in its entirety.
[0006] SEQUENCE LISTING
[0007] A sequence listing is submitted herewith as an XML file named 147222-00022-AD_Seq listing.xml, that was created on August 7, 2025, and having a size of 74,365 bytes. The content of the aforementioned file is hereby incorporated by reference in its entirety.
[0008] TECHNICAL FIELD
[0009] The present invention generally relates to the field of oncology, and more specifically to the treatment of cancer.
[0010] BACKGROUND ART
[0011] Precision medicine in the field of antineoplastic therapy focuses on tailoring treatments based on the molecular profiles of diseases. Cancer immunotherapies1, such as immune checkpoint inhibitors, targeted biologies, and adoptive cell transfers, have emerged as highly targeted systemic therapies with improved efficacy and safety. The success of these therapies relies on the specific molecular targets expressed by tumours. For example, HER2 amplification, which was originally associated with poor prognoses, now allows for targeted therapies with better outcomes2-5. Indeed, while the frequency of HER2 amplification may be high in some cancers, it may also be low in others thereby imposing a candidacy barrier to potentially curative targeted therapies. Resistance to targeted antineoplastic immunotherapies due to target absence or antigen shedding limits their efficacy and excludes tumours from candidacy.
[0012] There is thus a need for novel therapeutic approaches for cancer therapy, and notably for rendering tumors sensitive or responsive to targeted immunotherapies.
[0013] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.
[0014] SUMMARY OF THE INVENTION
[0015] In various aspects and embodiments, the present disclosure provides the following items 1 to 72:
[0016] 1 . A combination comprising:
[0017] (a) a first delivery vehicle for tumor cells comprising a nucleic acid encoding an engineered antigen, wherein the engineered antigen: 147222-000022
[0018] 2
[0019] (i) is localized at the cell surface when expressed;
[0020] (ii) comprises an extracellular domain of a naturally occurring receptor, or a fragment thereof comprising at least 20 amino acids, or a variant of the extracellular domain or fragment thereof having at least 90% sequence identity with the extracellular domain or fragment thereof;
[0021] (iii) comprises at least one epitope that is specifically recognized by at least one antibody or antigen-binding fragment thereof; and
[0022] (iv) lacks a functional intracellular domain; and
[0023] (b) at least one antibody or antigen-binding fragment thereof that specifically recognizes the at least one epitope.
[0024] 2. The combination of item 1 , wherein the delivery vehicle comprises a vesicle, a nanoparticle, an oncolytic bacterium, or a viral vector.
[0025] 3. The combination of item 2, wherein the delivery vehicle comprises a viral vector, such as an oncolytic virus.
[0026] 4. The combination of item 3, wherein the oncolytic virus is an oncolytic RNA virus
[0027] 5. The combination of item 4, wherein the oncolytic RNA virus is an oncolytic rhabdovirus.
[0028] 6. The combination of item 5, wherein the oncolytic rhabdovirus is a Maraba virus (MG1) or a vesicular stomatitis virus (VSV) or an arenavirus.
[0029] 7. The combination of item 6, wherein the VSV comprises a mutation in the VSV M protein.
[0030] 8. The combination of item 7, wherein the VSV is VSVA51 .
[0031] 9. The combination of any one of items 1 to 8, wherein the engineered antigen has an immunogenicity in humans that is lower than that of the naturally occurring receptor.
[0032] 10. The combination of any one of items 1 to 9, wherein the engineered antigen comprises a fragment of the naturally occurring receptor, or a variant thereof having at least 90% sequence identity with said fragment.
[0033] 11. The combination of item 10, wherein the fragment of the naturally occurring receptor comprises at least 50 amino acids.
[0034] 12. The combination of item 11 , wherein the fragment of the naturally occurring receptor comprises at least 100 amino acids.
[0035] 13. The combination of any one of items 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is conjugated to an antitumor agent.
[0036] 14. The combination of item 13, wherein the antitumor agent is a chemotherapeutic agent.
[0037] 15. The combination of any one of items 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is comprised within a chimeric antigen receptor (CAR).
[0038] 16. The combination of item 13, wherein the antigen-binding fragment is a single-chain variable fragment (scFv) or a single domain antibody. 147222-000022
[0039] 3
[0040] 17. The combination of item 13 or 14, wherein the at least one antibody or antigen-binding fragment thereof is expressed at the surface of an immune cell.
[0041] 18. The combination of item 17, wherein the immune cell is a T lymphocyte or a natural killer (NK) cell.
[0042] 19. The combination of any one of items 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is a bispecific antibody or an antigen-binding fragment thereof.
[0043] 20. The combination of item 19, wherein the bispecific antibody comprises a first binding domain that specifically recognizes the at least one epitope and a second binding domain that specifically binds to a protein involved in immune cell activation.
[0044] 21 . The combination of item 20, wherein the protein involved in immune cell activation is CD3, CD8 or CD16.
[0045] 22. The combination of any one of items 1 to 21 , wherein the engineered antigen comprises the extracellular domain of human Epidermal Growth Factor Receptor-2 (HER2), Epithelial Growth Factor Receptor (EGFR), CD33, CD30, CD22, CD79b, Nectin-4, Trop-2, CD19, Tissue Factor (TF), Folate Receptor alpha (FRa), c-MET, B-cell maturation antigen (BCMA), GPCR5D, or DLL3, or a fragment thereof, or a variant of the extracellular domain or fragment thereof.
[0046] 23. The combination of item 22, wherein the engineered antigen comprises the extracellular domain of human HER2, or a fragment thereof, ora variant of the extracellular domain or fragment thereof.
[0047] 24. The combination of item 23, wherein the engineered antigen lacks the intracellular kinase domain of native human HER2.
[0048] 25. The combination of item 23 or 24, wherein the engineered antigen lacks partially or completely extracellular domain I of native human HER2.
[0049] 26. The combination of item 25, wherein the engineered antigen lacks partially or completely extracellular domains I, II and / or III of native human HER2.
[0050] 27. The combination of item 25 or 26, wherein the engineered antigen comprises a sequence corresponding to amino acids 174 to 720 or 524 to 720 of native human HER2, or a variant thereof having at least 90% identity with said sequence.
[0051] 28. The combination of item 23 or 24, wherein the engineered antigen comprises the sequence of SEQ ID NO:2, 3, 11 , or 21 .
[0052] 29. The combination of any one of items 22 to 28, wherein the at least one antibody or antigenbinding fragment thereof is trastuzumab or antigen-binding fragment thereof, and / or pertuzumab or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof that competes with trastuzumab or pertuzumab for binding to human HER2.
[0053] 30. The combination of any one of items 1 to 29, wherein the engineered antigen comprises at least two different epitopes that are specifically recognized by at least two different antibodies or antigen-binding fragments thereof. 147222-000022
[0054] 4
[0055] 31 . The combination of item 30, wherein the at least two different epitopes are from the same protein.
[0056] 32. The combination of item 30, wherein the at least two different epitopes are from different proteins.
[0057] 33. The combination of any one of items 1 to 32, wherein the at least one antibody or antigenbinding fragment thereof is comprised in a second delivery vehicle for tumor cells.
[0058] 34. The combination of item 33, wherein the second delivery vehicle comprises a viral vector that comprises a nucleic acid encoding the at least one antibody or antigen-binding fragment thereof.
[0059] 35. The combination of item 34, wherein the second delivery vehicle is a second oncolytic virus.
[0060] 36. The combination of item 35, wherein the second oncolytic virus is a vaccinia virus (W), such as an attenuated W.
[0061] 37. The combination of item 36, wherein the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene.
[0062] 38. The combination of item 36 or 37, wherein the W encodes an interferon-binding decoy receptor, such as B8R and / or B18R / B19R.
[0063] 39. The combination of item 38, wherein the W is of the Tian Tian, Copenhagen, or Western Reserve, Lister, Wyeth or MVA strain.
[0064] 40. A combination comprising:
[0065] (a) a first oncolytic virus comprising a nucleic acid encoding a cell surface receptor;
[0066] (b) a second oncolytic virus comprising a nucleic acid encoding an antibody or antigenbinding fragment thereof that specifically binds to an extracellular domain of the cell surface receptor.
[0067] 41 . The combination of item 40, wherein the first and / or second oncolytic virus is an oncolytic rhabdovirus.
[0068] 42. The combination of item 41 , wherein the oncolytic rhabdovirus is a Maraba virus (MG1) or a vesicular stomatitis virus (VSV).
[0069] 43. The combination of item 42, wherein the VSV comprises a mutation in the VSV M protein.
[0070] 44. The combination of item 43, wherein the VSV is VSVA51 .
[0071] 45. The combination of any one of items 40 to 44, wherein the first and / or second oncolytic virus is an oncolytic poxvirus.
[0072] 46. The combination of item 45, wherein the oncolytic poxvirus is a vaccinia virus (W), such as an attenuated W.
[0073] 47. The combination of item 46, wherein the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene. 147222-000022
[0074] 5
[0075] 48. The combination of item 46 or 47, wherein the W is of the Tian Tan, Copenhagen, or Western Reserve strain.
[0076] 49. The combination of any one of items 40 to 48, wherein the first and / or second oncolytic virus encodes an interferon-binding decoy receptor, such as B8R and / or B18R / B19R.
[0077] 50. The combination of any one of items 40 to 49, wherein the cell surface receptor is the engineered antigen defined in any one of items 1 to 39.
[0078] 51. The combination of any one of items 40 to 50, wherein the antibody or antigen-binding fragment thereof is as defined in any one of items 1 to 39.
[0079] 52. A method for treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the combination of any one of items 1 to 51 .
[0080] 53. The method of item 52, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
[0081] 54. The method of item 52 or 53, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer, melanoma, or parotid cancer.
[0082] 55. The method of any one of items 52 to 54, wherein the subject is treated with an additional antitumor therapy.
[0083] 56. The method of item 55, wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
[0084] 57. The method of any one of items 52 to 56, wherein the combination is administered intravenously, intramuscularly, subcutaneously, intratumorally, or any combination thereof.
[0085] 58. The combination of any one of items 1 to 51 for use in treating cancer in a subject.
[0086] 59. The combination for use of item 58, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
[0087] 60. The combination for use of item 58 or 59, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer, melanoma or parotid cancer.
[0088] 61. The combination for use of any one of items 58 to 60, wherein the combination is for administration with an additional antitumor therapy.
[0089] 62. The combination for use of item 61 , wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a 147222-000022
[0090] 6 chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
[0091] 63. The combination for use of any one of items 58 to 62, wherein the combination is for administration by the intravenous, intramuscular, subcutaneous, or intratumoral route, or any combination thereof.
[0092] 64. Use of the combination of any one of items 1 to 51 for the manufacture of a medicament for treating cancer in a subject.
[0093] 65. The use of item 64, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
[0094] 66. The use of item 64 or 65, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer or parotid cancer.
[0095] 67. The use of any one of items 64 to 66, wherein the combination is for administration with an additional antitumor therapy.
[0096] 68. The use of item 67, wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
[0097] 69. The use of any one of items 64 to 68, wherein the medicament is for administration by the intravenous, intramuscular, subcutaneous, or intratumoral route, or any combination thereof.
[0098] 70. A method for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject, the method comprising administering to the subject an effective amount of the first delivery vehicle defined in any one of items 1 to 39.
[0099] 71 . The first delivery vehicle defined in any one of items 1 to 39 for increasing the susceptibility of a tumor to an immunotherapy.
[0100] 72. Use of the first delivery vehicle defined in any one of items 1 to 39 for the manufacture of a medicament for increasing the susceptibility of a tumor to an immunotherapy.
[0101] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
[0102] BRIEF DESCRIPTION OF DRAWINGS
[0103] In the appended drawings: 147222-000022
[0104] 7
[0105] FIG. 1A is a schematic of different HER2-derived engineered antigens according to the present disclosure. The top panel shows the full human HER2 protein including the intracellular domain, transmembrane domain, and extracellular domain (SEQ ID NO:1). Both Her2 variants according to the present disclosure have removed the kinase domain (signalling) as well as removing other domains according to the antigen design described herein. The HER2T-1 variant (SEQ ID NO:2) was used in this study when expressed via plasmid or virally, and the HER2T-2 variant (SEQ ID NO:3) was used to generate the animal models.
[0106] FIG. 1B shows that the expression of full length hHER2 promotes tumour rejection in immunocompetent BALB / c mice. 4T1.2-HER2 cells were implanted in athymic nude mice (right panel) or wildtype BALB / c mice (left panel) at the indicated cell numbers, subcutaneously in the right flank. Tumour volume was monitored by measurements using electronic calipers. (Excerpt from Figure 1 of Taha et al., Front Immunol. 2023; 14: 1181014).
[0107] FIG. 1C shows that 4T1.2-HER2T tumours exhibit improved take rate and reduced immunogenicity in vivo. Top panel: BALB / c mice were implanted with the indicated cells at 1 x 106seeding density, subcutaneously (s.c.) in the right flank, or orthotopically (o.t.) in the second mammary fat pad. Tumour progression was monitored through multiple weekly measurements with electronic calipers. Middle panels: mice were implanted with subcutaneous (n=5, left) or orthotopic tumours (n=5, right) as indicated. Tumours were harvested 25 days post-implantation, dissociated, and assessed for HER2T expression by flow cytometry. Bottom panel: serum from 4T1.2 (n=6), 4T1.2-HER2 (n=13), 4T1.2-HER2T (n=20) tumour-bearing mice, or naive controls, was collected 10 days post-implantation. Serum was incubated with JIMT1 (human breast carcinoma) for detection of HER2-reactive IgG by flow cytometry (mean ± SEM; one-way ANOVA with Dunnett’s correction for multiple comparison relative to 4T1.2). (Excerpt from Figure 3 of Taha et al., Front Immunol. 2023; 14: 1181014).
[0108] FIGs. 2A-2J show the target-selectivity of trastuzumab and VSVA51-HER2T. FIG. 2A: Single-cell suspensions of 786-0 and AF2068 cell lines were stained with trastuzumab as a primary antibody (1 : 1000) then incubated with anti-human IgG-PE secondary antibody. Data were acquired by flow cytometry to detect Trastuzumab-PE signal. FIG. 2B: 786-0 and AF2068 cells were treated in 24-well plates with T-DM1 at the indicated concentrations for 2 h. Supernatants were removed and cells were washed and replenished with fresh medium to remove excess unbound ADC. Cell viability was assessed by AlamarBlue™, 48 h post-treatment, and normalized to untreated controls. Shown are mean ± SEM, n = 3, P-value calculated by one-way ANOVA relative to untreated control with Dunnett correction for multiple comparisons. FIG. 2C: Cells were treated as in FIG. 2B then infected with MOI 0.001 VSVA51-Fluc. Viral supernatant was quantified 48 hpi by high-throughput luciferase titering. Shown are mean ± SEM, n = 3, P-value calculated by one-way ANOVA relative to untreated control with Dunnett correction for multiple comparisons. FIG. 2D: Overview of VSVA51 multi-step (top, MOI 0.01) and single-step (bottom, MOI 1.0) 147222-000022
[0109] 8
[0110] VSVA51 growth curves; 4T1.2 cells were seeded in 24-well plates at 2 x 105cells per well and incubated overnight. Cells were infected with VSVA51-HER2T or VSVA51-Fluc and incubated. Viral supernatant was collected at the indicated timepoints post-infection, including the wash, and viral titer was quantified by plaque assay. Shown are mean ± SEM, n = 3, P-value calculated by two-tailed unpaired t-test at each timepoint between both VSVA51 variants. FIG. 2E: 4T1.2 cells were seeded on glass coverslips and infected with VSVA51-HER2T MOI 0.1 , then incubated at 37°C uninfected 4T 1 .2-HER2T were stained as a control. Cells were fixed with 4% PFA at the indicated timepoints post-infection and stained then mounted and imaged at 20x magnification. Similar results were observed in 3 independent experiments. FIG. 2F: Total staining intensity was calculated using Imaged, and FIG. 2G trastuzumab-positive cells were counted. FIG. 2H: Human HT29 cells were seeded on glass coverslips, after which cells were infected with VSVA51-HER2T at an MOI of 0.1. Cells were fixed and stained 24 hpi using trastuzumab as a primary antibody (1 :1000) and imaged using a Zeiss Axiolmage.M2 microscope at 20x magnification. Similar results were observed in 3 independent experiments, with similar HER2-low human cell lines. FIG. 2I: Normal human fibroblasts GM38 cells were seeded on glass coverslips then infected with VSVA51-HER2T an MOI 0.1. Cells were fixed and stained 24 hpi then imaged at the indicated magnifications. SKOV3 cells were used as HER2+ controls. Similar results were observed in 2 independent experiments. FIG. 2J: Balb / c (n = 3) mice were implanted with subcutaneous bilateral CT26 tumours in the flanks. Upon reaching ~400 mm3(day 20 post-implantation) tumours were injected with VSVA51-HER2T (right hand right) or VSVA51-GFP as a control (left hand side), at 1 x 108PFU. Tumours were excised 24 h post-implantation, flash frozen in O.C.T. medium, sectioned, fixed in 4% PFA, and stained.
[0111] FIGs 3A-3I show that VSVA51 -encoded HER2T is expressed in vitro and in vivo. FIG. 3A: Schematic of the HER2T construct encoded within VSVA51. FIG. 3B: Overview of VSVA51 rescue, propagation, and purification. FIG. 3C: 4T1.2, CT26, and MC38 cells were seeded on glass coverslips and infected with the indicated VSVA51 variants at MOI 0.1 and incubated for 20 h. Cells were fixed in 4% paraformaldehyde (PFA) and stained using trastuzumab as a primary antibody (1 :1000) and goat anti-human IgG-Alexa Fluor 594 (1 :300) as a secondary antibody. Cells were mounted using Prolong Gold Antifade with DAPI, and imaged at 20x magnification using a Zeiss Axiolmager M1. Similar results were seen across 3 different independent experiments. FIG. 3D: Tumour samples were stained using trastuzumab as a primary antibody (1 :1000), and goat anti-human IgG-Alexa Fluor 594 (1 :300) as a secondary antibody. Sections were mounted using Prolong Gold Antifade with DAPI. Sections were imaged using the Zeiss Axiolmager M1 at 10x magnification. Similar results were seen across 3 different independent experiments. FIGs. 3E-F: Patient tumour cores were infected with (FIG. 3E) VSVA51-HER2T and co-treated with T-DM1 or mock (PBS) as indicated. Viral titer in supernatants was quantified 48 hpi. Shown are mean ± SEM, n = 4-14 cores, P-value calculated by multiple unpaired t-tests. 147222-000022
[0112] 9
[0113] (Endometrial 1 n = 4, Renal 1 n = 6, Ovarian 2 and Breast 1 n = 8, Parotid 2 n = 14, all others n = 12). FIG. 3F: Ratios of mean viral titer of T-DM1 / PBS for samples infected with VSVA51-HER2T or VSVA51-GFP were calculated and plotted as a heat map. FIG. 3G: Experimental overview: 5 x 1054T1 .2 cells were injected i.v. by teil vein injection into wildtype BALB / c mice on DO and then treated on D1 and D2 by i.v. administration of PBS, VSVA51-HER2T, T-DM1 , or VSVA51- HER2+T-DM1. Mice were euthanized on D10 post-implantation, and lungs were extracted, perfused, and stained for counting of metastatic lung nodules. FIG. 3H: Following staining with black India ink, lungs were fixed and imaged. FIG. 3I: Lung nodules from FIGs. 3G-3H were counted. Shown are mean ± SEM, n = 10 mice in PBS, n = 5 mice in treatment groups, P-value calculated by one-way ANOVA relative to PBS, with Dunnett correction for multiple comparisons.
[0114] FIG. 4 is a graph showing that VSV-HER2T infects cancer cells in the lungs and introduces the HER2T target, thereby enabling the destruction of the cancer cells by antibodydrug conjugates (ADCs). Mice were injected intravenously with 4T 1 .2 mouse breast cancer cells, which do not express human HER2. These cells travel to the lungs through the bloodstream rapidly. These mice were treated with i.v. injections of the indicated treatments (PBS control, T- DM1 Kadcyla, T-DXd Enhertu (another HER2-targeted ADC), VSV-HER2T alone, or the combinations of VSV-HER2T + ADC. The lungs of these mice were extracted 15 days later and the number of cancer nodules in the lungs were counted.
[0115] FIGs. 5A-5C show that VSVA51-HER2T delivers the target antigen for T-DM1 leading to enhanced viral output in ex vivo patient tumours. FIG. 5A: Schematic highlighting the process of generating and treating tumour cores. FIG. 5B: Cores from CT26 tumours were infected and treated as indicated. 48 hpi viral titer in the core supernatants was quantified and plotted. Shown are mean ± SEM, n = 4 cores, P-value calculated by two-way ANOVA with Dunnett correction for multiple comparisons. FIG. 5C: Patient tumour cores were infected with VSVA51-GFP and cotreated with T-DM1 or mock (PBS) as indicated. Viral titer in supernatants was quantified 48 hpi. (mean ± SEM, n = 4-14 cores, P-value calculated by multiple unpaired two-tailed t-tests; Endometrial 1 n = 4, Renal 1 n = 6, Ovarian 2 and Breast 1 n = 8, Parotid 2 n = 14, all others n = 12).
[0116] FIGs. 6A-6D show that 4T1.2 cells injected intravenously establish microscopic lesions within the lungs within 24 h. 4T1.2 cells were injected intravenously, via tail vein, into BALB / c mice. Control mice were injected with PBS. Cells were stained with an infrared dye. Mice underwent fluorescence IVIS imaging at 1 h and 24 h post-injection, at excitation 710 nm and emission 760 nm. FIG. 6A shows the quantification of stained lung regions of interest (ROIs) (mean ± SEM, n = 5 mice, p-value calculated by one way ANOVA with Fisher’s LSD test). FIG. 6B: Mice from were euthanized, chest cavities were opened, and ribcages removed to expose lungs for subsequent IVIS imaging, and stained lung ROIs were quantified (mean ± SEM, n = 2- 5 mice). FIG. 6C: Lungs from were perfused, fixed by formalin instillation, and processed for 147222-000022
[0117] 10 sectioning and H&E staining. Lung sections underwent histological evaluation by a pathologist (blinded). FIG. 6D: Stained ROIs (1-4) indicate representative microscopic 4T1.2 lesions.
[0118] FIGs. 7A-7G show that VSVA51-HER2T delivers the target antigen for T-DM1 and yields combinatorial efficacy in syngeneic murine tumour models. FIG. 7A: Experimental overview: 5 x 106ID8 Tp53- / - Pten- / - Flue cells were implanted i.p. into wildtype C57BL / 6 mice on DO and treated on D7, D9, and D11 as indicated. FIG. 7B: Mice were treated i.p. as indicated by the dotted lines. Mice underwent 4 rounds of IVIS imaging, 1 week apart, beginning on D5. Total flux was calculated and plotted. Shown are mean ± SEM, n = 5 mice per group, * P < 0.05, *** P < 0.001 ; comparison between VSVA51-HER2T+T-DM1 and whichever group the asterisk colour matches, by two-way ANOVA with Fisher’s LSD test. FIG. 7C: Mice from FIGs. 7A-B were monitored for overall survival; FIG. 7D: Experimental overview: 5 x 105MC38 cells were implanted s.c. into the right flanks of wildtype C57BL / 6 mice on DO, and treated on D9, D11 , and D13 as indicated. FIG. 7E: Tumour volumes were measured by electronic calipers and overall survival was monitored FIG. 7F. FIG. 7G: Mouse weights from FIG. 7D were measured (mean ± SEM, n = 5 mice).
[0119] FIGs. 8A-8K show that engineered «HER2-TCE recognizes HER2T antigen and can be encoded in W. FIG. 8A: Schematic of the anti-HER2 TOE design. FIG. 8B: TOE expression plasmids were transfected into HEK293T cells, and supernatants were resolved by SDS-PAGE 48 h post-transfection. Blots were probed with anti-His antibody to detect His-tagged TCEs. Similar results were seen across 3 different independent experiments. FIG. 8C: Whole cell lysates of the indicated cell lines were resolved by SDS-PAGE and probed with anti-HER2 antibody. FIG. 8D: TOE binding assay for the indicated cells lines (mean ± SEM, n = 3, P-value calculated by two-way ANOVA with Sidak’s correction for multiple comparisons). FIG. 8E-F: trastuzumab and TOE binding assays for MC38 and MC38-HER2T (mean ± SEM, n = 3). FIG. 8G: J69 cells (1 x 106) were co-cultured for 24 h with the indicated cell lines (5 x 105) in the presence or absence of 10 / / g / ml «HER2-TCE. J69 cells were then dislodged and isolated and TdTomato signal was quantified by the BioTek Cytation5 (Gen5 v2 software) at Ex555nm / Em580nm (mean ± SEM, n = 3, P-value calculated by multiple unpaired t-tests with the Holm-Sidak correction for multiple comparisons). FIG. 8H: Naive BALB / c splenocytes were isolated and co-cultured with the indicated target cells at a T:E ratio of 1 :0 or 1 :5. Co-cultures were incubated for 72 h with or without 10 / / g / ml «HER2-TCE. Cell viability was assessed by AlamarBlue and normalized to untreated target cells alone (mean ± SEM, n = 3, P-value calculated by multiple unpaired t-tests with the Holm-Sidak correction for multiple comparisons). FIG. 8I: Schematic of the engineering of TCEs into W and subsequent viral rescue and purification. FIG. 8J: Multi-step (left, MOI 0.01) and single-step (right, MOI 1.0) W growth curves. U-2 OS cells were seeded in 6-well plates at 1 x 106cells per well and incubated overnight. Cells were infected with W-Ctrl, W-Ctrl-TCE, or W-«HER2-TCE at the indicated MOI, and frozen at -80°C at the indicated timepoints. Cells 147222-000022
[0120] 11 undergo a total of 3 freeze-thaw cycles to liberate intracellular W, which was subsequently quantified by plaque assay. Shown are mean ± SEM, n = 3, P-value calculated by two-way ANOVA with T ukey’s correction for multiple comparisons. * P < 0.05, *** P < 0.001 , relative to W- aHER2-TCE. FIG. 8K: Whole cell lysates of U-2 OS cells infected with W and resolved by SDS- PAGE. Blots were probed with anti-His IgG to quantify His-tagged TOE, and anti-Vaccinia IgG to confirm W infection. Similar results were seen across 3 different independent experiments.
[0121] FIGs. 9A-9B show TOE generation and binding. FIG. 9A: Schematic highlighting the generation and purification of TCEs in vitro. FIG. 9B: Overview of the TOE binding assay.
[0122] FIGs. 10A-10E: Determining the effects of IFN[3 and W on VSVA51 infection. FIG. 10A: Vero cells seeded in 96-well plates at 2.5 x 104cells per well, and were infected with VSVA51- RFP at an MOI of 0.01 ± co-infection with W-GFP at the indicated MOI. I FN|3 was added 2 hpi. RFP and GFP counts were quantified 48 hpi using the Cellomics ArrayScan. Shown are mean ± SEM, n = 3, P value calculation by one-way ANOVA with Tukey’s correction for multiple comparisons. FIG. 10B: RFP (VSVA51 foci) and GFP (W foci) images from FIG. 10A, at 0 and 200 lU / ml IFNp, imaged at 2.5x magnification. FIG. 10C: The indicated cell lines were seeded in 24-well plates and infected with VSVA51-RFP at the indicated MOI ± co-infection with W-GFP at the indicated MOI. RFP foci counts were quantified 48 hpi as in FIG. 10A. Shown are mean ± SEM, n = 3, P-value calculated by two-way ANOVA relative to Mock (PBS), with Dunnett correction for multiple comparisons. FIG. 10D: RFP (VSVA51 foci) and GFP (W foci) images from FIG. 10C, imaged at 2.5x magnification. FIG. 10E: BALB / c mice bearing CT26 tumours were injected i.t. with the indicated viruses (1 x 108PFU VSVA51 ; 1 x 107PFU W). Mice were euthanized 48 hpi; tumours and organs were harvested and snap frozen. VSV-N mRNA expression was measured in different organs to assess the biodistribution of VSVA51 by qRT- PCR. Shown are mean ± SEM, n = 3 mice per group, P-value calculated by Student’s t-test. (N.D. not detected).
[0123] FIGs. 11A-11N show that treatment of syngeneic murine HER2T+ tumour models with W«HER2-TCE leads to efficacy. FIG. 11A: Experimental overview: 1 x 1064T1.2-HER2T cells were implanted s.c. in the right flank in BALB / c mice, followed by i.t. treatments as indicated. FIG. 11B: Tumour volumes from FIG. 11A were monitored (mean ± SEM, n = 5 mice per group). FIG. 11C: Overall survival from FIG. 11A was monitored. FIG. 11D: Mouse weights from FIG. 11 A. FIGs. 11E-F: Cured mice from FIGs. 11A-C were re-challenged with bilateral s.c. tumours, (FIG. 11E) parental 4T1.2 or (FIG. 11 F) 4T1.2-HER2T as indicated. Naive mice were challenged with bilateral s.c. tumours as indicated, and tumour volumes were monitored. FIG. 11G: Experimental overview: 5 x 1O5CT26-HER2T cells were implanted s.c. in the right flank in BALB / c mice, followed by i.t. treatments as indicated. FIG. 11H: Tumour volumes from FIG. 11G were monitored (mean ± SEM, n = 5 mice per group). FIG. 111: Overall survival from FIG. 11G was monitored. FIG. 11 J: Mouse weights from FIG. 11G. FIGs. 11K-L: Cured mice from FIGs. 11G-I were re- 147222-000022
[0124] 12 challenged with bilateral s.c. tumours, (FIG. 11K) parental CT26 or (FIG. 11L) CT26-HER2T as indicated. Naive mice were challenged with bilateral s.c. tumours as indicated, and tumour volumes were monitored. FIG. 11 M: Experimental overview: 5 x 106ID8-PP-HER2T cells were implanted i.p. in C57BL / 6 mice, followed by i.p. treatments as indicated. FIG. 11N: Overall survival from FIG. 11K was monitored.
[0125] FIGs. 12A-12D show the validation of tumour core, co-culture assays, and flow cytometry. FIG. 12A: Schematic highlighting the process of acquiring, processing, and analyzing tumour core specimens. FIGs. 12B-C: MC38 and MC38-HER2T cells were analyzed by flow cytometry for trastuzumab-PE binding. MC38-HER2T tumour cores were co-cultured with J69 cells ex vivo followed treatment as indicated. Images of J69 cells were acquired using a EVOS M5000 microscope (10x magnification). J69 cells were isolated, and TdTomato signal was quantified by flow cytometric analysis. The arrow indicates the shift in TdTomato signal followed treatment with W-aHER2-TCE. Frequency of TdTomato J69 cells (FIG. 12B) and MFI of TdTomato + J69 cells (FIG. 12C) were quantified. Shown are mean ± SEM, n = 5 cores per group; P-value was calculated by unpaired two-tailed t-test. FIG. 12D: Quantification of cell surface HER2 by flow cytometric analysis, using trastuzumab (1 : 1000) as a primary antibody. Shown are mean ± SEM, n = 3 biological replicates per cell line.
[0126] FIGs. 13A-13H show that infection of tumours with W-aHER2-TCE ex vivo leads to T- cell activation when combined with VSVA51-HER2. FIG. 13A: Images acquired using the EVOS M5000 microscope of the co-cultured J69 cells, which were cultured with MC38 tumour cores under different treatment conditions as indicated (20x magnification) FIG. 13B: J69 cells from FIG. 13A were isolated and assessed for TdTomato signal by flow cytometric analysis. FIG. 13C: MFI of TdTomato+ J69 cells was quantified. Shown are mean ± SEM, n = 3 cores per group; P- value calculated by one-way ANOVA, with Dunnett correction for multiple comparisons. FIG. 13D: J69 cells were isolated from co-culture with CT26 tumour cores following treatment as indicated, and TdTomato signal was quantified by flow cytometric analysis. FIG. 13E: Quantification of TdTomato signal from FIG. 13D. Shown are mean ± SEM, n = 6-19 cores per group; P-value calculated by one-way ANOVA related to VSVA51-HER2T + W-aHER2-TCE, with Dunnett correction for multiple comparisons. cPBS n = 8, W-Ctrl-TCE n = 7, W-Ctrl-TCE + VSVA51- HER2T n =8, W-aHER2-TCE n =10, W-aHER2-TCE + VSVA51-HER2T n = 19). FIG. 13F: HT29 xenografts were excised and cored by punch biopsy, then treated and co-cultured with J69 cells. J69 cells were isolated and assessed for TdTomato signal by flow cytometric analysis. FIG. 13G: Quantification of TdTomato signal from FIG. 13F. Shown are mean ± SEM, n = 3-6 cores per group; P-value calculated by one-way ANOVA related to VSVA51-HER2T + W-aHER2-TCE, with Dunnett correction for multiple comparisons. (PBS n = 3, W-Ctrl-TCE n = 3, W-Ctrl-TCE + VSVA51-HER2T n =5, W-aHER2-TCE n =6, W-aHER2-TCE + VSVA51-HER2T n = 6) FIG. 13H: Patient tumour specimens were treated and analyzed for J69 TdTomato signal. Shown are 147222-000022
[0127] 13 mean ± SEM, n = 2-6 cores per group (for exact n values, see Source Data); P-value calculated by one-way ANOVA related to VSVA51-HER2T + W-aHER2-TCE within each specimen, calculated only for n = 3 or more cores.
[0128] FIGs. 14A-14M show that treatment of tumour-bearing mice with W-aHER2-TCE and VSVA51-HER2T prolongs overall survival in localized disease models. FIG. 14A: Experimental overview: 5 x 105MC38 cells were implanted s.c. in C57BL / 6 mice in the right flank. Mice were treated i.t. as indicated. FIG. 14B: Tumour volumes (mean ± SEM, n = 5 per group) and (FIG. 14C) overall survival were monitored. FIGs. 14D-E: Cured mice from FIGs. 14A-C were rechallenged with bilateral s.c. tumours, (FIG. 14D) parental MC38 (left flank) or (FIG. 14E) MC38- HER2T (right flank). Naive mice were challenged with bilateral s.c. tumours in parallel as controls. FIG. 14F: Experimental overview: 5 x 105CT26 cells were implanted s.c. in BALB / c mice in the right flank. Mice were treated i.t. as indicated. Tumour volumes (mean ± SEM, n = 5 per group) (FIG. 14G) and overall survival (FIG. 14H) were monitored. FIGs. 141-J: Cured mice from FIGs. 14F-H were rechallenged with bilateral s.c. tumours, (FIG. 141) parental CT26 (left flank) or (FIG. 14J) CT26-HER2T (right flank). Naive mice were challenged with bilateral s.c. tumours in parallel as controls. FIG. 14K: Experimental overview: 5 x 1054T1.2 cells were implanted s.c. in BALB / c mice in the right flank. Mice were treated i.t. as indicated. Tumour volumes (mean ± SEM, n = 5 per group) (FIG. 14L) and overall survival (FIG. 14M) were monitored. For analysis of survival data, P-values were calculated by the Kaplan-Meier method followed by log-rank test.
[0129] FIGs. 15A-15D show the validation of the co-formulated virus co-injections in vivo. FIG. 15A: Experimental overview: 5 x 105MC38 cells were implanted s.c. in the right flank of C57BL / 6 mice. Mice were treated as indicated with the dual-virus combination; pink arrows indicate treatment with the co-formulated single-injection of both viruses. Arrows indicate sequential treatment with each virus. Tumour volumes (mean ± SEM, n = 5 per group; p-values calculated by two-way ANOVA relative to the co-injection group with Fisher’s LSD test; colour of the asterisks match the colour of the treatment group being compared) (FIG. 15B) and overall survival (FIG. 15C) were monitored. FIG. 15D: P-values were calculated by two-way ANOVA using tumour volume data from (FIG. 15B), all compared to VSVA51-HER2T i.t. + W-aHER2-TCE i.t. coformulated injection (teal curve).
[0130] FIGs. 16A-16F show the assessment of CT26 tumour infection of both single virus infection (VSV alone and W alone) and dual virus infection at 24 and 48 h post-injection. FIG. 16A: Experimental overview: 5 x 105CT26 cells were implanted bilaterally in BALB / c mice subcutaneously. 11 days post-implantation, both tumours were injected with the indicated treatments (n=10 mice per group). Half of the animals were harvested 24 h post-injection (n=5), and the remaining animals were harvested at the 48 h post-injection timepoint. All tumours from the right flank were dissociated for flow cytometry analysis, while all tumours from the left flank were fixed in formalin and used in subsequent IHC. Following harvest, tumours were dissociated 147222-000022
[0131] 14 and analyzed by flow cytometry to detect VSVA51 -infected at (FIG. 16B) 24 and (FIG. 16C) 48 h post-injection. Dissociated tumours were also analyzed for W-infected cells at (FIG. 16D) 24 and (FIG. 16E) 48 h post-injection. Following processing, sectioning, and staining of serial tumour sections with anti-VSV antibody or anti-W antibody, slides were scanned and analyzed. Quantification of DAB-positive (infected) area shown for VSVA51 in FIG. 16F (mean ± SEM, n = 4 mice per group, P-value calculated by one-way ANOVA with Fisher’s LSD test).
[0132] FIGs. 17A-17B show that the injection of CT26 tumours with VSVA51-HER2T+ W- «HER2-TCE triggers cell death in highly infected regions. Mice (n = 4 per group) bearing subcutaneous CT26 tumours were given a single intratumoral injection of the indicated treatments (from FIGs. 16A-16F). Tumours collected 48 h post-injection were fixed, paraffin embedded, and sectioned. Serial tumour sections were stained with the indicated antibodies and scanned, (a) Representative images from different tumour sections, stained with each of 4 different antibodies, are shown with close-up images of specific regions of interest (ROI) indicated by red circles (~1.5 mm2, 10,000+ detected cells per ROI per sample). The frequency of cleaved-caspase 3 positive cells (FIG. 17A) and cleaved caspase 1 positive cells (FIG. 17B) in specific regions of interest ROI from images from different tumour sections stained with each of 4 different antibodies.
[0133] FIGs. 18A-18M show that intratumoral injection of W-aHER2-TCE and VSVA51-HER2T induces anti-tumour immune responses. FIG. 18A: Experimental overview: 5 x 105CT26 cells were implanted s.c. in BALB / c mice in the right flank. Mice were treated i.t. as indicated. Tumours were harvested on day 3 for intracellular staining (ICS) of cytokines, and on day 5 for assessing the profiles of the immune infiltrating populations. FIGs. 18B-D: Following tumour-dissociation, immune cells were cultured ex vivo for 24 h and Golgi plugged following stimulation with PBS control, 2 x 106irradiated CT26 cells, or 2 x 106irradiated JIMT1 cells. Immune cells were analyzed by flow cytometric analysis for intracellular levels of IFNy and TNFa in (FIG. 18B) TCRytf T-cells, (FIG. 18C) CD4+ T-cells, and (FIG. 18D) CD8+ T-cells, (mean ± SEM, n = 3 mice in PBS and VSVA51-HER2T + W-Ctrl-TCE groups, n = 5 mice in W-aHER2-TCE + VSVA51-HER2T group; P-value calculated by one-way ANOVA relative to W-aHER2-TCE + VSVA51-HER2T, with Dunnett correction for multiple comparisons). FIGs. 18E-H: Tumours dissociated at day 5 were analyzed by flow cytometric analysis. FIG. 18E: Levels of CXCR3 (MFI) in total CD3+ T- cells are shown. Frequency of (FIG. 18F) PD1+LAG3+ CD3+ T-cells and (FIG. 18G) CTLA4+ Tregs were determined relative to total CD45+ cells. For all violin plots, n = 5 mice per group; P- value calculated by one-way ANOVA relative to W-aHER2-TCE + VSVA51-HER2T, with Dunnett correction for multiple comparison. FIG. 18H: Experimental overview: 5 x 105CT26 cells were implanted s.c. in BALB / c mice in the right flank. Mice were treated i.t. as indicated. Following harvest and dissociation of spleens at D 14 post-treatment, splenocytes were subjected to cultures in an ELISpot plate to quantify IFNy-secreting cells following 16 h culture in the presence of the following stimulation: 10 pM gp70 peptide (FIG. 181), irradiated CT26 cells (FIG. 18J), irradiated 147222-000022
[0134] 15
[0135] JIMT1 cells (FIG. 18K), 10 pM VSV-N peptide (FIG. 18L), 10 pM W-F2 / E3 peptides (FIG. 18M) (mean ± SEM, n = 5 mice per group; P-value calculated by one-way AN OVA relative to VSVA51- HER2T + W-aHER2-TCE, with Dunnett correction for multiple comparisons).
[0136] FIGs. 19A-19F show that intratumoral injection of VSVA51-HER2T + W-aHER2-TCE enhances tumour-infiltrating lymphocyte activation. FIGs. 19A-D: Levels of CXCR3 (MFI) were analyzed by flow cytometry in (FIG. 19A) CD8+ T-cells, (FIG. 19B) CD4+ T-cells, (FIG. 19C) TCRy<5 T-cells, and (FIG. 19D) NK cells. FIG. 19E: Quantification of CD3 levels (MFI). FIG. 19F: Frequency of PD-L1+ macrophages relative to total CD45+ cells. (For all violin plots, mean ± SEM, n = 5 mice per group; P-value calculated by one-way ANOVA relative to WaHER2-TCE + VSVA51-HER2T, with Dunnett correction for multiple comparison).
[0137] FIGs. 20A-20F show that splenocytes harvested from mice 14 days post-treatment exhibit reactivity against tumour and viral antigens. Following harvest of splenocytes from mice at day 14 post-treatment as indicated in FIG. 18H, splenocytes were used for intracellular cytokine staining (ICS). Splenocytes were analyzed by flow cytometric analysis for intracellular levels of IFNy, following 24 h ex vivo culture (Golgi plugged) stimulated by (FIG. 20A) PBS control, (FIG. 20B) 10 pM gp70 peptide, (FIG. 20C) irradiated CT26 cells, (FIG. 20D) irradiated JIMT1 cells, (FIG. 20E) 10 pM VSV-N peptide, (FIG. 20F) 10 pM W-F2 / E3 peptides. Dotted lines indicate % IFNy positive CD8+ T-cells following stimulation with PMA / ionomycin. (mean ± SEM, n = 5 mice per group; P-value calculated by one-way ANOVA relative to W-aHER2-TCE + VSVA51-HER2T, with Dunnett correction for multiple comparison).
[0138] FIGs. 21A-21F show that CT26 tumour-bearing mice receiving intratumoral VSVA51- HER2T+W-«HER2-TCE injections raise IgG against tumour and viral antigens. Serum was isolated from the lateral saphenous vein bleeds from FIG. 18H at day 7 and day 14 post-treatment. Serum was diluted (1 :100) and incubated with 5 x 105cells as follows: (FIG. 21A-B) CT26 cells or (FIG. 21 D-E) JIMT1 cells. Serum was washed off and IgG bound to cells was quantified using an anti-mouse IgG antibody (AlexaFluor™ Plus 488). Fluorescence signal was quantified by flow cytometry. FIGs. 21A and 21 D: Serum collected at day 7; FIGs. 21 B and 21 E: serum collected at day 14. Change in the IgG reactivity between day 7 and 14 is plotted for (FIG. 21 C) CT26 and (FIG. 21 F) JIMT1. Dotted lines indicate signal obtained using serum from naive mice. For all bar charts, mean ± SEM, n = 5 mice per group; P-value calculated by one-way ANOVA relative to W-«HER2-TCE + VSVA51-HER2T, with Dunnett correction for multiple comparison.
[0139] FIGs. 22A-22F show that treatment of tumour-bearing mice with W-aHER2-TCE and VSVA51-HER2T prolongs overall survival and reduces lung metastases in disseminated disease models. FIG. 22A: Experimental overview: 5 x 1054T1.2 cells were injected i.v. by teil vein injection into BALB / c mice, and treated as indicated, followed by harvest and staining of lungs. FIG. 22B: Following staining with black India ink, lungs were fixed and imaged. FIG. 22C: Metastatic lung nodules were quantified. Shown are mean ± SEM, n = 10 mice in the PBS group, 147222-000022
[0140] 16 n = 5 mice in all other groups; P-value calculated by one-way ANOVA relative to VSVA51-HER2T, with Dunnett correction for multiple comparisons. FIG. 22D: Experimental overview: 5 x 106ID8- PP cells were implanted i.p. in C57BL / 6 mice, followed by treatments as indicated. FIG. 22E: Overall survival was monitored; P-values indicated next to treatment groups is relative to VSVA51-HER2T + W-aHER2-TCE. For analysis of survival data, P-values were calculated by the Kaplan-Meier method followed by log-rank test. FIG. 22F: Schematic depicting the dual oncolytic virus approach to treat tumours (indicated by the number 1), whereby VSVA51 and W produce the HER2T synthetic target and its cognate TCE, respectively. These two OVs synergize since W dampens interferon levels and increases VSVA51 replication. W-produced TCEs recognize and bind to HER2T, forming a pseudo-immunological synapse that allows for the release of effector molecules (e.g., granzyme, perforin). OVs lead to the recruitment of immune cells in the tumour, and TCEs mediate the activation of T cells that trigger apoptosis of cancer cells. Ultimately, this strategy improves survival of mice bearing different tumour types and decreases lung metastases. Importantly, VSVA51 -mediated production of HER2T on the surface of cancer cells can synergize with other alternative antibody-based approaches, such as antibody-drug conjugates like T-DM1 (indicated by the number 2). In this case, the ADC can synergize with VSVA51 to promote viral replication. The ADC-mediated cell death also leads to increased survival in preclinical animal models and decreased lung metastases in mice.
[0141] FIGs. 23A-B show that treatment of C57BL / 6 mice with VSVA51-HER2T + W-aHER2- TCE following surgical excision of B16-F10 tumours prevents tumour recurrence and metastasis. FIG. 23A: Experimental overview: 5 x 105B16-F10 cells were implanted orthotopically in C57BL / 6 mice subcutaneously in the right flank. 10 days post-implantation, tumours were excised, and mice received intravenous injections of the indicated treatments 48h post-surgery. Mice were monitored over time and euthanized at day 45, where lungs, spleens, and recurrent primary tumours were harvested. FIG. 23B: Mice were scored (n = 5 per group) as indicated.
[0142] FIG. 24A is a schematic of different EGFR-derived engineered antigens according to the present disclosure. The top panel shows the full human EGFR protein including the intracellular domain, transmembrane domain, and extracellular domain (SEQ ID NO:4). Current antibodies targeting EGFR bind to epitopes located in Domain III. Both EGFR variants according to the present disclosure, EGFR-T1 (SEQ ID NO:5) and EGFR-T2 (SEQ ID NO:6), have removed the kinase domain (signalling) as well as residues 24-309 (Domain I and a major part of Domain II) according to the antigen design described herein. The EGFR-T2 variant also lacks residues Domain IV (residues 510-645). The native 24 a. a. EGFR signal peptide in EGFR-T1 and EGFR- T2 may be replaced with that of HER2 (22 a. a.) to generate variants EGFR-T 1 .2 (SEQ ID NO:44) and EGFR-T2.2 (SEQ ID NO:45). These variants can engage EGFR-targeted therapeutics and unbound EGFR-T targets can also act as decoy receptors for endogenous EGFR ligands, EGF and TGFa, to reduce pro-cancerous signaling in the environment. Due to the structural similarity 147222-000022
[0143] 17 of the extracellular domain of these variants, they may act as a dominant negative for EGFRvlll mutants and play a functional role, in addition to acting as an anchor for multiple EGFR-targeted therapeutics.
[0144] FIG. 24B is a schematic of a CD20-derived engineered antigens according to the present disclosure. The top panel shows the full CD20 protein (SEQ ID NO:43) including an intracellular loop (ICL, adaptor site for signaling mediators), two intracellular domains at the N- and C-terminal end, four transmembrane domains, and two extracellular domains (small and large extracellular loop, ECL). Several current antibodies targeting CD20 bind to epitopes located in the large ECL. The CD20-T variant (SEQ ID NO:46) comprises the ECL domain flanked by two transmembrane domains (TM3 and TM4), along with short N- and C-terminal domains, whereas the CD20-TL variant (SEQ ID NO:47) comprises the ECL domain flanked by one transmembrane domain (TM4) and a signal peptide (e.g., the HER2 signal peptide).
[0145] FIGs. 25A-D depict examples of multi-epitope engineered antigen constructs according to the present disclosure. The construct depicted in FIG. 25C (SEQ ID NO:48) comprises the epitope for rituximab (EGFR-T2), mosunetuzumab (CD20-TL), and the HER2 antibodies disitamab, pertuzumab, and trastuzumab (HER2-T1), along with the EGFR signal peptide and the HER2 transmembrane domain (804 aa - 2412 bp). The EGFR signal peptide may be replaced by the HER2 signal peptide to generate SEQ ID NO:49 (802 aa -2406 bp). The construct depicted in FIG. 26D (SEQ ID NQ:50) comprises the epitope for rituximab, mosunetuzumab, and trastuzumab (HER2), along with the EGFR signal peptide and transmembrane domain (454 aa - 1362 bp). The EGFR signal peptide may be replaced by the HER2 signal peptide to generate SEQ ID NO:51 (452 aa - 1356 bp)
[0146] FIGs. 26A-B show that the dual-virus + TIL therapy has reduced tumor sizes and increased survival compared to controls. FIG. 26A shows tumour volumes at days -1 , 7 and 13 (pre- and post-treatment) plotted on a bar graph for four groups. P-values are generated through two-way ANOVA, with Tukey’s correction for multiple comparisons. FIG. 26B shows a survival curve graph showing the highest survival in animals treated with the dual-virus + TIL ACT.
[0147] FIGs. 27A-C show that unconjugated MMAE or Colchicine in combination with VSV increase the viability of both the drug and virus. FIG. 27A-B show line plots indicating the relative metabolic activity of MMAE or Colchicine with VSVd51 . FIG. 27C shows well plates treated with 4T 1 .2 cells stained with Coomassie blue to demonstrate cell killing and virus spread for untreated and treated with MMAE cells.
[0148] FIG. 28 shows that Enfortumab vedotin (Padcev®) enhances VS A51 replication and spread. Human Nectin-4-positive cancer cells were pre-treated with vehicle control, MMAE, or Padcev® at the indicated concentrations for 4 hours, then infected with VSVA51-GFP at an MOI of 0.01. Cells were imaged at 40 hours post-infection to capture GFP signal as a measure of viral replication and spread. 147222-000022
[0149] 18
[0150] FIGs. 29A-B show that Trastuzumab Deruxtecan (Enhertu®) increases VSV replication and spread and cancer cell killing. FIG. 29A shows a line plot indicating the relative metabolic activity of exatecan with VSVd51. FIG. 29B shows Coomassie blue stained plates and fluorescence-imaging demonstrating increased cell killing and virus spread in the Enhertu®- treated plates.
[0151] DISCLOSURE OF INVENTION
[0152] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the technology (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.
[0153] The terms "comprising", "having", "including", and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted.
[0154] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.
[0155] The use of any and all examples, or exemplary language (“e.g.”, "such as") provided herein, is intended merely to better illustrate embodiments of the claimed technology and does not pose a limitation on the scope unless otherwise claimed.
[0156] No language in the specification should be construed as indicating any non-claimed element as essential to the practice of embodiments of the claimed technology.
[0157] Herein, the term "about" has its ordinary meaning. The term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% of the recited values (or range of values).
[0158] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All subsets of values within the ranges are also incorporated into the specification as if they were individually recited herein.
[0159] Where features or aspects of the disclosure are described in terms of Markush groups or list of alternatives, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member, or subgroup of members, of the Markush group or list of alternatives.
[0160] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in stem cell biology, cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry). 147222-000022
[0161] 19
[0162] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1- 4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0163] In the studies described herein, the present inventors have shown that it is possible to render cancers susceptible to antibody-based cancer immunotherapies by inducing the expression of an engineered cell surface antigen by the tumor cells using a delivery system targeting the tumor cells, such as an oncolytic virus, comprising a nucleic acid encoding the engineered cell surface antigen. Using a truncated version of human HER2 lacking the most immunogenic extracellular domain and the intracellular domain as a representative engineered cell surface antigen and VSV as a representative delivery system targeting tumor cells, it was shown that it is possible to increase the susceptibility of cancers to the known HER2-targeted ADC trastuzumab emtansine (Kadcyla®, T-DM1). It was also shown that a synergistic antitumor effect may be obtained using a combination of oncolytic viruses, for example a first oncolytic virus comprising a nucleic acid encoding a target cell surface antigen and a second oncolytic virus comprising a nucleic acid encoding an antibody or antigen-binding fragment thereof that specifically recognizes the target cell surface antigen. Thus, the approach proposed herein is to modify or “customize” a tumor to express a given antigen and make the tumor susceptible to immunotherapies (antibody or antibody fragment-based therapies such as CAR cells, ADCs, etc.), including known and / or clinically approved immunotherapies, targeting the antigen, instead of trying to develop new immunotherapeutic agents targeting an antigen specific for the tumor.
[0164] Accordingly, in an aspect, the present disclosure provides a method for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject, the method comprising administering to the subject an effective amount of a delivery vehicle for tumor cells comprising a nucleic acid encoding an engineered antigen, wherein the engineered antigen:
[0165] (i) is localized at the cell surface when expressed;
[0166] (ii) comprises an extracellular domain (or ectodomain) of a naturally occurring receptor, or a fragment thereof comprising at least 20 amino acids, or a variant of 147222-000022
[0167] 20 the extracellular domain or fragment thereof having at least 90% sequence identity with the extracellular domain or fragment thereof;
[0168] (iii) comprises at least one epitope that is specifically recognized by the antibody or antigen-binding fragment thereof; and
[0169] (iv) lacks a functional intracellular domain.
[0170] In another aspect, the present disclosure provides a combination or therapeutic agent, and more particularly a combination for the treatment of cancer, the combination or therapeutic agent comprising:
[0171] (a) a first delivery vehicle for tumor cells comprising a nucleic acid encoding an engineered antigen, wherein the engineered antigen:
[0172] (i) is localized at the cell surface when expressed;
[0173] (ii) comprises an extracellular domain of a naturally occurring receptor, or a fragment thereof comprising at least 20 amino acids, or a variant of the extracellular domain or fragment thereof having at least 90% sequence identity with the extracellular domain or fragment thereof;
[0174] (iii) comprises at least one epitope that is specifically recognized by at least one antibody or antigen-binding fragment thereof; and
[0175] (iv) lacks a functional intracellular domain; and
[0176] (b) at least one antibody or antigen-binding fragment thereof specifically recognizing the at least one epitope.
[0177] The term “delivery vehicle for tumor cells” as used herein generally refers to an agent or a system designed to transport and introduce nucleic acids specifically into tumor cells. Such delivery vehicles can take various forms, including but not limited to nanoparticles (such as lipid nanoparticles, LNPs), liposomes, viral vectors, or conjugates comprising an agent (e.g., a peptide, an antibody or an antigen-binding fragment) thereof targeting proteins expressed by tumor cells and being internalized by the cells. The delivery vehicle may include a combination of these, for example nanoparticles, liposomes or viral vectors conjugated to an agent (e.g., a peptide, an antibody or an antigen-binding fragment) thereof targeting proteins expressed by tumor cells.
[0178] In an embodiment, the delivery vehicle comprises a vesicle or nanoparticle such as a lipid vesicle (e.g., liposome) or lipid nanoparticle (LNP). The term liposome as used herein in accordance with its usual meaning, referring to microscopic lipid vesicles composed of a bilayer of phospholipids or any similar amphipathic lipids (e.g., sphingolipids) encapsulating an internal aqueous medium. The term “lipid nanoparticle” refers to liposome-like structure that may include one or more lipid bilayer rings surrounding an internal aqueous medium similar to liposomes, or micellar-like structures that encapsulates molecules (e.g., nucleic acids) in a non-aqueous core. Lipid nanoparticles typically contain cationic lipids, such as ionizable cationic lipids. Examples of cationic lipids that may be used for LNPs include DOTMA, DOSPA, DOTAP, ePC, DLin-MC3- 147222-000022
[0179] 21
[0180] DMA, C12-200, ALC-0315, CKK-E12, Lipid H (SM-102), OF-Deg-Lin, A2-lso5-2DC18, 306Oii0, BAME-O16B, TT3, 9A1 P9, FTT5, COATSOME® SS-E, COATSOME® SS-EC, COATSOME® SS- OC and COATSOME® SS-OP (see, e.g., Hou et al., Nature Reviews Materials, volume 6, pages 1078-1094 (2021); Tenchov et al., ACS Nano, 15, 16982-17015 (2021). Liposomes and lipid nanoparticles typically include other lipid components such as lipids, lipid-like materials, and polymers that can improve liposome or nanoparticle properties, such as stability, delivery efficacy, tolerability and biodistribution. These include phospholipids (e.g., phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, and phosphatidylglycerol) such as 1 ,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and DOPE, sterols (such as cholesterol and cholesterol derivatives), PEGylated lipids (PEG-lipids) such as 1 ,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (PEG2000-DMG) and 1 ,2-distearoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (PEG2000-DSG). In an embodiment, the nucleic acid encoding the engineered antigen is an mRNA molecule. In other embodiments, the nucleic acid encoding the engineered antigen is a self-amplifying mRNA (saRNA), a trans-amplifying mRNA (taRNA) or a circular mRNA (circRNA) (see, e.g., Liu et al., Nature Reviews Cancer, Volume 23, August 2023, pages 526-543). In an embodiment, the delivery vehicle comprises an LNP and the nucleic acid encoding the engineered antigen is an mRNA encapsulated within the LNP.
[0181] In another embodiment, the delivery vehicle comprises a viral vector. A viral vector can be those derived from adenovirus, vaccinia virus, retrovirus, lentivirus, adeno-associated virus (AAV), or foamy virus. As used herein, the term "viral vector" refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the coding sequence for the various proteins described herein in place of nonessential viral genes. In another embodiment, the nucleic acids encoding the engineered antigen of the present disclosure are provided in a self-amplifying or self-replicating RNA (srRNA) vectors. srRNAs are derived from positive-strand RNA viruses where the structural proteins have been removed and replaced with heterologous genes of interest (e.g., nucleic acids encoding the engineered antigen of the present disclosure). srRNAs have been successfully derived from flaviviruses, nodamura viruses, nidoviruses, and alphaviruses with therapeutic versions of the technology providing the structural proteins in trans to create single cycle viral replicon particles (VRPs) (see, e.g., Aliahmad et al., Next generation self-replicating RNA vectors for vaccines and immunotherapies. Cancer Gene Ther (2022). https: / / doi.org / 10.1038 / s41417-022-00435-8). The vector and / or particle can be utilized for the purpose of transferring DNA, RNA or other nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
[0182] In an embodiment, the viral vector comprises an oncolytic virus (OV). The term “oncolytic virus” refers to a virus that preferably infects (and, if desired, kills) tumor / cancer cells over normal, 147222-000022
[0183] 22 healthy cells. Cancer cells possess several distinctive features that make them susceptible to infection by OVs, including:
[0184] • Genetic and Metabolic Alterations: Cancer cells often exhibit genetic mutations and altered metabolic pathways compared to normal cells. These changes can result in dysregulated cell signaling and immune evasion mechanisms, which are often targeted by OVs. For instance, defects in cellular signaling pathways involved in antiviral responses can render cancer cells more permissive to OV infection. Oncogenic mutations and abnormal metabolic demands in cancer cells may also create dependency on specific cellular functions that OVs can disrupt or exploit for their replication cycles.
[0185] • Defective Antiviral Responses: One aspect that makes cancer cells more susceptible to OV infection is their compromised antiviral defenses. Normal cells typically mount robust antiviral responses upon viral entry, which include interferon-mediated pathways and cellular mechanisms to block viral replication. In contrast, cancer cells frequently exhibit defects in these pathways, either due to mutations or epigenetic alterations acquired during tumorigenesis. This defectiveness in antiviral responses allows OVs to replicate within cancer cells while evading detection and elimination by the immune system.
[0186] • Enhanced Receptor Expression: Certain cancer cells overexpress receptors that facilitate viral entry and infection. OVs can be engineered to exploit these receptor profiles for targeted infection. For example, receptors such as integrins, carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), and others are often upregulated on the surface of various cancer cells. Engineering OVs to bind specifically to these receptors enhances their specificity and efficacy in targeting malignant tissues while sparing normal cells that lack such receptor expression.
[0187] • Altered Tumor Microenvironment (TME): The TME of solid tumors presents a complex milieu characterized by hypoxia, acidic pH, and immunosuppressive factors. These conditions not only support cancer cell survival and growth but also provide a conducive environment for OV replication and spread. OVs have been shown to thrive under hypoxic conditions and can exploit the dysregulated vasculature and nutrient supply within tumors. Moreover, the immunosuppressive nature of the TME, including the presence of regulatory T cells and myeloid-derived suppressor cells, can be partially countered by OV-induced immune responses, thereby enhancing their anti-tumor effects.
[0188] • Cellular Proliferation and Apoptosis Resistance: Cancer cells typically exhibit dysregulated cell proliferation and resistance to apoptosis, making them ideal targets for OV- mediated oncolysis. OVs induce direct cell lysis by exploiting these vulnerabilities, leading to tumor cell death. Furthermore, OV infection can trigger immunogenic cell death (ICD), which promotes the release of tumor-associated antigens and danger signals that stimulate potent anti- 147222-000022
[0189] 23 tumor immune responses. This dual mechanism of action - direct tumor cell killing and immune activation, contributes to the therapeutic efficacy of OVs in treating various cancers.
[0190] Non-limiting examples of oncolytic viruses include those derived from an adenovirus, coxsackievirus, H-1 parvovirus, herpesviruses such as herpes simplex virus (HSV), influenza virus, measles virus, Myxoma virus, Newcastle disease virus, parvovirus picornavirus, reovirus, oncolytic RNA viruses such as rhabdovirus (e.g., vesicular stomatitis virus (VSV), Maraba virus (MG1)), paramyxovirus such as Newcastle disease virus, picornavirus such as poliovirus or Seneca valley virus, poxviruses such as vaccinia virus (e.g. Copenhagen, Indiana Western Reserve, and Wyeth strains), reovirus, arenavirus (such as LCMV) or retrovirus such as murine leukemia virus (MLV).
[0191] In an embodiment, the oncolytic virus comprises a rhabdovirus, and more particularly VSV. Vesicular stomatitis virus (VSV). The VSV genome is a single molecule of negative-sense RNA that encodes 5 major polypeptides: a nucleocapsid (N) polypeptide, a phosphoprotein (P) polypeptide, a matrix (M) polypeptide, a glycoprotein (G) polypeptide, and a viral polymerase (L) polypeptide. In an embodiment, the HSV comprises a mutation in the VSV Matrix (M) protein to eliminate the matrix’ protein ability to block the nuclear pores from exporting type 1 interferon mRNA. In an embodiment, the mutation is a deletion of methionine at position 51 (A51).
[0192] In an embodiment, the oncolytic virus comprises a vaccinia virus (W). Exemplary strains of the vaccinia virus include Copenhagen, Western Reserve, Wyeth, Lister, EM63, ACAM2000, LC16m8, CV-1 , modified vaccinia Ankara (MVA), Dairen I, GLV-lh68, IHD-J, L-IVP, LC16m8, LC16mO, Tashkent, Tian Tan, and W AU86 / 88-1 , and more particularly the Tian Tan, Copenhagen, or Western Reserve strain. In an embodiment, the W is an attenuated W. In an embodiment, the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene (J2R) and / or the ribonucleotide reductase (RR) gene. In an embodiment, the attenuated W comprises a mutation or deletion of the TK gene, which leads to more selective and permissive infection in cancer cells with high endogenous thymidine kinase activity. In an embodiment, the W or attenuated W encodes an interferon-binding decoy receptor, i.e., a secreted protein with homology to an interferon (IFN) receptor. A nonlimiting example of such an interferon-binding decoy receptor is the protein encoded by the B8R gene in a Copenhagen strain of W (UniProtKB database entry P21004). The B8R may also include fragments or variants of the protein listed above, or of homologous genes from another vaccinia virus strain. Variants include, without limitation, those sequences having at least 80, 85, 90 or 95% identity to the above-noted sequence. Another nonlimiting example of such an interferon-binding decoy receptor is the protein encoded by the B19R gene in a Copenhagen strain of W (UniProtKB database entry P21077). The B19R protein may also include fragments or variants of the protein listed above, or of homologous genes from another vaccinia virus strain. Variants include, without limitation, those sequences having at least 80, 85, 90 or 95% identity to the above-noted sequence. 147222-000022
[0193] 24
[0194] The delivery vehicle may also comprise oncolytic bacteria. Oncolytic bacteria, which include species of Klebsiella (such as Klebsiella pneumoniae), Listeria (such as Listeria monocytogenes), Mycobacteria, Streptococcus / Serratia (Coley’s Toxin), Proteus, Salmonella (such as Salmonella typhimurium, and Clostridium (such as Clostridium novyi-NT, which have emerged as promising vehicles for delivering antigens to cancer cells (see, e.g., Roe et al., Pharmaceutics 2023, 15(7), 2004; https: / / doi.org / 10.3390 / pharmaceutics15072004). These bacteria may be genetically modified to express tumor antigens or immunostimulatory molecules.
[0195] The engineered antigen according to the present disclosure may be derived from any naturally occurring receptor that is expressed at the surface of tumor cells and not (or at a much lower level) in normal human cells, i.e., tumor antigens. The engineered antigen includes an extracellular domain (ectodomain) comprising one or more epitopes that may be recognized by one or more antibodies or antigen-binding fragments thereof. These may be complete epitopes, or truncated sequences, and may be expressed in tandem on a single multi-epitope peptide or as separate multiple epitopes from a self-cleaving precursor peptide.
[0196] Examples of tumor antigens from which the engineered antigen according to the present disclosure may be derived include GD2 / GD3 gangliosides (which may be targeted by, e.g., 3F8, Dinutuximab, Ecromeximab, Mitumomab, Naxitamab), EpCAM (which may be targeted by, e.g., Adecatumumab, Citatuzumab, Edrecolomab), Carcinoembryonic antigen (CEA) (which may be targeted by, e.g., Altumomab pentetate, Besilesomab, Labetuzumab), mesothelin (which may be targeted by, e.g., Amatuximab, Anetumab), Tumor-associated glycoprotein 72 (TAG-72) (which may be targeted by, e.g., Anatumomab mafenatox, Minretumomab), gelatinase B (which may be targeted by, e.g., Andecaliximab), activin receptor-like kinase 1 (which may be targeted by, e.g., Ascrinvacumab), EGFR (which may be targeted by, e.g., Amivantamab, Cetuximab, Depatuxizumab, Futuximab, Imgatuzumab, Matuzumab, Modotuximab, Necitumumab, Nimotuzuma, Panitumumab), VEGF (which may be targeted by, e.g., Bevacizumab, Ranibizumab), VEGFRAZEGFR2 (which may be targeted by, e.g., Icrucumab, Ramucirumab), CD44v6 (which may be targeted by, e.g., Bivatuzumab), CD30 (which may be targeted by, e.g., Brentuximab vedotin), CD52 (which may be targeted by, e.g., Alemtuzumab), CD19 (which may be targeted by, e.g., Blinatumomab, Coltuximab, Denintuzumab), B-cell maturation antigen (BCMA) (which may be targeted by, e.g., Belantamab), CD22 (which may be targeted by, e.g., Bectumomab, Moxetumomab), Notchl (which may be targeted by, e.g., Brontictuzumab), CanAg (which may be targeted by, e.g., Cantuzumab), Lewis-Y antigen (which may be targeted by, e.g., cBR96), CEACAM5 (which may be targeted by, e.g., Cibisatamab), CD221 (which may be targeted by, e.g., Cixutumumab, Dalotuzumab, Figitumumab, Ganitumab), PTK7 (which may be targeted by, e.g., Cofetuzumab), CD38 (which may be targeted by, e.g., Daratumumab, Isatuximab), DLL4 (which may be targeted by, Demcizumab), CD20 (which may be targeted by, Divozilimab, Obinutuzumab, Ofutumumab, Ibritumomab, Rituximab), ERBB3 (HER3) (which may 147222-000022
[0197] 25 be targeted by, Elgemtumab, Duligotuzumab, Lumretuzuma), HER2 / neu (which may be targeted by, Pertuzumab, Trastuzumab), CSF1 R (which may be targeted by, Emactuzumab), HGFR (which may be targeted by, e.g., Emibetuzumab), folate receptor 1 (which may be targeted by, e.g., Farletuzumab, Mirvetuximab), Hepatocyte growth factor (HGF) (which may be targeted by, e.g., Ficlatuzumab, Rilotumumab), TYRP1 (which may be targeted by, e.g., Flanvotumab), MUC1 (which may be targeted by, e.g., Gatipotuzumab), CD33 (which may be targeted by, e.g., Gemtuzumab, Lintuzumab), carbonic anhydrase 9 (CA-IX) (which may be targeted by, e.g., Girentuximab), GPNMB (which may be targeted by, e.g., Glembatumumab), CA-125 (which may be targeted by, e.g., Oregovoma, Sofituzumab), MUC1 (which may be targeted by, e.g., Pemtumomab), TROP-2 (which may be targeted by, e.g., Sacituzumab), RANKL (which may be targeted by, e.g., Denosumab), CD79b (which may be targeted by, e.g., Polatuzumab), and tissue factor (TF) (which may be targeted by, e.g., Tisotumab.
[0198] In an embodiment, the engineered antigen comprises one or more epitopes recognized by one or more antibodies or antigen-binding fragments thereof known to bind the tumor antigens from which the engineered antigen according to the present disclosure is derived. For example, if the is derived from EpCAM, it includes one or more epitopes recognized by Adecatumumab (located around residues 165-175 of human EpCAM), Citatuzumab, and / or Edrecolomab (located around residues 30-50 of human EpCAM). Epitopes bound by antibodies or antigen-binding fragments thereof directed against tumor antigens are either known in the art or may be easily identified by the skilled person using known assays such as mutagenesis, competition assay, crystal structure, in silica prediction / analysis, etc.
[0199] It is to be understood that the engineered antigen according to the present disclosure may include a plurality of epitopes and thus be recognized by more than one antibody or antibody fragment (FIGs. 25A-D). FIG. 25A shows a schematic of a multi-epitope construct according to the present disclosure. Epitope domains A, B, C, D, E, and F are permutable domains within the multi-epitope construct. A is proximal to the transmembrane region, whereas F is furthest away. Optional linkers (L) and transmembrane anchors (TMA) may be included in constructs. The TMA and the signal peptide (SP) used may be prototypical / synthetic sequences, but may also be TMA and SP from a native protein or other proteins. While 6 permutable domains (A-F) are illustrated, it is to be understood that the final construct may contain fewer (e.g., 2, 3, 4 or 5) or more (e.g., 7, 8 or 9) domains depending on the purpose of the construct and the antibody-binding effectiveness. The multi-epitope constructs according to the present disclosure should fulfill the following conditions: (a) the tertiary structure of the epitopes must be uncompromised to allow antibody binding, which may be determined empirically; (b) final construct should not be overtly immunogenic, which may be determined empirically; and (c) if the delivery vehicle is a viral vector, and more particularly a rhabdovirus such as the VSVA51 variant, the final length of the construct 147222-000022
[0200] 26 should ideally not exceed 2500-3000 bp, preferably 2000-2500 bp, for successful rescue of the resulting viral vector (e.g., VSVA51 variant) encoding the total sequence.
[0201] The engineered antigen may include several known epitopes from same tumor antigen and / or a plurality of known epitopes from different tumor antigens. For example, the engineered antigen may comprise a domain / epitope from CD30 recognized by Brentuximab, a domain / epitope from the folate receptor recognized by Mirvetuximab, and two domains / epitopes from HER2 / neu recognized by Pertuzumab and Trastuzumab, or a domain / epitope from CD20 recognized by Rituximab, Ibritumomab, or Obinutuzumab, a domain / epitope from EGFR recognized by Cetuximab, Panitumumab or Necitumumab, and two domains / epitopes from HER2 / neu recognized by Pertuzumab and Trastuzumab, as illustrated in FIGs. 25B-D. The engineered antigen according to the present disclosure may comprise any combination of known domains / epitopes from one or several tumor antigens. In further embodiments, the engineered antigen comprises the multi-epitope construct set forth in any of SEQ ID NOs:48-51 .
[0202] These different domains / epitopes may be directly linked to each other, or may be separated by one or more amino acid linkers. The amino acid (or peptide) linker comprises from 2 to 30 amino acids in length, for example about 5 to about 20-25 amino acids or about 10 to about 15-20 amino acids. The composition and length of each of the linkers may be chosen depending on various properties desired such as flexibility and aqueous solubility. For instance, the peptide linker may comprise relatively small amino acid residues, including, but not limited to, glycine; small amino acid residues may reduce the steric bulk and increase the flexibility of the peptide linker. The peptide linker may also comprise polar amino acids, including, but not limited to, serine. Polar amino acid residues may increase the aqueous solubility of the peptide linker. In an embodiment, the linker comprises glycine and serine residues, for example GGGGS (SEQ ID NO:64) repeats (e.g., 1 to 5 repeats). Furthermore, programs such as Globplot 2.3 (binding et al., GlobPlot: exploring protein sequences for globularity and disorder, Nucleic Acid Res 2003 - Vol. 31 , No.13, 3701-8), may be used to help determine the degree of disorder and globularity, thus also their degree of flexibility. Examples of linkers are depicted in Table 1 below.
[0203] Table 1 147222-000022
[0204] 27
[0205] In an embodiment, the engineered antigen comprises one or more epitopes recognized by an antibody or antibody fragment from an immunotherapeutic antitumor agent (therapeutic antibody, CAR cell, ADC, etc.) that is approved by a recognized drug regulatory agency, such as the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA, Europe), Health Canada, the Pharmaceuticals and Medical Devices Agency (PMDA) in Japan, and the Therapeutic Goods Administration (TGA) in Australia.
[0206] In an embodiment, the ectodomain of the engineered antigen according to the present disclosure comprises at least 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids. In an embodiment, the ectodomain of the engineered antigen according to the present disclosure comprises 1000, 900, 800, 700, 600, or 500 amino acids or less.
[0207] In an embodiment, the engineered antigen according to the present disclosure is derived from HER2 and comprises the domains / epitopes recognized by T rastuzumab and / or Pertuzumab. In a further embodiment, the engineered antigen according to the present disclosure is derived from HER2 and comprises the domains / epitopes recognized by both Trastuzumab and Pertuzumab. The epitope recognized by Trastuzumab is located in domain IV of the ectodomain of HER2 spanning about residues 510-644 of native human HER2, and involves residues P579, E580, D582, Q583, K591 , D592, P593, P594, F595, D607, L608, Y610, K615, D618, Q624, C626, and P627 (IEDB epitope ID 2135124). The epitope recognized by Pertuzumab is located in domain II of the ectodomain of HER2 spanning about residues 183-344 of native human HER2, and involves residues His 245, Vai 286, Ser 288, Leu 295, His 296 and Lys 311 (primarily), and to a lesser extent residues Phe 257, Thr 268, Thr 290, and Pro 315 (Franklin et al., Cancer cell Volume 5, Issue 4, p317-328, April 2004). Thus, in an embodiment, the engineered antigen according to the present disclosure comprises: (a) residues 510-644 of native human HER2 or a variant thereof having at least 80, 85, 90 or 95 sequence identity therewith and maintaining the ability to bind to Trastuzumab, e.g., comprising the epitope defined by residues P579, E580, D582, Q583, K591 , D592, P593, P594, F595, D607, L608, Y610, K615, D618, Q624, C626, and P627; (b) residues 183-344 of native human HER2 or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Pertuzumab, e.g., comprising the epitope defined by residues His 245, Vai 286, Ser 288, Leu 295, His 296 and Lys 311 (and optionally residues Phe 257, Thr 268, Thr 290, and / or Pro 315): or (c) both (a) and (b). 147222-000022
[0208] 28
[0209] In a further embodiment, the engineered antigen according to the present disclosure comprises residues 183-344 and 510-644 of native human HER2, or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Trastuzumab and Pertuzumab. In a further embodiment, the engineered antigen according to the present disclosure comprises residues 183-644 of native human HER2, or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Trastuzumab and Pertuzumab.
[0210] In an embodiment, the engineered antigen according to the present disclosure is derived from EGFR and comprises the domains / epitopes recognized by Cetuximab, Panitumumab, and / or Necitumumab. The epitopes recognized by these antibodies are located in domain III of the ectodomain of EGFR spanning about residues 334-504 of native human EGFR, and involves residues R377, Q408, Q432, H433, F436, V441 , S442, S464, K467, K489, 1491 , S492, and N497 for Cetuximab (IEDB epitope ID 2135097), residues P373, P384, D379, F436, and I462 for Panitumumab (Garcia-Foncillas et al., Front. Oncol., 19 September 2019. Sec. Gastrointestinal Cancers Volume 9 - 2019). The residues defining the epitope bound by Necitumumab are similar to that of Cetuximab, with S492 playing a minor role (Bagchi et al., Mol Cancer Ther. 2017 Nov 20;17(2):521-531). Thus, in an embodiment, the engineered antigen according to the present disclosure comprises residues 334-504 of native human EGFR or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Cetuximab, Panitumumab, and / or Necitumumab, e.g., comprising the epitope defined by residues R377, Q408, Q432, H433, F436, V441 , S442, S464, K467, K489, 1491 , and N497 (and optionally S492) or P373, P384, D379, F436, and I462. In a further embodiment, the engineered antigen comprises residues 310-504 of native human EGFR or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Cetuximab, Panitumumab, and / or Necitumumab. In an embodiment, the engineered antigen further comprises domain IV of native human EGFR or a portion thereof. In a further embodiment, the engineered antigen comprises residues 310-645 of native human EGFR, or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Cetuximab, Panitumumab, and / or Necitumumab.
[0211] In an embodiment, the engineered antigen according to the present disclosure is derived from CD20 and comprises the domains / epitopes recognized by Rituximab, Ibritumomab, and / or Obinutuzumab. The epitopes recognized by these antibodies are located in the large extracellular loop (ECL) of the ectodomain of CD20 spanning about residues 141-189, and more particularly 167-178, of native human CD20, and involves residues 170 to 173 (mostly) and 182 to 185 for Rituximab and Ibritumomab, and residues Pro172, Ser173, Asn176, and Ser177 for Obinutuzumab (Klein et al., MAbs. 2013 Jan 1 ;5(1):22-33). Thus, in an embodiment, the engineered antigen according to the present disclosure comprises residues 141-189 of native 147222-000022
[0212] 29 human CD20 or a variant thereof having at least 80, 85, 90 or 95% sequence identity therewith and maintaining the ability to bind to Rituximab, Ibritumomab, and / or Obinutuzumab. In a further embodiment, the engineered antigen comprises residues 141-189 of native human CD20.
[0213] "Identity" refers to sequence identity between two polypeptides. Percent (%) sequence identity with respect to a reference polypeptide sequence is the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are known for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences are able to be determined, including algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
[0214] The engineered antigen according to the present disclosure does not comprise (or lacks) a functional intracellular domain, i.e., it does not comprise an intracellular domain having enzymatic activity and / or signaling activity capable of activating one or more signaling pathways in the cell upon binding of a ligand (either a natural ligand of the receptor or a synthetic ligand such as an antibody or antigen-binding fragment thereof) on the engineered antigen. As such, binding of the ligand to the engineered antigen (e.g., binding of the antibody or antigen-binding fragment binding to its epitope on the ectodomain) does not lead to activation of, e.g., intracellular pathways, phosphorylation cascades, production of second messengers, changes in gene expression, alteration of cellular metabolism, proliferation, differentiation, etc. directly mediated by the intracellular domain of the engineered antigen. This may be achieved by mutating or deleting one or more of the domains involved in signaling in the intracellular domain (e.g. , residues that may be phosphorylated and / or involved in the binding of signaling mediators or adaptors, such as kinase domains). In an embodiment, the engineered antigen is free of intracellular domain. In an embodiment, the intracellular domain only comprises one or more motifs involved in the internalization / endocytosis of the engineered antigen, which may be optimal for delivering the payload of ADCs or other conjugates and kill the tumor cells. Such motifs comprise short linear tyrosine- and dileucine-based sequences bound by adaptor complex 2 (AP2) involved in clathrin-mediated endocytosis.
[0215] In an embodiment, the engineered antigen according to the present disclosure is derived from HER2 and lacks the intracellular kinase domain (e.g., spanning about residues 720-993) from native HER2 or a portion thereof. In a further embodiment, the engineered antigen according to the present disclosure is derived from HER2 and lacks residues 721-1255 of the intracellular domain from native human HER2. 147222-000022
[0216] 30
[0217] In an embodiment, the engineered antigen according to the present disclosure is derived from EGFR and lacks the intracellular kinase domain (e.g., spanning about residues 706-979) from native EGFR or a portion thereof. In a further embodiment, the engineered antigen according to the present disclosure is derived from EGFR and lacks residues 706-1210 of the intracellular domain from native human EGFR.
[0218] In an embodiment, the engineered antigen according to the present disclosure is derived from CD20 and lacks (a) the intracellular loop (ICL) (e.g., spanning about residues 105-121) from native CD20 or a portion thereof, (b) the N-terminal cytoplasmic domain (e.g., spanning about residues 1-57) from native CD20 or a portion thereof, and / or (c) the C-terminal cytoplasmic domain (e.g., spanning about residues 209-297) from native CD20 or a portion thereof. In a further embodiment, the engineered antigen according to the present disclosure is derived from CD20 and lacks residues 105-121 of the ICL from native human CD20, residues 30-57 from the N- terminal cytoplasmic domain and residues 216-297 the C-terminal cytoplasmic domain.
[0219] In an embodiment, the engineered antigen comprises a transmembrane domain or is attached to plasma membrane through an anchor, e.g., a glycosylphosphatidylinositol (GPI)- anchor, so as to be expressed at the surface of tumor cells. In a further embodiment, the engineered antigen comprises a transmembrane domain. The transmembrane domain may be the native transmembrane domain of a tumor antigen from which the engineered antigen according to the present disclosure is derived, or a transmembrane domain from another known protein, or a synthetic transmembrane domain.
[0220] In an embodiment, the engineered antigen according to the present disclosure is derived from HER2 and comprises the transmembrane domain of native human HER2, i.e., residues 653- 675 (SEQ ID NO:58).
[0221] In an embodiment, the engineered antigen according to the present disclosure is derived from EGFR and comprises the transmembrane domain of native human EGFR, i.e., residues 646- 668 (SEQ ID NO:59).
[0222] In an embodiment, the engineered antigen according to the present disclosure is derived from CD20 and comprises the fourth transmembrane domain (TM4) of native human CD20, i.e., residues 189-209 (SEQ ID NQ:60). In another embodiment, the engineered antigen according to the present disclosure is derived from CD20 and comprises the third transmembrane domain (TM3) of native human CD20, i.e., residues 121-141. In another embodiment, the engineered antigen according to the present disclosure is derived from CD20 and comprises TM3 and TM4 of native human CD20 (SEQ ID NQ:60).
[0223] In an embodiment, the engineered antigen has an immunogenicity in humans that is lower than that of the naturally occurring receptor from which it is derived. A lower immunogenicity means that upon expression by the tumor cells, the engineered antigen raised a weaken immune response, as measured for example by lower activation of antigen-specific T cells and / or lower 147222-000022
[0224] 31 levels of antigen-specific antibodies relative to the naturally occurring receptor from which it is derived. In an embodiment, the engineered antigen raised lower levels of antigen-specific antibodies relative to the naturally occurring receptor from which it is derived. In another embodiment, the engineered antigen raised a lower or weaker T-cell response (e.g., CD8+T cell response) relative to the naturally occurring receptor from which it is derived. Such lower immunogenicity may be achieved, for example, by mutating or deleting residues or domains from the native ectodomain that contains T-cell and / or B cell epitopes. Putative T-cell and / or B cell epitopes in a given protein may be identified using a suitable epitope prediction tool / program. Examples of B cell epitope identification tools / programs include the Bepipred Linear Epitope Prediction 2.0 tool (Larsen JE, Lund O, Nielsen M. 2006. Improved method for predicting linear B-cell epitopes. Immunome Res 2:2), BCPREDS (EL-Manzalawy Y, Dobbs D, Honavar V (2008) Predicting linear B-cell epitopes using string kernels. J Mol Recognit 21 : 243-255), FBCPREDS (EL-Manzalawy Y, Dobbs D, Honavar (2008) Predicting flexible length linear B-cell epitopes. 7thInternational Conference on Computational Systems Bioinformatics, Stanford, CA. pp. 121- 131), and amino acid pair (AAP) antigenicity scale (Chen J, Liu H, Yang J, Chou K (2007) Prediction of linear B-cell epitopes using amino acid pair antigenicity scale. Amino Acids 33: 423- 428). Examples of B cell epitope identification tools / programs include POPI, POPISK, PAAQD, NetMHCstab, NetMHCstabpan, NetTepi, NetMHCcons, and NetTCR (reviewed in Schaap- Johansen et al., Front. Immunol., 2021 ; 12: 712488).
[0225] Without being bound by any theory, it is hypothesized that removing the most immunogenic domain(s) from the naturally occurring receptor prevents the anti-tumour immune response from being directed primarily against the engineered antigen itself, and instead goes on to include more quiescent tumour endogenous antigens (i.e., to prevent the immune response from being “distracted away” from tumour endogenous antigens).
[0226] In an embodiment, the engineered antigen according to the present disclosure is derived from HER2 and lacks the amino-terminal portion, e.g., residues 23-173, of native human HER2.
[0227] In an embodiment, the engineered antigen according to the present disclosure is derived from EGFR and lacks the amino-terminal portion (extracellular domains I and II), e.g., residues 24-309, and / or extracellular domain IV, e.g., residues 510-645, of native human EGFR. In an embodiment, the engineered antigen according to the present disclosure is derived from EGFR and lacks the amino-terminal portion (extracellular domains I and II), e.g., residues 24-309, of native human EGFR. In another embodiment, the engineered antigen according to the present disclosure is derived from EGFR and lacks the amino-terminal portion (extracellular domains I and II), e.g., residues 24-309, and extracellular domain IV, e.g., residues 510-645, of native human EGFR.
[0228] In an embodiment, the engineered antigen according to the present disclosure is derived from CD20 and lacks the amino-terminal portion, e.g., residues 30-57, of native human CD20, 147222-000022
[0229] 32 and / or the small ECL, e.g., residues 78-85, of native human CD20. In an embodiment, the engineered antigen according to the present disclosure is derived from CD20 and lacks both the amino-terminal portion, e.g., residues 30-57, and the small ECL, e.g., residues 78-85, of native human CD20. In a further embodiment, the engineered antigen lacks residues 30-121 of native human CD20.
[0230] The engineered antigen according to the present disclosure also comprises a signal peptide for proper secretion and membrane insertion of the engineered antigen. The signal peptide may be the native signal peptide of a tumor antigen from which the engineered antigen according to the present disclosure is derived, or a signal peptide from another known protein, or a synthetic signal peptide. Signal peptides, also known as signal sequences or leader sequences, are short peptides chain (usually 15-30 amino acids long) typically found at the N-terminus of newly synthesized proteins, and contain a core of hydrophobic residues flanked by positively charged amino acids at the N-terminal and polar amino acids at the C-terminal. In an embodiment, the engineered antigen according to the present disclosure comprises the signal peptide of native human HER2, / .e., residues 1-22 (SEQ ID NO:62). In an embodiment, the engineered antigen according to the present disclosure comprises the signal peptide of native human EGFR, / .e., residues 1-24 (SEQ ID NO:63).
[0231] It may be advantageous for the engineered antigen (and, consequently the nucleic acid encoding the engineered antigen) to be as small as possible, especially if the delivery vehicle is a viral vector such as an oncolytic virus, for various reasons:
[0232] • to improve stability, as larger antigens are typically more unstable.
[0233] • to better integrate into the viral genome. For example, using gene-editing technologies such as CRISPR and considering antibiotic resistance, small size is helpful - rescuing the virus is often not successful with larger antigens.
[0234] • to help reduce immunogenicity.
[0235] • to facilitate delivery through mechanisms that have size limitation, i.e. certain oncolytic viruses such as VSV which have a coding capacity constraint.
[0236] Thus, in certain embodiments, the nucleic acid encoding the engineered antigen has a length of 4000 base pairs (bp) or less, for example 3500 bp or less. In further embodiments, the nucleic acid encoding the engineered antigen has a length of 3000 bp or less, 2500 bp or less, 2000 bp or less, 1900 bp or less, 1800 bp or less, 1700 bp or less, 1600 bp or less, 1500 bp or less, 1400 bp or less, 1300 bp or less, 1200 bp or less, 1100 bp or less, or 1000 bp or less.
[0237] In an embodiment, the first delivery vehicle comprises one or more nucleic acids encoding at least two different engineered antigens. In another embodiment, the combination or therapeutic agent according to the present disclosure comprises two delivery vehicles, wherein each of the delivery vehicle comprises a different engineered antigen. 147222-000022
[0238] 33
[0239] The nucleic acid(s) encoding the engineered antigen(s) may be incorporated into a desired delivery vehicle (e.g., viral vector such as an oncolytic virus) by any method known in the art, as described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rded. Cold Spring Harbor Laboratory Press (2001). The nucleic acid(s) encoding the engineered antigen(s) may also be incorporated into a desired delivery vehicle using gene-editing technologies such as zinc finger nucleases (ZFNs), Transcription activator-like effector nucleases (TALENs), Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) and Programmable Addition via Site-specific Targeting Elements (PASTE).
[0240] The antibody or antigen-binding fragment thereof specifically recognizing the at least one epitope from the engineered antigen may be in any form suitable to inhibit the growth and / or induce the killing of the tumor cells expressing the engineered antigen.
[0241] The term “antibody or antigen-binding fragment thereof’ as used herein refers to any type of antibody / antibody fragment including monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, humanized antibodies, CDR-grafted antibodies, chimeric antibodies and antibody fragments so long as they exhibit the desired antigenic specificity / binding activity. Antibody fragments comprise a portion of a full-length antibody, generally an antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules (e.g., single-chain Fv, scFv), single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments. Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to,Hregions (H, VH-VH), anticalins, PepBodies, antibody-T- cell epitope fusions (Troybodies) or Peptibodies.
[0242] In an embodiment, the antibody or antigen-binding fragment thereof comprises a constant region having an effector function. Exemplary “effector functions” include Fc receptor binding; C1q binding; cell-dependent cytotoxicity (CDC); antibody-dependent cell cytotoxicity (ADCC); and / or antibody-dependent cell phagocytosis (ADCP).
[0243] In an embodiment, the antibody of the present disclosure is a multispecific antibody or antigen-binding fragment thereof, such as a bispecific antibody or antigen-binding fragment thereof. In such multispecific (e.g., bispecific) antibodies or antigen-binding fragments thereof, at least one of the antigen-binding domains binds to the engineered antigen as described herein. Examples of bispecific antibody or antigen-binding fragment formats include bispecific monoclonal antibodies (mab)2, "knob into hole" IgG, crossMab, ortho-Fab IgG, DVD-lg, two in one IgG, IgG-scFv, scFv2-Fc, bispecific F(mab’)2, quadroma, bispecific diabodies (BsDb), single-chain bispecific diabodies (scBsDb), single-chain bispecific tandem variable domain (scBsTaFv), dock- and-lock trivalent Fab (DNL-(Fab)3), bispecific single-domain antibodies (BssdAb), tandem Ab, 147222-000022
[0244] 34 tandem diabodies (TandAb), and tandem ScFv (see, e.g., Brinkmann and Kontermann, MAbs. 2017 Feb-Mar; 9(2): 182-212).
[0245] Bispecific antibodies are monoclonal, often human or humanized, antibodies that have binding specificities for two different epitopes on the same or different antigen. In the present disclosure, one of the binding specificities can be directed towards a first epitope present in the engineered antigen, the other can be for a second epitope present in the engineered antigen. Bispecific antibodies of the disclosure include IgG format bispecific antibodies and single chainbased bispecific antibodies. Single chain-based bispecific antibodies of the disclosure can be any of the various types of single chain-based bispecific antibodies known in the art, such as bispecific T-cell engagers (BiTEs), diabodies, tandem diabodies (tandabs), dual-affinity retargeting molecules (DARTs), and bispecific killer cell engagers. See, e.g., Loftier et al., 2000, Blood 95:2098-103; Holliger et al., 1993, Proc Natl Acad Sci USA, 90:6444-8; Kipriyanov et al., 1999, Mol B / o / 293:41-56; Johnson et al., 2010, Mol Biol 399:436-49; Wiernik et al., 2013, Clin Cancer Res 19:3844 55; Liu et al., 2017, Front. Immunol. 8:38; and Yang et al., 2017, Int. J. Mol. Sci. 18:48.
[0246] In some embodiments, the bispecific antibodies of the disclosure are bispecific T-cell engagers (BiTEs). BiTEs are single polypeptide chain molecules that having two antigen-binding domains, one of which binds to a T-cell antigen and the second of which binds to the engineered antigen described herein (See, PCT Publication WO 05 / 061547; Baeuerle et al., 2008, Drugs of the Future 33: 137-147; Bargou, et al., 2008, Science 321 :974-977). Thus, the BiTEs of the disclosure have an antigen binding domain that binds to a T-cell antigen (e.g. , CD3), and a second antigen binding domain that binds to the engineered antigen disclosed herein. In some embodiments, the bispecific antibodies of the disclosure are dual-affinity retargeting molecules (DARTs). DARTs comprise at least two polypeptide chains that associate (especially through a covalent interaction) to form at least two epitope binding sites, which may recognize the same or different epitopes. Each of the polypeptide chains of a DART comprise an immunoglobulin light chain variable region and an immunoglobulin heavy chain variable region, but these regions do not interact to form an epitope binding site. Rather, the immunoglobulin heavy chain variable region of one (e.g., the first) of the DART polypeptide chains interacts with the immunoglobulin light chain variable region of a different (e.g., the second) DART polypeptide chain to form an epitope binding site. Similarly, the immunoglobulin light chain variable region of one (e.g., the first) of the DART polypeptide chains interacts with the immunoglobulin heavy chain variable region of a different (e.g., the second) DART polypeptide chain to form an epitope binding site. DARTs may be monospecific, bispecific, trispecific, etc., thus being able to simultaneously bind one, two, three or more different epitopes (which may be of the same or of different antigens). DARTs may additionally be monovalent, bivalent, trivalent, tetravalent, pentavalent, hexavalent, etc., thus being able to simultaneously bind one, two, three, four, five, six or more molecules. 147222-000022
[0247] 35
[0248] These two attributes of DARTs (i.e., degree of specificity and valency may be combined, for example to produce bispecific antibodies (i.e., capable of binding two epitopes) that are tetravalent (i.e., capable of binding four sets of epitopes), etc. DART molecules are disclosed in PCT Publications WO 2006 / 113665, WO 2008 / 157379, and WO 2010 / 080538. In some embodiments of the bispecific antibodies of the disclosure, one of the binding specificities is directed towards the engineered antigen, and the other is directed to an antigen expressed on immune effector cells. The term “immune effector cell” or “effector cell” as used herein refers to a cell within the natural repertoire of cells in the mammalian immune system which can be activated to affect the viability of a target cell. Immune effector cells include cells of the lymphoid lineage such as natural killer (NK) cells, T cells including cytotoxic T cells, or B cells, but also cells of the myeloid lineage can be regarded as immune effector cells, such as monocytes or macrophages, dendritic cells and neutrophilic granulocytes. Hence, said effector cell is preferably an NK cell, a T cell, a B cell, a monocyte, a macrophage, a dendritic cell or a neutrophilic granulocyte. Recruitment of effector cells to aberrant cells means that immune effector cells are brought in close vicinity to the aberrant target cells such that the effector cells can directly kill, or indirectly initiate the killing of the aberrant cells that they are recruited to. In order to avoid non-specific interactions, it is preferred that the bispecific antibodies of the disclosure specifically recognize antigens on immune effector cells that are at least over-expressed by these immune effector cells compared to other cells in the body. Target antigens present on immune effector cells may include CD3, CD8, CD16, CD25, CD28, CD64, CD89, NKG2D and NKp46. Preferably, the antigen on immune effector cells is CD3 expressed on T cells. Examples of BiTEs approved for the treatment of various cancers are listed in Table 2 below.
[0249] Table 2 147222-000022
[0250] 36
[0251] The bispecific antibody of the present disclosure may include a binding domain that binds to an immune checkpoint inhibitor (ICI). The term "immune checkpoint inhibitor" or "ICI" generally refers to an agent that modulates (inhibits) an immune checkpoint protein (a "checkpoint protein"). A checkpoint inhibitor can partially or fully reduce, inhibit, or interfere with the activity of the immune checkpoint protein. It can also induce structural changes in the immune checkpoint protein that affect its binding to a ligand or impact a pathway related to the checkpoint protein's activity. This can be achieved, for instance, by acting as an antagonist to the immune checkpoint protein or its ligand. An immune checkpoint inhibitor can be a compound such as an antibody, antibody fragments or other proteins that bind and antagonize human programmed cell death protein 1 (PD-1 ; also known as PDCD1 , CD279) or programmed cell death ligand 1 (PD-L1 ; also known as BZ-H1 , CD274). These are referred to as PD-1 antagonists and PD-L1 antagonists, respectively.
[0252] As disclosed herein, immune checkpoint proteins can, in certain contexts and states, interfere with T-cell-mediated killing of cancer cells. Immune checkpoint inhibitors can reverse this interference, but in certain cancers (e.g., certain solid tumors), interference with a single immune checkpoint protein might not be sufficient. The present disclosure contemplates that combining an anti-LILRB2 antibody or antigen-binding fragment thereof disclosed herein with another immune checkpoint inhibitor can relieve macrophage-mediated T-cell exhaustion and stimulate T-cell effector function.
[0253] An ICI can target one or more immune checkpoint proteins such as PD-1 , CD28, CTLA- 4, ICOS, TMIGD2, 4-1 BB, BTLA, CD160, LIGHT, LAG3, 0X40, CD27, CD40L, CD47, GITR, DNAM-1 , TIGIT, CD96, PVRIG, 2B4, TIM-3, Galectin9, LILRB1 , LILRB2, CEACAM1 , SIRP alpha, DC-SIGN, CD200R, DR3, CHK1 , CHK2, A2aR, and B-7 family proteins. An ICI can target a ligand of an immune checkpoint protein. Examples of such ligands include PD-L1 , PD-L2, ICOS ligand, VISTA, 4-1 BBL, Herpesvirus Entry Mediator (HVEM), tumor necrosis factor receptor superfamily member 14 (TNFRSF14), MHC class I, MHC class II, PVR, OX-40L, CD70, CD40, GITRL, 147222-000022
[0254] 37
[0255] CD155, CD48, GAL9, HMGB1 , CEASAM-1 , phosphatidylserine (PtdSer), IDO, TDO, CD47, BTN2A1 , CD200, TL1A, CD1 12, CD155, LSECtin, CHK1 , CHK2, A2aR, and B-7 family ligands (e.g., CD80 (B7-1), CD86 (B7-2), B7-H3, B7-H4, B7-H7 (HHLA2), etc.).
[0256] In an embodiment, the ICI is an inhibitor of PD-1. Exemplary PD-1 antibodies suitable for use include, without limitation, nivolumab, pembrolizumab, cemipilimab, dostarlimab, pimivalimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, INCMGA00012, AMP-224, AMP-514, and balstilimab.
[0257] In some embodiments, the ICI is a PD-L1 antagonist, such as a PD-L1 antibody. Examples of PD-L1 antibodies include avelumab, durvalumab, atezolizumab, envafolimab, cosibelimab, LY3300054, CA-170, and BMS-936559. Other PD-L1 antagonists may include AUNP-12 and BMS-986189.
[0258] In an embodiment, the ICI is an inhibitor of cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) or its ligand. CTLA-4 antibodies block the interaction of CTLA-4 with its ligands CD80 / CD86, which are expressed on antigen-presenting cells, thereby preventing the negative downregulation of immune responses. CTLA-4 antibodies can include ipilimumab, tremelimumab, and quavonlimab.
[0259] In an embodiment, the ICI is an inhibitor of Lymphocyte-activation gene 3 (LAG-3, CD223), which is a CD4-related transmembrane protein that competitively binds MHC II and acts as a co-inhibitory checkpoint for T cell activation. LAG-3-binding proteins (e.g., antibodies), can include LAG525, MK-4280, REGN3767, relatlimab, and Bl 7541 1 1.
[0260] In an embodiment, the ICI is an inhibitor of T cell immunoglobulin mucin 3 (TIM-3, HAVCR2), which is a type I glycoprotein receptor that binds to Galectin-9 (Gal-9). TIM-3-binding antibodies, can include TSR-022 and MGB453.
[0261] In an embodiment, the ICI is an inhibitor of T cell immunoglobulin and ITIM domain (TIGIT), which is an inhibitory receptor on lymphocytes that interacts with CD155 on antigen- presenting or tumor cells. TIGIT antagonists can include Tiragolumab, AB154, vibostolimab, BMS-985207, and ASP8374.
[0262] The antibody or antigen-binding fragment thereof according to the present disclosure may be conjugated to a therapeutic agent (e.g., antitumor agent) to form an antibody-drug conjugate (ADC). The therapeutic agent (e.g., often referred to as the payload) may be directly conjugated to the antibody or antigen-binding fragment thereof, or may also be indirectly conjugated through a linker. The therapeutic agent may also be loaded on or encapsulated into a suitable vehicle, such as liposomes or other polymeric or lipid-based vesicles (e.g., lipid nanoparticles).
[0263] The antitumor agent may be any compound that has the ability to inhibit the growth and / or kill tumor cells and includes, for example, small molecules, peptides, proteins, oligonucleotides (e.g., siRNA, shRNA), radionuclide agents (e.g.,177Lu,18F,68Ga,90Y,99mTc,111ln, 147222-000022
[0264] 38
[0265] 213Bi,221At,225Ac,227Th), antibodies, as well as drug delivery systems including nanoparticles, liposomes, nanotubes, graphene particles loaded with or encapsulating a therapeutic antitumor agent.
[0266] In an embodiment, the antitumor agent is a chemotherapeutic agent. The term “chemotherapeutic agent” refers to agents that kill tumor cells and / or inhibit their proliferation / growth. Examples in chemotherapeutic agents include alkylating agents (e.g., Cyclophosphamide, Ifosfamide, Mechlorethamine, Chlorambucil, Melphalan, Dacarbazine, Nitrosoureas, Temozolomide, Carmustine, Lomustine, Streptozocin, Busulfan, Procarbazine), anthracyclines (e.g., Daunorubicin, Doxorubicin, Epirubicin, Idarubicin, Mitoxantrone, Valrubicin), Monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), cytoskeletal disruptors (e.g., taxanes such as Paclitaxel, Docetaxel, Abraxane, Taxotere, cabazitaxel), histone deacetylase inhibitors (e.g., Vorinostat, Romidepsin), topoisomerase I inhibitors (e.g., camptothecin analogs such as Irinotecan, Topotecan, SN-38, Exotecan), topoisomerase II inhibitors (e.g., Etoposide, Teniposide, Tafluposide), kinase inhibitors (e.g., Bortezomib, Erlotinib, Gefitinib, Imatinib, Vemurafenib, Vismodegib, Dasatinib, Nilotinib, Osimertinib, Crizotinib, Dabrafenib, Vemurafenib, Trametinib, Ibrutinib), nucleotide analogs and precursor analogs (e.g., Azacitidine, Azathioprine, Capecitabine, Cytarabine, Doxifluridine, Fluorouracil (5-FU), Gemcitabine, Hydroxyurea, Mercaptopurine, Methotrexate, Tioguanine (Thioguanine)), peptide antibiotics (e.g., Bleomycin, Actinomycin), platinum-based agents (e.g., Carboplatin, Cisplatin, Oxaliplatin), retinoids (Tretinoin, Alitretinoin, Bexarotene), mitotic inhibitors such as vinca alkaloids and derivative (e.g., Vinblastine, Vincristine, Vindesine, Vinorelbine), toxins such as maytansinoids (e.g., DM1 , DM4), Auristatins, Calicheamicins, Amatoxin or Amanitin, as well as natural phytochemicals having antitumor properties such as curcumin, Alkaloids (e.g., Chlorogenic acid, Theobromine, Theophylline), Anthocyanins (e.g., Cyanidin, Malvidin, Carotenoids (Beta-Carotene, Lutein, Lycopene), Coumestans, Flavan-3-Ols, Flavonoids (e.g., Epicatechin, Hesperidin, Isorhamnetin, Kaempferol, Myricetin, Naringin, Nobiletin, Proanthocyanidins, Quercetin, Rutin, Tangeretin), Hydroxycinnamic Acids (e.g., Chicoric acid, Coumarin, Ferulic acid, Scopoletin), Isoflavones (e.g., Daidzein, Genistein), Lignans (e.g., Silymarin), Monoterpenes (e.g., Geraniol, Limonene), Organosulfides (e.g., Allicin, Glutathione, lndole-3-Carbinol, Isothiocyanates, Sulforaphane), Damnacanthal, Digoxin, Phytic acid, Phenolic Acids (e.g., Capsaicin, Ellagic Acid, Gallic acid, Rosmarinic acid, Tannic Acid), Phytosterols (e.g., Beta-Sitosterol), Saponins, Stylbenes (e.g., Pterostilbene, Resveratrol), Triterpenoids (e.g., Ursolic acid), Xanthophylls (e.g., Astaxanthin, Beta-Cryptoxanthin), and Monophenols (e.g., Hydroxytyrosol).
[0267] Examples of ADCs approved for the treatment of various cancers are listed in Tables
[0268] 3A-3B below. 147222-000022
[0269] 39
[0270] Table 3A 147222-000022
[0271] 40
[0272] Table 3B 147222-000022
[0273] 41
[0274] ALL: Acute lymphoblastic leukemia; HCL: Hairy Cell Leukemia; DLBCL: Diffuse large B-cell lymphoma; UC: Urothelial carcinoma; GC: Gastric cancer; NSCLC: Non-small cell lung cancer; MMAE: monomethyl auristatin E; MMAF: monomethyl auristatin F; DM1 : emtansine; DM4: Ravtansine; PE38: Pseudomonas exotoxin PE-38; DXD: deruxtecan; SN-38: 7-ethyl-10- hydroxycamptothecin; PBD SG3199: pyrrolobenzodiazepine (PBD) dimer;
[0275] In an embodiment, the at least one antibody or antigen-binding fragment thereof according to the present disclosure is one of the antibody or antigen-binding fragment thereof present in the above-identified approved ADCs (e.g., Gemtuzumab, Brentuximab, Trastuzumab, Inotuzumab, Moxetumomab, Polatuzumab, Enfortumab, Sacituzumab, Disitamab, Loncastuximab, Tisotumab, Mirvetuximab, Daptopotamab, Telisotuzumab, or Belantamab), and the engineered antigen comprises the epitope from the antigen recognized by the antibody or antigen-binding fragment thereof (e.g., CD33, CD30, HER2, CD22, CD79b, Nectin-4, TROP2, CD19, TF, FRa, c-Met or BCMA), as depicted in Table 3B.
[0276] In an embodiment, the antibody or antigen-binding fragment thereof according to the present disclosure is comprised in a recombinant receptor, such as a chimeric antigen receptor (CAR). Such CAR typically comprises an extracellular ligand-binding domain (e.g., an antibody or antibody fragment such as a single-chain variable fragment (scFv)) that provides specificity for the target antigen linked to an activating intracellular domain portion, such as a T cell or NK cell activating domain, providing a primary activation signal, in some aspects via linkers and / or transmembrane domain(s). In some embodiments, the CAR comprises an antigen-binding fragment (e.g., scFv) that specifically recognizes the engineered antigen disclosed herein expressed on the surface of tumor cells.
[0277] In particular embodiments, the recombinant receptor (e.g., CAR) comprises an intracellular signaling domain, which includes an activating cytoplasmic signaling domain (also interchangeably called an intracellular signaling region), such as an activating cytoplasmic (intracellular) domain capable of inducing a primary activation signal in an immune cell (T cell, NK cell, for example), a cytoplasmic signaling domain of a T cell receptor (TCR) component (e.g. a cytoplasmic signaling domain of a CD3-zeta (CD3 Q chain or a functional variant or signaling portion thereof) and / or that comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the receptor, e.g., CAR, further includes a portion of one or more additional molecules such as Fc receptor y, CD8, CD4, CD25, or CD16. In some aspects, the CAR includes 147222-000022
[0278] 42 a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex. Primary cytoplasmic signaling sequences that act in a stimulatory manner may comprise signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAM comprising primary cytoplasmic signaling sequences include those derived from TCR or FcR gamma or FcR beta. In some embodiments, cytoplasmic signaling molecule(s) in the CAR comprise(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 in some embodiments, to promote full activation, a component for generating a secondary or co-stimulatory signal is also included in the CAR, such as the signaling domain of a costimulatory receptor such as CD28, 4-1 BB, 0X40, DAP10, and ICOS. In some aspects, an additional CAR is expressed in the same cell and provides the component for generating the secondary or costimulatory signal. In some cases, CARs are referred to as first, second, and / or third generation CARs. In some aspects, a first-generation CAR is one that solely provides an antigen-receptor (e.g., CD3-chain) induced signal upon antigen binding; in some aspects, a second-generation CARs is one that provides such a signal and costimulatory signal, such as one including an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137; in some aspects, a third generation CAR in some aspects is one that includes multiple costimulatory domains of different costimulatory receptors.
[0279] In some embodiments, the recombinant receptor (e.g., a CAR) further comprises a transmembrane domain connecting the extracellular ligand-binding domain and the activating cytoplasmic (intracellular) domain. In one embodiment, a transmembrane domain that naturally is associated with one of the domains in the receptor, e.g., CAR, is used. In some instances, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex. The transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is, or is derived from, any membrane-bound or transmembrane protein. Transmembrane regions include those derived from ( / .e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the TCR, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154). Alternatively, the transmembrane domain in some embodiments is synthetic. In some aspects, the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
[0280] In some embodiments, the recombinant receptor (e.g., a CAR) further includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or variant or modified version thereof, such as a hinge region, e.g., an lgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is of a human IgG, such 147222-000022
[0281] 43 as lgG4 or lgG1. In some aspects, the portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., scFv, and transmembrane domain. The spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer. Exemplary spacers include those having at least about 10 to 220 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and including any integer between the endpoints of any of the listed ranges. Exemplary spacers include lgG4 hinge alone, lgG4 hinge linked to CH2 and CH3 domains, or lgG4 hinge linked to the CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or PCT patent publication number WO 2014 / 031687.
[0282] Examples of CAR cell therapies approved for the treatment of various cancers are listed in Table 4 below.
[0283] Table 4
[0284] In an embodiment, the at least one antibody or antigen-binding fragment thereof according to the present disclosure is present in the above-identified approved CARs (e.g., Tisagenlecleucel, Axicabtagene ciloleucel, Brexucabtagene autoleucel, Lisocabtagene maraleucel, Idecabtagene vicleucel, or Ciltacabtagene autoleucel), and the engineered antigen comprises the epitope from the antigen recognized by the antibody or antigen-binding fragment thereof (e.g., CD19 or BCMA), as depicted in Table 4.
[0285] In an embodiment, the antibody or antigen-binding fragment thereof is comprised in a second delivery vehicle for tumor cells. The second delivery vehicle may be selected from any of 147222-000022
[0286] 44 the delivery vehicles described above. In an embodiment, the second delivery vehicle is an oncolytic virus.
[0287] In another aspect, the present disclosure provides a combination or therapeutic agent comprising: a first oncolytic virus comprising a nucleic acid encoding a cell surface receptor; a second oncolytic virus comprising a nucleic acid encoding an antibody or antigen-binding fragment thereof that specifically binds to an extracellular domain of the cell surface receptor.
[0288] The cell surface receptor may be any tumor antigen such as those listed above, or the engineered antigen as disclosed herein.
[0289] In an embodiment, the first and second oncolytic viruses are not the same.
[0290] In an embodiment, the first oncolytic virus comprises a rhabdovirus, and more particularly VSV. Vesicular stomatitis virus (VSV). The VSV genome is a single molecule of negative-sense RNA that encodes 5 major polypeptides: a nucleocapsid (N) polypeptide, a phosphoprotein (P) polypeptide, a matrix (M) polypeptide, a glycoprotein (G) polypeptide, and a viral polymerase (L) polypeptide. In an embodiment, the HSV comprises a mutation in the VSV Matrix (M) protein to eliminate the matrix’ protein ability to block the nuclear pores from exporting type 1 interferon mRNA. In an embodiment, the mutation is a deletion of methionine at position 51 (A51 or d51 ).
[0291] In an embodiment, the second oncolytic virus comprises a vaccinia virus (W). Exemplary strains of the vaccinia virus include Copenhagen, Western Reserve, Wyeth, Lister, EM63, ACAM2000, LC16m8, CV-1 , modified vaccinia Ankara (MVA), Dairen I, GLV-lh68, IHD-J, L-IVP, LC16m8, LC16mO, Tashkent, Tian Tan, and WAU86 / 88-1 , and more particularly the Tian Tan, Copenhagen, or Western Reserve strain. In an embodiment, the W is an attenuated W. In an embodiment, the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene (J2R) and / or the ribonucleotide reductase (RR) gene. In an embodiment, the attenuated W comprises a mutation or deletion of the TK gene, which leads to more selective and permissive infection in cancer cells with high endogenous thymidine kinase activity. In an embodiment, the W or attenuated W encodes an interferon-binding decoy receptor, i.e., a secreted protein with homology to an interferon (IFN) receptor. A nonlimiting example of such an interferon-binding decoy receptor is the protein encoded by the B8R gene in a Copenhagen strain of W (UniProtKB database entry P21004). The B8R may also include fragments or variants of the protein listed above, or of homologous genes from another vaccinia virus strain. Variants include, without limitation, those sequences having at least 80, 85, 90 or 95% identity to the above-noted sequence. Another nonlimiting example of such an interferon-binding decoy receptor is the protein encoded by the B19R gene in a Copenhagen strain of W (UniProtKB database entry P21077), or orthologues thereof such as B18R. The B19R protein may also include fragments or variants of the protein listed above, or of homologous genes from another vaccinia virus strain. Variants include, without limitation, those sequences having at least 80, 85, 90 or 95% identity to the above-noted sequence. 147222-000022
[0292] 45
[0293] The results presented in the Examples below show that by combining a W encoding an interferon-binding decoy receptor with the interferon-sensitive VSV, a synergistic effect is obtained notably through enhanced VSV replication.
[0294] In an embodiment, the second oncolytic virus comprising a nucleic acid encoding a bispecific antibody, and more particularly a bispecific T-cell engager (BiTE) as described above.
[0295] The oncolytic viruses of this disclosure are produced by methods known to one of skill in the art. In certain embodiments, the modified oncolytic virus is propagated in suitable host cells, e.g., HeLa cells, 293 cells, or Vero cells, isolated from host cells and stored in conditions that promote stability and integrity of the virus, such that loss of infectivity overtime is minimized. The oncolytic viruses may be propagated in host cells using cell stacks, roller bottles, or perfusion bioreactors. In some examples, downstream methods for purification of the modified oncolytic viruses comprise filtration (e.g., depth filtration, tangential flow filtration, or a combination thereof), ultracentrifugation, or chromatographic capture. The oncolytic viruses may be stored, e.g., by freezing or drying, such as by lyophilization. Prior to administration, the stored oncolytic viruses may be reconstituted (if dried for storage) and diluted in a pharmaceutically acceptable carrier for administration.
[0296] In various embodiments, the delivery vehicles and at least one antibody or antigenbinding fragment thereof are comprised in a pharmaceutical composition. It would be understood by the skilled person that the delivery vehicles and the at least one antibody or antigen-binding fragment thereof may be formulated in the same pharmaceutical composition or in different pharmaceutical compositions. The pharmaceutical compositions of the disclosure are formulated with suitable diluents, carriers, excipients, buffers, and other agents that provide improved transfer, delivery, tolerance, and the like. The compositions may be formulated for specific uses, such as for veterinary uses or pharmaceutical uses in humans. The form of the composition and the excipients, diluents and / or carriers used will depend upon the intended uses of the delivery vehicles and / or the mode of administration. A multitude of appropriate formulations can be found in the formulary known to pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa. These formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid- (cationic or anionic) containing vesicles (such as LIPOFECTIN™, Life Technologies, Carlsbad, Calif.), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax. See also Powell et al. "Compendium of excipients for parenteral formulations" PDA (1998) J Pharm Sci Technol 52:238-311. A “pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid, or liquid filler, diluent, encapsulating material, formulation auxiliary, or carrier conventional in the art for use with a therapeutic agent that together comprise a “pharmaceutical composition” for administration to a subject. A pharmaceutically acceptable carrier is non-toxic to 147222-000022
[0297] 46 recipients at the dosages and concentrations employed and are compatible with other ingredients of the formulation. The pharmaceutically acceptable carrier is appropriate for the formulation employed.
[0298] The delivery vehicles may be administered by various routes, including, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, oral, or intratumoral routes.
[0299] A pharmaceutical composition of the present disclosure can be delivered subcutaneously, intratumorally or intravenously with a standard needle and syringe.
[0300] Intratumoral injection, or injection directly into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration also may be appropriate. The delivery vehicles may advantageously be contacted by administering multiple injections to the tumor, spaced, for example, at approximately 1 cm intervals.
[0301] In an embodiment, the pharmaceutical composition is an injectable preparation. These injectable preparations may be prepared by methods publicly known. For example, the injectable preparations may be prepared, e.g. , by dissolving, suspending or emulsifying the delivery vehicle in a sterile aqueous medium or an oily medium conventionally used for injections. As the aqueous medium for injections, there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc. As the oily medium, there are employed, e.g., sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. The injection thus prepared is preferably filled in an appropriate ampoule.
[0302] The dose of delivery vehicles and / or at least one antibody or antigen-binding fragment thereof administered to a patient may vary depending upon the age and the size of the patient, target disease, conditions, route of administration, and the like. The preferred dose is typically calculated according to body weight or body surface area. Depending on the severity of the condition, the frequency and the duration of the treatment can be adjusted. Effective dosages and schedules for administering the delivery vehicles and / or at least one antibody or antigen-binding fragment thereof may be determined empirically; for example, patient progress can be monitored by periodic assessment, and the dose adjusted accordingly. Moreover, interspecies scaling of dosages can be performed using well-known methods in the art (e.g., Mordenti et al., 1991 , Pharmaceut. Res. 8:1351).
[0303] In some embodiments, the amount of an oncolytic virus described herein administered to a subject is between about 103and 1012infectious viral particles or plaque forming units (PFU), 147222-000022
[0304] 47 or between about 105and 1010PFU. or between about 105and 108PFU, or between about 108and 101° PFU.
[0305] In another aspect, the present disclosure provides a method for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject, the method comprising administering to the subject an effective amount of the first delivery vehicle defined herein. The present disclosure also provides the use of the first delivery vehicle defined herein for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject, or for the preparation of a medicament for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject. As described throughout the present application and exemplified in the Examples below, inducing the expression of an engineered antigen comprising one or more epitopes targeted by a therapeutic antibody in a tumor permits to render the tumor susceptible (or responsive) to the therapeutic antibody.
[0306] In another aspect, the present disclosure provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the combination or therapeutic agent described herein. The present disclosure also provides the use of the combination or therapeutic agent described herein for treating cancer in a subject, or for the manufacture of a medicament for treating cancer in a subject. The present disclosure also provides the combination or therapeutic agent described herein for treating cancer in a subject. It would be understood by the skilled person that the individual components of the combination or therapeutic agent (delivery vehicle, antibody) may be administered at the same time or at different times, at the same frequency or different frequencies, etc.
[0307] In certain embodiments of the method of treating and uses described herein, the cancer is leukemia, lymphoma, liver cancer, bone cancer, lung cancer, brain cancer, bladder cancer, gastrointestinal cancer, breast cancer, cardiac cancer, cervical cancer, uterine cancer, head and neck cancer, gallbladder cancer, laryngeal cancer, lip and oral cavity cancer, ocular cancer, melanoma, pancreatic cancer, prostate cancer, colorectal cancer, testicular cancer, and throat cancer.
[0308] In certain embodiments of the method of treating and uses described herein, the cancer is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), adrenocortical carcinoma, AIDS-related lymphoma, primary CNS lymphoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, bile duct cancer, extrahepatic cancer, Ewing sarcoma family, osteosarcoma and malignant fibrous histiocytoma, central nervous system embryonal tumors, central nervous system germ cell tumors, craniopharyngioma, ependymoma, bronchial tumors, Burkitt lymphoma, carcinoid tumor, primary lymphoma, chordoma, chronic 147222-000022
[0309] 48 myeloproliferative neoplasms, colon cancer, extrahepatic bile duct cancer, ductal carcinoma in situ (DOS), endometrial cancer, ependymoma, esophageal cancer, neuroblastoma, extracranial germ cell tumor, extragonadal germ cell tumor, fallopian tube cancer, fibrous histiocytoma of bone, gastrointestinal carcinoid tumor, gastrointestinal stromal tumors (GIST), testicular germ cell tumor, gestational trophoblastic disease, glioma, childhood brain stem glioma, hairy cell leukemia, hepatocellular cancer, Langerhans cell histiocytosis, Hodgkin lymphoma, hypopharyngeal cancer, islet cell tumors, pancreatic neuroendocrine tumors, Wilms tumor and other childhood kidney tumors, Langerhans cell histiocytosis, small cell lung cancer, cutaneous T cell lymphoma, intraocular melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, midline tract carcinoma, multiple endocrine neoplasia syndromes, multiple myeloma / plasma cell neoplasm, myelodysplastic syndromes, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma (NHL), non-small cell lung cancer (NSCLC), epithelial ovarian cancer, germ cell ovarian cancer, low malignant potential ovarian cancer, pancreatic neuroendocrine tumors, papillomatosis, paraganglioma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, primary peritoneal cancer, rectal cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Kaposi's sarcoma, rhabdomyosarcoma, Sezary syndrome, small intestine cancer, soft tissue sarcoma, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter, urethral cancer, endometrial uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, and Waldenstrom macroglobulinemia.
[0310] In some embodiments, the cancer can be a melanoma, ovarian cancer, cervical cancer, lung cancer, bladder cancer, breast cancer, head and neck cancer, renal cell carcinoma, acute myeloid leukemia, colorectal cancer, and sarcoma. In some embodiments, the cancer is a cancer with a high mutational burden. In some embodiments, the cancer is melanoma, lung squamous, lung adenocarcinoma, bladder cancer, lung small cell cancer, esophageal cancer, colorectal cancer, cervical cancer, head and neck cancer, stomach cancer or uterine cancer. In some embodiments, the cancer is an epithelial cancer. In some embodiments, the cancer is selected from non-small cell lung cancer (NSCLC), CRC, ovarian cancer, breast cancer, esophageal cancer, gastric cancer, pancreatic cancer, cholangiocarcinoma cancer, endometrial cancer. In some embodiments, the breast cancer is HR+ / HER2- breast cancer. In some embodiments, the breast cancer is a triple negative breast cancer (TNBC). In some embodiments, the breast cancer is a HER2+ breast cancer.
[0311] In further embodiments, the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer or parotid cancer
[0312] In some embodiments, the cancer is a hematological tumor. In other embodiments, the cancer is a solid cancer. 147222-000022
[0313] 49
[0314] In some embodiments, the subject is one whose cancer is refractory to, and or who has relapsed following treatment with an immunotherapy such as anti-VEGF (e.g., Bevacizumab) therapy, anti-HER2 therapy (e.g., Trastuzumab / Herceptin®), anti-EGFR therapy (e.g., Cetuximab), anti-CD20 therapy (Rituximab / Rituxan®), and the like. In some embodiments, the subject is one whose cancer is refractory to chemotherapies.
[0315] In some embodiments, the methods and uses comprises the administration or use of one or more additional anticancer therapy to the subject. The anticancer therapy can be a chemotherapeutic agent, a biologic agent (e.g., an antibody, antibody-drug conjugate), a cancer vaccine, radiotherapy, and / or surgery. In an embodiment, the additional anticancer therapy comprises an immunotherapeutic molecule, such as an immune checkpoint inhibitor (ICI), as described above. In an embodiment, the methods and uses comprises the administration or use of tumor-infiltration lymphocytes (TILs). TILs are immune cells that have been recruited to the site of the tumour. These cells include CD3+ T cells. TILs may be extracted or collected from tumors and expanded ex vivo, and then reintroduced to cancer patients using methods known in the art (e.g., by infusion).
[0316] As shown in the Examples below, the efficacy of the strategy described herein relies at least in part on the presence of CD3+ T cells in the tumor. By administering TIL therapy alongside the strategy described herein, it is expected that that efficacy would be improved because more tumor-specific T cells would infiltrate the tumour.
[0317] The present disclosure also provides kits, medicines, compositions, and unit dosage forms for use in any of the methods described herein. Kits can include one or more containers comprising the delivery vehicle disclosed herein (or unit dosage forms and / or articles of manufacture). In some embodiments, kits further comprise instructions for use in the treatment of cancer in accordance with any of the methods described herein. The kit may further comprise a description of selection an individual suitable or treatment. Instructions supplied in the kits are typically written instructions on a label or package insert (for example, a paper sheet included in the kit), but machine-readable instructions (for example, instructions carried on a magnetic or optical storage disk) are also acceptable. In some embodiments, the kit further comprises another therapeutic agent.
[0318] The kits are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (for example, sealed Mylar or plastic bags), and the like. Kits may optionally provide additional components such as buffers and interpretative information. The present application thus also provides articles of manufacture, which include vials (such as sealed vials), bottles, jars, flexible packaging, and the like.
[0319] The sequences presented in the accompanying sequence listing are shown in Table 5 below. 147222-000022
[0320] 50
[0321] Table 5 147222-000022
[0322] 51 147222-000022
[0323] 52 147222-000022
[0324] 53 147222-000022
[0325] 54
[0326] MODE(S) FOR CARRYING OUT THE INVENTION
[0327] The present invention is illustrated in further details by the following non-limiting examples.
[0328] Example 1 : Materials and Methods Cells
[0329] All cell lines used, growth media, vendors, and catalogue numbers are listed in Table 5.
[0330] Table 5: Cell lines used in the studies described herein 147222-000022
[0331] 55 147222-000022
[0332] 56
[0333] Cell lines. * = The murine colon adenocarcinoma MC38 cell line derived from C57BL / 6 mice was provided by Dr. Guy Ungerechts; ** = The ID8-PP cell line was gift from Dr. lain McNeish; *** = The primary human ovarian cancer cell lines (AF2068, AF2028, AF2780) were obtained from the Ottawa Ovarian Ethics Board (OHSN-REB 1999540-01 H) with informed consent, and provided by Dr. Barbara Vanderhyden; **** = 4T1.2 and 4T1.2-HER2 cells were provided by Dr. Michael Kershaw; These lines were generated as previously described6. JJ69 cells were generated by CRISPR-mediated insertion of TdTomato underthe control of the CD69 promoter in Jurkat cells7. $ = Coriell Institute for Medical Research; ATCC: American Type Culture Collection (Manassas, VA); DSMZ: Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany); DMEM: Dulbecco’s modified Eagle’s medium (HyClone, Waltham, Massachusetts or Corning, Manassas, Virginia); RPMI: Roswell Park Memorial Institute medium (Hyclone, Cat. # SH3002701).
[0334] All media were supplemented with 10% fetal bovine serum (VWR, Mississauga, Ontario, Canada, Cat. #45001-106) and 1% penicillin-streptomycin solution (ThermoFisher Scientific, Cat.
[0335] # 15140163), unless otherwise indicated. All cells were maintained at 37°C in a 5% CO2 humidified incubator, routinely tested for mycoplasma contamination by Hoechst staining and PCR (Diamed, Mississauga, Ontario, Catalogue # ABMG238) and used within 3-10 passages since thaw. None of the cell lines listed were present in the commonly misidentified cell lines database maintained by ICLAC.
[0336] Plasmids
[0337] TOE constructs were created using sequences from the EMBL-EBI database and IMGT database for anti-human CD3 (OKT3) and anti-murine CD3 (145-2C11) single-chain variable fragments (scFv), respectively, in addition to the trastuzumab HER2 sequence. A flexible glycineserine (GS) linker was utilized to connect the two scFv fragments. The TOE sequences were designed to include a Kozak sequence and an IgK leader sequence for secretion. A C-terminal His-tag was included for TOE detection. Plasmids were synthesized (GenScript, NJ, USA). Through restriction enzyme digestion, TCEs were cloned into a vaccinia vector for insertion into the B14R locus along with EGFP and Flue reporter transgenes.
[0338] To generate VSVA51-HER2T, the expression plasmid encoding human wildtype ERBB2 (NM_004448.3) was obtained as a gift from Mien-Chie Hung (Addgene plasmid # 16257; http: / / n2t.net / addgene: 1625 ;RRID:Addgene16257). The required truncations were generated, and the HER2T cds6was amplified by PCR. The final amplicon was flanked by 5’ Xho\ and a 3’ Nhe\ cutsites for insertion into the gene junction between G and L in the VSVA51 backbone. The sequence for HER2T in VSVA51-HER2T is distinct from the sequence of HER2T used in the generation of stable HER2T+ cell lines.
[0339] TCE expression
[0340] Transfection of HEK293T cells with TCE-pcDNAwas performed in a 15 cm2plate. A total of 20 pg DNA and 60 pl Lipofectamine™ 2000 were used, following the manufacturer's instructions (Life Technologies, ON, CAN). OptiMEM™ (ThermoFisher Scientific) was used as the transfection medium, and cells were incubated at 37°C with 5% CO2for 6 h. Subsequently, 147222-000022
[0341] 57 the transfection mixture was replaced with serum-free DMEM, and the cells were further incubated for 48 h at 37°C with 5% CO2. To concentrate the TCEs, supernatants from the transfected cells were collected and cleared of cell debris by centrifugation at 400 g for 5 min at room temperature. The resulting supernatants were then subjected to centrifugal concentration using Amicon™ Ultra-15 Centrifugal Filter Units with a 10 kDa molecular weight cutoff (EMD Millipore, Cat. # UFC901024, MA, USA). This step involved centrifugation at 4500 g for 30 min at 4°C. The concentrated TCE samples were aliquoted and stored at -80°C until further use. Quantification of TCEs was performed utilizing a pre-coated anti-His ELISA kit (Cayman Chemical, Cat. # 10012445, Ml, USA) following the manufacturer's instructions.
[0342] Viruses
[0343] Vaccinia virus (VV). The parental W Tian Tan strain was previously described40. To propagate oncolytic W, HeLa cells were cultured in roller bottles of 1700 cm2, using DMEM supplemented with 25 mM HEPES. These cells were infected with the virus at a multiplicity of infection (MOI) of 0.05 and incubated at 37°C until the development of a cytopathic effect (48-72 h). The resulting viruses were harvested and purified following established protocols4047. Viral titers were quantified by standard plaque assay titration using U-2 OS cells, as described7 4047.
[0344] Generation of VV-TCE. Insertion of aHER2 TCE transgenes derived from TCE-pcDNA plasmids was achieved by integrating them into a W expression backbone (W-TCE plasmid) containing homology arms specific to the vaccinia B14R locus. Standard DNA cloning techniques involving Xho\ and Not restriction enzymes (NEB) for digestion and ligation were utilized during this process, and the resulting constructs were verified through sequencing. TCE expression was regulated by both pEarly and pLate promoters. The coding sequence (cds) for Flue and the fluorescent selection marker EGFP were separated by a P2A sequence, and their expression was also under the control of pEarly and pLate promoters. U-2 OS cells were infected with parental Tian Tan vaccinia virus at a multiplicity of infection (MOI) of 0.05 for 2 h. Subsequently, the media was removed, and the cells were transfected with 1 pg of DNA, maintaining a DNA-to- Lipofectamine 2000 ratio of 1 :3. After 2 h, the transfection mix was replaced with DMEM supplemented with 10% fetal bovine serum (FBS). Recombination facilitated the insertion of TCE transgenes into the viral genome. The infected cells were incubated for 48 h at 37°C with 5% CO2and examined for EGFP expression. For virus rescue, cells showing EGFP-positive plaques were collected and subjected to three cycles of freeze / thawing. The collected virus was serially diluted and used to infect fresh U-2 OS cells. The newly infected U-2 OS cells were cultured with an overlay medium composed of a 1 :1 mixture of 3% carboxymethyl cellulose (CMC) and 2x DMEM supplemented with FBS for 48 h at 37°C with 5% CO2. Plaques displaying EGFP-positive signals were selected using sterile pipette tips, and three rounds of freeze / thawing were performed. The resulting virus was used to infect U-2 OS cells in subsequent iterations of the process until pure virus was obtained. Once a pure virus population was established, an mCherry geneblock was 147222-000022
[0345] 58 introduced into the J2R locus using U-2 OS Cas9 cells and an sgRNA guide targeting the locus, following previously described methods48. Selection for double-positive plaques expressing EGFP-mCherry was performed.
[0346] Vesicular stomatitis virus (VSVA51). The oncolytic versions of VSV (Indiana serotype) encoding a firefly luciferase protein tag (VSVA51-Fluc), green fluorescent protein (VSVA51-GFP) tag, red fluorescent protein (VSVA51-RFP) tag, or truncated HER2 (VSVA51-HER2T) were propagated using Vero cells as previously described49. Briefly, VSVA51 was added at an MOI of 0.01 to 95% confluent Vero cells in 150 mm culture dishes or roller bottles in a total volume of 25 ml complete DMEM. Inoculated Vero cells were incubated at 37°C with 5% CO2for 24 h or until approximately 50% CPE (cytopathic effects, cell rounding) was observed. Supernatants were collected and pelleted at 780 g to clear heavy debris. Virus contained within the cleared supernatant was subsequently subject to 0.22 pm membrane filtration and purified using 5-50% OptiPrep™ (Sigma-Aldrich, Oakville, ON, Canada, Cat. # D1556) gradient. The purified virus suspension was aliquoted and frozen at -80°C. For all virus infections, viruses were diluted in serum free DMEM to obtain the specified multiplicity of infection (MOI), or for mock infection cells were supplemented with an equal volume of serum free DMEM.
[0347] For quantification of viral titers by using standard plaque assay titration, Vero cells were seeded into 12-well plates at a final density of 3 x 105cells per well. Infectious supernatants were serially diluted using serum-free DMEM, transferred (500 pL / well) onto Vero cells and incubated at 37°C, 5% C02for45 min. Media was removed and replaced with 1 ml / well of an agarose overlay (1 :1 ratio of 1% agarose mixed with 2x DMEM containing 20% FBS). After a 24 h incubation, plaques were fixed with methanol: glacial acetic acid in a 3:1 ratio for a minimum of 1 h, then stained for 30 min with a Coomassie Blue solution (Sigma, Cat. # B0149; 4 g Coomassie Brilliant Blue R, 800 ml methanol, 400 ml acetic acid and 2800 ml distilled water) to visualize and count plaques.
[0348] Quantification of viral infection by reporter imaging. Virus infections were conducted on cells cultured in serum-free media at the designated multiplicities of infection (MOIs). After a 1.5- 2 h incubation period, the media were replaced with RPMI or DMEM supplemented with 10% FBS and 1% (v / v) penicillin / streptomycin. Following incubation at 37°C in 5% CO2, cells were examined for EGFP or RFP expression at 24 or 48 hpi using an EVOS M5000 fluorescence microscope (Thermo Fisher Scientific) or Cellomics ArrayScan (Thermo Fisher Scientific) using the HCS Studio v2 software.
[0349] For the treatment of Vero cells by IFN|3 (AVNONEX™, Interferon beta-1a) cells were seeded in 96- or 24-well plates. Cells were treated with I FN|3 at the indicated concentrations for 30 min, followed by co-infection with VSVA51-RFP and / or W at the indicated MOI.
[0350] Viral growth curves. Cells were seeded in 24 well plates for overnight confluency. Cells were then inoculated with VSVA51 or W at an MOI of 0.01 (multi-step growth curve) or 1.0 147222-000022
[0351] 59
[0352] (single-step growth curve). Cells infected at MOI 1.0 were incubated for 60 min, following by washing and replenishing with fresh medium.
[0353] For VSVA51 , cells were incubated up to 54 hpi, with the supernatant collected and frozen in Eppendorf tubes at -80°C at the indicated timepoints. For W, cells were incubated up to 72 hpi. Cells were scraped off each well and collected and frozen with the supernatant in Eppendorf tubes at -80°C at the indicated timepoints. Viral titer in collected supernatant was quantified by standard plaque assay.
[0354] Immunoblottinq
[0355] Samples were prepared following protein quantification via a bicinchoninic acid assay (ThermoFisher Scientific, Cat. # 23227; Waltham, MA, USA), and immunoblotting was performed with equal amounts of protein for whole cell lysates or supernatant samples. Total protein was detected by ponceau S staining (Sigma-Aldrich, Cat. # P7170-1 L; St Louis, MO, USA). TCEs were detected via their His tag using a mouse anti-His antibody (Abeam, 1 :1000, Cat.# ab18184, ON, Toronto, Canada). Vaccinia virus presence was confirmed with a rabbit polyclonal antibody that detects vaccinia virus proteins (LSBio, Cat. # LS-C103289, 1 :1000, Seattle, WA, USA). HER2 levels were detected using a mouse monoclonal antibody against human HER2 / ErbB2 (1 :1000, Invitrogen, Cat. # MA5-13105). [3-Actin (1 :1000; 13E5; Cell Signaling Technology) was used as a loading control for immunoblots. After overnight incubation with primary antibodies, the immunoblots were probed with HRP-coupled anti-rabbit or anti-mouse antibodies (1 :5000) (Jackson ImmunoResearch Laboratory, West Grove, PA, USA, Cat. # 711-035-152 (anti-rabbit) 715-035-150 (anti-mouse)). Supersignal West Pico Plus Chemiluminescent substrate (Thermo Scientific, Cat. # 34577, Burlington, Ontario, Canada,) was used to visualize the protein bands on a Bio-Rad ChemiDoc.
[0356] Metabolic activity assay
[0357] The metabolic activity of cells was evaluated using alamarBlue™ (Invitrogen, Cat. # DAL1025, MA, USA) or resazurin sodium salt (Sigma-Aldrich, Cat. # R7017) following the manufacturer's instructions. Treated and / or infected cells were treated with 10% (v / , final) resazurin in each well and incubated for 1-2 h, depending on the specific cell line. Fluorescence intensity was measured at 590 nm upon excitation at 530 nm using the BioTek Synergy™ or Cytation™ 5 Microplate Readers (BioTek, VT, USA).
[0358] TCE or antibody binding assay
[0359] Single-cell suspensions (5 x 105cells) were placed on ice and treated with His-tagged TCEs or trastuzumab (10-25 pg / ml) for 1 h prior to washing away excess unbound TCEs or antibody. Anti-His IgG-AlexaFluor™ 647 (1 :300, ThermoFisher Scientific, Cat. # MA1-21315- A647) or anti-human IgG-PE (1 :500, Invitrogen, Cat. # PA1-86978) were used to quantify attachment to cell-surface. Fluorescence was quantified by Cytation™ 5 plate reader (Biotek). MFI were normalized to mock control MFI. 147222-000022
[0360] 60
[0361] Syngeneic mouse models
[0362] For cell implantation into mice, cells were washed twice with PBS, filtered through a 70 pm filter, and counted using ViCell. The cells were then resuspended in PBS and kept on ice until the injection procedure. Tumours were implanted by mixing equal volume of cells with cold Geltrex® (1 :1 ratio, Thermo Fisher, Cat. # A1413201). After tumour implantation, animal cohorts were randomized before the initiation of treatment regimens. Tumour volumes were determined using a modified ellipsoidal formula: Tumour volume =Wldth*len9th) tumour volume = [(width2x length) / 2], where width corresponds to the smallest dimension. For palpable tumours, mice were treated when tumours reached 80-100 mm3as indicated in figures. Mice were euthanized when tumour volumes reached above 1500 mm3, and according to the institutional guidelines review board for animal care. Tumour progression was regularly monitored by measurements every other day, or every 2 days. As such, there were instances where maximum tumour volumes were marginally exceeded.
[0363] For all in vivo mouse experiments, female mice were used to account for the relevance of breast cancer and ovarian cancer models used, as well as to account for sex-based physiological variability. Using female mice further enabled minimization of animal housing costs (n = 5 per cage) compared to male mice (n=1 per cage).
[0364] In 8-week-old female immunocompetent C57BL / 6 mice (Charles River Laboratories, Wilmington, MA, USA), MC38 (or MC38-HER2T) murine colorectal cancer cells (5 x 105cells in 50 pL of PBS), or B16-F10 (5 x 105cells in 50 pL of PBS) murine melanoma cells were injected subcutaneously. Alternatively, ID8 Tp53- / ~ Pten -I- Flue (ID8-PP) (or ID8-PP-HER2T) murine ovarian cancer cells (5 x 106cells in 50 pL of PBS) were injected intraperitoneally into the abdomen. Treatment with viruses or controls was administered at the designated time points.
[0365] Bioluminescence imaging by IVIS Spectrum (Living Image Software v4.7) (PerkinElmer, Waltham, MA, USA) was performed on ID8-PP i.p. tumour-bearing mice for longitudinal monitoring of tumour burden. Mice were imaged one a week for a total of four weeks. Briefly, 200 pL of 10 mg / ml D-luciferin (PerkinElmer, Cat. # 1227991) were injected subcutaneously in mice, which were rested for 5 min. Mice were then anesthetized by inhaled isoflurane, imaged using a 30 second exposure, then revived. Radiance and total flux were calculated using the Living Image v4.7 software (PerkinElmer).
[0366] 8-week-old female immunocompetent BALB / c mice (Charles River Laboratories, Wilmington, MA, USA), 4T1.2 (or 4T1.2-HER2T) murine breast cancer cells or CT26 (or CT26- HER2T) murine colorectal cancer cells (5 x 105cells in 50 pL of PBS) were injected subcutaneously. Alternatively, 4T1.2 cells (5 x 105cells in 50 pL of PBS) were injected intravenously into the tail veins of mice for the lung metastasis model. T reatment with intravenous injections of viruses or controls was administered at the indicated time points prior to lung 147222-000022
[0367] 61 harvesting. On day 10, mice were euthanized, and their lungs were injected intratracheally with black India ink. The lungs were then excised, rinsed with water, and fixed in Fekete solution (100 mL formalin, 700 mL ethanol, 50 mL glacial acetic acid, and 150 mL distilled water) before counting the metastatic nodules.
[0368] All rechallenge studies were performed D90 post-implantation, by implanting bilateral tumours. For these bilateral implantations, cells were seeded at double the original seeding density, distal or contralateral to the initial site of tumour implantation. Parental tumours were implanted in the contralateral side, while HER2-expressing derivatives of the parental tumours were implanted in the right flank at a distal site from the initial tumour. Tumour progression and overall survival were monitored over time.
[0369] Post-surgical metastasis model
[0370] 8-week-old female immunocompetent C57BL / 6 mice were implanted orthotopically with B16-F10 cells (5 x 105cells) subcutaneously in the right flank. 10 days post implantation when tumours reached ~150-250 mm3and were given enough time to disseminate metastatic cells, tumours were surgically excised. Mice were observed in post-operative care for 24 h. 48 h following recovery, mice received intravenous injections of the indicated treatments via tail vein. Animals were monitored for wellness until day 45 following initial implantation. All primary tumours, lungs, and spleens were collected. Each animal was scored 0-3 as indicated in FIG. 23B, where recurrence of the primary tumour = +1 , spleen metastasis = +1 , lung metastasis = +1.
[0371] Tracking migration of i.v. injected tumour cells
[0372] Confirmation of migration of i.v. 4T1.2 cell injection to lungs was done by IVIS fluorescence imaging. Briefly, 4T1.2 cells were stained with IVISense DiR 750 Fluorescent Cell Labeling Dye (Rewity, Cat. # 125964, MA, USA) according to the manufacturer’s instructions. Cells were then injected into mice through tail veins. Following 1 h and 24 h post-injection, ventral sides of mice were imaged by IVIS (Exzio / Emzeo). Following imaging, mice were euthanized, lungs were perfused with a total volume of 10 ml of PBS supplemented with 50 lU / ml heparin sodium salt through slow injection (200 pL / second) into the right ventricle Lungs were then inflated by slow (200 pL / second) instillation of 10% neutral buffered formalin solution for overnight fixation. Lungs were then processed for hematoxylin and eosin staining for subseguent histological analysis for the identification of micrometastatic lesions.
[0373] Virus biodistribution
[0374] Female BALB / c mice bearing CT26 tumours were injected with i.t. VSVA51 or VSVA51 + W at the indicated doses. 48 hpi, mice were euthanized. Organs and tumours were harvested and snap frozen for subseguent RNA extraction. Frozen tissues were crushed using a dounce homogenizer; RNA extraction was performed by using QiaShredder™ columns (Qiagen, Cat. # 79656, Hilden, Germany) and RNeasy™ kits (Qiagen, Cat. # 74106). RNA was converted to 147222-000022
[0375] 62 cDNA using (Thermo Fisher Scientific, Cat. # K1622). Real-time PCRs were performed using PowerUp™ SYBR™ green, according to the manufacturer's instructions (Thermo Fisher Scientific, Cat. # A25776) on a 7500 Fast Real-Time PCR system (Applied Biosystems). Optimal thresholds, reaction efficiencies, and Ct values were determined using the ABI software and melt curves for each primer exhibited a single peak. Gene expression relative to HPRT was calculated by the Pfaffl method. Fold-change was determined relative to the Mock control for each gene. Primers used:
[0376] VSV-N F: GATAGTACCGGAGGATTGACG (SEQ ID NO:65)
[0377] VSV-N R: TCAAACCATCCGAGCCATTC (SEQ ID NO:66) mHPRT F: TGAAGAGCTACTGTAATGATCAGTCAA (SEQ ID NO:67) mHPRT R: AGCAAGCTTGCAACCTTAACCA (SEQ ID NO:68)
[0378] Bilateral CT26 model for intratumoural viral spread
[0379] 8-week-old female BALB / c mice were implanted with s.c. CT26 tumours in both the left and right flanks. 11 days post-implantations when tumour volumes reach ~100-150 mm3, both tumours were injected as indicated. Mice were euthanized and tumours were collected at either 24 or 48 h post-injection. All tumours from the right flank were dissociated as described below. All tumours from the left flank were fixed in 10% neutral buffered formalin solution for subsequent paraffin embedding, sectioning, and immunohistochemistry.
[0380] Xenograft mouse models
[0381] 8-week-old female CD1 nude mice (Crl:CD1-Foxn1nu; Charles River Laboratories, Wilmington, Massachusetts, USA, Strain code # 086) were implanted subcutaneously with HT- 29 human colorectal cancer cells (5 x 105cells in 100 pL of PBS). Priorto implantation, cells were mixed with equal volume of cold Geltrex® (1 :1 ratio, Thermo Fisher).
[0382] Tissue processing
[0383] Tumours were dissociated using the Miltenyi mouse tumour dissociation kit (Miltenyi Biotec, Cat. # 130-096-730, CA, USA) and the gentleMACS Octo Dissociator (Miltenyi Biotec, Cat. # 130-096-427). Spleens were collected and dissociated by crushing the organs through a 70 pm strainer using the plunger of a 3 mL syringe. All dissociated spleens underwent erythrocyte lysis using ACK buffer (Gibco, Cat. #A1049201). All cell suspensions were strained and counted. 2 x 106cells were resuspended in 200 pl of FACS buffer (0.5 % BSA-PBS) and transferred to round-bottom 96-well plates for staining for flow cytometry. Alternatively, dissociated tumours or splenocytes were resuspended in 100 pl RPMI supplemented with 10% heat-inactivated FBS for in vitro culture.
[0384] Flow cytometry
[0385] After processing tissues as described above, cells were stained with fixable viability dye FVS510 (1 :1000, BD Biosciences, NJ, USA, Cat. #564406) in PBS for 15 min at room 147222-000022
[0386] 63 temperature. Cells were washed and then incubated with anti-CD16 / 32 (1 :100, BD Biosciences, Cat. # 553141) in 0.5% BSA-PBS for 30 min at 4°C to block non-specific antibody interaction with Fcreceptors. Cells were next incubated with CellBlox™ blocking buffer (1 :100, Invitrogen, Cat. # B001T06F01) to block non-specific interactions with monocytes and macrophages. Cells were subsequently stained with an antibody cocktail diluted in 0.5% BSA-PBS and Super Bright complete staining buffer (1 :50, Invitrogen, Cat. # SB-4401-75). Antibodies are detailed in Table 6.
[0387] Table 6: Antibodies used for flow cytometry assays described herein
[0388] 147222-000022
[0389] 64
[0390] Cells were then washed and resuspended in 1% paraformaldehyde (PFA) in PBS. Samples were acquired with the BD LSRFortessa™ (using FACSDiva™ v9 software) or the Cytek® Aurora spectral cytometer (using SpectroFlo® software) at the University of Ottawa Flow Cytometry and Virometry core facility (Director: Dr. Vera Tang), and the OHRI Flow Cytometry and Cell Sorting core facility (Director: Fernando Ortiz). Data were analyzed using FlowJo v10.8 software or the OMIQ online platform. Dimensionality reduction plots were generated using the 147222-000022
[0391] 65 opt-SNE50. Unstained controls, and fluorescence-minus-one (FMO) controls were prepared in parallel. Ultracomp eBeads (Thermo Scientific, Cat. # 01-2222-42) single-stained beads were used for compensation.
[0392] For the detection of virally-encoded fluorophores, samples were not fixed and were assessed by flow cytometry immediately after dissociation and staining to prevent fluorescence quenching. For the detection of cells infected by VSVA51-HER2T, cells were stained with trastuzumab (1 :1000) followed by a goat anti-human IgG-PE (1 :300, Invitrogen, PA1 -86078).
[0393] Intracellular staining
[0394] Dissociated tumour specimens, including tumour-infiltrating lymphocytes, were counted and seeded at 1 x 106cells in 100 pl RPMI supplemented with 10% FBS, 10 mM HEPES, 50 pM 2-mercaptoethanol, and 1 x non-essential amino acids (Gibco, Cat. #11140050) in round-bottom 96-well plates. Cells were incubated with 100 pl of the following stimulants for 4 h: PBS, irradiated CT26 cells, irradiated JIMT1 cells, 10 pM VSV-N peptide (H-2Ld MPYLIDFGL51, CanPeptide Inc.), 10 pM W-F2 / E3 peptides SPGAAGYDL / VGPSNSPTF52; Genscript, NJ, USA), 10 pM gp70 (AH1) peptide (H-2Ld SPSYVYHQF51, MBL International Corporation, Cat. # SPM521), or PMA (50 ng / ml) and ionomycin (1 pg / ml) (BioLegend, Cat. # 423301). GolgiPlug / Brefeldin A (1 :1000, BD Biosciences, Cat. # 555029) was added to each well, and cells were incubated overnight for 18 h. Cells were stained for viability and surface markers, followed by fixation and permeabilization (BD Cytofix / Cytoperm™, BD BioSciences, Cat. # 554714). Intracellular staining was performed according to the protocol previously described and using the antibodies listed in Table 6.
[0395] For the preparation of irradiated stimulants, CT26 or JIMT1 cells were resuspended in CTL medium (Immunospot, Cat. # CTLT-010, OH, USA) at 2 x 106cells per 100 pl, then irradiated (Pantak HF320 X-Ray Machine) with 90 Gy.
[0396] Mouse IFN-y single-color enzyme-linked immune absorbent spot (ELISPOT)
[0397] ELISpots were done as previously described6. Briefly, Immunospot ELISPOT plates were prepared according to manufacturer’s instructions (Immunospot, OH, USA, Cat. # mlFNgp- 1 M / 5), with stimulants added to wells as indicated. 2 x 105splenocytes incubated in CTL medium in the IFN-y pre-coated plates. Spots were counted using ImmunoSpot® Software version 5.3. Counts from unstimulated / DMSO control were treated as background and subsequently subtracted from all conditions within the same sample. Stimulants used were: DMSO, irradiated CT26 cells, irradiated JIMT1 cells, 10 pM VSV-N peptide, 10 pM W-F2 / E3 peptides, 10 pM gp70 (AH1) peptide, or PMA (50 ng / ml) and ionomycin (1 pg / ml) (BioLegend, Cat. # 423301). For irradiation, cells were resuspended in CTL medium at 2 x 106cells per 100 pl, then irradiated (Pantak HF320 X-Ray Machine) with 90 Gy.
[0398] IqG assay
[0399] 3 x 105cells were resuspended in 100 pl of 0.5% BSA-PBS and transferred to a roundbottom 96-well plate. Cells were incubated with mouse serum (1 :100) for 60 minutes at 4°C, then 147222-000022
[0400] 66 incubated with goat anti-mouse IgG-AlexaFluor™ Plus 488 (1 :300, Invitrogen, Cat. # A32723). Cells were washed and resuspended in 1% PFA-PBS and acquired by flow cytometry.
[0401] Ex vivo tumour cores
[0402] Mouse tumours were excised immediately after mice were euthanized. Patient specimens were retrieved from the pathology lab after patient consenting and surgical excision. Smaller patient specimens were exhausted, and higher priority conditions received as many tumour cores as possible, leaving few cores for lower priority conditions (such as n = 2 cores in Fig. 3h; Basal cell carcinoma and Ovarian samples, W-Ctrl-TCE control condition). All tumours were trimmed and processed into 2 mm thick sections, which were then cored by 2 mm punch biopsy (Integra Miltex, VWR, Cat. # 21909-132). Cores were cultured in DMEM supplemented with 10% FBS, 10 mM HEPES, 0.75 pg / ml amphotericin B, 1% penicillin-streptomycin, and 50 pg / ml gentamicin in 24-well plates. Cores were treated as indicated, and infected with 3 x 104PFU / core VSVA51 or 3 x 105PFU / core W.
[0403] For the J69 activation assay, cores were infected as described. 48 hpi J69 were added (1 x 106cells / well) and incubated for 24 h. J69 cells were then dislodged from the well, collected, and analyzed by flow cytometric analysis for TdTomato signal.
[0404] Immunofluorescence (IF) staining
[0405] Cells on sterile glass coverslips were incubated overnight at 37°C. Cells were then fixed with 4% paraformaldehyde, quenched with 100 mM glycine in PBS* (supplemented with 1 mM CaCI2and 0.5 mM MgCI2), and blocked in 5% BSA-PBS*. For detection of cell surface HER2 or HER2T, slides were incubated overnight at 4°C with trastuzumab (1 :1000), in 1% BSA-PBS*. Coverslips were washed then incubated for 1 h at room temperature with a goat anti-human IgG- AlexaFluor-594 (1 :200, Invitrogen, Cat. # A-11014). Coverslips were mounted on slides with Prolong Diamond anti-fade with DAPI (Invitrogen, Cat. # P36962), and stored at 4°C. Images were taken using the AxioCam HRm camera (Carl Zeiss Ltd, Toronto ON) mounted on the Zeiss Axioscope Imager M1 or the Zeiss Axio Imager M2 microscope. Image analysis and signal quantification was performed using Imaged v2.9 software.
[0406] Immunohistochemistry (IHC)
[0407] For frozen tissue samples: following harvest, tumours were rinsed with PBS then embedded and frozen in O.C.T. medium using an ethanol dry ice bath. Samples were sectioned by cryostat and mounted. Slides were gradually thawed at room temperature before brief rehydration with PBS followed by fixation with 4% paraformaldehyde. Serially sectioned slides were blocked with serum-free Dako protein block (Agilent, Cat. # X090930-2, CA, USA). Tissue sections for intracellular VSV detection were permeabilized for 10 min in a solution of 0.2% T riton- X100 in PBS*. Sections for extracellular HER2 or HER2T detection were not permeabilized. Staining was done using rabbit polyclonal anti-VSV5354(1 :5000) or trastuzumab (1 :1000) overnight, followed by visualization using anti-rabbit IgG-Alexa Fluor-594 (1 :300, Invitrogen, Cat. 147222-000022
[0408] 67
[0409] # A-11012) or anti-human IgG-Alexa Fluor-594 (1 :300, Invitrogen, Cat. # A-11014). Slides were mounted using Prolong Diamond anti-fade with DAPI (Invitrogen, Cat. # P36962), and imaged using a Zeiss Axio Imager M2 microscope and ZEN v2.6 (blue edition) software.
[0410] For fixed tissue samples: following harvest, tumour samples were rinsed in PBS and fixed in 10% neutral buffered formalin (Sigma, Cat. # HT501128) for 24 h, then transferred to 70% ethanol. Following paraffin embedding and sectioning, 4 pm thick tissue sections were deparaffinized (5 minutes each in CitriSolv™ (DeconLabs, Cat. # 1601 , PA, USA) then rehydrated in descending alcohol series (100%, 95%, 90%, 80%, 5 minutes each). Antigen retrieval was performed in citrate buffer (pH 6.0, Vector H-3301) and endogenous peroxidase activity was quenched in 3% H2O2. Tissue sections were blocked using serum-free Dako protein block. Serially sectioned slides were then incubated with the following primary antibodies overnight at 4°C: rabbit anti-vaccinia virus polyclonal antibody (1 :2000, Invitrogen, Cat. # PA1-7258), rabbit anti-VSV polyclonal antibody5354(1 :2000), rabbit anti-cleaved caspase 1 monoclonal antibody (1 :500, Invitrogen, Cat. # PA5-99390), rabbit anti-cleaved caspase 3 monoclonal antibody (1 :2000, Cell Signaling Technology, Cat. # 9664). Slides were developed using the ImmPRESS HRP Horse Anti-rabbit IgG Kit (Vector Laboratories, Cat. # MP-7401-15), then counterstained in hematoxylin, dehydrated, and mounted. Tissue sections were imaged using an AxioScan.ZI and the ZEN v2.6 (blue edition) software. For quantification of 3,3'-Diaminobenzidine (DAB) staining, percentage of DAB-positive cells were calculated in per ROI per section, using QuPath vO.5.1 software55.
[0411] Statistics and reproducibility
[0412] All graphs and statistical analyses were performed using Excel or GraphPad Prism v.10.2.1. Individual statistical tests were detailed in figure legends. A minimum of three biological replicates are used in all experiments. Each in vitro or ex vivo experiment was independently replicated a minimum of twice. All animal experiments were replicated in multiple models, by 2 different operators. All in vitro experiments are the result of at least 2 independent experiments. One-way or two-way ANOVA were followed-up with Fisher’s LSD test when few planned comparisons were pre-determined. Exact P-values are indicated where possible, but are capped at a lower limit of P = 0.0001 for ANOVA when calculated using GraphPad Prism. Normal distribution of the data was assessed using D’Agostino & Pearson omnibus and Shapiro-Wilk normality tests. Non-parametric tests were implemented if assumptions for parametric tests were not met. Alpha levels for all tests were 0.05 (confidence levels of 95%). Analysis of in vivo survival data was performed by the Kaplan-Meier method followed by log-rank test. In vivo group sizes were based on a power calculation of 0.8, with an anticipated doubling of mOS. The number of ex vivo tumour core biological replicates was based on a power calculation of 0.8, with an anticipated tripling in viral titer, or an anticipated doubling in J69 activation. Power calculations were computed using the NIH Sample Size Calculator56. Biological replicates are indicated by a 147222-000022
[0413] 68 number n, and defined as per NIH guidelines, and error calculated as the standard error of the mean (SEM).
[0414] Example 2: Design of HER2 antigens
[0415] In general, it is advantageous for the epitope / antigen size to be small. This is for the following reason: o For stability, as larger antigens are typically more unstable. o to better integrate into the viral genome. For example, using CRISPR and considering antibiotic resistance, small size is helpful, rescuing the virus is often not successful with larger antigens o helps to reduce immunogenic nature of epitope - makes it minimally immunogenic and therefore will not be rejected by the immune system quickly (enabling targeting by the immunotherapeutic). Less immunogenic also means there is no IgG to block the antigen from the immunotherapy. o Also so that it can be delivered through mechanisms that have size limitation i.e. certain oncolytic viruses such as VSV which have a coding capacity constraint.
[0416] The maximum size for a reasonable antigen could be up to 3000-4000 bp in design. For practical purposes, including successful viral rescue and replication, and specifically in the case of small rhabdoviruses (VSVd51 , MG1) the size of the antigen should preferably be no larger than 2000 bp, ideally around 1500 bp.
[0417] It has been previously reported that human HER2 is very immunogenic in mice57-59. In mice specifically, the outermost domain in HER2 was found to be the most immunogenic, specifically around residues 63-71 . In fact, it was found that when HER2 was expressed on cells and those cells implanted in animals, the tumours did not develop, and the mice developed specific robust immunity against that specific region of HER2. By omitting that region, it was hypothesized that immunogenicity would be reduced.
[0418] In a report studying an anti-HER2 cancer vaccine in mice60. In this study, different truncations of a rodent orthologue of HER2 called Neu were created in plasmid form. These truncations were used to vaccinate animals (DNA vaccine). After vaccination, the animals were challenged with Neu+ tumours. Many of the truncations made led to successful immunity against the tumour formation, i.e., the vaccine was successful and prevented Neu+ tumours from growing. A few of these vaccines were less successful, and one of these particularly underperformed (no immunity against the Neu+ tumours), so the tumours grew just as well as they did in the immunized animals as in the non-immunized animals.
[0419] Non-immunogenic human HER variants were design to develop the mouse model described herein. FIG. 1A is a schematic of different HER2 variants according to the present 147222-000022
[0420] 69 disclosure. The top panel shows the full HER2 protein including the intracellular domain, transmembrane domain, and extracellular domain. Both designed Her2 variants (HER2T-1 and HER2T-2) according to the present disclosure lack the kinase domain (signalling) as well as other extracellular domains (notably the outermost, N-terminal domain). The HER2T-1 variant, which is a dual-epitope antigen capable of being targeted by two different HER2 targeting immunotherapies (trastuzumab and pertuzumab) (FIG. 3A), was used in the present study when expressed via plasmid or virally, and the HER2T-2 variant, which only includes the epitope targetable by trastuzumab (FIG. 3A), was used to generate the animal models.
[0421] The outermost domain of human HER2 is especially immunogenic in mice. FIG. 1B shows that immunogenic HER2 is rejected by immune-competent BALB / c mice, stressing the importance in the present study of a non-immunogenic antigen as part of the design. As shown in FIG. 1C, the non-immunogenic HER2T cells develop tumors and grow relative to the immunogenic full length HER2 cells.
[0422] Example 3: Synthetic HER2T antigen encoded within VSVA51 is expressed in vitro and in vivo and can be recognized by trastuzumab
[0423] Levels of cell-surface target expression confer sensitivity to targeted biologies, such as the antibody-drug conjugate (ADC) T-DM15. Indeed, HER2-low 786-0 cells showed reduced sensitivity to T-DM1 relative to HER2-high AF2068 cells (FIGs. 2A-B). VSVA51 replication was enhanced in AF2068 cells, but not 786-0 cells, treated with low concentrations of T-DM1 (FIG. 2C). The truncated, kinase-dead version of HER2 (HER2T-2)6described above, retaining the trastuzumab epitope and its ability to simulate HER2+ status, was incorporated into the VSVA51 genome (FIG. 3A). The oncolytic virus, referred to as VSVA51-HER2T, which exhibited unchanged growth kinetics relative to control VSVA51-Fluc (FIG. 2D), was rescued and purified (FIG. 3B). HER2T expression peaked at ~16 h post-infection (hpi) with VSVA51-HER2T in 4T1.2 cells, visualized by immunofluorescence staining (FIGs. 2E-G). It was demonstrated that VSVA51 -induced HER2T protein trafficked to the cell surface in CT26 and MC38 cells (FIG. 3C). VSVA51-HER2T also enhanced trastuzumab binding in HER2-low HT29 cells (FIG. 2H) and did not infect normal GM38 fibroblasts to express HER2T (FIG. 2I), showing that the virus is cancer cell-selective with multiple different cancer cell types but does not infect non-cancer cells.
[0424] Equal doses of intratumoral (i.t.) injections of VSVA51-HER2T or VSVA51-GFP were next administered into subcutaneous (s.c.) CT26 tumours in wildtype BALB / c mice (FIG. 2J). Tumour sections obtained 24 h post-injection revealed HER2T+ trastuzumab-binding only in VSVA51-HER2T-treated tumours by immunohistochemistry (FIG. 3D). HER2T+ regions overlapped with VSVA51+ regions in these sections, suggesting antigen expression is localized. These data suggest VSVA51-HER2T exhibits unimpaired growth kinetics and mediates trastuzumab-binding cell-surface expression of HER2T in vitro and in vivo. 147222-000022
[0425] 70
[0426] Example 4: Cancer cells in bloodstream and lungs that do not express HER2 can be made HER2+ using the approach described, and recognized by multiple immunotherapeutics (T-DXd / Enhertu and T-DM1 / Kadcyla)
[0427] Mice were injected intravenously with 4T 1 .2 mouse breast cancer cells which are HER2 negative. These cells travel to the lungs through the bloodstream rapidly. These mice were treated with i.v. injections of the indicated treatments (PBS control, T-DM1 Kadcyla, T-DXd Enhertu (another HER2-targeted ADC), VSV-HER2T alone, or the combinations of VSV-HER2T + ADC. The lungs of these mice were extracted 15 days later and the number of cancer nodules in the lungs were counted. The ADCs alone did not have an impact on the nodule count, due to the absence of the target (HER2T) on the cancer cells for the ADCs to engage. In the combination treatments however, a significant reduction in the number of lung nodules was observed. In this combination approach, the VSV-HER2T infects cancer cells in the lungs and introduces the HER2T target, thereby enabling the ADCs to engage and promote killing of the cancer cells (FIG. 4).
[0428] Example 5: VSVA51 -mediated HER2T expression sensitizes solid tumours to T-DM1 in murine tumour models in vivo and in patient tumour specimens ex vivo
[0429] The mechanistic synergy between microtubule destabilizing agents (MDAs) and VSVA51 has been previously reported269. It was found that MDAs enhance VSVA51 spread and bystander killing within tumours, through disruption of type I interferon secretion. It was moreover demonstrated that ADCs bearing an MDA payload led to the same combinatorial synergy with VSVA51 although in a very specific targeted fashion26. To determine whether HER2T can respond to a HER2-targeted therapy, murine CT26 tumour cores were treated ex vivo with VSVA51-HER2T and T-DM1 . CT26 tumour cores were used in ex vivo experiments to refine the treatment conditions before implementing more challenging patient surgically-excised tumour specimens. CT26 tumour cores were infected with VSVA51-GFP and VSVA51-HER2T, and treated with mock and trastuzumab emtansine (Kadcyla®) (50 pg / mL (48 hpi), 100 pg / mL (48 hpi), and 100 pg / ml (6hpi), and core supernatants were quantified and plotted, with mean ± SEM, n = 4 cores and P-value calculated by two-way ANOVA with Dunnett correction for multiple comparisons, as shown in FIG. 5B. Viral replication was enhanced in a HER2T-dependent manner, consistent with previous findings showing increased VSVA51 replication in the presence of T-DM1 in HER2+ cell lines2 69. In other words, T-DM1 affects microtubules in cancer cells by enhancing viral replication due to binding the HER2 antigen. Similar results were observed in patient tumour cores with unknown and HER2 negative status as described in Table 7 (FIGs. 3E- F; FIG. 5C), where patient tumours were treated with VSVA51-HER2T + T-DM1 , or SVA51-GFP + T-DM1 as control or mock (PBS), and viral supernatants were quantified at 48 hpi (shown are mean ± SEM, n = 4-14 cores, P-value calculated by multiple unpaired t-tests. (Endometrial 1 n = 147222-000022
[0430] 71
[0431] 4, Renal 1 n = 6, Ovarian 2 and Breast 1 n = 8, Parotid 2 n = 14, all others n = 12). (FIG. 5C, Table 5). As shown in FIG. 5C, and in FIG. 3E, which show mean ± SEM, n = 4-14 cores, P-value calculated by multiple unpaired t-tests. (Endometrial 1 n = 4, Renal 1 n = 6, Ovarian 2 and Breast 1 n = 8, Parotid 2 n = 14, all others n = 12), viral titers were only enhanced in the presence of VSVA51 -induced HER2T, which enabled binding of T-DM1 and its subsequent internalization, leading to enhanced VSVA51 output. In the control condition using VSVA51-GFP (FIG. 5C), there was no target for T-DM1 to bind to, and therefore there was no enhancement of VSVA51 output. The tables at the bottom of FIG. 3F shows the viral titers and ratios of mean viral titer of T- DM1 / PBS for samples infected with VSVA51-HER2T or VSVA51-GFP.
[0432] Table 7
[0433] Specimen ID TNM scoring HER2 status Pathology report
[0434] Example 6: VSVA51 -mediated HER2T expression sensitizes solid tumours to T-DM1 (trastuzumab metansine) in murine tumour models in vivo
[0435] In vivo, a disseminated disease model based on intravenous (i.v.) implantation of the 4T1.2 murine mammary carcinoma model and i.v. treatments was used6 10 11, whereby 5 x 1054T1.2 cells were injected i.v. by teil vein injection into wildtype BALB / c mice on DO and then treated on D1 and D2 by i.v. administration of PBS, VSVA51-HER2T, T-DM1 , or VSVA51- HER2+T-DM1. Mice were euthanized on D10 post-implantation, and lungs were extracted, perfused and fixed by formalin instillation, and processed for sectioning and H&E staining for counting of metastatic lung nodules. Lung sections underwent histological evaluation by a pathologist (blinded)6 10 11. Histological assessment of lungs harvested 24 h post-injection of cells revealed presence of micrometastatic lesions (FIGs. 6A-B). More specifically, foci within regions of interest, containing large epithelioid cells with ample eosinophilic cytoplasm, high 147222-000022
[0436] 72 nuclearcytoplasmic ratio, prominent nucleoli, open vesicular chromatin and pleomorphism. These findings confirm the presence of established lung metastases before treatment initiation.
[0437] Implementing this validated model for assessment of the therapeutic strategy proposed herein, a reduction in lung tumour nodules following combination treatment with VSVA51-HER2T and T-DM1 was observed, as shown in the images of lungs in FIG. 3H and quantification of nodules in FIG. 3I, where lungs from BALB / c mice were treated with PBC, T-DM1 , VSVA51- HER2T, and VSVA51-HER2T +T-DM1 and stained with Black India Ink (whereas the tumours do not uptake the dye and remain white).
[0438] The proposed combination approach was further assessed in a disseminated disease model of ovarian high-grade serous carcinoma bearing Tp53 and Pten double knockouts (ID8- PP) (FIGs. 7A-C) and in a subcutaneous MC38 murine colorectal carcinoma tumour model (FIGs. 7D-G). The combination treatment stunted tumour progression and improved overall survival in these ovarian and colorectal carcinoma models. Importantly, the therapeutic regimen was well- tolerated as shown in FIG. 7G, which shows that mouse weight among the control and + immunotherapeutic groups is similar. Together, these findings suggest that VSVA51-HER2T delivers a surface antigen that enables targeting of infected tumour cells by clinically-approved T- DM1 immunotherapeutic. This combination enables utilization of HER2-targeted biologies2 3569in HER2-negative tumours, including clinical tumour specimens.
[0439] Example 7: HER2T-targeted TCEs activate T-cells and can be encoded in oncolytic W
[0440] Having demonstrated compatibility between VSVA51-HER2T and an “off-the-shelf’ therapeutic as a proof-of-concept, using a dual-virus combination strategy was evaluated.
[0441] HER2-targeted T-cell engager (TOE) was engineered as shown in FIG. 8A. The TOE, designed with trastuzumab single-chain variable fragments (scFv) targeting human HER2 (trastuzumab antibody) and either mouse or human CD3E (145-2011 or OKT3, respectively), was validated for secretion and binding to HER2+ cell lines (FIGs. 8B-D and FIGs. 9A-B). Herein, “Ctrl-TCE” designation will refer to the aHER2-TCE bearing the incompatible aCD3s species arm as a negative control in experiments. Notably, the TCE exhibited binding, similar to trastuzumab, on MC38-HER2T cells (FIGs. 8E, F). T-cell stimulatory activity of the aHER2-TCE was confirmed through co-culture experiments, using HER2+ human ovarian cancer cell lines or HER2T+ ID8 murine ovarian cancer cells, with Jurkat cells expressing TdTomato under the control of the CD69 promoter (J69)7(FIG. 8G). The presence of aHER2-TCE led to increased TdTomato signal of J69 cells in co-culture with cells expressing HER2 or HER2T. The aHER2-TCE was further shown to induce target-dependent cytolytic activity by reducing the viability of HER2+ or HER2T+ 4T1.2 target cells in the presence of naive syngeneic splenocytes (FIG. 8H), with no impact on HER2- cells. 147222-000022
[0442] 73
[0443] Next, the TCEs were successfully encoded into vaccinia virus (W), which was rendered oncolytic by J2R deletion (FIG. 8I), and then confirmed that W-aHER2-TCE maintained viral growth kinetics comparable to W-Ctrl-TCE using growth curves and immunoblotting (FIGs. 8J- K). The selection of VSVA51 and W as complementary viral vectors for delivering HER2T and cognate TOE payloads was motivated by their observed feed-forward synergy (FIGs. 10A-E). VSVA51 , susceptible to IFN|3-mediated antiviral effects, showed improved replication and spread when co-infected with W, particularly in the presence of high IFN[3 concentrations (FIGs. 10A- D). The combination also resulted in enhanced VSVA51 replication in VSVA51 -resistant cell lines expressing endogenous IFN|3 (FIGs. 10C-D). The biodistribution of i.t. administered dual viruses in CT26 tumour-bearing BALB / c mice was gauged, where minimal or non-detectable VSVA51 in off-target organs at 48 h post-injection was observed (FIG. 10E). Moreover, an increased in \ / S\ / - / V transcript was observed in tumours where VSVA51 was co-administered with W, suggesting enhanced VSVA51 replication, likely attributable to the synergy between the two viruses. These findings indicated that a low threshold of W infection, as observed in murine cancer cell lines, was sufficient for therapeutic efficacy, supporting the minimal requirement for W tumour infection (FIG. 10D). In summary, it was confirmed the functional engagement of the engineered «HER2- TCE with HER2T and its successful incorporation into W, reinforcing the potential ofthe SVA51- HER2T and W-TCE combination for a feed-forward anti-tumour response.
[0444] Example 8: Treatment of murine HER2T tumour models with W-aHER2-TCE leads to efficacy in vivo
[0445] Efficacy of W-aHER2-TCE was assessed in murine models of HER2T+ cancer, including 4T1.2-HER2T (FIGs. 11A-11F) and CT26-HER2T (FIGs. 11G-11L) s.c. tumour models and i.p. ID8-PP-HER2T tumour model (FIGs. 11M-11N). Treatment of 4T1.2-HER2T tumourbearing mice with W-«HER2-TCE resulted in significant tumour growth stunting (FIG. 11B) and improved overall survival compared to controls (FIG. 11C), with tolerable treatments and stable weights (FIG. 11D). Complete tumour regression was observed in 2 / 5 mice (40%), and rechallenge experiments confirmed tumour rejection (FIGs. 11 E-F). Similar results were observed in the CT26-HER2T model, with safe administration, reduction in tumour progression and enhanced overall survival (FIGs. 11H-11J), and complete tumour rejection upon rechallenge (FIGs. 11K-11L). In the i.p. ID8-PP-HER2T model, W-aHER2-TCE significantly improved overall survival compared to control groups (mOS 50 days vs 28-33 days) (FIGs. 11 M-11N). These findings underscore the therapeutic efficacy afforded by «HER2-TCE in murine tumour models expressing the same HER2T antigen encoded within VSVA51-HER2T, supporting the use of the latter in localized and disseminated tumour models. 147222-000022
[0446] 74
[0447] Example 9: Treatment of murine HER2T tumour models with W-aHER2-TCE leads to T cell activation
[0448] Having demonstrated that the HER2T antigen engages W-encoded «HER2-TCE in vivo, the ability of the virally-encoded TCE to engage and induce T-cell activation was assessed. For this ex vivo approach, MC38-HER2T tumour cores were first obtained by punch biopsy. These tumour cores were incubated with J69 cells alone, or in combination with W-Ctrl-TCE or W- «HER2-TCE. Flow cytometric quantification of J69 signal 48 hpi revealed a significant enhancement in the total frequency and signal intensity of activated J69 cells (FIGs. 12A-C). Having optimized conditions, a similar approach was implemented using wildtype HER2-MC38 tumour cores co-infected with VSVA51-HER2T and W-aHER2-TCE (FIGs. 13A-E). Flow cytometric quantification of J69 cells revealed a robust CD69-TdTomato signal 48 hpi following co-infection with VSVA51-HER2T and W-aHER2-TCE compared to control virus combinations (FIGs. 13B-C). This effect was reproducible in CT26 tumour cores, another HER2-negative murine model (FIGs. 13D-E).
[0449] Similar outcomes were observed in human HER2-low HT-29 colorectal tumour cores from xenografts (FIGs. 13F-G). Quantification of J69 TdTomato signal reveals significant activation following co-infection with VSVA51-HER2T and W-aHER2-TCE compared with all other conditions. These findings demonstrated using HT-29 cores are especially important, as HT-29 cells express low-intermediate levels of HER2 (FIG. 12D). These results therefore suggest this approach is viable in both HER2- tumours to introduce the target antigen, or in HER2-low tumours to increase pre-existing antigen density for improved targeting. Indeed, significant enhancement in J69 activation 48 hpi was induced following co-infection of patient tumour cores with VSVA51-HER2T and W-aHER2-TCE (FIG. 13H; patient clinical characteristics in Table 8) relative to other conditions.
[0450] Table 8: Clinical characteristics of patient-derived tumour specimens.
[0451] Specimen ID TNM scoring HER2 status Pathology report
[0452] Left ovary endometroid adenocarcinoma, negative for surface Ovarian GTC414 pT1. Nx. Mx Unknown involvement Absence of malignancy in omentum, ascitic fluid, and right ovary. G2 moderated ifferentiated P53 normal, MMR proficient
[0453] Basal cell , Previous metastatic melanoma spread to left axillary lymph nodes, carcinomap' Axillary contents collected, 1 / 40 lymph nodes positive for malignancy 147222-000022
[0454] 75
[0455] Example 9: Co-administration of VSVA51-HER2T and W-aHER2-TCE in vivo leads to improved survival in localized models of disease
[0456] After confirming the biological activity of the TCE both in vitro and in vivo, and compatibility with the HER2T antigen, the dual-virus approach was next assessed in multiple HER2-negative in vivo syngeneic tumour models. The response of the combination therapeutic strategy was first assessed in MC38 s.c. tumours (FIG. 14A). Mice were treated with W-aHER2- TCE alone, or a combination of W and VSVA51 with different permutations of transgenes to ensure equivalent total viral dose, of which only the combination ofVSVA51-HER2T+W-aHER2- TCE (mOS 47 days vs 28-32 days) led to a significant impact on tumour progression and overall survival (FIGs. 14B-C). Interestingly, all mice in this combination treatment group exhibited stunted tumour progression, while only 2 / 5 experienced cures. Upon tumour rechallenge, cured mice exhibited complete tumour rejection of MC38-HER2T tumours, but not parental MC38 tumours (FIGs. 14D-E). Treatments were well-tolerated, as suggested by mouse weights.
[0457] Similar responses were observed in BALB / c mice challenged with CT26 s.c. tumours (FIGs. 14F-H), with a similar enhancement in overall survival following treatment with VSVA51- HER2T+W-«HER2-TCE (mOS 43 days) compared to controls. Complete tumour rejection was observed in 2 / 5 mice, both of which rejected the bilateral wildtype CT26 and CT26-HER2T tumour rechallenge (FIGs. 141-J). All treatments were well-tolerated.
[0458] With the previous two models being in situ tumours, BALB / c mice bearing metastatic 4T1.2 s.c. tumours were next treated (FIGs. 14K-M). 5 / 5 mice treated with VSVA51-HER2T+W- «HER2-TCE exhibited significant stunting in tumour progression, which led to a significant enhancement in overall survival compared to controls (mOS 57 days vs 32-39 days), and all treatments were well-tolerated.
[0459] To evaluate the extent of tumour control exerted by the dual-virus combination, a singleshot approach was implemented for subsequent immunological studies and disseminated disease models. A co-formulated dose containing both OVs was optimized, and it was verified that this co-formulation yields similar efficacy to the original sequential treatment regimen (FIGs. 15A-D). This co-formulation enables a more rapid treatment administration within a shorter timeframe to allow the assessment of intratumoral immune responses at early timepoints. It was also demonstrated that switching the order of the OVs in the sequential regimen does not significantly impact efficacy (FIG. 15C).
[0460] The extent of viral infection within injected tumours following a single co-formulated injection was next examined to validate successful tumour infection (FIGs. 16A-E). BALB / c bearing CT26 tumours were injected intratumorally as indicated (FIG. 16A). Tumours were harvested at 24 or 48 hpi then dissociated and interrogated by flow cytometry for the quantification of virus-infected tumour cells (FIGs. 16B-E). Approximately 2% of tumour cells were infected by 147222-000022
[0461] 76
[0462] VSVA51-HER2T, increasing to ~4% when co-injected with W, at both 24 and 48 hpi (FIGs. 16B- C). W infected 0.1-1% of tumour cells, increasingly modestly when co-injected with VSVA51- HER2T (FIGs. 16D-E). A reduced proportion of VS A51-HER2T + W-aHER2-TCE co-infected cells were also observed, compared to VSVA51-HER2T + W-Ctrl-TCE. Examination of tumours by IHC confirms presence of VSVA51-HER2T and W, with a notable enhancement in VSVA51- HER2T spread in tumours injected with VSVA51-HER2T + W. Quantification of the total VSVA51 -positive area in all tumours confirms a significant enhancement of VSVA51-HER2T staining when combined with W in vivo (FIG. 16F).
[0463] To assess immediate virus-induced oncolysis following treatment as indicated (FIG. 16A), tumours were examined 48 hpi by immunohistochemical evaluation to determine levels of two markers of cell death: cleaved caspase-3 and 1. Here, the analysis was focused on regions of interest (ROI) exhibiting robust positive staining for SVA51-HER2T and W to determine the percentage of cells staining positive for cell death markers. Examination of these ROI as indicated reveal increased percentage of cleaved caspase-3 positive cells (FIG. 17A) and cleaved caspase- 1 positive cells (FIG. 17B) in tumours injected with VSVA51-HER2T + W-aHER2-TCE, compared with control groups.
[0464] This data taken together confirm that viral infection following injection is successful and detectable until at least 48 hpi. Highly infected intratumoral foci exhibited elevated proportions cells staining positive for cell death markers. The total proportion of the tumour infected by either VSVA51-HER2T or W-aHER2-TCE was estimated to be approximately 1-4%, as confirmed by both flow cytometry and IHC. This minor infection rate suggests that the overall efficacy of the dual-virus injection that was previously observed likely involves the triggering of a significant antitumour immune response. Therefore, the next series of experiments aimed at characterizing the early and late anti-tumour immune responses.
[0465] Example 10: Treatment of tumour-bearing mice with W-aHER2-TCE and VSVA51-HER2T enhances tumour-infiltrating lymphocyte activation and migration in the tumour
[0466] Having established efficacy of the single-shot, dual-virus approach in multiple tumour models, the early immune mechanisms by which the viral payloads operate was next assessed. Dual-virus treatment of subcutaneous CT26 tumours with W-aHER2-TCE+VSVA51-HER2T resulted in increased IFNy+ and TNF«+ tumour-infiltrating lymphocyte (TIL) populations (FIGs. 18A-D) at 72 hpi, consistent with TCE-mediated T-cell activation12 13. These TILs include CD4+, CD8+, and invariant TCRytf CD3+ T-cells, all of which exhibited reactivity against irradiated CT26 tumour cells and irradiated HER2+ JIMT1 cells14, with elevated baseline (PBS) activity (FIGs. 18B-D).
[0467] Profiling of T-cell and NK responses at day 5 post-treatment revealed a distinct shift in the clustering patterns of these lymphocytes following treatment with W-«HER2-TCE +VSVA51- 147222-000022
[0468] 77
[0469] HER2T (FIGs. 18E-G and 19A-F). Interrogation of the optimized t-distributed stochastic neighbor embedding (opt-SNE)15plots revealed hot-spots of migratory CXCR3+ lymphocytes following combination treatment, absent in control groups. Indeed, W-aHER2-TCE+VSVA51-HER2T treatment upregulated migratory marker CXCR3 in CD3+ TILs (FIG. 18E), including CD4+, CD8+, TCRytf T-cells and NK cells (FIGs. 19A-D). A trend towards reduced CD3E expression was also observed (FIG. 19E), suggestive of early T-cell activation associated with TCEs12 13. Exhausted T-cell phenotypes (PD1+LAG3+) were also reduced following combination treatment, along with immune-suppressive CTLA4+ Tregpopulations and PD-L1+ macrophages (FIGs. 18F-G and 19F). These results indicate an enhanced migratory potential of TILs and reduced immune suppression in the tumour microenvironment immediately following intratumoral injection of VSVA51-HER2T and W-«HER2-TCE. These results highlight the early signs of mechanistic synergy of the viral payloads in mediating efficacy.
[0470] The systemic immune responses following therapy, including directly anti-tumour immune responses as well as anti-viral and anti-HER2T immune responses, was next assessed. Following intratumoral injection of BALB / c mice bearing s.c. CT26 tumours as indicated (FIG. 18H), serum was isolated from peripheral blood at D7 and D14 post-treatment and spleens were harvested at D14 post-treatment.
[0471] Splenocytes isolated at D14 were assessed for antigen reactivity by ELISpot (FIGs. 181- M) and by intracellular cytokine staining (ICS) (FIGs. 20A-G). Splenocytes isolated from mice that received VSVA51-HER2T and W-aHER2-TCE treatment exhibited significantly increased reactivity against a specific CT26-derived tumour antigen (gp70, FIG. 181) or tumour cells (irrCT26, FIG. 18J), compared with control groups. This same treatment group also exhibited significant reactivity against HER2+ JIMT1 cells, indicative of reactivity against the exogenous HER2T antigen (FIG. 18K). Anti-viral responses against VSVA51 or W were only detectable in groups receiving the viral injection (FIGs. 18L-M). However, anti-VSV reactivity was significantly higher in the mice receiving dual-virus injections compared to mice receiving VSVA51-HER2T alone, likely a result of the elevated intratumoral VSVA51-HER2T replication and spread due to the presence of W (FIG. 18L). It was further note than anti-gp70 and anti-JIMT1 reactivity was, on average, greater in the VSVA51-HER2T + W-«HER2-TCE treatment group compared to antiviral responses (FIGs. 181 and 18K-M). Similar reactivity trends were observed by ICS when evaluating the level of IFNy+ CD8+ T-cells following stimulation (FIGs. 20A-G).
[0472] The presence of humoral anti-tumour or anti-HER2T responses at D7 and D14 posttreatment was assessed. Elevated levels of CT26-reactive serum IgG was observed at D7 and D14 post-treatment in mice that received VSVA51-HER2T and W-aHER2-TCE injections; CT26- reactive IgG reached levels significantly greater than those detectable in control groups by D14 (FIGs. 21A-C). Similar evaluation of HER2-reactive IgG revealed a significant elevation in the serum of mice treated with VSVA51-HER2T and W-aHER2-TCE at D7 post-treatment compared 147222-000022
[0473] 78 to all control groups (FIG. 21 D). Modest elevations at this timepoint were also detected in the control groups receiving VSVA51-HER2T compared to PBS. By D14 post-treatment all HER2- reactive IgG reached comparable levels (FIGs. 21E-F).
[0474] Taken together, these data indicate that intratumoral VSVA51-HER2T+W-aHER2-TCE injections induce early activation and migration of immune subsets into tumours within 3-5 days post-treatment. Evaluation of systemic immune responses at a late timepoint, D14 post-treatment, revealed robust anti-tumour immune cellular and humoral responses. Anti-viral responses were also observed at D14, including those reactive against the VSVA51 -delivered HER2T.
[0475] Example 11: Co-administration of VSVA51-HER2T and W-aHER2-TCE in vivo leads to improved survival and reduced metastases in disseminated models of disease
[0476] Having validated the presence of robust systemic anti-tumour immune responses following intratumoral injections, it was postulated that these same systemic immune responses can confer therapeutic benefit in disseminated disease models. To address this hypothesis, BALB / c mice bearing the 4T1.2 lung metastases model were treated (FIGs. 22A-C). No impact was observed following treatment with W alone, relative to PBS control. Treatment with VSVA51- HER2T led to a ~50% reduction in nodule count relative to PBS or W alone, irrespective of the TOE payload. Treatment with control combinations of VSVA51+W led to a significant ~70% reduction in nodules relative to PBS control, or a ~60% reduction compared to VSVA51-HER2T alone, underscoring the existing synergy between the two viruses and the rationale for combining W and VSVA51. Treatment with VSVA51-HER2T+W-aHER2-TCE led to a significant 93% reduction in nodule count relative to PBS control, and an 85% reduction relative to VSVA51- HER2T alone.
[0477] The lung metastasis model demonstrated efficacy of the strategy in early-stage disseminated disease, but it does not capture the true progression of metastasis over time. The therapeutic benefit of the VSVA51-HER2T+W-aHER2-TCE combination strategy in a post- surgical B16-F10 metastasis model was evaluated. Briefly, C57BL / 6 mice were implanted orthotopically with B16-F10 metastatic melanoma tumours. Tumours were surgically excised at 10 days post-implantation upon reaching ~250 mm3. Treatments were administered intravenously as indicated (FIG. 23A) 48 h post-surgery. Mice were monitored up to day 35 post-surgery, upon which the recurrence of the primary tumour was noted, and mice were dissected to determine the occurrence of metastases within spleens and lungs (FIG. 23B). The results demonstrate that post-surgical systemic treatment with VSVA51-HER2T+W-aHER2-TCE completely prevented metastases and the recurrence of primary tumours in all mice, whereas none of the control treatments led to consistent and significant therapeutic benefit.
[0478] The dual-virus approach was next evaluated in ID8-PP i.p. tumours in C57BL / 6 mice (FIGs. 22D-E). Significant improvement in overall survival was observed following systemic 147222-000022
[0479] 79 treatment with VSVA51-HER2T+W-aHER2-TCE (mOS 41 days), while treatment with control combinations did not significantly impact survival relative to PBS or monotherapy controls. These findings highlight the robust therapeutic efficacy of the dual-virus approach (FIG. 22F), which confers survival advantage in both metastatic and non-metastatic localized primary tumours, or disseminated disease models. As well, the dual-virus approach offers protection from primary tumour recurrence and metastases when administered in the adjuvant setting following surgical excision of the primary tumour. Finally, both localized or systemic administration of VSVA51- HER2T+W-«HER2-TCE demonstrated efficacy, across colorectal, ovarian, and breast, and melanoma preclinical cancer models.
[0480] Example 12: Co-administration of VSVA51-HER2T and W-aHER2-TCE in combination with TIL-ACT and IL2 in vivo exhibits improved efficacy compared to monotherapy
[0481] To show that the co-administration of VSVA51-HER2T in combination with the W- «HER2-TCE may be used in conjunction with TIL therapy to improve efficacy, 6-8 week old female C57BL / 6 mice were implanted with subcutaneous MC38 cells at a seeding density of 3x105cells, using a 1 :1 volume of cell suspension to Matrigel™ basement membrane. Mice received 150 mg / kg i.p. cyclophosphamide (CTX) preconditioning for non-myeloablative lymphodepletion 24 hours prior to treatments (Day -1). TILs were administered 24 hours following CTX lymphodepletion, at a single intravenous (i.v.) dose of ~5 x106TILs / mouse in 200 pl of PBS. Mice were then treated as indicated when tumour volumes reached an average of 62.5-100 mm3. Dualvirus intratumoral (i.t.) injections were administered on DO and D3, with a VSVA51-HER2T dose of 1 x108PFU and a VacV (TianTan)-anti-HER2-TCE dose of 1x107PFU, in a total of 50 pl. 50,000 U of IL-2 was administered 4 hours after TIL-ACT, and every 12-16 hours after that at 30,000 U / dose, in 100 pl of PBS intraperitoneally (i.p.), for a total dose of 200,000 U / mouse (6 total injections). Tumour volumes were measured regularly using digital calipers, and mouse wellness and survival were monitored.
[0482] FIGs. 26A-B show that the dual-virus + TIL therapy has reduced tumor sizes and increased survival relative to controls. FIG. 26A shows tumour volumes at days -1 , 7 and 13 (pre- and post-treatment) plotted on a bar graph for four groups. P-values are generated through two- way ANOVA, with Tukey’s correction for multiple comparisons. FIG. 26B shows a survival curve graph showing the highest survival in animals treated with the dual-virus + TIL ACT. P-values indicated are generated through the Kaplan-Meier method followed by log-rank test.
[0483] Example 13: Unconjugated and Conjugated MMAE enhances VSVA51 spread and cancer cell killing
[0484] Monomethyl auristatin E (MMAE, or vedotin) is a cytotoxic compound (microtubule disrupting agent) which is a payload on 7 out of the 16 approved ADCs in Table 1 above. 147222-000022
[0485] 80
[0486] Colchicine is another microtubule disrupting agent, which is similar to the payload in Kadcyla® (emtansine). It has been shown that experimental results of unconjugated colchicine were directly translatable to the ADC Kadcyla®. As such, unconjugated MMAE and colchicine were investigated to examine the effect on VSV replication and spread, and killing of cancer cells, as shown in FIGs. 27A-B. 786-0 cells were seeded in 96-well plates, then treated with MMAE (FIG. 27A) or colchicine (FIG. 27B) (or DMSO as vehicle control) for 4 hours at the indicated concentrations. Cells were then infected with VSVA51-GFP at an MOI of 0.1. Control uninfected cells were treated with drug but not infected. 24 hours post-infection, cells were imaged to capture GFP foci as a measure of virus infection and spread. 48 hours post-infection resazurin was added to the wells to quantify metabolic activity of the cells as a measure of cellular viability. The dotted line along the X-axis represents baseline GFP foci counts of untreated cells. FIGs. 27A-B show that low doses of MMAE (left panel) and colchicine (left panel) significantly enhances VSV replication and spread and killing of cancer cells. MMAE appears to have a more potent effect than colchicine.
[0487] In FIG. 27C, 4T1.2 cells were seeded in 6-well plates. Cells were treated with DMSO (untreated) or 0.5 pM MMAE for 3 hours. Wells were then infected with VSVA51-GFP at an MOI of 0.0001 and incubated for 1 hour at 37°C. Wells were then washed, and a 0.5% agarose-DMEM plug was overlaid, and cells were incubated for 48 hours. Wells were fixed and stained with Coomassie blue to capture cell killing and virus spread. FIG. 27C shows increased cell killing and virus spread in the MMAE-treated plates.
[0488] These findings with MMAE suggest that if the unconjugated MMAE can enhance VSV, then conjugated MMAE in any ADC can also synergize with VSV in a targeted fashion. As such, similarly to how Kadcyla® synergizes with VSV-HER2T in HER2-negative cancer, it is hypothesized that any MMAE-armed ADC is amenable to the same effect with VSV-HER2T. In line with this hypothesis, the results presented in FIG. 28 show that conjugated MMAE (Enfortumab vedotin-ejfv; Padcev®) enhances VSVA51 replication and spread in human Nectin- 4-positive cancer cells.
[0489] Example 14: Conjugated or unconjugated exatecan enhance VSVA51 spread and cancer cell killing
[0490] To explore a different class of drugs and ADCs, deruxtecan, a topoisomerase inhibitor, and its ADC Enhertu® (trastuzumab deruxtecan) were examined. 786-0 cells were seeded in 96- well plates, then treated with exatecanmesylate (or DMSO as vehicle control) at the indicated concentrations in FIG. 29A. Cells were then immediately infected with VSVA51-GFP at an MOI of 0.1. Control uninfected cells were treated with drug but not infected. 24 hours post-infection, cells were imaged to capture GFP foci as a measure of virus infection and spread. 48 hours postinfection resazurin was added to the wells to quantify metabolic activity of the cells as a measure 147222-000022
[0491] 81 of cellular viability. Similar to the results reported in Example 13, exatecan enhances VSV replication and spread and killing of cancer cells.
[0492] In FIG. 29A, JIMT1 cells were seeded in 6-well plates. Cells were treated with PBS (untreated) or 50 pg / ml of trastuzumab deruxtecan (Enhertu®) 30 minutes. Wells were then infected with VSVA51-GFP at an MOI of 0.0001 and incubated for 2 hours at 37°C. Wells were then washed and a 0.5% agarose-DMEM plug was overlaid, and cells were incubated for 48 hours. Wells were imaged for GFP to capture virus infection and spread, then fixed and stained with Coomassie blue to capture cell killing and virus spread. FIG. 29A shows Coomassie blue stained plates and fluorescence-imaging demonstrating increased cell killing and virus spread in the Enhertu®-treated plates.
[0493] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.
[0494] REFERENCES
[0495] 1. Finck, A., Gill, S. I. & June, C. H. Cancer immunotherapy comes of age and looks for maturity. Nature Communications vol. 11 Article number: 3325 (2020).
[0496] 2. Arulanandam, R. etal. The strategic combination of trastuzumab emtansine with oncolytic rhabdoviruses leads to therapeutic synergy. Commun Biol 3, (2020).
[0497] 3. von Minckwitz, G. et al. Trastuzumab Emtansine for Residual Invasive HER2-Positive Breast Cancer. New England Journal of Medicine 380, 617-628 (2019).
[0498] 4. Cortes, J. et al. Trastuzumab Deruxtecan versus Trastuzumab Emtansine for Breast Cancer. New England Journal of Medicine 386, 1143-1154 (2022).
[0499] 5. Swain, S. M., Shastry, M. & Hamilton, E. Targeting HER2-positive breast cancer: advances and future directions. Nature Reviews Drug Discovery vol. 22 101-126 Preprint at https: / / doi.Org / 10.1038 / S41573-022-00579-0 (2023) .
[0500] 6. Taha, Z. et al. Syngeneic mouse model of human HER2+ metastatic breast cancer for the evaluation of trastuzumab emtansine combined with oncolytic rhabdovirus. Front Immunol 14, 1181014 (2023).
[0501] 7. Crupi, M. J. F. et al. Oncolytic virus driven T-cell-based combination immunotherapy platform for colorectal cancer. Front Immunol 13, (2022).
[0502] 8. Le Boeuf, F. et al. Synergistic interaction between oncolytic viruses augments tumor killing. Molecular Therapy 18, 888-895 (2010). 147222-000022
[0503] 82
[0504] 9. Arulanandam, R. et al. Microtubule disruption synergizes with oncolytic virotherapy by inhibiting interferon translation and potentiating bystander killing. Nat Commun 6, (2015).
[0505] 10. Lucke, J. et al. Protocol for generating lung and liver metastasis in mice using models that bypass intravasation. STAR Protoc 5, (2024).
[0506] 11 . Rashid O et al. Is tail vein injection a relevant breast cancer lung metastasis model? J Thorac Dis 5, 385-392 (2013).
[0507] 12. Li, G. etal. CD3 engagement as a new strategy for allogeneic “off-the-shelf’ T cell therapy. Mol Ther Oncolytics 24, 887-896 (2022).
[0508] 13. Morita, M., Mizui, M., Masuyama, S., Tsokos, G. C. & Isaka, Y. Reduction of Cell Surface T-Cell Receptor by Non-Mitogenic CD3 Antibody to Mitigate Murine Lupus. Front Immunol 13, (2022).
[0509] 14. Reits, E. A. et al. Radiation modulates the peptide repertoire, enhances MHC class I expression, and induces successful antitumor immunotherapy. Journal of Experimental Medicine 203, 1259-1271 (2006).
[0510] 15. Belkina, A. C. et al. Automated optimized parameters forT-distributed stochastic neighbor embedding improve visualization and analysis of large datasets. Nat Commun 10, (2019).
[0511] 16. Mateo, J. et al. Delivering precision oncology to patients with cancer. Nat Med 28, 658- 665 (2022).
[0512] 17. Choi, B. D. et al. CAR-T cells secreting BiTEs circumvent antigen escape without detectable toxicity. Nat Biotechnol 37 , 1049-1058 (2019).
[0513] 18. Aalipour, A. et al. Viral Delivery of CAR Targets to Solid Tumors Enables Effective Cell Therapy. Mol Ther Oncolytics 17, 232-240 (2020).
[0514] 19. Park, A. K. et al. Effective combination immunotherapy using oncolytic viruses to deliver CAR targets to solid tumors. Sci Transl Med 12, (2020).
[0515] 20. Liu, Y. et al. Oncolytic herpes simplex virus delivery of dual CAR targets of CD19 and BCMA as well as immunomodulators to enhance therapeutic efficacy in solid tumors combined with CAR T cell therapy. Front Oncol 12, (2022).
[0516] 21. Zhang, A. Q. et al. Universal redirection of CAR T cells against solid tumours via membrane-inserted ligands for the CAR. Nat Biomed Eng (2023) doi: 10.1038 / S41551 -023-01048- 8.
[0517] 22. Heinrich, M. et al. Suicide risk and mortality among patients with cancer. Nat Med 28, 852-859 (2022).
[0518] 23. Hurvitz, S. A. et al. Trastuzumab deruxtecan versus trastuzumab emtansine in patients with HER2-positive metastatic breast cancer: updated results from DESTINY-BreastO3, a randomised, open-label, phase 3 trial. The Lancet 401 , 105-117 (2023).
[0519] 24. Li, B. T. et al. Trastuzumab Deruxtecan in HER2 -Mutant Non-Small-Cell Lung Cancer . New England Journal of Medicine 386, 241-251 (2022). 147222-000022
[0520] 83
[0521] 25. Modi, S. et al. Trastuzumab Deruxtecan in Previously Treated HER2-Positive Breast Cancer. New England Journal of Medicine 382, 610-621 (2020).
[0522] 26. Gamboa, L. et al. Sensitizing solid tumors to CAR-mediated cytotoxicity using synthetic antigens, preprint at b / oRx / doi:10.21203 / rs.3.rs-1276779 / v1.
[0523] 27. Breitbach, C. J. et al. Oncolytic vaccinia virus disrupts tumor-associated vasculature in humans. Cancer Res 73, (2013).
[0524] 28. Arulanandam, R. et al. VEGF-Mediated Induction of PRD1-BF1 / Blimp1 Expression Sensitizes Tumor Vasculature to Oncolytic Virus Infection. Cancer Cell 28, 210-224 (2015).
[0525] 29. Breitbach, C. J. et al. Targeting tumor vasculature with an oncolytic virus. Mol Ther 19, 886-894 (2011).
[0526] 30. Le Boeuf, F. et al. Model-based rational design of an oncolytic virus with improved therapeutic potential. Nat Commun 4, (2013).
[0527] 31 . Bastin, D. et al. Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference. J Immunother Cancer G, (2018).
[0528] 32. Crupi, M. J. F., Bell, J. C. & Singaravelu, R. Concise Review: Targeting Cancer Stem Cells and Their Supporting Niche Using Oncolytic Viruses. Stem Cells 37, 716-723 (2019).
[0529] 33. Scott, E. M., Duffy, M. R., Freedman, J. D., Fisher, K. D. & Seymour, L. W. Solid Tumor Immunotherapy with T Cell Engager-Armed Oncolytic Viruses. Macromolecular Bioscience vol.
[0530] 18 Preprint at https: / / doi.org / 10.1002 / mabi.201700187 (2018).
[0531] 34. Benonisson, H. et al. CD3-bispecific antibody therapy turns solid tumors into inflammatory sites but does not install protective memory. Mol Cancer Ther 18, 312-322 (2019).
[0532] 35. Ma, J. et al. Characterization of virus-mediated immunogenic cancer cell death and the consequences for oncolytic virus-based immunotherapy of cancer. Cell Death Dis 11, (2020).
[0533] 36. Wang, Y. et al. Inflammasome Activation Triggers Caspase-1-Mediated Cleavage of cGAS to Regulate Responses to DNA Virus Infection. Immunity 46, 393-404 (2017).
[0534] 37. Yu, P. et al. Pyroptosis: mechanisms and diseases. Signal Transduction and Targeted Therapy vol. 6 Preprint at https: / / doi.org / 10.1038 / s41392-021-00507-5 (2021).
[0535] 38. Denes, A., Lopez-Castejon, G. & Brough, D. Caspase-1 : Is IL-1 just the tip of the ICEberg? Cell Death and Disease vol. 3 Preprint at https: / / doi.org / 10.1038 / cddis.2012.86 (2012).
[0536] 39. Ohn, J. et al. SAFE ADMINISTRATION OF THE MEASLES VACCINE TO CHILDREN ALLERGIC TO EGGS. New England Journal of Medicine 332, 1262-1266 (1995).
[0537] 40. Boulton, S. et al. Single-dose replicating poxvirus vector-based RBD vaccine drives robust humoral and T cell immune response against SARS-CoV-2 infection. Molecular Therapy 30, 1885-1896 (2022). 147222-000022
[0538] 84
[0539] 41. Boulton, S. et al. A T Cell-Targeted Multi-Antigen Poxvirus Vector Vaccine Generates Robust Cellular and Humoral Immunity Against SARS-CoV-2 Infection. Mol Ther Methods Clin Dev 101110 (2023) doi:10.1016 / j.omtm.2023.101110.
[0540] 42. Wang, J. et al. An Overview of Antivirals against Monkeypox Virus and Other Orthopoxviruses. J Med Chem 66, 4468-4490 (2023).
[0541] 43. Gong, N. et al. Small-molecule-mediated control of the anti-tumour activity and off-tumour toxicity of a supramolecular bispecific T cell engager. Nat Biomed Eng (2024) doi:10.1038 / s41551 -023-01147-6.
[0542] 44. Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021).
[0543] 45. Ruffolo, J. A., Chu, L.-S., Mahajan, S. P. & Gray, J. J. Fast, accurate antibody structure prediction from deep learning on massive set of natural antibodies. Nat Commun 14, 2389 (2023).
[0544] 46. Davila, A. et al. AbAdapt: an adaptive approach to predicting antibody-antigen complex structures from sequence. Bioinformatics Advances 2, (2022).
[0545] 47. Martin, N. T. et al. Engineering Rapalog-lnducible Genetic Switches Based on Split-T7 Polymerase to Regulate Oncolytic Virus-Driven Production of Tumour-Localized IL-12 for AntiCancer Immunotherapy. Pharmaceuticals 16, (2023).
[0546] 48. Whelan, J. T. et al. CRISPR-mediated rapid arming of poxvirus vectors enables facile generation of the novel immunotherapeutic STINGPOX. Front Immunol 13, (2023).
[0547] 49. Diallo, J. S., Vaha-Koskela, M., Le Boeuf, F. & Bell, J. Propagation, purification, and in vivo testing of oncolytic vesicular stomatitis virus strains, in Methods in Molecular Biology vol. 797 127-140 (Humana Press Inc., 2012).
[0548] 50. Belkina, A. C. et al. Automated optimized parameters for T-distributed stochastic neighbor embedding improve visualization and analysis of large datasets. Nature Communications 2019 10:1 10, 1-12 (2019).
[0549] 51. Alluqmani, N. et al. Vanadyl sulfate-enhanced oncolytic virus immunotherapy mediates the antitumor immune response by upregulating the secretion of pro-inflammatory cytokines and chemokines. Front Immunol 13, 1032356 (2022).
[0550] 52. Boulton, S. et al. A T cell-targeted multi-antigen vaccine generates robust cellular and humoral immunity against SARS-CoV-2 infection. Mol Ther Methods Clin Dev 31 , 101110 (2023).
[0551] 53. Breitbach, C. J. et al. Targeting Tumor Vasculature With an Oncolytic Virus. Molecular Therapy 19, 886 (2011).
[0552] 54. Wedge, M. E. et al. Virally programmed extracellular vesicles sensitize cancer cells to oncolytic virus and small molecule therapy. Nat Commun 13, 1-16 (2022).
[0553] 55. Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. Scientific Reports 2017 7:1 7, 1-7 (2017). 147222-000022
[0554] 85
[0555] 56. Kohn MA & Senyak J. NIH Sample Size Calculator. UCSF CTSI https: / / www. samplesize. net / (Accessed 03 April 2024) (2024).
[0556] 57. Rivera A, Fu X, Tao L, Zhang X. Modification of a popular syngeneic murine mammary tumor model for immunotherapy studies. ISRIM Immunol (2011) 2011 :1-8. doi: 10.5402 / 2011 / 238379.
[0557] 58. Danishmalik SN, Lee S-H, Sin J-l, Nilofar Danishmalik S, Lee S-H, Sin J-l. Tumor regression is mediated via the induction of HER2 63-71 - specific CD8+ CTL activity in a 4T1.2 / HER2 tumor model: no involvement of CD80 in tumor control. Oncotarget (2017) 8:26771- 88. doi: 10.18632 / oncotarget.15816. 59. Xu Y, Rogers C. Temporal changes in immune responses within the tumor microenvironment in the 4T1.2-HER2 mammary tumor model. (2021). doi: 10.21203 / rs.3.rs- 180530 / vl .
[0558] 60. Simona Rolla, Cristina Marchini, Silvia Malinarich, Elena Quaglino, Stefania Lanzardo, Maura Montani, Manuela lezzi, Mauro Angeletti, Giorgio Ramadori, Guido Forni, Federica Cavallo, and Augusto Amici. Protective Immunity Against neu-Positive Carcinomas Elicited by Electroporation of Plasmids Encoding Decreasing Fragments of Rat Neu Extracellular Domain. Human Gene Therapy, Vol. 19, No. 3, 229-240 (2008).
Claims
147222-00002286WHAT IS CLAIMED IS:1 . A combination comprising:(a) a first delivery vehicle for tumor cells comprising a nucleic acid encoding an engineered antigen, wherein the engineered antigen:(i) is localized at the cell surface when expressed;(ii) comprises an extracellular domain of a naturally occurring receptor, or a fragment thereof comprising at least 20 amino acids, or a variant of the extracellular domain or fragment thereof having at least 90% sequence identity with the extracellular domain or fragment thereof;(iii) comprises at least one epitope that is specifically recognized by at least one antibody or antigen-binding fragment thereof; and(iv) lacks a functional intracellular domain; and(b) at least one antibody or antigen-binding fragment thereof that specifically recognizes the at least one epitope.
2. The combination of claim 1 , wherein the delivery vehicle comprises a vesicle, a nanoparticle, an oncolytic bacterium, or a viral vector.
3. The combination of claim 2, wherein the delivery vehicle comprises a viral vector, such as an oncolytic virus.
4. The combination of claim 3, wherein the oncolytic virus is an oncolytic RNA virus5. The combination of claim 4, wherein the oncolytic RNA virus is an oncolytic rhabdovirus.
6. The combination of claim 5, wherein the oncolytic rhabdovirus is a Maraba virus (MG1) or a vesicular stomatitis virus (VSV) or an arenavirus.
7. The combination of claim 6, wherein the VSV comprises a mutation in the VSV M protein.
8. The combination of claim 7, wherein the VSV is VSVA51.
9. The combination of any one of claims 1 to 8, wherein the engineered antigen has an immunogenicity in humans that is lower than that of the naturally occurring receptor.
10. The combination of any one of claims 1 to 9, wherein the engineered antigen comprises a fragment of the naturally occurring receptor, or a variant thereof having at least 90% sequence identity with said fragment.
11. The combination of claim 10, wherein the fragment of the naturally occurring receptor comprises at least 50 amino acids.
12. The combination of claim 11 , wherein the fragment of the naturally occurring receptor comprises at least 100 amino acids.147222-0000228713. The combination of any one of claims 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is conjugated to an antitumor agent.
14. The combination of claim 13, wherein the antitumor agent is a chemotherapeutic agent.
15. The combination of any one of claims 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is comprised within a chimeric antigen receptor (CAR).
16. The combination of claim 15, wherein the antigen-binding fragment is a single-chain variable fragment (scFv) or a single domain antibody.
17. The combination of claim 15 or 16, wherein the at least one antibody or antigen-binding fragment thereof is expressed at the surface of an immune cell.
18. The combination of claim 17, wherein the immune cell is a T lymphocyte or a natural killer (NK) cell.
19. The combination of any one of claims 1 to 12, wherein the at least one antibody or antigenbinding fragment thereof is a bispecific antibody or an antigen-binding fragment thereof.
20. The combination of claim 19, wherein the bispecific antibody comprises a first binding domain that specifically recognizes the at least one epitope and a second binding domain that specifically binds to a protein involved in immune cell activation.
21. The combination of claim 20, wherein the protein involved in immune cell activation is CD3, CD8 or CD16.
22. The combination of any one of claims 1 to 21 , wherein the engineered antigen comprises the extracellular domain of human Epidermal Growth Factor Receptor-2 (HER2), Epithelial Growth Factor Receptor (EGFR), CD33, CD30, CD22, CD79b, Nectin-4, Trop-2, CD19, Tissue Factor (TF), Folate Receptor alpha (FRa), c-MET, B-cell maturation antigen (BCMA), GPCR5D, or DLL3, or a fragment thereof, or a variant of the extracellular domain or fragment thereof.
23. The combination of claim 22, wherein the engineered antigen comprises the extracellular domain of human HER2, or a fragment thereof, ora variant of the extracellular domain or fragment thereof.
24. The combination of claim 23, wherein the engineered antigen lacks the intracellular kinase domain of native human HER2.
25. The combination of claim 23 or 24, wherein the engineered antigen lacks partially or completely extracellular domain I of native human HER2.
26. The combination of claim 25, wherein the engineered antigen lacks partially or completely extracellular domains I, II and / or III of native human HER2.147222-0000228827. The combination of claim 25 or 26, wherein the engineered antigen comprises a sequence corresponding to amino acids 174 to 720 or 524 to 720 of native human HER2, or a variant thereof having at least 90% identity with said sequence.
28. The combination of claim 23 or 24, wherein the engineered antigen comprises the sequence of SEQ ID NO:2, 3, 11 , or 21 .
29. The combination of any one of claims 22 to 28, wherein the at least one antibody or antigen-binding fragment thereof is trastuzumab or antigen-binding fragment thereof, and / or pertuzumab or antigen-binding fragment thereof, or an antibody or antigen-binding fragment thereof that competes with trastuzumab or pertuzumab for binding to human HER2.
30. The combination of any one of claims 1 to 29, wherein the engineered antigen comprises at least two different epitopes that are specifically recognized by at least two different antibodies or antigen-binding fragments thereof.31 . The combination of claim 30, wherein the at least two different epitopes are from the same protein.
32. The combination of claim 31 , wherein the at least two different epitopes are from different proteins.
33. The combination of any one of claims 1 to 32, wherein the at least one antibody or antigenbinding fragment thereof is comprised in a second delivery vehicle for tumor cells.
34. The combination of claim 33, wherein the second delivery vehicle comprises a viral vector that comprises a nucleic acid encoding the at least one antibody or antigen-binding fragment thereof.
35. The combination of claim 34, wherein the second delivery vehicle is a second oncolytic virus.
36. The combination of claim 35, wherein the second oncolytic virus is a vaccinia virus (W), such as an attenuated W.
37. The combination of claim 36, wherein the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene.
38. The combination of claim 36 or 37, wherein the W encodes an interferon-binding decoy receptor, such as B8R and / or B18R / B19R.
39. The combination of claim 38, wherein the W is of the Tian Tian, Copenhagen, or Western Reserve, Lister, Wyeth or MVA strain.
40. A combination comprising:147222-00002289(a) a first oncolytic virus comprising a nucleic acid encoding a cell surface receptor;(b) a second oncolytic virus comprising a nucleic acid encoding an antibody or antigenbinding fragment thereof that specifically binds to an extracellular domain of the cell surface receptor.41 . The combination of claim 40, wherein the first and / or second oncolytic virus is an oncolytic rhabdovirus.
42. The combination of claim 41 , wherein the oncolytic rhabdovirus is a Maraba virus (MG1) or a vesicular stomatitis virus (VSV).
43. The combination of claim 42, wherein the VSV comprises a mutation in the VSV M protein.
44. The combination of claim 43, wherein the VSV is VSVA51 .
45. The combination of any one of claims 40 to 44, wherein the first and / or second oncolytic virus is an oncolytic poxvirus.
46. The combination of claim 45, wherein the oncolytic poxvirus is a vaccinia virus (W), such as an attenuated W.
47. The combination of claim 46, wherein the attenuated W comprises a mutation or deletion of the thymidine kinase (TK) gene.
48. The combination of claim 46 or 47, wherein the W is of the Tian Tan, Copenhagen, or Western Reserve strain.
49. The combination of any one of claims 40 to 48, wherein the first and / or second oncolytic virus encodes an interferon-binding decoy receptor, such as B8R and / or B18R / B19R.
50. The combination of any one of claims 40 to 49, wherein the cell surface receptor is the engineered antigen defined in any one of claims 1 to 39.51 . The combination of any one of claims 40 to 50, wherein the antibody or antigen-binding fragment thereof is as defined in any one of claims 1 to 39.
52. A method for treating cancer in a subject in need thereof, the method comprising administering to the subject an effective amount of the combination of any one of claims 1 to 51 .
53. The method of claim 52, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
54. The method of claim 52 or 53, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer, melanoma, or parotid cancer.
55. The method of any one of claims 52 to 54, wherein the subject is treated with an additional antitumor therapy.147222-0000229056. The method of claim 55, wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
57. The method of any one of claims 52 to 65, wherein the combination is administered intravenously, intramuscularly, subcutaneously, intratumorally, or any combination thereof.
58. The combination of any one of claims 1 to 51 for use in treating cancer in a subject.
59. The combination for use of claim 58, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
60. The combination for use of claim 58 or 59, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer, melanoma or parotid cancer.
61. The combination for use of any one of claims 58 to 60, wherein the combination is for administration with an additional antitumor therapy.
62. The combination for use of claim 61 , wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
63. The combination for use of any one of claims 58 to 62, wherein the combination is for administration by the intravenous, intramuscular, subcutaneous, or intratumoral route, or any combination thereof.
64. Use of the combination of any one of claims 1 to 51 for the manufacture of a medicament for treating cancer in a subject.
65. The use of claim 64, wherein the cancer is resistant to chemotherapies and / or immunotherapies.
66. The use of claim 64 or 65, wherein the cancer is lung cancer, colorectal cancer, endometrial cancer, ovarian cancer, renal cancer, breast cancer or parotid cancer.147222-0000229167. The use of any one of claims 64 to 66, wherein the combination is for administration with an additional antitumor therapy.
68. The use of claim 67, wherein the additional antitumor therapy comprises an alkylating agent, a platinum agent, a taxane, a vinca agent, an anti-estrogen drug, an aromatase inhibitor, an ovarian suppression agent, a VEGF / VEGFR inhibitor, an EGF / EGFR inhibitor, a PARP inhibitor, a cytostatic alkaloid, a cytotoxic antibiotic, an antimetabolites, an endocrine / hormonal agent, a bisphosphonate therapy agent, an immune checkpoint inhibitor, a chimeric antigen receptor (CAR) cell, tumor infiltrating lymphocytes (TILs), or any combination thereof.
69. The use of any one of claims 64 to 68, wherein the medicament is for administration by the intravenous, intramuscular, subcutaneous, or intratumoral route, or any combination thereof.
70. A method for increasing the susceptibility of a tumor to an immunotherapy comprising an antibody or an antigen-binding fragment thereof in a human subject, the method comprising administering to the subject an effective amount of the first delivery vehicle defined in any one of claims 1 to 39.
71. The first delivery vehicle defined in any one of claims 1 to 39 for increasing the susceptibility of a tumor to an immunotherapy.
72. Use of the first delivery vehicle defined in any one of claims 1 to 39 for the manufacture of a medicament for increasing the susceptibility of a tumor to an immunotherapy.