TCR-Anti-CD3 antibody fusion molecule for the treatment of HIV infection

A heterodimeric TCR-anti-CD3 antibody fusion molecule dosing regimen targets HIV reservoirs, providing effective HIV control in patients with ART experience by reducing viral load and minimizing adverse events.

WO2026033067A1PCT designated stage Publication Date: 2026-02-12IMMUNOCORE LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/072739
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-07
Filing Date
2025-08-07
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Current antiretroviral therapies (ART) are unable to eliminate HIV genomes, leading to persistent viral reservoirs in CD4+ T cells, necessitating lifelong administration and are limited by drug resistance and adherence issues, while immunotherapeutic approaches have been refractory due to low antigen expression and viral mutational escape.

Method used

A heterodimeric TCR-anti-CD3 antibody fusion molecule is administered in a specific dosing regimen, including a maintenance dose of at least 40 μg, with optional escalating doses to minimize cross-reactivity and adverse events, targeting the SLYNTVATL-HLA-02 complex to reduce HIV reservoirs.

Benefits of technology

The dosing regimen effectively reduces HIV viral load to a level where further intervention may not be required, demonstrating strong tolerability and efficacy in patients with ART experience, achieving sustained control of HIV without ART.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000043_0000
    Figure 00000043_0000
  • Figure 00000043_0001
    Figure 00000043_0001
  • Figure 00000044_0000
    Figure 00000044_0000
Patent Text Reader

Abstract

The present invention relates to treating human immunodeficiency virus (HIV) infection in a subject. The subject may be administered a composition comprising a heterodimeric TCR-anti-CD3 antibody fusion molecule in a maintenance dose comprising at least 40 µg of the TCR-anti-CD3 antibody fusion molecule.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHOD

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to treating human immunodeficiency virus (HIV) infection in a subject. The subject may be administered a composition comprising a heterodimeric TCR-anti-CD3 antibody fusion molecule, at a maintenance dose. Prior to the maintenance dose, the subject may also be administered a first and second dose. The second dose may comprise a larger amount of the TCR-anti-CD3 antibody fusion molecule than the first dose, and / or the maintenance dose may comprise a larger amount of the TCR-anti-CD3 antibody fusion molecule than the second dose.

[0004] BACKGROUND

[0005] The first cases of acquired immunodeficiency syndrome (AIDS) were described 40 years ago. The causative agent, HIV-1 (referred to as HIV throughout this document), is estimated to have infected nearly 76 million people, of whom 38 million are living with the virus today. The arrival of effective antiretroviral therapy (ART) regimens and optimization of their use has transformed what was once a fatal infection into a manageable chronic condition. Initiation of ART before significant CD4+ cell loss has occurred confers a normal lifespan, with greatly reduced risk of HIV-related complications. Furthermore, virological suppression under ART interrupts onward transmission. However, these benefits are sustained only with consistent and lifelong adherence to ART. In addition, long-term toxicities, drug-drug interactions and emergence of antiretroviral drug-resistant viruses can limit the effectiveness of existing drug regimens. Lastly, stigmatization as a result of HIV-positive status is detrimental to the mental and physical health and economic prospects of people living with HIV (PLWH).

[0006] There are currently 65 main classes of approved antiretroviral agents, each targeting a different stage of the virus life cycle. These drugs act in concert to prevent the production of infectious virus but are incapable of eliminating HIV genomes, since the virus is able to integrate into host deoxyribonucleic acid (DNA) in CD4+ memory T cells and monocytic cells and persist in a stable form (provirus) that may be transcriptionally silent. If ART is interrupted, a small fraction of proviruses may reactivate and cause virological relapse. Cells harbouring these inducible proviruses have a long lifespan and thus constitute a reservoir that presents a significant barrier to a cure.

[0007] The majority of PLWH mount a vigorous immune response against the virus within the first few weeks of infection. CD8+ T cells in particular play a crucial role in curtailing acute viremia. However, they are unable to exert complete control in most cases and no one has successfully spontaneously cleared the virus. In the absence of ART, viral escape mutants arise as a result of immune selective pressure and, in turn, chronic viremia drives T cell exhaustion. However, approximately 1 in 300 PLWH show exceptional control of HIV, indicated by maintenance of a low or undetectable plasma viral load without ART for more than a decade. Selected HLA class I alleles are over-represented in these "HIV controllers” and likely drive CD8+ T cell responses that effectively restrict viral replication and reservoir formation. Spontaneous HIV control is thus an important model of functional cure that lends support for the development of immunotherapeutic agents as a component of cure strategies.

[0008] ART is effective in suppressing HIV replication but is incapable of eliminating the virus because it is able to integrate permanently into host chromosomes, resulting in the formation of a cellular reservoir within the first few days of infection. Replication-competent viral genomes may persist in long-lived CD4+ T cells and re-fuel virus production if ART is interrupted, necessitating lifelong administration of ART to prevent relapse. Finite interventions that can eradicate viral reservoirs or reduce them to low enough levels to enable long-term drug-free control (“functional cure”) are therefore highly desirable.

[0009] HIV reservoirs have proven to be refractory to immunotherapeutic approaches to date because of low antigen expression, pre-existing viral mutational escape and sequestration in immune privileged sites. Furthermore, HIV-specific cytolytic T cells (CTLs) exhibit persistent functional deficits even after long-term ART.

[0010] The expansion of access to ART across the world over the past two decades has led to a 60% reduction in HIV-related deaths and a 40% reduction in new infections. Over three quarters of PLWH now have access to ART (UNAIDS 2023). However, the insecurity of drug supplies in many high-burden regions is a major barrier to universal access and to maintenance of lifelong adherence to therapy, which may be required for several decades. A finite treatment that results in sustained control of HIV without the need for ART is highly desirable.

[0011] T-cell receptor (TCR) bispecific proteins targeting the HIV Gag matrix protein p17 and CD3 are disclosed in WO2023 / 156663. Clinical trials designed to evaluate the safety and efficacy of such bispecific proteins represent novel approaches for treating PLWH.

[0012] SUMMARY OF THE INVENTION

[0013] In a first aspect, the present invention provides a heterodimeric TCR-anti-CD3 antibody fusion molecule for use in a method of treating HIV infection in a subject, the method comprising administering to the subject a composition comprising the heterodimeric TCR-anti-CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti-CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and 10 respectively, wherein the method comprises administering: a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule.

[0014] Although dosing regimens for TCR-anti-CD3 antibody fusion molecules are known, they are exclusively in relation to treating cancer. The present invention is the first dosing regimen using such a fusion molecule to treat a viral infection. The teachings relating to treatment of cancer are not relevant to the treatment of viral infections such as HIV, not least because considerations related to drug tolerability and efficacy are distinct for the different patient populations. A high level of drug tolerability is required for the treatment of PLWH. In addition, unlike viral disease targets, cancer targets are typically self-antigens, which therefore present a higher risk of cross reactivity against non-diseased tissues in patients. The inventors have surprisingly found that a dosage regimen comprising a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule is well tolerated and effective at treating PLWH. The present invention also provides an escalating dosage regimen in which efficacious doses are tolerated. Due to the higher maintenance doses contemplated for the TCR-anti-CD3 antibody fusion molecule described herein, it may be desirable to include multiple step-up doses to avoid cross reactivity and / or adverse events. Using multiple step up doses is unique to the dosing regimen disclosed herein, and the use of a first, second and third dose may minimize cross reactivity and adverse events.

[0015] The present invention is particularly useful in patients that have been receiving ART for 12 months or more. This is because it may reduce viral load to a level whereby no further intervention (e.g. ART) is subsequently required to sustain a sub clinical viral load.

[0016] In a second aspect, the present invention provides a method of treating HIV infection in a subject, the method comprising administering to the subject a composition comprising a heterodimeric TCR-anti-CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti-CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and 10 respectively, wherein the method comprises administering: a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule.

[0017] In a further aspect, the present invention provides a kit comprising:

[0018] (i) at least one first container comprising a first dose of a heterodimeric TCR-anti CD3 antibody fusion molecule,

[0019] (ii) at least one second container comprising a second dose of the heterodimeric TCR-anti CD3 antibody fusion molecule,

[0020] (iii) one or more maintenance containers, each maintenance container comprising a maintenance dose of the heterodimeric TCR-anti CD3 antibody fusion molecule, and

[0021] (iv) instructions for administering the heterodimeric TCR-anti CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and 10 respectively

[0022] In a further aspect, the present invention provides a heterodimeric TCR-antibody fusion molecule for use in a method of reducing HIV viral reservoir in a PLWH, wherein the TCR targets the SLYNTVATL-HLA-02 complex.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The following drawings form part of the present specification and are included to further demonstrate exemplary embodiments of certain aspects of the present invention.

[0025] FIG. 1 depicts a schema of the IMC-M113V-103 SAD study (see also Example 1).

[0026] FIG. 2 depicts a schema of the IMC-M113V-103 MAD study (see also Example 1).

[0027] FIG. 3 depicts a schema of the specific step-dose regimens evaluated in various cohorts in the IMC-M113V-103 MAD study. FIG. 4 depicts the pharmacokinetic profile of single doses of IMC-M113V in different cohorts of the SAD study. Serum concentrations of IMC-M113V were measured pre-infusion, at end of infusion and at 2, 4, 8, 12 and 24 hours post-end of infusion. Mean drug concentrations for all dose cohorts (±SD for the 15 mcg dose cohort) are indicated.

[0028] FIG. 5 depicts pharmacodynamic data of IMC-M113V in the IMC-M113V-103 SAD study. A. Serum IL-6 was quantified in samples obtained pre-infusion, 8 and 24 hours and 7 days postinfusion. Each line represents an individual study participant. The lower limit of quantification (2.5 pg / ml) is indicated by dotted line. B. IMC-M113VRESbinding affinity (37 °C) was determined for Gag?7-85 variants identified in pre-dose HIV cell-associated RNA (CA-RNA) extracted from participants’ peripheral blood CD4+ cells (15 mcg cohort). The dominant sequence for each participant is shown. C. Peak serum IL-6 response was plotted against pre-dose HIV CA-RNA value. Participants with pM and nM affinity viral variants are indicated by * and ** respectively.

[0029] FIG. 6 depicts pharmacodynamic data of IMC-M113V in the IMC-M113V-103 MAD study. Data from participants in three different cohorts is shown. Participants were dosed with a 15 / 30 / 60 dosing regimen in cohort 1 , a 20 / 40 / 120 dosing regimen in cohort 2, and a 20 / 40 / 300 dosing regimen in cohort 3, as indicated by the number next to the downward pointing arrow symbol at the top of each graph. Serum IL-6, serum IFN gamma and serum IP-10 were quantified in samples obtained from participants prior to infusion of each different dose amount (pre-infusion), as well as 8 and 24 hours post-infusion of each different dose amount, where these time points are each indicated on the X-axis of each graph. Each line represents an individual study participant in the relevant cohort.

[0030] FIG. 7 depicts plasma viral load measurements in the MAD participants during 12 weeks of analytical treatment interruption (ATI) and the time to ART resumption. Top: Individual viral load measurements (weekly) are shown for cohort 1 (n=5), 2 (n=5), and 3 (n=2) during the 12 weeks of analytical treatment interruption Bottom: Bar graphs showing time to ART resumption following treatment interruption for the individual participants in the three cohorts.

[0031] FIG. 8 depicts quantification of the active HIV-1 reservoir in the MAD participants following treatment with IMC-M113V. Cell associated HIV-1 Gag RNA (CA-RNA) levels were quantified in participants’ peripheral blood CD4+ cells using droplet digital PCR. Pre-dose, week 7 and week 13 timepoints were analysed for the participants except for GB01-2002 (W7 and 13 only), ES02-2011 (pre dose, W3, W7 and W12) and ES03-2003 (Predose, W3, and W6). Individual measurements are shown for cohort 1 (n=5), 2 (n=5), and 3 (n=2). * represents participants with Gag77-85 variants (sequenced in CA-RNA) recognized by IMC-M113V with pM affinity whereas ** represents those with nM affinity. Analysis for BE03-2005 (C3) is pending. ES03-2003 terminated early. DETAILED DESCRIPTION

[0032] Dosage

[0033] The present invention relates to a maintenance dose of a heterodimeric TCR-anti-CD3 antibody fusion molecule of at least 20 pg . The maintenance dose may be in the range of 40 to 3600 pg. The present invention may also involve a dose escalation regimen, in which increasing doses of the heterodimeric TCR-anti-CD3 antibody fusion molecule are sequentially administered to the subject. Doses can thus administered in the specified order: first dose, then second dose, then maintenance dose. A third dose may optionally be administered between the second and maintenance doses.

[0034] "First dose" refers to a dose, i.e., dosage amount, of the TCR-anti-CD3 antibody fusion molecule at a first amount within the specified range. "Second dose" refers to a dose, i.e., dosage amount, of the TCR-anti-CD3 fusion molecule at a second amount within a specified range, but which is greater than the first dose. “Third dose” refers to a dose, i.e., dosage amount, of the TCR-anti-CD3 fusion molecule at a third amount within a specified range, but which is greater than the second dose. "Maintenance dose" refers to a dose, i.e., dosage amount, of the TCR-anti-CD3 fusion molecule at a maintenance amount within a specified range, but which is greater than the second dose or the third dose, if present. It will be appreciated that a subject may receive at least three total doses (i.e., a first dose, a second dose, and a maintenance dose). However, the subject may receive more than three total doses. For example, the subject can receive one or more first doses, one or more second doses, one or more optional third doses, and / or one or more maintenance doses of the heterodimeric TCR-anti-CD3 antibody fusion molecule. As used herein, the amount in each second dose is larger than the amount in each first dose, and the amount in each maintenance dose is larger than the amount in each second dose. Where present, the amount in each third dose is larger than the amount in each second dose.

[0035] Herein, each dose (i.e., first dose, second dose, third dose, maintenance dose) is expressed as a specified mass, i.e., weight, of the heterodimeric TCR-anti-CD3 antibody fusion molecule. Other vehicles, excipients, carriers, etc., may be administered with the heterodimeric TCR-anti-CD3 antibody fusion molecule but are not included in the calculated mass.

[0036] The first dose may be about 2 pg to about 30 pg. The first dose may be about 2 pg to about 20 pg, about 10 pg to about 20 pg, about 13 pg to about 17 pg or about 14.5 to about 15.5 pg. The first dose may be about 15 pg. The first dose may be about 5 pg to about 25 pg, about 10 pg to about 24 pg, about 15 pg to about 23 pg or about 18 to about 22 pg. The first dose may be about 20 pg. The first dose can be 2 pg, 3 pg, 4 pg, 5pg, 6 pg, 7 pg, 8pg, 9 pg, 10 pg, 11 pg, 12 pg, 13 pg, 14 pg, 15 pg, 16 pg, 17 pg, 18 pg, 19 pg, 20 pg, 21 pg, 22 pg, 23 pg, 24 pg, 25 pg pg, 26 pg, 27 pg, 28 pg, 29 pg or 30 pg. The first dose may be 15 pg or 20 pg. The first dose may be 15 pg. The first dose may be 20 pg.

[0037] Various numbers of first doses can be administered to the subject. For example, the first dose may be administered once, i.e., one time. The first dose may be administered more than one time, e.g., two to 10 times, two to five times, or two to three times. The first dose may be administered twice.

[0038] The number of first doses can be determined, for example, by the occurrence or severity of an adverse event (AE) following administration of the first dose. In cases with adverse events, more than one first dose may be administered before escalating to the second dose. The first dose may be a "range" of amounts, e.g., 2 to 30 pg. Thus, where multiple first doses are administered, the first dose can comprise the same amount in each first dose (e.g., each first dose comprises 15 or 20 pg). Alternatively, where multiple first doses are administered, the first dose amount can comprise different amounts in one or more of each first dose (e.g., first dose #1 comprises 15pg and first dose #2 comprises 20 pg), as long as each dose is within the first dose amount specified.

[0039] The second dose may be about 5 pg to about 60 pg. The second dose may be about 10 pg to about 60 pg, about 20 pg to about 50 pg, about 25 pg to about 45 pg, about 25 pg to about 35 pg or about 28 pg to about 32 pg. The second dose may be about 30 pg. The second dose may be about 10 pg to about 60 pg, about 20 pg to about 55 pg, about 30 pg to about 50 pg, about 35 pg to about 45 pg or about 38 pg to about 42 pg. The second dose may be about 40 pg. The second dose can be 5 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 35 pg, 40 pg, 45 pg, 50 pg, 55 pg, or 60 pg. The second dose may be about 10 pg, 20 pg, 30 pg, 40 pg, or 60 pg. The second dose may be 30 pg. The second dose may be 40 pg.

[0040] Various numbers of second doses can be administered to the subject. For example, the second dose may be administered once, i.e., one time. Alternatively, the second dose may be administered more than one time, e.g., two to 10 times, two to five times, or two to three times. The second dose may be administered twice.

[0041] The invention can include administration of more than one second dose before escalating to the maintenance dose. The second dose may be a "range" of amounts, e.g., 5 to 60 pg. Thus, where multiple second doses are administered, the second dose can comprise the same amount in each second dose (e.g., each second dose comprises 30 pg or 40 pg). Alternatively, where multiple second doses are administered, the second dose amount can comprise different amounts in one or more of each second dose (e.g., second dose #1 comprises 35 pg and second dose #2 comprises 40 pg), as long as each dose is within the second dose amount specified. Each second dose may be higher than the first dose. When multiple second doses are given, each second dose may be higher than the previous second dose. Alternatively, when multiple second doses are given, each second dose may be the same as the previous second dose.

[0042] The optional third dose may be about 20 pg to about 400 pg, about 20 pg to about 800 pg, or about 20 pg to about 1600 pg. The third dose may be about 10 pg to about 350 pg, about 30 pg to about 340 pg, about 40 pg to about 330 pg, about 50 pg to about 320 pg or about 60 pg to about 310 pg. The third dose may be about 300 pg. The third dose can be 50 pg, 100 pg, 150 pg, 200 pg, 250 pg, 260 pg, 270 pg, 280 pg, 290 pg, 300 pg, 310 pg, 320 pg, 350 pg, 400 pg, 450 pg, 500 pg, 550 pg, 600 pg, 650 pg, 700 pg, 750 pg, 800 pg, 850 pg , 900 pg , 950 pg ,1000 pg, 1050 pg, 1100 pg, 1150 pg or 1200 pg. The third dose may be 300 pg. The third dose may be 600 pg. The third dose may be 1200 pg.

[0043] Various numbers of third doses can be administered to the subject. For example, the third dose may be administered once, i.e., one time. Alternatively, the third dose may be administered more than one time, e.g., two to 10 times, two to five times, or two to three times. The third dose may be administered twice.

[0044] The invention can include administration of more than one third dose before escalating to the maintenance dose. The third dose may be a "range" of amounts, e.g., 20 to 400 pg, or about 20 pg to about 1600 pg. Thus, where multiple third doses are administered, the third dose can comprise the same amount in each third dose (e.g., each third dose comprises 200 pg or 300 pg). Alternatively, where multiple third doses are administered, the third dose amount can comprise different amounts in one or more of each third dose (e.g., third dose #1 comprises 200 pg and third dose #2 comprises 300 pg), as long as each dose is within the third dose amount specified. Each third dose may be higher than the second dose. When multiple third doses are given, each third dose may be higher than the previous third dose. Alternatively, when multiple third doses are given, each third dose may be the same as the previous third dose.

[0045] The term "maintenance dose(s)" is a dosage administered to the subject to maintain the desired therapeutic effect. The maintenance dose may be administered repeatedly until treatment is stopped. There may be a plurality of first and / or second (and / or third) doses before the maintenance dose is administered. Each of the plurality of first, second and / or third doses may be less than the maintenance dose.

[0046] The maintenance dose may be at least about 40 pg, at least about 50 pg, at least about 60 pg, at least about 80 pg, at least about 100 pg, at least about 120 pg, at least about 150 pg, at least about 180 pg, at least about 220 pg, at least about 250 pg, at least about 280 pg, at least about 300 pg. The maintenance dose may be a minimum of about 50 pg, of about 60 pg, of about 80 pg, of about 100 pg, of about 120 pg, of about 150 pg, of about 180 pg, of about 220 pg, of about 250 pg, of about 280 pg, of about 300 pg, of about 400 pg, of about 500 pg, of about 600 pg, of about 700 pg, of about 800 pg, of about 900 pg, of about 1000 pg, of about 1100 pg, of about 1200 pg, of about 1300 pg, of about 1400 pg, of about 1500 pg, of about 1600 pg, of about 1700 pg, of about 1800 pg, of about 1900 pg, of about 2000 pg, of about 2100 pg, of about 2200 pg, of about 2300 pg, of about 2400 pg, of about 2500 pg, of about 2600 pg, of about 2700 pg, of about 2800 pg, of about 2900 pg, of about 3000 pg, of about 3100 pg, of about 3200 pg, of about 3300 pg, of about 3400 pg, of about 3500 pg, of about 3600 pg. The maintenance dose may be 600 pg. The maintenance dose may be 1200 pg.

[0047] The maintenance dose may be about 50 pg to about 70 pg. The maintenance dose may be about 60 pg. The maintenance dose may be about 80 pg to about 160 pg, about 100 to about 140 pg, about 90 to about 130 pg, about 110 pg to about 130 pg, about 115 pg to about 125 pg. The maintenance dose may be about 120 pg. The maintenance dose may be about 150 pg to about 450 pg, about 200 to about 400 pg, about 250 to about 350 pg, about 270 pg to about 330 pg, about 295 pg to about 305 pg. The maintenance dose may be about 300 pg. The maintenance dose may be about 300 pg to about 3600 pg, about 500 pg to 3500 pg, about 1000 pg to about 3000 pg. The maintenance dose may be about 3000 pg, about 3100 pg, about 3200 pg, about 3300 pg, about 3400 pg, about 3500 pg or about 3600 pg. The maintenance dose may be about 3600 pg.

[0048] The maintenance dose may be no greater than about 3600 pg, no greater than about 3500 pg, no greater than about 3400 pg, no greater than about 3300 pg, no greater than about 3200 pg, no greater than about 3100 pg, no greater than about 3000 pg, no greater than about 2900 pg, no greater than about 2800 pg, no greater than about 2700 pg, no greater than about 2600 pg, no greater than about 2500 pg, no greater than about 2400 pg, no greater than about 2300 pg, no greater than about 2200 pg, no greater than about 2100 pg, no greater than about 2000 pg, no greater than about 1900 pg, no greater than about 1800 pg, no greater than about 1700 pg, no greater than about 1600 pg, no greater than about 1500 pg, no greater than about 1400 pg, no greater than about 1300 pg, no greater than about 1200 pg, no greater than about 1100 pg, no greater than about 1000 pg, no greater than about 900 pg, no greater than about 850 pg, no greater than about 800 pg, no greater than about 750 pg, no greater than about 700 pg, no greater than about 650 pg, no greater than about 600 pg, no greater than about 550 pg, no greater than about 500 pg.

[0049] The maintenance dose can be 40 pg, 50 pg, 60 pg, 70 pg, 80 pg, 90 pg, 100 pg, 120 pg, 150 pg, 180 pg, 200 pg, 250 pg, 300 pg, 350 pg, 400 pg or 450 pg. The maintenance dose may be about 60 pg, about 120 pg, about 300 pg, about 1000 pg, about 1500 pg, about 2000 pg, about 3500 pg, about 3000 pg, or about 3600 pg. The maintenance dose may be at least about 300 pg, at least about 1000 pg, at least about 2000 pg, at least about 3000 pg or at least about 3600 pg. The maintenance dose may be about 40 pg to about 900 pg. The maintenance dose may be about 40 pg to about 3600 pg. The maintenance dose may be about 60 pg to about 800 pg. The maintenance dose may be about 120 pg to about 700 pg. The maintenance dose may be about 300 pg to about 600 pg. The maintenance dose may be 300 pg and increased in 1 .5 fold intervals, e.g. from 300 pg to 450 pg, to 600 pg, to 750 pg, to 900 pg, to 1050 pg, to 1200 pg, to 1350 pg, to 1500 pg, to 1650 pg, to 1800 pg, to 1950 pg, etc. The maintenance dose may be 300 pg and increased in 2 fold intervals, i.e. from 300 pg to 600 pg, to 900 pg, to 1200 pg, to 1500 pg, to 1800 pg, to 2100 pg, to 2400 pg, to 2700 pg, to 3000 pg, to 3300 pg, to 3600 pg. Preferably, the maintenance dose is about 300 pg to about 3600 pg.

[0050] The invention may include administration of maintenance dose(s) of about 300 pg, of about 400 pg, of about 500 pg, of about 600 pg, of about 700 pg, of about 800 pg, of about 900 pg, of about 1000 pg, of about 1100 pg, of about 1200 pg, of about 1300 pg, of about 1400 pg, of about 1500 pg, of about 1600 pg, of about 1700 pg, of about 1800 pg, of about 1900 pg, of about 2000 pg, of about 2100 pg, of about 2200 pg, of about 2300 pg, of about 2400 pg, of about 2500 pg, of about 2600 pg, of about 2700 pg, of about 2800 pg, of about 2900 pg, of about 3000 pg, of about 3100 pg, of about 3200 pg, of about 3300 pg, of about 3400 pg, of about 3500 pg, or of about 3600 pg. Preferably, the maintenance dose is about 300 pg to about 3600 pg.

[0051] Applicant observed that 300 pg showed strong IFN gamma induction and IP-10 induction, as well as delayed viral rebound and / or control of viremia. The maintenance dose may also reduce active HIV reservoir. HIV reservoir may be measured at the RNA level. Reduction in HIV reservoir may mean a reduced level of CA-RNA. The term “HIV reservoir” refers to a population of cells that are infected with HIV but are not actively producing the virus. These cells have the potential to begin producing HIV if they become activated. It is hypothesized that the dosing regimen of the invention may reduce HIV reservoir, which is a major challenge in curing HIV. HIV reservoirs can persist in a latent state for long periods, undetected by the immune system and unaffected by antiretroviral therapy (ART). The invention may reduce the viral reservoir in a PLWH. Also contemplated is a heterodimeric TCR-antibody fusion molecule for use in a method of reducing HIV viral reservoir in a PLWH. The invention also comprises a heterodimeric TCR-antibody fusion molecule for use in a method of reducing HIV viral reservoir in a PLWH, wherein the TCR targets the SLYNTVATL-HLA- 02 complex. The heterodimeric TCR-antibody fusion molecule may be the heterodimeric TCR-CD3 antibody fusion molecule as disclosed herein.

[0052] Various numbers of maintenance doses can be administered to the subject. For example, the maintenance dose may be administered once. The maintenance dose may be administered more than once, e.g., three to 200 times, 5 to 100 times, 7 to 50 times, 7 to 20 times, 7 to 16 times or 7 to 12 times. The maintenance dose may be administered 10 times. The maintenance dose may be administered until the HIV infection is cured, in remission, or is as otherwise determined by a healthcare professional. Treatment can be stopped, for example due to unacceptable toxicity or the occurrence of adverse events, or because the subject has shown an unacceptable level of disease progression. Alternatively, treatment can be stopped, for example, because the subject's symptoms have reduced in severity and / or infection has fallen to a level at which treatment with the TCR-anti- CD3 fusion molecule is deemed no longer necessary.

[0053] More than one maintenance dose may be administered. The maintenance dose may be a “range” of amounts, e.g., 40 to 900 pg, or 300 to 3600 pg. Thus, where multiple maintenance doses are administered, the maintenance dose can comprise the same amount in each maintenance dose (e.g., each maintenance dose comprises about 300 pg). Alternatively, the maintenance dose amount can comprise different amounts in one or more of each maintenance dose (e.g., maintenance dose #1 comprises 120 pg and maintenance dose #2 comprises 300 pg), as long as each dose is within the maintenance dose amount specified. Each maintenance dose may comprise a different amount of the heterodimeric TCR-anti CD3 antibody fusion molecule, as long as each maintenance dose comprises at least 40 pg.

[0054] The first dose may comprise 2 to 30pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may comprise 5 to 60 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may comprise at least 40 pg of the TCR-anti-CD3 antibody fusion molecule.

[0055] The first dose may comprise 15 or 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may comprise 30 or 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may comprise 60, 120, 300, or at least 3000 pg of the TCR-anti-CD3 antibody fusion molecule.

[0056] The first dose may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may comprise at least 300 pg of the TCR-anti-CD3 antibody fusion molecule.

[0057] The first dose may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may comprise about 3000 pg of the TCR-anti-CD3 antibody fusion molecule.

[0058] The first, second, third and maintenance doses may be 20, 40, 300, 600 pg respectively; or 20, 40, 300, 1200 pg, respectively. The first, second, third and maintenance doses may be 20, 40, 600, 2400 pg respectively; 20, 40, 600, 3000 pg respectively; 20, 40, 600, 3600 pg respectively; 20, 40, 1200, 3000 pg respectively; or 20, 40, 1200, 2600 pg respectively. Alternatively, the first, second and maintenance doses may 20, 40, 600 pg respectively; 20, 40, 1200 pg respectively; 20, 40, 2400 pg respectively; 20, 300, 2400 pg respectively; 20, 300, 3000 pg respectively; 20, 300, 3600 pg respectively; 20, 600, 1200 pg respectively; 20, 600, 2400 pg respectively; 20, 600, 3000 pg respectively; or 20, 600 3600 pg respectively.

[0059] In the present invention, the respective doses may be expressed as a specified weight of therapeutic irrespective of the patient’s weight or whether the same amount of therapeutic would be administered if calculated through one of the other methods routinely used to calculate an appropriate dosage for a patient such as weight of therapeutic per Kg of body weight, body surface area or lean muscle mass etc.

[0060] Timing

[0061] Each of the first, second and maintenance doses may be administered once or more than once. The first dose may be administered once every 4 to 14 days. The first dose may be is administered once every 6 to 8 days. The first dose may be administered once every 7 days. The first dose may be administered only once, on day 1 of the treatment regimen.

[0062] The first dose may be administered for 1 week to about 3 weeks. The first dose may be administered for 1 week.

[0063] The second dose may be administered 4 to 14 days following the first dose. The second dose may be administered 6 to 8 days following the first dose. The second dose may be administered 7 days following the first dose. The second dose may be administered once every 4 to 14 days. The second dose may be administered once every 6 to 8 days. The second dose may be administered once every 7 days. The second dose may be administered once, 7 days after the first dose.

[0064] The second dose may be administered for 1 week to about 3 weeks. The second dose may be administered for 1 week.

[0065] The third dose, when present, may be administered 4 to 14 days following the second dose. The third dose may be administered 6 to 8 days following the second dose. The third dose may be administered 7 days following the second dose. The third dose may be administered once every 4 to 14 days. The third dose may be administered once every 6 to 8 days. The third dose may be administered once every 7 days. The third dose may be administered once, 7 days after the second dose. The third dose may be administered for 1 week to about 3 weeks. The third dose may be administered for 1 week.

[0066] The maintenance dose may be administered at least once, at least twice, at least three, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 times. The maintenance dose may be administered about 5, about 8, about 10, about 12, about 15 times. The maintenance dose may be administered between 5 to 20 times, between 8 to 15 times. The maintenance dose may be administered about 10 times.

[0067] The maintenance dose may be administered 4 to 14 days following the second dose or, where present, third dose. The maintenance dose may be administered 6 to 8 days following the second dose or, where present, third dose. The maintenance dose may be administered 7 days following the second dose or, where present, third dose. The maintenance dose may be administered multiple times in a week. For example, once in a week, twice in a week, 3 times in a week or more. The maintenance dose may be administered once in a week. The maintenance dose may be administered once in a week, starting 7 days following the second dose. The maintenance dose may be administered once every 4 to 21 days. The maintenance dose may be administered once every 6 to 15 days. The maintenance dose may be administered once every 6 to 8 days. The maintenance dose may be administered once every 7 days. The maintenance dose may be administered once every 12 to 16 days or once every 13 to 15 days. The maintenance dose may be administered once every 14 days.

[0068] The present invention provides a dosing regimen, wherein the heterodimeric TCR-anti-CD3 antibody fusion molecule is administered in specified amount. When the first dose is administered multiple times, the first dose may be administered every 4 days to every 14 days, or every 6 days to every 8 days, until each of the first doses is administered. When the first dose is administered multiple times, the first dose may be administered every 7 days until each of the first doses is administered.

[0069] When the second dose is administered multiple times, the second dose may be administered every 4 days to every 14 days, or every 6 days to every 8 days, until each of the second doses is administered. When the second dose is administered multiple times, the second dose may be administered every 7 days until each of the second doses is administered. The second dose may be administered 4 to 14, or 6 to 8 days after the last administration of the first dose. The second dose may be administered 7 days after the last administration of the first dose.

[0070] When the third dose is present and is administered multiple times, the third dose may be administered every 4 days to every 14 days, or every 6 days to every 8 days, until each of the third doses is administered. When the third dose is administered multiple times, the third dose may be administered every 7 days until each of the third doses is administered. The third dose may be administered 4 to 14, or 6 to 8 days after the last administration of the second dose. The third dose may be administered 7 days after the last administration of the second dose. The maintenance dose may be first administered 7 days after the last administration of the second dose or, where present, third dose. The maintenance dose can be administered in multiple phases, for example, a first phase, a second phase and a third phase. As used herein, the term "phase" refers to a period of time in which the frequency of administration of the maintenance dose is substantially consistent. The term "substantially consistent" refers to a frequency that is ±24 hours of a given value. For example, if the phase frequency was "every 7 days," then a frequency of 7 days ±24 hours would be in the same phase. The "first phase" can comprise administering the maintenance dose every 6 to 8 days, the "second phase" can comprise administering the maintenance dose every 12 to 16 days, and / or the "third phase" can comprise administering the maintenance dose every 26 to 30 days. The "first phase" can comprise administering the maintenance dose every 7 days, i.e., once a week, the "second phase" can comprise administering the maintenance dose every 14 days, i.e., every 2 weeks, and / or the "third phase" can comprise administering the maintenance dose every 28 days, i.e., every 4 weeks.

[0071] The dosage regimen, including administration of the first dose, the second dose, the third dose, where present, and the maintenance dose, may be at least 5 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 15 weeks, at least 18 weeks, at least 20 weeks, at least 50 weeks, at least 60 weeks, at least 70 weeks, at least 80 weeks, or at least 90 weeks. The dosage regimen, including administration of the first dose, the second dose, the third dose, where present, and the maintenance dose, may be about 10 weeks to about 15 weeks. The dosage regimen, including administration of the first dose, the second dose, the third dose, where present, and the maintenance dose, may be about 12 weeks.

[0072] The first dose may be administered for 1 to 3 weeks. The first dose may be administered for 1 week. The second dose may be administered for 1 to 3 weeks. The second dose may be administered for 1 week. The maintenance dose may be administered for 5 to 100 weeks, 8 weeks to 20 weeks, or 9 weeks to 15 weeks. The maintenance dose may be administered for 10 weeks.

[0073] The first dose may be administered for 1 to 3 weeks, the second dose may be administered for 1 to 3 weeks, and the maintenance dose may be administered for at least 5 weeks, e.g., 5 weeks to 100 weeks, 8 weeks to 20 weeks, or 9 weeks to 15 weeks, or about 10 weeks. The first dose may be administered for 1 week, the second dose may be administered for 1 week, and the maintenance dose may be administered for 10 weeks, or at least 10 weeks.

[0074] The first dose may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule and may be administered once, the second dose may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule and may be administered 7 days after the first dose, and the maintenance dose may comprise at least 300 pg of the TCR-anti-CD3 antibody fusion molecule and may be administered weekly, for 10 weeks, 7 days from the last dose of the second dose. Molecule

[0075] The heterodimeric TCR-anti-CD3 antibody fusion molecules useful in the present invention may be immune-mobilising monoclonal T cell receptor against viruses (ImmTAV®), a new class of bispecific protein therapeutic designed to deliver targeted elimination of HIV reservoirs in individuals with chronic HIV infection (as described in WO 2023 / 156663). The molecules may comprise a soluble, affinity-enhanced T cell receptor (TCR; targeting domain) fused to an antibody single-chain fragment variable that specifically recognises cluster of differentiation 3 (anti-CD3 scFv; effector domain). The molecules recognise a complex consisting of a peptide derived from the HIV Gag matrix protein p17, presented by a human leukocyte antigen, HLA-A*02, on the surface of infected CD4+ cells. Once the soluble TCR is engaged, the scFv effector domain can bind to CD3 on any T cell in the vicinity, stimulating the T cell to release effector cytokines and to lyse the bound target cell.

[0076] The heterodimeric TCR-anti-CD3 antibody fusion molecules bind the SLYNTVATL-HLA-A*02 complex. They may also bind to complexes containing natural escape variants of SLYNTVATL (SEQ ID NO: 18) presented by HLA-A*02. Escape variants of the peptide SLYNTVATL (SEQ ID NO: 18) have been isolated from AIDS patients and include the following (Sewell et al., (1997) Eur J Immunol. 27: 2323-2329):

[0077] SLFNTVATL (SEQ ID NO: 19)

[0078] SLFNTVAVL (SEQ ID NO: 20)

[0079] SLSNTVATL (SEQ ID NO: 21)

[0080] SSFNTVATL (SEQ ID NO: 22)

[0081] SLLNTVATL (SEQ ID NO: 23)

[0082] SLYNTIATL (SEQ ID NO: 24)

[0083] SLYNTIAVL (SEQ ID NO: 25)

[0084] SLFNTIATL (SEQ ID NO: 26) SLFNTIAVL (SEQ ID NO: 27) SLYNFVAVL (SEQ ID NO: 28)

[0085] The specific binding molecules useful in the invention may bind the complex of target peptide when bound to one of more HLA-A*02 subtypes, for example the specific binding molecules of the invention may bind the complex of the target peptide when bound to HLA-A*02:01 and / or the specific binding molecules of the invention may bind the complex of the target peptide when bound to HLA-A*02:05 and or HLA-A*02:06 and or HLA-A*02:07 and or HLA-A*02:02.

[0086] The key properties of the heterodimeric TCR-anti-CD3 antibody fusion molecules, may be a high affinity TCR for the HIV peptide-HLA (pHLA) complex (approximately one million-fold greater than a natural TCR) and the capacity to recruit large numbers of polyclonal T cells via a CD3 effector domain. T cell redirection is achieved through formation of an immunological synapse which is formed when the TCR targeting domain binds to pHLA complexes on target cells and the CD3 effector domain binds polyclonal T cells leading to execution of an immediate effector response. In addition to its high affinity, the TCR may be engineered to be highly specific for the target peptide, which ensures selective on-target activity and minimal off-target effects.

[0087] The heterodimeric TCR-anti-CD3 antibody fusion molecule of SEQ ID Nos: 5 and 15 is also called “IMC-M113V”. IMC-M113V specifically targets the highly immunodominant Gag?7_85 epitope (amino acid residues 77-85: SLYNTVATL (SEQ ID NO: 18)) in p17 which is presented by the HLA class I allotype, HLAA*02:01. The frequent detection of circulating Gag77_85-specific CD8+ T cells in a study of over 500 people with acute and chronic HIV infection confirms that it is expressed throughout the course of disease. CD8+ T cell responses remain detectable after prolonged ART, albeit at lower frequencies than those observed in ART-naive individuals, providing further evidence for continued expression of Gag proteins in the absence of viremia. The heterodimeric TCR-anti-CD3 antibody fusion molecule may comprise the alpha chain of SEQ ID NO: 5, or a sequence with at least 90% identity thereto and the beta chain of SEQ ID NO: 13 or SEQ ID NO: 15, or a sequence with at least 90% identity thereto. Preferably, the heterodimeric TCR-anti-CD3 antibody fusion molecule may comprise the alpha chain of SEQ ID NO: 5, or a sequence with at least 90% identity thereto and the beta chain of SEQ ID NO: 15, or a sequence with at least 90% identity thereto. The heterodimeric TCR-anti-CD3 antibody fusion molecule may comprise the alpha chain of SEQ ID NO: 5, and the beta chain of SEQ ID NO: 13 or SEQ ID NO: 15. The heterodimeric TCR-anti-CD3 antibody fusion molecule may comprise the alpha chain of SEQ ID NO: 5, and the beta chain of SEQ ID NO: 15.

[0088] The heterodimeric TCR-anti-CD3 antibody fusion molecule useful in the present invention may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and 10 respectively.

[0089] The alpha chain amino acid sequence may have at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the amino acid sequence of SEQ ID NO: 5.

[0090] The beta chain amino acid sequence may have at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the amino acid sequence of SEQ ID NO: 13. The beta chain amino acid sequence may have at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the amino acid sequence of SEQ ID NO: 15.

[0091] The alpha chain amino acid sequence may have 100% identity to the amino acid sequence of SEQ ID NO: 5 and / or the beta chain amino acid sequence may have 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15.

[0092] The alpha chain amino acid sequence may have 100% identity to the amino acid sequence of SEQ ID NO: 5 and the beta chain amino acid sequence may have 100% identity to the amino acid sequence of SEQ ID NO: 15.

[0093] Although the invention is described herein with reference to heterodimeric TCR-anti-CD3 antibody fusion molecules, the invention may be practiced with TCR-anti-CD3 antibody fusion molecules that are not heterodimers. For example, the fusion molecules may be monomers (e.g. comprising a single chain) or trimers.

[0094] Route of administration

[0095] The compositions described herein may be administered by any suitable means. It is preferred if the composition is administered by intravenous infusion. Alternative routes of administration include other parenteral routes, such as subcutaneous or intramuscular infusion, enteral (including oral or rectal), inhalation or intranasal routes.

[0096] The composition comprising the heterodimeric TCR-anti-CD3 antibody fusion molecule may be administered as a monotherapy. Alternatively it may be administered in combination with one or more anti-retroviral therapies, The heterodimeric TCR-anti-CD3 antibody fusion molecule may be administered on its own for the first and subsequent doses, with the optional additional therapeutic agents being added thereafter or vice-versa.

[0097] The composition comprising the heterodimeric TCR-anti-CD3 antibody fusion molecule may further comprise one or more pharmaceutically acceptable carriers or excipients. This composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage forms. The composition may be adapted for administration by any appropriate route, such as parenteral (including subcutaneous, intramuscular, intrathecal or intravenous), enteral (including oral or rectal), inhalation or intranasal routes. Such compositions may be prepared by any method known in the art of pharmacy, for example by mixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.

[0098] The treatment may further include administering separately, in combination, or sequentially, one or more additional anti-viral agents and / or one or more additional immunotherapeutic agents and / or one of more soluble bispecific binding proteins. For example, the treatment may involve administration of the heterodimeric TCR-anti-CD3 antibody fusion molecule described herein and additional specific binding molecules that recognize alternative HIV proteins.

[0099] Subject to be treated

[0100] The term “subject” means any subject, particularly a mammalian subject, in need of treatment. The term “subject” may refer to a human subject. The term “subject” may refer to an adult human subject. The term “subject” may refer to a male human subject. The term “subject” may refer to a female human subject. The term “subject” may refer to administration to a subject in need thereof, i.e., a subject having a chronic HIV infection. As used herein, a “subject in need thereof’ can refer to the subject for whom it is desirable to treat, e.g., a subject being diagnosed with a chronic HIV infection as described herein. The term “subject in need thereof’ can refer to a subject having one or more symptoms associated with a chronic HIV infection. The term “subject in need thereof’ can refer to a subject at high risk for suffering from a chronic HIV infection suitable to treatment with the heterodimeric TCR-anti-CD3 antibody fusion molecule and / or second active agent as described herein, independently of whether the subject has physical manifestations of such condition. The subject may be an adult, i.e., at least 18 years old. The subject may be 12-18 years old. The subject may be less than 12 years old. The subject to be treated may be a person living with HIV (PLWH).

[0101] The term “chronic HIV” refers to the stage of HIV infection that follows the acute or primary infection phase. “Chronic HIV” represents a prolonged phase of HIV infection where the virus is actively replicating but at a lower level than during the acute phase, leading to ongoing immune system damage if not effectively treated. Patients to be treated may be receiving antiretroviral therapy (ART). Alternatively, patients to be treated may have ceased using ART. For example, such patients may be undergoing analytical therapy interruption (ATI). Alternatively, patients to be treated may be ART naive. Patients who have chronic HIV infection who may be receiving ART, may have ceased ART, or may be ART naive can also be referred to as “people living with HIV” (“PLWH”). The invention may be used as a second line treatment. The invention herein may be used as third line, fourth line, fifth line, sixth line, etc. treatment. Second line or further lines of therapy (third line, fourth line, seventh line, etc.) may be used for a few different reasons, e.g.; the first-line treatment doesn't work, the first-line treatment worked but has since stopped working, the first-line treatment has side effects that are not tolerated, and / or new treatment becomes available that appears to be more effective than the present treatment.

[0102] The invention may be used to treat a subject that has previously received ART. The subject may have ceased receiving ART prior to the first administration of the first dose and / or may have previously received ART for at least 3 months, at least 6 months, at least 12 months or longer.

[0103] Corticosteroids may or may not be administered before administration of any dose of the heterodimeric TCR-anti-CD3 antibody fusion molecule. Corticosteroids may not be administered 3 months, 2 months, 1 month, 3 weeks, 2 weeks or 1 week before administration of any dose of the heterodimeric TCR-anti-CD3 antibody fusion molecule. Corticosteroids may not be administered 3 weeks before administration of any dose of the heterodimeric TCR- anti-CD3 antibody fusion molecule. Corticosteroids can be administered 3 months, 2 months, 1 month, 3 weeks, 2 weeks or

[0104] 1 week before administration of any dose the heterodimeric TCR-anti-CD3 antibody fusion molecule. Corticosteroids may be administered 3 weeks before administration of any dose of the heterodimeric TCR- anti-CD3 antibody fusion molecule. Corticosteroids may be administered only before the first, second or subsequent doses. Corticosteroids may be administered only before the second and maintenance doses. Corticosteroids may be administered only before one or more of the maintenance doses.

[0105] The invention may be used as a monotherapy, e.g., wherein no other antiretroviral drugs are coadministered during the dosing regimen. The invention may be used as a monotherapy, e.g., wherein no other antiretroviral drugs are co- administered 3 months, 2 months, 1 month, 3 weeks,

[0106] 2 weeks or 1 week before administration of the heterodimeric TCR-anti-CD3 antibody fusion molecule. The invention may be used as a monotherapy, e.g., wherein no other antiretroviral drugs are co-administered 3 months, 2 months, 1 month, 3 weeks, 2 weeks or 1 week after completion of the dosage regimen.

[0107] The invention may not be used as a monotherapy, i.e., the heterodimeric TCR-anti-CD3 antibody fusion molecule and one or more additional antiretroviral drugs may be administered. The dosing regimen may further comprise administering a second therapeutic agent, a third therapeutic agent, a fourth therapeutic agent, or greater than four therapeutic agents. The dosing regimen may further comprise administering a second therapeutic agent. The second therapeutic agent, a third therapeutic agent, a fourth therapeutic agent, or greater than four therapeutic agents can be an antiretroviral therapeutic agent. The invention may be used at the same time as another antiretroviral drug. The dosing regimen described herein may be co-administered with antiretroviral treatment for the duration of the regimen. The dosing regimen described herein may be co-administered with antiretroviral treatment for the first week, then ART therapy may be ceased temporarily or permanently. The dosing regimen described herein may be co-administered with antiretroviral treatment for the first two weeks, then ART therapy may be ceased temporarily or permanently. The dosing regimen described herein may be co-administered with antiretroviral treatment for the first three weeks, then ART therapy may be ceased temporarily or permanently. The dosing regimen described herein may be co-administered with antiretroviral treatment for a first period of time, then ART therapy may be ceased temporarily or permanently. ART treatment may be resumed immediately after the final dose of the maintenance dose is received. ART treatment may be resumed about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks after the final dose of the maintenance dose is received. ART treatment may be resumed about 1 month, 2 about months, about 3 months, about 4 months, about 5 months or about 6 months after the final dose of the maintenance dose is received. ART treatment may be resumed about 12 months or longer after the final dose of the maintenance dose is received. ART treatment may be resumed after the final dose of the maintenance dose is received only if a healthcare professional considers additional therapy to control HIV infection is required. ART treatment may never be resumed after the final dose of the maintenance dose is received.

[0108] The second therapeutic agent (for example, antiretroviral drugs) may be administered for the duration of the dosing regimen. The second therapeutic agent may be administered for a period of time suitable to achieve the necessary effect. The second therapeutic agent may be administered for a period of time as prescribed by a healthcare professional. The second therapeutic agent may be administered for at least 10 weeks. The second therapeutic agent may administered for at least 20 weeks, at least 30 weeks, at least 40 weeks, at least 50 weeks, at least 60 weeks, at least 70 weeks, at least 80 weeks, or at least 90 weeks. The second therapeutic agent may be administered for a shorter duration when co-administered with the heterodimeric TCR-anti-CD3 antibody fusion molecule relative to the second therapeutic being administered as a monotherapy.

[0109] The invention may be used in a subject that has previously received ART for at least 12 months, but who ceased receiving ART prior to the first administration of the first dose. ART therapy may not be given for the duration of the dosing regimen. ART treatment may not be resumed after the final dose of the maintenance dose is received for a period of time. Treatment with the invention may result in increased IFN-gamma and / or IP-10 and / or IL10 expression. Levels of IFN-gamma, IP10 and IL10 can be measured by any suitable means. Levels of each cytokine may increase by 2 fold to at least 10 fold or 100 fold.

[0110] Treatment with the dosing regimen of the invention may reduce viral load in the subject. The viral load may be reduced after treatment with the composition compared to before treatment with the composition. The viral load may be reduced to below 500 copies / ml, below 400 copies / ml, below 300 copies / ml, below 200 copies / ml, or lower. The viral load may be maintained at below 500 copies / ml, below 400 copies / ml, below 300 copies / ml, below 200 copies / ml, or lower after treatment. The viral load may be reduced to sub-clinical levels.

[0111] The dosing regimen may also be used in a method of reducing HIV reservoir in a subject, the method comprising administering to the subject a composition comprising a heterodimeric TCR- antibody fusion molecule, wherein the TCR targets the SLYNTVATL-HLA-02 complex. The heterodimeric TCR-antibody fusion molecule may be a heterodimeric TCR-anti-CD3 antibody fusion molecule, which may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively, wherein the dosing regimen comprises administering:

[0112] (i) a first dose comprising 2 to 30 ug of the TCR-anti-CD3 antibody fusion molecule,

[0113] (ii) a second dose comprising 5 to 60 pg of the TCR-anti-CD3 antibody fusion molecule, and

[0114] (iii) a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule, and wherein the second dose comprises a larger amount of the TCR-anti-CD3 antibody fusion molecule than the first dose, and the maintenance dose comprises a larger amount of the TCR- anti-CD3 antibody fusion molecule than the second dose.

[0115] The invention also comprises a method of reducing the viral reservoir in a patient living with HIV (PLWH), the method comprising administering a soluble TCR - antibody fusion molecule, wherein the TCR targets the SLYNTVATL-HLA-02 complex to the patient. The method of reducing HIV reservoir may be further modified by any feature disclosed herein.

[0116] The dosing regimen of the present invention may be for a finite duration, such as 20, 16 or 12 weeks. The subject to be treated may be a person living with HIV (PLWH) who has prior received ART or who has discontinued ART. Where the PLWH has prior received ART, the prior treatment may have been for at least 3 months, at least 6 months, at least 1 year, at least 2 years. The prior treatment may be at least 1 year.

[0117] Kits

[0118] For administration to subjects, the heterodimeric TCR-anti-CD3 antibody fusion molecule can be provided as part of a composition together with one or more pharmaceutically acceptable carriers or excipients. This pharmaceutical composition can be in any suitable form, (e.g., depending upon the desired method of administering it to a subject). It can be provided in unit dosage form and will generally be provided in a sealed container and can be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use, and specifically can include detailed instructions related to the dosage amounts and the timing of administration. The kit can include a plurality of containers.

[0119] The kit may comprise more than one container, wherein each container comprises a specific amount of lyophilized heterodimeric TCR-anti-CD3 antibody fusion molecule. The lyophilized heterodimeric TCR-anti-CD3 antibody fusion molecule in one container can be reconstituted in a liquid vehicle, e.g., a buffered saline solution, prior to administration to the subject, while the remaining containers remain lyophilized. The kit may comprise more than one container, wherein each container comprises a specific amount of heterodimeric TCR-anti-CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti-CD3 antibody fusion molecule is solubilized in a liquid vehicle, e.g., a buffer system and / or one or more excipients.

[0120] Thus, for example, the kit can comprise (i) one to five first containers, each first container comprising a first dose comprising 2 to 30 pg of a heterodimeric TCR-anti-CD3 antibody fusion molecule, (ii) one to five second containers, each second container comprising a second dose comprising 5 to 60 pg of the heterodimeric TCR-anti-CD3 antibody fusion molecule, and (iii) one or more maintenance containers, each maintenance container comprising a maintenance dose comprising at least 40 pg (preferably 300 - 3600 pg) of the heterodimeric TCR- anti-CD3 antibody fusion molecule, and (iv) instructions for administering the heterodimeric TCR-anti-CD3 antibody fusion molecule in a dosing regimen. The instructions may specify a dosing regimen as described herein.

[0121] The kit may comprise (i) one first container comprising a first dose comprising 2 to 30 pg of a heterodimeric TCR-anti-CD3 antibody fusion molecule, (ii) one second container comprising a second dose comprising 5 to 60 pg of the heterodimeric TCR-anti-CD3 antibody fusion molecule, (iii) one or more maintenance containers, each maintenance container comprising a maintenance dose comprising at least 40 pg (preferably 300 - 3600 pg) of the heterodimeric TCR-anti-CD3 antibody fusion molecule, and (iv) instructions for administering the heterodimeric TCR-anti-CD3 antibody fusion molecule in a dosing regimen, wherein the dosing regimen is specified as (a) administering the first dose on week 1 , (b) administering the second dose on week 2, and (c) administering a maintenance dose weekly for 10 weeks.

[0122] The kit may also comprise one or more third containers comprising a third dose comprising at least 40 pg of a heterodimeric TCR-anti-CD3 antibody fusion molecule.

[0123] The kit may comprise 1 or 2 first containers, 1 or 2 second containers, and various numbers of maintenance containers. For example, the kit may comprise 2 to 60 maintenance containers, 3 to 50 maintenance containers, 4 to 40 maintenance containers, 5 to 30 maintenance containers, 6 to 20 maintenance containers, 7 to 16 maintenance containers, 8 to 12 maintenance containers, or 9 to 11 maintenance containers. For example, the kit may comprise 10 maintenance containers,

[0124] The kit may comprise (i) 1 to 2, 1 to 3, 1 to 4, 1 to 5, or more first containers, each first container comprising a first dose comprising 2 to 30 pg of a heterodimeric TCR-anti-CD3 antibody fusion molecule, (ii) 1 to 2, 1 to 3, 1 to 4, 1 to 5, or more second containers, each second container comprising a second dose comprising 5 to 60 pg of the heterodimeric TCR-anti-CD3 antibody fusion molecule, and / or (iii) 1 or more, 2 or more, 3 or more maintenance containers, each maintenance container comprising a maintenance dose comprising at least 40 pg of the heterodimeric TCR- anti-CD3 antibody fusion molecule.

[0125] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 15 or 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 30 or 40 pg of the TCR- anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 300 pg of the TCR-anti- CD3 antibody fusion molecule.

[0126] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 15 or 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 30 or 40 pg of the TCR- anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 300 pg of the TCR-anti- CD3 antibody fusion molecule, wherein the TCR-anti-CD3 antibody fusion molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0127] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 300 pg of the TCR-anti-CD3 antibody fusion molecule.

[0128] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 300 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0129] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 600 pg of the TCR-anti-CD3 antibody fusion molecule.

[0130] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 600 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0131] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, the third dose may be administered once, 7 days after the second dose and may comprise 300 pg of the TCR-anti-CD3 antibody fusion molecule and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 600 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0132] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 1000 pg of the TCR-anti-CD3 antibody fusion molecule.

[0133] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 1000 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0134] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 1500 pg of the TCR-anti-CD3 antibody fusion molecule.

[0135] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 1500 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0136] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 2000 pg of the TCR-anti-CD3 antibody fusion molecule.

[0137] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 2000 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0138] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 3000 pg of the TCR-anti-CD3 antibody fusion molecule.

[0139] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 3000 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

[0140] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 3600 pg of the TCR-anti-CD3 antibody fusion molecule.

[0141] The present invention provides a dosing regimen, wherein the first dose may be administered once and may comprise 20 pg of the TCR-anti-CD3 antibody fusion molecule, the second dose may be administered once, 7 days after the first dose and may comprise 40 pg of the TCR-anti-CD3 antibody fusion molecule, and the maintenance dose may be administered 7 days after the second dose, every 7 days for 10 weeks and may comprise at least 3600 pg of the TCR-anti-CD3 antibody fusion , wherein the molecule may comprise (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively. Unless otherwise defined herein, scientific and technical terms used in the present disclosure shall have meanings that are commonly understood by one of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0142] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0143] The use of the term “or” in the claims is used to mean “and / or,” unless explicitly indicated to refer only to alternatives or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”

[0144] As used herein, the terms “comprising” (and any variant or form of comprising, such as “comprise” and “comprises”), “having” (and any variant or form of having, such as “have” and “has”), “including” (and any variant or form of including, such as “includes” and “include”) or “containing” (and any variant or form of containing, such as “contains” and “contain”) are inclusive or open- ended and do not exclude additional, unrecited, elements or method steps.

[0145] The use of the term “for example” and its corresponding abbreviation “e.g.” means that the specific terms recited are representative examples and embodiments of the disclosure that are not intended to be limited to the specific examples referenced or cited unless explicitly stated otherwise.

[0146] As used herein, “about” can mean plus or minus 10% of the provided value. Where ranges are provided, they are inclusive of the boundary values. “About” can additionally or alternately mean either within 10% of the stated value, or within 5% of the stated value, or in some cases within 2.5% of the stated value; or “about” can mean rounded to the nearest significant digit.

[0147] As used herein, “between” is a range inclusive of the ends of the range. For example, a number between x and y explicitly includes the numbers x and y and any numbers that fall within x and y.

[0148] The term “administration” or “administering” refers to routes of introducing a compound or composition provided herein to a subject to perform its intended function. An example of a route of administration that can be used includes, but is not limited to, intravenous fusion. The term “treating” refers to administering an active agent with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect a condition (e.g., a disease), the symptoms of the condition, or to prevent or delay the onset of the symptoms, complications, biochemical indicia of a disease, or otherwise arrest or inhibit further development of HIV in a statistically significant manner.

[0149] Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis. The prior art documents mentioned herein are incorporated by reference to the fullest extent permitted by law.

[0150] Sequences

[0151] SEQ ID NO: 1 is the amino acid sequence of a TOR alpha chain variable region, with CDR1-3 underlined (SEQ ID NOS: 2-4 respectively):

[0152] AKEVEQNSGP LSVPEGAIAS LNCTYSSWEG QSFFWYRQYS GKSPELIMKL YADPDKEDGR

[0153] FTAQLNKASQ YVSLLIRDSQ PSDSATYLCA VRTNAGYALN FGKGTSLLVT P (SEQ ID NO: 1)

[0154] SEQ ID NO: 5 is the amino acid sequence of the TOR alpha chain variable region of SEQ ID NO: 1 with additional constant domain residues in italics (SEQ ID NO: 6):

[0155] AKEVEQNSGP LSVPEGAIAS LNCTYSSWEG QSFFWYRQYS GKSPELIMKL YADPDKEDGR

[0156] FTAQLNKASQ YVSLLIRDSQ PSDSATYLCA VRTNAGYALN FGKGTSLLVT PHIQKPDPAV

[0157] YQLRDSKSSD KSVCLFTDFD SQTNVSQSKD SDVYITDKCV LDMRSMDFKS NSAVAWSNKS

[0158] DFACANAFNN SIIPEDT (SEQ ID NO: 5)

[0159] SEQ ID NO: 7 is the amino acid sequence of a TOR beta chain variable region, with CDR1-3 underlined (SEQ ID NOS: 8-10 respectively):

[0160] DAGVTQSPTH LIKTRGQQVT LRCSPKSGHD TVSWYQQALG QGPQFI FQAV RGVERQRGNF PDRFSGHQFP NYSSELNVNA LLLGDSALYL CASSDTVSYE QYFGPGTRLT VT (SEQ ID NO: 7)

[0161] SEQ ID NO: 11 is the amino acid sequence of the TOR beta chain variable region of SEQ ID NO: 7 with additional constant domain residues (in italics - SEQ ID NO: 12):

[0162] DAGVTQSPTH LIKTRGQQVT LRCSPKSGHD TVSWYQQALG QGPQFI FQAV RGVERQRGNF

[0163] PDRFSGHQFP NYSSELNVNA LLLGDSALYL CASSDTVSYE QYFGPGTRLT VTEDLKNVFP

[0164] PEVAVFEPSE AEISHTQKAT LVCLATGFYP DHVELSWWVN GKEVHSGVCT DPQPLKEQPA

[0165] LNDSRYALSS RLRVSATFWQ DPRNHFRCQV QFYGLSENDE WTQDRAKPVT QIVSAEAWGR

[0166] AD (SEQ ID NO: 11) SEQ ID NO: 13 is the sequence of SEQ ID NO: 11 linked to an anti-CD3 scFV (underlined - SEQ ID NO: 14) via a linker (in bold - SEQ ID NO: 17)

[0167] AIQMTQSPSS LSASVGDRVT ITCRASQDIR NYLNWYQQKP GKAPKLLIYY TSRLESGVPS RFSGSGSGTD YTLTI SSLQP EDFATYYCQQ GNTLPWTFGQ GTKVEIKGGG GSGGGGSGGG GSGGGGSGGG SEVQLVESGG GLVQPGGSLR LSCAASGYSF TGYTMNWVRQ APGKGLEWVA LINPYKGVST YNQKFKDRFT I SVDKSKNTA YLQMNSLRAE DTAVYYCARS GYYGDSDWYF DVWGQGTLVT VSSGGGGSDA GVTQSPTHLI KTRGQQVTLR CSPKSGHDTV SWYQQALGQG PQFI FQAVRG VERQRGNFPD RFSGHQFPNY SSELNVNALL LGDSALYLCA SSDTVSYEQY FGPGTRLTVT EDLKNVFPPE VAVFEPSEAE ISHTQKATLV CLATGFYPDH VELSWWVNGK EVHSGVCTDP QPLKEQPALN DSRYALSSRL RVSATFWQDP RNHFRCQVQF YGLSENDEWT QDRAKPVTQI VSAEAWGRAD (SEQ ID NO: 13)

[0168] SEQ ID NO: 15 is the sequence of SEQ ID NO: 11 linked to an alternative anti-CD3 scFV (underlined - SEQ ID NO: 16) via a linker (in bold - SEQ ID NO: 17)

[0169] AIQMTQSPSS LSASVGDRVT ITCRASQDIR NYLNWYQQKP GKAPKLLIYY TSRLESGVPS RFSGSGSGTD YTLTI SSLQP EDFATYYCQQ GNTLPWTFGQ GTKVEIKGGG GSGGGGSGGG GSGGGGSGGG SEVQLVESGG GLVQPGGSLR LSCAASGYSF TGYAMNWVRQ APGKGLEWVA LINPYKGVST YNQKFKDRFT FSVDKSKNTA YLQMNSLRAE DTAVYYCARS GYYGDSDWYF DVWGQGTLVT VSSGGGGSDA GVTQSPTHLI KTRGQQVTLR CSPKSGHDTV SWYQQALGQG PQFIFQAVRG VERQRGNFPD RFSGHQFPNY SSELNVNALL LGDSALYLCA SSDTVSYEQY FGPGTRLTVT EDLKNVFPPE VAVFEPSEAE ISHTQKATLV CLATGFYPDH VELSWWVNGK EVHSGVCTDP QPLKEQPALN DSRYALSSRL RVSATFWQDP RNHFRCQVQF YGLSENDEWT QDRAKPVTQI VSAEAWGRAD (SEQ ID NO: 15)

[0170] SEQ ID NO: 18 is: SLYNTVATL

[0171] SEQ ID NO: 19 is: SLFNTVATL

[0172] SEQ ID NO: 20 is: SLFNTVAVL

[0173] SEQ ID NO: 21 is: SLSNTVATL

[0174] SEQ ID NO: 22 is: SSFNTVATL

[0175] SEQ ID NO: 23 is: SLLNTVATL

[0176] SEQ ID NO: 24 is: SLYNTIATL

[0177] SEQ ID NO: 25 is: SLYNTIAVL

[0178] SEQ ID NO: 26 is: SLFNTIATL

[0179] SEQ ID NO: 27 is: SLFNTIAVL

[0180] SEQ ID NO: 28 is: SLYNFVAVL SEQ ID NO: 29 is: AAATCTCTAGCAGTGGCGCCCGAACAG

[0181] SEQ ID NO: 30 is:TAACCCTGCGGGATGTGGTATTCC

[0182] SEQ ID NO: 31 is: GCGCCCGAACAGGGACYTGAAARCGAAAG

[0183] SEQ ID NO: 32 is: TATCATCTGCTCCTGTATC

[0184] SEQ ID NO: 33 is: GACTAGCGGAGGCTAGAAGGAGAGA

[0185] SEQ ID NO: 34 is: CTAATTTTCCSCCDCTTAATAYTGACG

[0186] SEQ ID NO: 35 is: AT+G+GGT+GC+GAGA

[0187] EXAMPLES

[0188] The present invention will now be described with respect to the following representative examples that are to be considered illustrative embodiments that do not limit the scope of the invention which is defined solely by the claims. All references to publications, including scientific publications, treatises, textbooks, patent applications and issued patents are hereby incorporated by reference for all purposes to the fullest extent permitted by law.

[0189] Example 1: IMC-M113V-103 Clinical Trial

[0190] Patients have been treated in an ongoing Phase 1 / 2 clinical trial study of IMC-M113V (IMC-M1 ISV- 103) entitled “A Phase 1 / 2 study of IMC-M113V in virologically suppressed chronic HIV infection.” The study was designed as an open-label dose-escalation study to assess the safety, pharmacokinetics (PK), and antiviral activity of IMC-M113VC when administered in HLA-A*02:01- positive subjects with chronic HIV infection who are virologically suppressed. Initially, the study was limited to include individuals who had been undergoing antiretroviral therapy (ART) for 1-7 years. This was later expanded to include participants who had been undergoing ART for 12 years or less.

[0191] In IMC-M113V-103, participants were administered IMC-M113V by intravenous (IV) infusion. Participants received premedication with a non-steroidal anti-inflammatory agent and an antihistamine within 30 minutes of the planned start of IV infusion. Corticosteroids were optionally added to the premedication regimen at any dose level, including in circumstances where a single Grade 2 cytokine release syndrome (CRS) episode was observed, where two or more Grade 1 CRS episodes did not resolve within 6 hours of onset despite medical intervention, or where it was otherwise deemed advisable by the clinician or sponsor of the trial.

[0192] The IMC-M113V-103 study was designed in two parts. The first part was a single ascending dose (SAD) study conducted to determine the safety, tolerability, and pharmacokinetics of ascending doses and to identify the lowest dose associated with pharmacodynamic (PD) effects. The schematic of the SAD study is shown in FIG. 1 . The doses assessed corresponded to 1 .6 mcg, 5 mcg, and 15 mcg. Participants in the SAD cohort remained on ART upon treatment with IMC- M113V. The duration of the study for a SAD study participant included a one day treatment period and a 28-day follow-up period to confirm resolution of any laboratory abnormalities.

[0193] The second part was a multiple ascending dose (MAD) study. A schematic of the MAD study is shown in FIG.2. Duration of the MAD study for a participant included a twelve (12) week treatment period followed by an ART treatment interruption (ATI) of up to 24 weeks. The ATI enabled evaluation of the impact of IMC-M113V on viral reservoirs. The ATI period was followed by resumption of ART and a twelve (12) week follow up period to confirm that participants have achieved re-suppression of plasma HIV viral load (pVL) and resolution of any laboratory abnormalities.

[0194] In the MAD study, IMC-M113V was administered using a step-dose regimen, amongst other reasons, to mitigate tumor lysis. Step dosing of different cohorts in the MAD study is shown in FIG. 3. In the step dosing regimen of this study, the first dose was administered on week 1 , the second dose on week 2, and the target (or maintenance) dose on week 3.

[0195] Example 2: IMC-M113V-103 SAD Safety, Pharmacokinetic and Pharmacodynamic Activity

[0196] For the SAD study, serum IMC-M113V concentrations were measured pre-dose and up to 24 hours after IV administration and were used to derive pharmacokinetic profiles for each dose level using non-compartmental analysis. IMC-M113V was detectable at all dose levels administered and peak concentrations were observed immediately after infusion (FIG.4). Overall, exposure increased in a dose-proportional manner, with Cmax values between 171 and 3,650 pg / mL and area under the curve (AUCiast) values from 1 ,220 to 45,400 h*pg / mL. Serum IMC-M113V levels decreased below the limit of quantification by 12 hours post-administration of the 1.6 mcg dose but remained detectable at all time-points up to 24 hours for the 5 and 15 mcg doses. Based on the 15 mcg dose (n = 10), clearance (CL) ranged from 2.03-12.8 L / day; the steady-state volume of distribution (Vss) was 1 .93-11 .2 L and the terminal half-life was estimated to be 14.5-21 .6 hours.

[0197] Serum IL-6 was quantified pre-dose, at 8, and at 24 hours post-dose, and on Day 8. Baseline IL-6 values were below the lower limit of quantification in 9 / 12 participants. The remaining three participants all had values within the normal range. A small increase of 2 to 3-fold from baseline in IL-6 was noted in each of the single participant cohorts, with a peak occurring at 8 hours for the 1 .6 mcg dose and 24 hours for the 5 mcg dose. Five of the 10 participants in the 15 mcg dose cohort showed a >4-fold increase in IL-6 from baseline, of whom two had a >10-fold rise (FIG. 5A). By Day 8, IL-6 levels had declined to baseline or below 10 pg / ml. To explore the relationship between pharmacodynamic (PD) response (based on IL-6 fold-change) and baseline HLA-A*02:01-Gag77-85 expression, HIV cell-associated RNA (HIV CA-RNA) was quantified as a measure of the ‘active reservoir’. In addition, Gag transcripts were sequenced to determine the presence of Gag77-85 cognate or variant sequences, given that IMC-M113V binding affinity for pHLA is affected by known mutations in this epitope. Median HIV CA-RNA copy number was 639 (range 89-2,777) copies 1 106TBP (TATA box binding protein) for the 15 mcg cohort. Gag77-85 sequences detected in HIV CA-RNA included variants for which the IMC-M113VRESbinding affinity was determined reactively (FIG. 5B). The relationship between baseline HIV CA- RNA copy number, dominant Gag77-85 sequence and peak IL-6 response (fold-change post-dose) is shown in FIG 5C. IL-6 elevations of >10-fold were observed in 2 / 3 and 0 / 7 participants with pM and nM affinity Gag77-85 variants, respectively. One participant with a pM affinity variant but no IL-6 response had very low HIV CA-RNA levels (112 copies 1 106TBP). A trend was observed for the 3 participants with a pM Gag77-85 variant (Pearson r2= 0.87). These observations are consistent with in vitro studies where the magnitude of IMC-M113V-mediated cytokine response was dependent on both the peptide concentration and the affinity of IMC-M113V for the peptide variant.

[0198] Example 3: IMC-M113V-103 MAD Safety, Pharmacodynamic, and Clinical Activity

[0199] In the IMC-M113V-103 MAD study, tolerability was demonstrated for the three target doses as shown in FIG. 3 over a twelve week schedule. While continuing antiretroviral therapy (ART), three sequential cohorts evaluated weekly IV infusions of IMC-M113V up to doses of 60 mcg (n=5), 120 mcg (n=5), and 300 mcg (n=6) administered over 12 weeks, followed by analytical treatment interruption (ATI) for up to 12 weeks, after which participants resumed their prior ART regimen.

[0200] All doses were well tolerated and no serious adverse events (AEs) or dose limiting toxicities were observed. For cohort 1 , no cytokine release syndrome (CRS) or dose limiting toxicity (DLT) was observed and only 1 instance of a grade 3 fatigue. For cohort 2, no CRS or DLT was observed. One headache / fatigue was observed, and one example of an increase in temperature. For cohort 3, no DLT was observed. Four participants experienced a grade 1 CRS after the first 300 mcg dose.

[0201] Dose-dependent increases in serum cytokines were observed, consistent with the mechanism of action, with the highest levels of T cell-derived cytokines at 300 mcg. The pharmacodynamics analysis demonstrated strong IFN gamma induction and IP-10 induction at the highest evaluated dose to date, 300 mcg dose. This is shown in FIG. 6.

[0202] In the 15 evaluable PLWH, delayed viral rebound and / or viremia control at any point during ATI was observed in one of five at 120 mcg, and two of five at 300 mcg. The three PLWH with evidence of viral control had a viral load of approximately 200 c / mL at week 8. The historical rate for this observation is 5% (Gunst, J.D., Gohil, J., Li, J.Z. et al. Time to HIV viral rebound and frequency of post-treatment control after analytical interruption of antiretroviral therapy: an individual data-based meta-analysis of 24 prospective studies. Nat Commun 16, 906 (2025)). Furthermore, 2 of these 3 PLWH remained off ART for the entire 12 week ATI period that was pre-specified in the protocol. At this 300 mcg dose, delayed viral rebound and / or control of viremia was also observed (FIG. 7).

[0203] This delay in rebound also appeared to correlate with the IMC-M113V therapeutic having higher affinity to the target peptide in the participant showing such effect (FIG. 7).

[0204] Furthermore, in the three PLWH with evidence of viral control, the pattern consisted of initial viral rebound followed by viral reduction to approximately 200 c / mL, including 1 PLWH at 300 mcg who had initial viremia to >104 c / mL before subsequent decrease to <50 c / mL at week 12. This observation of initial viremia followed by control at week 12 is typically observed in <1% of all PLWH (See Gunst et al.). It is typically uncommon to be able to interrupt ART for 12 weeks or longer, with the vast majority of people showing viral rebound by 4 weeks. The above described results show a greater level of viremia control than demonstrated with the use of prior therapies.

[0205] Levels of cell associated RNA (CA-RNA) were also evaluated to ascertain the level of virus in the HIV reservoir. In a portion of the participants in the study, a reduction in the active HIV reservoir was observed. In particular, a greater than 2-fold reduction was shown in over a third of the participants to date.

[0206] In summary, this data demonstrates that IMC-M113V, the first TCR bispecific molecule targeting HIV, has a favourable safety and tolerability profile in HLA-A*02:01 -positive people living with HIV (PLWH) treated with ART for up to 7 years. Moreover, the biological activity detected after single 15 mcg doses suggests that IMC-M113V is sensitive to levels of HIV Gag protein typically expressed during ART. The above data also shows that that active reservoirs are being targeted by this novel immunotherapeutic approach without the need for prior treatment with a latencyreversing agent, and that this novel immunotherapeutic has the potential to provide delayed viral rebound and a level of viremia control that is beneficial to PLWH. As the dose limiting toxicity has not been reached, higher dose levels are anticipated to be consistent with the above-described results.

[0207] Example 4: Materials and Methods

[0208] Pharmacokinetic Assay

[0209] Plasma concentrations of IMC-M113V were measured using a validated electrochemiluminescence immunoassay (ECLIA). This assay format was based on step-wise capture of free IMC-M113V in patient serum samples via immobilized pHLA, followed by detection with reporter-labeled recombinant human CD3. Pharmacodynamic Activity

[0210] Serum cytokines and chemokine measurements were performed at a central laboratory (Q2 Lab solutions) in accordance with their standard operating procedures. Serum IL-6 was measured using Electrochemiluminescence immunoassays (ECLIA) from Cobas C6000 (Roche Diagnostics). Lower limit of quantification (LLOQ) was 2.5 pg / ml.

[0211] Sequencing of Gagnes from HIV CA-RNA

[0212] CD4+ cells were isolated from PBMCs (CD4 Microbeads, Miltenyi Biotech) following which RNA was extracted using the RNeasy Mini Kit (Qiagen). cDNA was synthesized and amplified (RT- PCR1) using Superscript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen) and RNAseOUT (Invitrogen) and the following primers:

[0213] Gag_F_RTPCR1 : 5'-AAATCTCTAGCAGTGGCGCCCGAACAG-3' (SEQ ID NO: 29) Gag_R_RTPCR1 : 5'-TAACCCTGCGGGATGTGGTATTCC-3'. (SEQ ID NO: 30)

[0214] The following touchdown thermal cycling conditions were used59: 50°C for 30 min followed by 94°C for 2 min and then 94°C for 30 s, 64°C for 30 s, and 68°C for 3 min (3 cycles); 94°C for 30 s, 61 °C for 30 s, and 68°C for 3 min (3 cycles); 94°C for 30 s, 58°C for 30 s, and 68°C for 3 min (3 cycles); 94°C for 30 s, 55°C for 30 s, and 68°C for 3 min (41 cycles); and then 68°C for 3 min.

[0215] The total reaction volume was 13.5 pl containing maximum of 2000 ng RNA. The amplified product from RT-PCR1 was diluted with 15 pl of nuclease free water. 2 pl of the diluted RT-PCR1 product was next amplified (PCR2) in a 25 pl reaction volume using Platinum Taq DNA polymerase High Fidelity (Invitrogen), the same thermocycling conditions as RT-PCR1 (excluding the RT 50°C for 30 min step) and the following nested primers:

[0216] Gag_F_PCR2: 5'-GCGCCCGAACAGGGACYTGAAARCGAAAG-3' (SEQ ID NO: 31) Gag_R_PCR2: 5'-TATCATCTGCTCCTGTATC-3' (SEQ ID NO: 32)

[0217] TapeStation 2200 (Agilent) and Qubit 3.0 (Invitrogen) was used to confirm PCR2 amplification before proceeding to library preparation using Nextera XT Library Preparation Kit and Nextera XT Index Kit v2 Set A (Illumina) as per manufacturer’s protocol. Amplified indexed libraries were purified using Illumina purification beads and analysed on a Tapestation 2200 and Qubit 3.0 prior to producing a 4nM library pool. The pooled library was paired-end sequenced on a MiSeq Sequencer using a 300 cycle MiSeq Reagent Kit v2 (Illumina).

[0218] For sequence analyses, Fastq files were processed as follows: Quality and adaptor trimming was performed using Trim Galore (vO.6.2) with default parameters, specifying the amplification primers and Nextera adaptors. FastQC was used to assess read quality. Mapping was carried out against the HIV-1 HXB2 reference annotation (obtained from NCBI November 2022; ASM310297v1 I GCA_003102975.1) using BWA INDEX and BWA MEM (vO.7.17) with PCR duplicates removed. MultiQC was used to assess mapping statistics. iVar variants (v1 .3.1) was used to call variants from the aligned BAM files and iVar consensus (v1 .3.1) used to generate consensus sequences. SAMtools Depth (v1 .3) was used to compute the alignment depth along the HIV-1 genome. Sequence alignment, plotting and visualisation was performed in R using the packages muscle (v3.38.0), seqinr (v4.2.16), ggplot2 (3.3.6) and ggmsa (v1 .2.3). Variants obtained in the region of interest (HIV Gag?7-85) at a frequency of > 3% were reported.

[0219] Quantification of HIV Gag CA-RNA

[0220] Quantification of HIV Gag CA-RNA was performed using ddPCR based on the previously published method with some modifications60. CD4+ cells were isolated from PBMCs (CD4 Microbeads, Miltenyi Biotech) following which RNA was extracted using the RNeasy Mini Kit (Qiagen) and quantified using the Qubit 3.0 and a Broad Range RNA Kit (Invitrogen). A minimum of two replicates each containing up to 350 ng RNA were analysed using the One-Step RT-ddPCR Advanced Kit for Probes and the QX200 ddPCR System (Bio-Rad), following the manufacturers protocol. The following primers and probe were used for the quantification:

[0221] CS-Gag forward primers: 5'- GACTAGCGGAGGCTAGAAGGAGAGA’-3' (SEQ ID NO: 33) CS-Gag reverse primers: 5'- CTAATTTTCCSCCDCTTAATAYTGACG’-3' (SEQ ID NO: 34) CS-Gag FAM / BHQ Probe: 5'-AT+G+GGT+GC+GAGA-3' (SEQ ID NO: 35)

[0222] For some participants, primers and / or probes were customised based on the Gag sequence determined in CA-RNA (Supplementary Table S2). Droplets were prepared using an Automated Droplet Generator (Bio-Rad) and cycled at 95 °C for 10 min; 40 cycles of (94 °C for 30 s, 59 °C for 1 min) and 98 °C for 10 min, using a ramp rate of 2 °C to improve droplet separation. Droplets were analysed on a QX200 Droplet Reader (Bio-Rad) using QXManager software (Bio-Rad, version 1.2).

[0223] RNA of the human TATA box binding protein (TBP) gene was also quantified using the TaqMan Gene Expression VIC Assay (20x) from Invitrogen (Hs00427620_m1). For this purpose, RNA was diluted 20-fold, and 2 pl was used per reaction. HIV Gag CA-RNA values were normalised to TBP expression and are presented as HIV CA-RNA copies 1 106TBP.

[0224] The invention also provides a TCR-anti-CD3 antibody fusion molecule for use in a method of treating HIV infection in a subject, the method comprising administering to the subject a composition comprising the TCR-anti-CD3 antibody fusion molecule, wherein the TCR-anti-CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8,

[0225] 9 and 10 respectively, wherein the method comprises administering: a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule.

[0226] In a further aspect, the present invention provides a method of treating HIV infection in a subject, the method comprising administering to the subject a composition comprising a TCR-anti-CD3 antibody fusion molecule, wherein the TCR-anti-CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and

[0227] 10 respectively, wherein the method comprises administering: a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule

[0228] In a further aspect, the present invention provides a kit comprising:

[0229] (i) at least one first container comprising a first dose of a TCR-anti CD3 antibody fusion molecule,

[0230] (ii) at least one second container comprising a second dose of the TCR-anti CD3 antibody fusion molecule,

[0231] (iii) one or more maintenance containers, each maintenance container comprising a maintenance dose of the TCR-anti CD3 antibody fusion molecule, and

[0232] (iv) instructions for administering the TCR-anti CD3 antibody fusion molecule, wherein the TCR-anti CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID Nos: 8, 9 and 10 respectively

[0233] In a further aspect, the present invention provides a TCR-antibody fusion molecule for use in a method of reducing HIV viral reservoir in a PLWH, wherein the TCR targets the SLYNTVATL-HLA- 02 complex.

Claims

CLAIMS1 . A heterodimeric TCR-anti-CD3 antibody fusion molecule for use in a method of treating HIV infection in a subject, the method comprising administering to the subject a composition comprising the heterodimeric TCR-anti-CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti-CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively, wherein the method comprises administering: a maintenance dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule.

2. The fusion molecule for use of claim 1 , wherein prior to administration of the maintenance dose, a first dose of the fusion molecule is administered followed by administration of a second dose of the fusion molecule, and wherein the second dose comprises a larger amount of the TCR- anti-CD3 antibody fusion molecule than the first dose, and the maintenance dose comprises a larger amount of the TCR-anti-CD3 antibody fusion molecule than the second dose.

3. The fusion molecule for use of claim 2, wherein the first dose comprises 2 to 30 pg of the TCR-anti-CD3 antibody fusion molecule and / or a second dose comprising 5 to 60 pg of the TCR- anti-CD3 antibody fusion molecule,4. The fusion molecule for use of claim 2 or 3, wherein the first dose comprises 10 to 25 pg of the TCR-anti-CD3 antibody fusion molecule.

5. The fusion molecule for use of any one of claims 2 to 4, wherein the second dose comprises 25 to 45 pg of the TCR-anti-CD3 antibody fusion molecule.

6. The fusion molecule for use of any preceding claim, wherein the maintenance dose comprises at least 60 pg of the TCR-anti-CD3 antibody fusion molecule, optionally wherein the maintenance dose comprises at least 100 pg, at least 200 pg, at least 300 pg, at least 3000 pg or about 300 to 3600 pg of the TCR-anti-CD3 antibody fusion molecule.

7. The fusion molecule for use of any of claims 2 to 6, wherein the method further comprises administering a third dose comprising at least 40 pg of the TCR-anti-CD3 antibody fusion molecule and wherein the maintenance dose comprises a larger amount of the TCR-anti-CD3 antibody fusion molecule than the third dose.

8. The fusion molecule for use of any preceding claim, wherein the alpha chain amino acid sequence has 100% identity to the amino acid sequence of SEQ ID NO:

59. The fusion molecule for use of any preceding claim, wherein the beta chain amino acid sequence has 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15.

10. The fusion molecule for use of any one of claims 2 to 9, wherein the first dose is administered once every 6 to 8 days, optionally wherein the second dose is administered 6 to 8 days following the first dose.11 . The fusion molecule for use of any one of claims 2 to 10, wherein the first dose is administered for 1 week to about 3 weeks, optionally wherein the first dose is administered for 1 week.

12. The fusion molecule for use of any one of claims 2 to 11 , wherein the second dose is administered for 1 week to about 3 weeks, optionally wherein the second dose is administered for 1 week.

13. The fusion molecule for use of any one of claims 2 to 12, wherein the maintenance dose is first administered 6 to 8 days following the second dose.

14. The fusion molecule for use of any preceding claim, wherein the maintenance dose is administered for about 2 weeks to about 20 weeks, optionally for about 10 weeks.

15. The fusion molecule for use of any preceding claim, wherein the maintenance dose is administered every other week.

16. The fusion molecule for use of any one of claims 2 to 15, wherein the first dose is administered for 1 week, the second dose is administered for 1 week and the maintenance dose is administered for 10 weeks17. The fusion molecule for use of any preceding claim, wherein the treatment includes coadministration with ART.

18. The fusion molecule for use of any preceding claim wherein the composition is administered by intravenous (IV) infusion.

19. The fusion molecule for use of any preceding claim, wherein the HIV is chronic.

20. A kit comprising:(i) at least one first container comprising a first dose of a heterodimeric TCR-anti CD3 antibody fusion molecule,(ii) at least one second container comprising a second dose of the heterodimeric TCR-anti CD3 antibody fusion molecule,(iii) one or more maintenance containers, each maintenance container comprising a maintenance dose of the heterodimeric TCR-anti CD3 antibody fusion molecule, and(iv) instructions for administering the heterodimeric TCR-anti CD3 antibody fusion molecule, wherein the heterodimeric TCR-anti CD3 antibody fusion molecule comprises (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.21 . The kit of claim 20, wherein the kit comprises:(i) one to five first containers, each first container comprising a first dose comprising 2 to 30 pg of a heterodimeric TCR-anti-CD3 antibody fusion molecule,(ii) one to five second containers, each second container comprising a second dose comprising 5 to 60 pg of the heterodimeric TCR-anti-CD3 antibody fusion molecule, and / or(iii) three or more maintenance containers, each maintenance container comprising a maintenance dose comprising at least 40 pg of the heterodimeric TCR- anti-CD3 antibody fusion molecule.

22. A heterodimeric TCR-antibody fusion molecule for use in a method of reducing HIV viral reservoir in a PLWH, wherein the TCR targets the SLYNTVATL-HLA-02 complex.

23. The heterodimeric TCR-antibody fusion molecule for use of claim 22, wherein the heterodimeric TCR-antibody fusion molecule is a heterodimeric TCR-anti-CD3 antibody fusion molecule comprising (a) an alpha chain amino acid sequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 5, and (b) a beta chain amino acidsequence that has at least 90%, at least 95% or 100% identity to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 15, wherein the alpha chain comprises complementarity-determining regions (CDRs) comprising alpha chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 2, 3 and 4 respectively, and the beta chain comprises beta chain CDRs 1 , 2 and 3 having the amino acid sequences of SEQ ID NOs: 8, 9 and 10 respectively.

Citation Information

Patent Citations

  • HIV-specific binding molecules and tcr

    WO2023156663A1

  • HIV Specific Binding Molecules

    US20230265191A1