Methods for detection, qualification, or monitoring of parkinson's disease
The use of tRFs with a consensus sequence motif in blood tests addresses the limitations of current Parkinson's disease diagnosis methods, offering a non-invasive, cost-effective means for early detection and monitoring disease progression.
Patent Information
- Application Number
- PCT/IL2025/050687
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-12
- Filing Date
- 2025-08-12
- Publication Date
- 2026-02-19
AI Technical Summary
Current methods for diagnosing Parkinson's disease are inadequate, often delayed, and lack sensitivity and specificity, requiring invasive procedures and are not cost-effective, making it difficult to identify early symptoms and monitor disease progression effectively.
Utilizing specific transfer RNA fragments (tRFs) carrying a consensus sequence motif, particularly RGTTCRA (SEQ ID NO: 1), to detect and monitor Parkinson's disease through non-invasive blood tests, analyzing their abundance and ratio to mitochondrial tRFs, enabling accurate diagnosis, staging, and monitoring disease progression.
Provides a simple, accurate, and cost-effective method for diagnosing and monitoring Parkinson's disease through blood tests, allowing early identification and tracking of disease severity and response to therapy.
Smart Images

Figure IL2025050687_19022026_PF_FP_ABST
Abstract
Description
METHODS FOR DETECTION, QUALIFICATION, OR MONITORING OF PARKINSON’S DISEASEREFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0001] The contents of the electronic sequence listing (HUJI-P-0109-PCT.xml; size: 5,643 bytes; and date of creation: August 10, 2025) is herein incorporated by reference in its entirety.CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 770,445, entitled “METHODS FOR DETECTION, QUALIFICATION, OR MONITORING OF PARKINSON’S DISEASE”, filed March 12, 2025, and of U.S. Provisional Patent Application No. 63 / 681,905, entitled “METHODS FOR DETECTION, QUALIFICATION, OR MONITORING OF PARKINSON’S DISEASE”, filed August 12, 2024, and of U.S. Provisional Patent Application No. 63 / 734,203, entitled “METHODS FOR DETECTING OR MONITORING TRAUMATIC BRAIN INJURY”, filed December 16, 2024. The contents of both applications are incorporated herein by reference in their entirety.FIELD OF THE INVENTION
[0003] The present invention relates generally to the field of Parkinson's disease diagnosis.BACKGROUND
[0004] Parkinson’s disease (PD) is the second most prevalent neurodeg enerative disease, consisting of a major clinical, social, and financial burden to society. The progressive movement disabilities and cognitive impairments in PD reflect premature death of dopaminergic neurons, especially in the substantia nigra pars compacta (SN). Oxidative stress notably accelerates this neuronal death, which is further accompanied by a dopaminergic-cholinergic imbalance, but diagnosis is often delayed and efforts to develop arelatively simple blood test which would identify early patients and offer a follow-up of worsening disease symptoms have so far failed, further hampering testing of novel diseasemodifying therapeutics for replacing the current palliative treatments.
[0005] Although some symptoms such as smell loss and rapid eye movement (REM) sleep disorders surface sometimes years before motor impairments, patients are largely unidentified until the more severe symptoms which involve motor impairments (bradykinesia, rest tremor, rigidity and alterations in gait and posture) arise and are reported by patients or their relatives. By that time, substantial damage has already occurred, raising an urgent need for development of a blood-based, inexpensive, and rapid pre-symptomatic diagnosis approach.
[0006] To reduce false positive results, validate the identification of true positive cases and limit the test costs, the desirable diagnosis should be based on blood-present biomarker(s) which offer high sensitivity and disease specificity. To meet these requirements, the levels of the pursued biomarkers should be noticeably altered in subjects already at the earliest suspicion of developing PD, and the testing process must be completely safe, inexpensive, handy, and rapid and free of side effects.
[0007] Many attempts sought single molecules presenting PD-related accumulation which would enable early diagnosis and reliable follow-up of PD’s symptoms severity, the latest consisting of accumulation in the cerebrospinal fluid (CSF) of the PD-related protein a- Synuclein (aSyn). Nonetheless, such methods require surgical CSF sampling procedures, involve cumbersome aSyn purification and detection procedures and are not sensitive enough.
[0008] Short non-coding tRNA-related fragments (tRFs; 16-50 bases) can be derived from either nuclear and / or mitochondrial tRNA genes, and may be divided into five principal tRF groups, generated by a number of nucleases: 5 ’-halves and 3 ’-halves formed by Angiogenin- mediated breakdown of tRNA molecules; and 5 ’-tRF, i-tRF and 3 ’-tRFs corresponding to the 5 ’-most, middle and 3 ’-most parts of tRNA molecules formed after cleavage by Angiogenin, Dicer and other, yet unknown nucleases.
[0009] There is still a great need for simple and accurate methods for detecting, qualifying, and monitoring Parkinson's disease, such as using tRFs as biomarkers in a blood test.SUMMARY
[0010] The current study included initiation of a search for PD-related alterations in tRF families carrying common sequence motifs that may potentially be involved in PD’s pathology and whose blood levels are altered along PD progression and respond to medical treatment(s) affecting its symptoms. The current study included the mining of tRF profdes from patients’ brain, blood, and CSF samples, including the current cohorts as well as NIH and PPMI-collected patients along PD initiation and progression.[Oi l] Transfer RNA fragments (tRFs) may be derived from either the nuclear or the mitochondrial genome. The current invention, in some embodiments, is based, at least in part, on the surprising findings of the accumulation of nuclear-originated tRFs carrying a consensus sequence motif and the decline of mitochondrial-originated tRFs reflecting the mitochondrial decline, thus provides an accurate, cost effective, and easy to perform method for diagnosing, monitoring, and staging of PD, such as by a blood test.
[0012] According to the first aspect, there is provided a method for diagnosing a mitochondrial-related disease or disorder in a subject, the method comprising determining in a sample obtained or derived from the subject, any one of: (i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF); (ii) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; and (iii) both (a) and (b), wherein any one of: the abundance determined in (a), the ratio determined in (b), and both, being greater than a pre-determined threshold, is indicative of the subject being afflicted with a mitochondrial-related disease, and wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long, thereby diagnosing a mitochondrial-related disease in the subject.
[0013] According to another aspect, there is provided a method for determining the abundance of tRF comprising the motif RGTTCRA (SEQ ID NO: 1) in a sample, the method comprising amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long.
[0014] According to another aspect, there is provided a method for treating PD in a subject in need thereof, the method comprising: (a) determining in a sample obtained or derivedfrom the subject whether any one of: (i) an abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1;); (ii) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; and (iii) both (i) and (ii), being greater than a pre-determined threshold, wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long; and (b) administering to the subject determined as having any one of: (i) the abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1;); (ii) the ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and the abundance of all tRFs in the sample; and (iii) both (i) and (ii), being greater than the pre-determined threshold, a therapeutically effective amount of an anti PD therapy, thereby treating PD in the subject.
[0015] According to another aspect, there is provided a method for monitoring progression of PD in a subject afflicted therewith, the method comprising: (a) determining in a plurality of samples obtained from the subject comprising a first sample and at least one second sample, wherein the at least one second sample is obtained from the subject chronologically after the first sample is obtained from the subject, any one of: (i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF) in a sample of the plurality of samples; (ii) a ratio between the abundance of the RGTTCRA- tRF (SEQ ID NO: 1) of (i) and an abundance of all tRFs in the sample of the plurality of samples; and (iii) both (i) and (ii), wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long; and (b) comparing any one of: the abundance of (i), the ratio of (ii), and (iii) determined in the first sample of the plurality of samples to any one of the abundance of (i), the ratio of (ii), and (iii) determined in the at least one second sample of the plurality of samples, thereby monitoring the progression PD in the subject.
[0016] According to another aspect, there is provided a method for determining efficacy of an anti PD therapy in a subject administered therewith, the method comprising: (a) determining in a plurality of samples obtained from the subject comprising a first sample and at least one second sample, wherein the at least one second sample is obtained from the subject chronologically after the first sample is obtained from the subject, any one of: (i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF) in a sample of the plurality of samples; (ii) a ratio between theabundance of the RGTTCRA-tRF (SEQ ID NO: 1) of (i) and an abundance of all tRFs in the sample of the plurality of samples; and (iii) both (i) and (ii) wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long; and (b) comparing any one of: the abundance of (i), the ratio of (ii), and (iii) determined in the first sample of the plurality of samples to any one of the abundance of (i), the ratio of (ii), and (iii) determined in the at least one second sample of the plurality of samples, thereby determining efficacy of an anti PD therapy in the subject.
[0017] According to another aspect, there is provided a method for diagnosing Parkinson’s disease (PD) in a subject, the method comprising determining in a sample obtained or derived from the subject, any one of: (a) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF); (b) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; and (c) both (a) and (b), wherein any one of: the abundance determined in (a), the ratio determined in (b), and both, being greater than a pre- determined threshold, is indicative of the subject being afflicted with PD, and wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long, thereby diagnosing PD in the subject.
[0018] According to another aspect, there is provided a method for determining the severity of PD in a subject afflicted therewith, the method comprising: (i) determining in a sample obtained or derived from the subject, any one of: (a) an abundance of RGTTCRA-tRF (SEQ ID NO: 1); (b) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; and (c) both (a) and (b); and (ii) comparing a value determined for any one of (a) to (b) to a pre-determined threshold, wherein any one of: (1) the value being lower than the pre-determined threshold is indicative of the subject being afflicted with a mild form of PD; (2) the value being equal to the pre-determined threshold is indicative of the subject being afflicted with a moderate form of PD; and (3) the value being greater than the pre-determined threshold is indicative of the subject being afflicted with immoderate form of PD, and wherein the determining comprises amplifying a nucleic acid product comprising the motif and being 14 to 26 base pairs long, thereby determining the severity of PD in the subject afflicted therewith.
[0019] In some embodiments, the mitochondrial-related disease is PD.
[0020] In some embodiments, the mitochondrial-related disease is induced by or comprises traumatic brain injury (TBI).
[0021] In some embodiments, the amplifying is by polymerase chain reaction (PCR).
[0022] In some embodiments, the method further comprises determining the abundance of MT-tRFs in the sample.
[0023] In some embodiments, determining the abundance of MT-tRFs in the sample comprises amplifying MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0024] In some embodiments, the method further comprises comparing the determined abundance of the tRF comprising the motif RGTTCRA (SEQ ID NO: 1) to the abundance of the MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0025] In some embodiments, determining is in a plurality of samples being obtained or derived from the subject in a plurality of sampling events.
[0026] In some embodiments, the subject is administered with an effective amount of an anti PD therapy.
[0027] In some embodiments, the method further comprises comparing any one of: the abundance of (a), the ratio of (b), and (c) determined in a first sample of the plurality of samples to any one of the abundance of (a), the ratio of (b), and (c) determined in at least one second sample of the plurality of samples, wherein the at least one second sample of the plurality of samples is obtained from the subject chronologically after the first sample of the plurality of samples is obtained from the subject, thereby determining efficacy of the anti PD therapy in the subject.
[0028] In some embodiments, the abundance of (a), the ratio of (b), and (c) determined in the at least one second sample of the plurality of samples is lower than any one of the abundance of (a), the ratio of (b), and (c) determined in the first sample of the plurality of samples, is indicative of the anti PD therapy being effective in the subject.
[0029] In some embodiments, the sample comprises: whole blood, plasma, or cerebrospinal fluid (CSF) of the subject.
[0030] In some embodiments, the tRFs are nuclear genome-originated tRFs.
[0031] In some embodiments, all tRFs in the sample is or comprises all mitochondrial genome-originated tRFs (MT-tRFs) in the sample.
[0032] In some embodiments, MT-tRFs comprise the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0033] In some embodiments, tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise the nucleic acid sequence GGTCCCTGGTTCAA (SEQ ID NO: 2).
[0034] In some embodiments, determining is in vitro or ex vivo determining.
[0035] In some embodiments, determining is by a method selected from the group consisting of: small RNA-sequencing, quantitative polymerase chain reaction (qPCR), and polynucleotide hybridization.
[0036] In some embodiments, the polynucleotide hybridization comprises pre-prepared chip, Nanostring test, or both.
[0037] In some embodiments, all tRFs in the sample are or comprise all mitochondrial genome-originated tRFs (MT-tRFs) in the sample.
[0038] In some embodiments, anti PD therapy comprises deep brain stimulation.
[0039] In some embodiments, anti PD therapy comprises at least one compound selected from the group consisting of: 1-3,4-dihydroxyphenylalanine (L-DOPA), monoamine oxidase B inhibitor, a DOPA decarboxylase inhibitor, a catechol-O-methyltransferase (COMT) inhibitor, bromocriptine, pergolide, pramipexole, ropinirole, piribedil, cabergoline, apomorphine, lisuride, and any combination thereof.
[0040] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification,including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0041] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
[0042] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the figures and by study of the following detailed description.BRIEF DESCRIPTION OF THE FIGURES
[0043] Figures 1A-1F include illustrations, schemes, and graphs showing that nuclear- originated RGTTCRA-tRFs (SEQ ID NO: 1) accumulate but MTtRFs decline in PD patients’ CSF. (1A) Postmortem CSF samples from 63 PD male (blue) and female (pink) patients and 55 matched controls (doughnut charts) were analyzed. (IB) Each dot is a tRF. X: log2(Fold Change) of PD / Ctrl levels. Y:-loglO(FDR adjusted p value). Horizontal and vertical lines: FDR<0.05; log2(FC)>l or <-l. Background colors: NtRFs (blue), MTtRFs (green). Dot colors: tRFs’ length. (1C) Scheme of tRNA breakdown into tRF types by Angiogenin (Ang) or Dicer (DICR). (ID) The consensus motif sequence identified by the MEME tool. Fetters heights: Nucleotides conservation among upregulated NtRFs. Purple square: the RGTTCRA motif. (IE) PD CSF NtRFs segregated into RGTTCRA-carrying and lacking tRFs (Axes and colors as in B). Blue thick line: FDR=0.05. Grey line: unadjusted p=0.05. (IF) Y axis: median levels (counts per million) of nuclear RGTTCRA-tRF (SEQ ID NO: 1) longer than 30 bases (left; blue background) and MT-TRFs (right; green background). Healthy control donors (grey, n=53); AD (green, n=53), PD patients (blue, n=46). Dashed lines: median of all tRF levels in the dataset.
[0044] Figs. 2A-2D include a scheme and graphs showing that in the substantia nigra (SN), RGTTCRA-tRF (SEQ ID NO: 1) levels correlate with Eewy bodies accumulation, diseaseduration and MT-tRNA decline in PD. (2A) Graphical abstract. (2B) Mitochondrial tRFs decline and RGTTCRA-tRFs (SEQ ID NO: 1) elevation associates with Lewy body scores. X axis: log2(foldchange) for high vs. low Lewy bodies score. Y axis: -loglO(FDR adjusted p values). Color scale: tRF lengths. Horizontal blue line: FDR=0.05. Green and blue backgrounds: MTtRFs, NtRFs. Note the massive PD-related increase in long nuclear- originated RGTTCRA-tRFs (SEQ ID NO: 1). (2C-2D) SN RGTTCRA-tRFs (SEQ ID NO: 1) and MT-tRF fractions increase with disease duration (Y, X axes). Blue: PD patients; orange: SWEDD-like patient.
[0045] Figs. 3A-3F include a scheme and graphs showing that SN RGTTCRA-tRF levels correlate with Eewy bodies accumulation and PD duration. (3A) Graphical abstract: Blood taken from Early (PPMI) patients shows elevated RGTTCRA-tRFs (SEQ ID NO: 1) and reduced MT-tRFs in PD vs. controls, whereas blood from advanced (post-mortem; NBB) patients showed elevation of both tRF groups and correlation to Eewy body scores. (3B-3C) Correlation of % RGTTCRA-tRFs (SEQ ID NO: 1) and %MT-tRFs from NBB advanced post-mortem samples with the Eewy body score of each patient (X axis). (3D-3E) The RGTTCRA-tRF (SEQ ID NO: 1); purple axes) and MT-tRF (green axes) percentages in PD and Control groups (normalized to the mean in the control group), in blood samples from both living (PPMI; Early) and post-mortem subjects (NBB; same samples as in 3B and 3C; Advanced). The PPMI subjects are classified as “Idiopathic” (i.e., not carrying any PD- related mutation) or “Genetic” (namely, carrying ERRK2, GBA or SNCA mutation). (3F) As in 3D and 3E, albeit when the Y axis shows RGTTCRA-tRFs (SEQ ID NO: l) / MT-tRFs ratio.
[0046] Figs. 4A-4E includes schemes and graphs showing that RGTTCRA-tRFs (SEQ ID NO: 1) decline in deep brain stimulation (DBS)-treated PD patients and both RGTTCRA- tRFs (SEQ ID NO: 1) and MT-tRFs respond to electrophysiological stimuli. (4A) Graphical abstract: RGTTCRA-tRFs (SEQ ID NO: 1) are elevated in mutation-carrying PD patients’ blood and reduced back to basal levels in matched DBS-treated patients. (4B) Blood RGTTCRA-tRF (SEQ ID NO: 1) levels in apparently healthy control carriers of PD-related mutations (Ctrl; grey; n=9) and in PD patients, mostly carriers of mutations in the ERRK2 gene and some with a mutated GBA gene (PD; blue; n=30), with and without DBS (black and red lines; n=10, n=20). Y axis: mean blood RGTTCRA-tRFs (SEQ ID NO: 1) levels(white rhombuses). (4C) RGTTCRA-tRFs (SEQ ID NO: 1) blood levels in healthy controls (grey; left boxplot; n=3) and PD patients with DBS-on (blue. Middle, n=2) and one hour post DBS-off, when tremor resumes (right; n=3). (4D) The share of RGTTCRA-tRFs (SEQ ID NO: 1) (purple; upper panel) and MT-tRFs (green; lower panel) in whole cells (left) and ribosome-bound fractions (right) of RNA-seq from resting cells, immediately after depolarization (Dep) or two hours later (2h pDP). Each column represents a sample. Black lines represent RGTTCRA-tRF (SEQ ID NO: 1) or MT-tRF mean percentage of samples. (4E) Same as in 4D when Y axis shows ratios between RGTTCRA-tRFs and MT-tRFs.
[0047] Figs. 5A-5F include a scheme and graphs showing that RGTTCRA-tRFs (SEQ ID NO: 1) decline in DBS-treated PD patients and segregate prodromal PD patients from healthy controls. (5A) Graphical abstract: Ratio between RGTTCRA-tRFs (SEQ ID NO: 1) to MT-tRFs, along with motor activity changes (section III) of the UPDRS and the Hohen and Yahr (H&Y) scores served to segregate 60 PPMI prodromal patients and 129 controls. (5B) ROC curve classification of optimally matched Prodromal and control patients (n= 60 in each), using both clinical measurements (UPDRS III and H&Y) and tRFs (RGTTCRRF- tRFs (SEQ ID NO: l) / MT-tRFs ratio; red), only tRFs (yellow) or only clinical measurements (purple), as well as classification based on tRFs and clinical measurements, albeit with scrambled tags. The tRF-based classification was based on RGTTCRA-tRFs (SEQ ID NO: 1) including the GGTCCCTGGTTCAA (SEQ ID NO: 2) and MT-tRFs carrying the TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3) sequences. (5C) ROC area under the curve (AUC) values of 100 permutations of 5B after full matching of patients and controls (n=60, n=l 89) where each time 60 patients were compared to a different sample subset of 60 controls. (5D) Ratio between the two B tRF groups in Prodromal patients (orange) and controls (grey) separated by their ethnicity and genetic backgrounds. (5E) As in 5B for PD patients (n=193) and controls (n=255). (5F) Correlation with time of the ratio between RGTTCRA-tRFs and MT-tRFs (left; black axes), MT-tRFs alone (middle; green axes) and RGTTCRA-tRFs (SEQ ID NO: 1) alone (right; purple axes) in Controls (grey; n=405), SWEDD (pink; n=56), Prodromal (orange; n=62) and advanced PD (blue; n=583) subjects with at least 3 timepoints available. Each dot represents a patient. Positive or negative correlations represent increase or decrease with time of the measured sequences.
[0048] Figs. 6A-6E include a scheme, graphs, structure illustrations, and fluorescent micrographs showing that RGTTCRA-tRFs (SEQ ID NO: 1) co-hybridize with a ribosomeessential tRF and the large ribosomal subunit. (6A) Graphical abstract: RGTTCRA-tRFs (SEQ ID NO: 1; purple) can hybridize with a Ribosome-essential tRF (Ribo-essential; cyan) as well as with secondary structure-free regions in the 18S and 28S ribosomal RNAs, leading to a ‘dual lock’ translational arrest. (6B) Right: Predicted interaction between an RGTTCRA-tRF (SEQ ID NO: 1 ; purple) and the Ribo-essential tRF (cyan). Orange Asterix: the RGTTCRA (SEQ ID NO: 1) motif nucleotides. Left: Total binding energy (Y axis) of all CSF-expressed RGTTCRA (SEQ ID NO: l)-lacking (green) or RGTTCRA (SEQ ID NO: l)-carrying (purple) tRFs to the Ribo-essential tRF. (6C) Secondary structures of the 18S and 28S rRNA segments including motif-complementary sequences (red), and total binding energy for their interaction with RGTTCRA-tRFs (SEQ ID NO: 1) and all other tRFs (as in 6B). (6D) localization of RGTTCRA-tRFs (SEQ ID NO: 1) upon endogenous expression. Shown are the nucleus (blue; DAPI) the cytoplasm (green) and in-situ hybridization staining for RGTTCRA-tRFs (SEQ ID NO: 1; red). (6E) Same as in 6D upon overexpression of RGTTCRA-tRF (SEQ ID NO: 1) mimic (50 nM).
[0049] Figs. 7A-7B include plots showing that MTtRFs decline and NtRFs elevate in PD vs. controls. Volcano plots for male (7A) and Female (7B) CSF samples. Each dot is a tRF. X: log2(Fold Change) of PD / Ctrl levels. Y:-loglO(FDR adjusted p value). Horizontal and vertical lines: FDR<0.05; log2(FC)>l or <-l. Left: NtRFs, right: MTtRFs. Dot colors: tRFs’ length.
[0050] Figs. 8A-8B include schemes and plots showing distinct expression patterns for different tRF types. (8A) A non-limiting scheme of tRNA breakdown into tRF types by Angiogenin (Ang) or Dicer (DICR). (8B) Segregation of PD-modified tRFs (Fig. IB) to subtypes as in 8A. Each dot is a tRF. X: log2(Fold Change) of PD / Ctrl levels. Y:-logl0(FDR adjusted p value). Background colors: NtRFs (blue), MTtRFs (green).
[0051] Figs. 9A-9B include plots showing that RGTTCRA-tRFs (SEQ ID NO: 1) are elevated both in Male and Female PD patients. Volcano plots for male (9 A) and Female (9B) CSF samples. PD CSF NtRFs segregated into RGTTCRA (SEQ ID NO: l)-carrying and lacking tRFs. Blue thick line: FDR=0.05. Grey line: unadjusted p=0.05. Each dot is a tRF.X: log2(Fold Change) ofPD / Ctrl levels. Y:-loglO(FDR adjusted p value). Dot colors: tRFs’ length.
[0052] Fig. 10 includes a graph showing no correlation between %RGTTCRA-tRFs (SEQ ID NO: 1) to patient’s age (SN). No correlation between the percentage of RGTTCRA-tRFs (SEQ ID NO: 1) (Y) in PD SN samples to the patient’s age (X). Color indicates PD (blue) and SWEDD-like (orange) patients.
[0053] Figs. 11A-11B includes graphs showing that SWEDD-like patients express seemingly healthy levels of TH and DAT. Tyrosine hydroxylase (TH, 11 A) and dopamine transporter (DAT, 11B) mRNA levels (Y; counts per million) in PD and SWEDD-like patients’ SN. X axis: distance from the linear fit. Note that the SWEDD-like patient is distant from the fit and shows apparently healthy levels of TH and DAT.
[0054] Figs. 12A-12B include graphs showing that general tRFs and MT-tRNA decline with PD progression. (12A) Sums of all tRFs for the same patients (black), RGTTCRA-tRFs (SEQ ID NO: 1; purple) and MT-tRFs normalized to their sums in sample S09 / 195 (shortest PD-duration; Y axis) in correlation with PD-duration (X axis). Note sharp decline of total tRFs with disease progression. Orange: SWEDD-like patient. (12B) SN samples of healthy controls with (grey) or without (pink) healthy-reflecting levels of TH in their SN, compared to PD patients (blue) and SWEDD-like patients (orange) from a cohort of NBB Long-RNA- seq (n=25). Y axis: LoglO of sum of all expressed MT-tRNAs. X axis: PD duration in years.
[0055] Figs. 13A-13B include graphs showing that MT-tRFs show no significant change upon DBS stimuli. (13A) Blood MT-tRF levels in apparently healthy control carriers of PD- related mutations (Ctrl; grey; n=9) and in PD patients, mostly carriers of mutations in the LRRK2 gene and some with a mutated GBA gene (PD; blue; n=30), with and without DBS (black and red lines; n=l l, n=19). Y axis: mean blood MT-tRFs levels (white rhombuses). (13B) MT-tRFs blood levels in healthy controls (grey; left boxplot; n=3) and PD patients with DBS-on (blue. Middle, n=2) and one hour post DBS-off, when tremor resumes (right; n=3).
[0056] Figs. 14A-14B include graphs showing that 3’ and i-tRFs present enriched ribosome bound RGTTCRA-tRFs which is impaired 2 h pDP. GSE155727 dataset of ribosomal profiling and short-RNA-seq from SHSY cells. Counts per million of 3 ’-tRFs and i-tRFslacking this motif (green) and carrying it (purple), from ribosome associated RNA-seq (14A) or bulk short RNA-seq (14B) in resting cells, or in cells right after or two hours post depolarization (2 h pDP).
[0057] Figs. 15A-15B include graphs showing that RGTTCRA / MT-tRF (SEQ ID NO: 1) score separate prodromal and control even without normalization and UPDRS.III score show similar, yet less significant, trends to RGTTCRA / MT-tRF s (SEQ ID NO: 1) score. (15A) Ratio between RGTTCRA-tRFs (SEQ ID NO: 1) to MT-tRF in Prodromal patients (orange; n=60) and controls (grey; n=129) separated by their ethnicity and genetic backgrounds. (15B) UPDRS.III (motor) score of optimally matched Prodromal patients (orange; n=60) and controls (grey; n=60) separated by their ethnicity and genetic backgrounds.
[0058] Fig. 16 includes a scheme and a graph showing ribosomal bound tRFs. Interaction of motif-carrying tRFs with ribosomes based on the GSE113751 dataset of short RNA-seq from ribosomes pulldown in HeLa (red), HCT116 (green) and HEK293T (blue) cells. Cells were either untreated or starved for Arg(inine) or Leu(cine) for three or six hours. Left Y axis points show RGTTCRA- tRF (SEQ ID NO: 1) fractions among all tRFs. Right Y axis: total number of reads per sample. Horizontal dashed line: percent RGTTCRA-tRFs (SEQ ID NO: 1) among all tRFs.
[0059] Figs. 17A-17D include Venn diagrams and a heatmap showing that different tissues expressed different sets of tRFs. (17A) All tRFs in all tissues. Numbers show percentage of the tRFs in the specific intersection from all tRFs in all tissues together (i.e., all percentages in the diagram sum together to 100%). (17B) As in 17A for only MT-tRFs. (17C) As in 17A for only RGTTCRA-tRFs (SEQ ID NO: 1). (17D) Substruction of 17A from 17B (MT; left column) and of 17A from 17C (RGTTCRA (SEQ ID NO: 1); right column). Colors show the difference of percentages between the relevant intersection to its correspondent in 17A.
[0060] Fig. 18 includes a graph showing random motif scoring. This graph supports the notion that the AUC resulting from the tRF-score reflects a biological phenomenon.
[0061] Fig. 19 includes a graph showing that using only either the nuclear genome- originated tRFs or the MT-tRFs, is much less advantageous over the ratio thereof (nuclear genome-originated tRFs to MT-tRFs).
[0062] Fig. 20 includes a box plot showing levels of the RGTTCRA-tRFs (SEQ ID NO: 1) motif as measured in saliva samples from 42 mixed martial arts (MMA) fighters, which were taken one week and one day prior to- or one hour, 2-3 days, one week or more than three weeks post MMA combat. Some samples were collected from fighters which suffered a direct head injury during combat(s).DETAILED DESCRIPTION
[0063] According to one aspect, there is provided a method for diagnosing a mitochondrial- related disease or disorder in a subject.
[0064] As used herein, the term “mitochondrial-related disease or disorder” refers to a group of conditions characterized by dysfunction of the mitochondria, which are cellular organelles responsible for energy production. These diseases or disorders may result from mutations in mitochondrial DNA or nuclear DNA that affect mitochondrial function, structure, or number. Mitochondrial-related diseases or disorders may manifest in various organ systems, particularly those with high energy demands such as the brain, heart, muscles, and liver. Symptoms may include, but are not limited to, neurological problems, muscle weakness, vision and hearing impairments, developmental delays, and metabolic abnormalities. The severity and presentation of mitochondrial -related diseases or disorders can vary widely among individuals, even within the same family.
[0065] In some embodiments, a mitochondrial-related disease or disorder is selected from: Parkinson’s disease (PD), Mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes (MELAS), Myoclonic epilepsy with ragged red fibers (MERRF), Leigh syndrome, Kearns-Sayre syndrome (KSS), Neuropathy, ataxia, and retinitis pigmentosa (NARP), Leber's hereditary optic neuropathy (LHON), Mitochondrial DNA depletion syndrome, Pearson syndrome, Alpers-Huttenlocher syndrome, Chronic progressive external ophthalmoplegia (CPEO), Mitochondrial neurogastrointestinal encephalopathy (MNGIE), Barth syndrome, Coenzyme Q10 deficiency, Mitochondrial complex I deficiency, Mitochondrial complex III deficiency, Mitochondrial complex IV deficiency (cytochrome c oxidase deficiency), Mitochondrial complex V deficiency (ATP synthase deficiency), Mitochondrial DNA deletion syndrome, Mitochondrial myopathy, Friedreich's ataxia (whileprimarily considered a neurodegenerative disorder, it involves mitochondrial dysfunction), and any combination thereof.
[0066] In some embodiments, a mitochondrial-related disease or disorder is induced by traumatic brain injury (TBI). In some embodiments, a mitochondrial-related disease or disorder comprises by TBI. In some embodiments, a mitochondrial-related disease or disorder is induced by and / or comprises TBI.
[0067] According to another aspect, there is provided a method for diagnosing Parkinson’s disease (PD) in a subject.
[0068] According to another aspect, there is provided a method for determining the severity of PD in a subject afflicted therewith.
[0069] According to another aspect, there is provided a method for treating PD in a subject in need thereof.
[0070] According to another aspect, there is provided a method for determining efficacy of an anti PD therapy in a subject in need thereof.
[0071] In some embodiments, the method comprises determining in a sample obtained or derived from the subject: (a) an abundance or level of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF); (b) a ratio between the abundance or level of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; and (c) both (a) and (b).
[0072] In some embodiments, the abundance determined in (a), the ratio determined in (b), or both, being greater than a pre-determined threshold, is indicative of the subject being afflicted with PD. In some embodiments, the abundance determined in (a), the ratio determined in (b), or both, being lower than a pre-determined threshold, is indicative of the subject not being afflicted with PD.
[0073] In some embodiments, comprises: (i) determining in a sample obtained or derived from the subject: (a) an abundance of RGTTCRA-tRF (SEQ ID NO: 1); (b) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; or (c) both (a) and (b); and (ii) comparing a value determined for (a), (b) or (c) to a pre-determined threshold.
[0074] In some embodiments, the value being lower than the pre-determined threshold is indicative of the subject being afflicted with a mild form of PD; the value being equal to the pre-determined threshold is indicative of the subject being afflicted with a moderate form of PD; or the value being greater than the pre-determined threshold is indicative of the subject being afflicted with immoderate form of PD.
[0075] In some embodiments, mild form of PD comprises or is characterized by low symptom(s) of PD.
[0076] In some embodiments, a PD subject is characterized by increased or accumulating levels or abundance of RGTTCRA-tRF (SEQ ID NO: 1). In some embodiments, a PD subject is characterized by reduced or declining levels or abundance of mitochondrial genome-originated tRFs. In some embodiments, a PD subject is characterized by increased or accumulating levels or abundance of RGTTCRA-tRF (SEQ ID NO: 1) and reduced or declining levels or abundance of mitochondrial genome-originated tRFs. In some embodiments, a PD subject is characterized by a ratio between increased or accumulating levels or abundance of RGTTCRA-tRF (SEQ ID NO: 1) and reduced or declining levels or abundance of mitochondrial genome-originated tRFs being greater than the pre-determined threshold.
[0077] In some embodiments, a pre-determined threshold is a range of pre-determined thresholds. In some embodiments, a pre-determined threshold is a value with a standard deviation, standard error, or both. In some embodiments, a pre-determined threshold is a value ± 1-20%, 1-5%, 1-10%, 1-15%, 5-10%. 5-15%, or 5-20%. Each possibility represents a separate embodiment of the invention.
[0078] In some embodiments, determining is in a plurality of samples being obtained or derived from the subject. In some embodiments, the plurality of samples are obtained, collected, sampled, or any equivalent thereof, from the subject in a plurality of sampling events. In some embodiments, the plurality of sampling events are at least 1 day, 3 days, 5 days, 7 days, 14 days, 30 days, 2 months, 3 months, 5 months, 6 months, 8 months, 10 months, or 1 year apart, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0079] In some embodiments, the subject is administered with an effective amount of anti PD therapy.
[0080] As used herein, the term “anti PD therapy” encompasses any procedure, stimulation, drug, etc., which at least alleviates one or more symptoms of PD or prevents the diseasespecific potentiation of such symptoms.
[0081] Compounds and means for alleviating PD symptoms would be apparent to one of ordinary skill in the art, such as further specified herein below.
[0082] In some embodiments, the subject is administered with an effective amount of anti TBI therapy.
[0083] As used herein, the term “anti TBI therapy” encompasses any procedure, stimulation, drug, etc., which at least alleviates one or more symptoms of TBI, including the risk of one or more epileptic seizures.
[0084] Compounds and means for alleviating TBI symptoms would be apparent to one of ordinary skill in the art, such as further specified herein below.
[0085] In some embodiments, the method further comprises comparing: the abundance of(a), the ratio of (b), or (c) determined in a first sample of the plurality of samples to the abundance of (a), the ratio of (b), or (c) determined in at least one second sample of the plurality of samples.
[0086] As used herein, the term “plurality” refers to any integer being equal to or greater than 2.
[0087] In some embodiments, at least one second sample of the plurality of samples is obtained from the subject chronologically after or later than the first sample of the plurality of samples.
[0088] In some embodiments, an abundance of (a), a ratio of (b), or (c) determined in at least one second sample of a plurality of samples being lower than an abundance of (a), a ratio of(b), or (c) determined in a first sample of a plurality of samples, is indicative of an anti PD therapy being effective in a subject.
[0089] In some embodiments, an abundance of (a), a ratio of (b), or (c) determined in at least one second sample of a plurality of samples being equal to or greater than an abundance of (a), a ratio of (b), or (c) determined in a first sample of a plurality of samples, is indicative of an anti PD therapy being ineffective in a subject.
[0090] In some embodiments, tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise more than 10 nucleobases, more than 15 nucleobases, more than 17 nucleobases, more than 18 nucleobases, or more than 20 nucleobases, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0091] In some embodiments, tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise 14 to 30 nucleobases, 15 to 29 nucleobases, 14 to 28 nucleobases, 15 to 27 nucleobases, 14 to 20 nucleobases, 14 to 22 nucleobases, 14 to 23 nucleobases, or 15 to 26 nucleobases. Each possibility represents a separate embodiment of the invention. Determining the presence of a tRF comprising the motif RGTTCRA (SEQ ID NO: 1) and being of a length of e.g., at least 14 nucleobases and / or at most 30 nucleobases, may be advantageous, as exemplified hereinbelow (e.g., Example 10, and Table 1).
[0092] In some embodiments, a sample comprises any bodily fluid, biopsy, or both, being obtained or derived from a subject.
[0093] In some embodiments, the method further comprises a step preceding or before the determining step, comprising obtaining a sample from the subject.
[0094] In some embodiments, the sample comprises: saliva, whole blood, plasma, or cerebrospinal fluid (CSF) of the subject, including any fraction, portion, extract, homogenate, or any combination thereof.
[0095] In some embodiments, the sample comprises an extract of nucleic acids of: saliva, whole blood, plasma, or cerebrospinal fluid (CSF), of the subject.
[0096] In some embodiments, tRFs comprise nuclear genome-originated tRFs. In some embodiments, the sample comprises nuclear genome-originated tRFs. In some embodiments, nuclear genome-originated tRFs are tRFs derived from a cell nucleus. In some embodiments, the cell is a cell of a subject. In some embodiments, the cell is a blood cell. In some embodiments, the tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) are enriched,prominent, or the like, in a cell nucleus. In some embodiments, nuclear genome-originated tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) are tRFs enriched, prominent, or the like, in a cell nucleus.
[0097] In some embodiments, the method comprises distinguishing, differentiating, isolating, enriching, or any combination thereof, nuclear genome- originated tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) from all tRFs in the sample.
[0098] In some embodiments, all tRFs in a sample comprise or consist of all mitochondrial genome-originated tRFs (MT-tRFs) in the sample. In some embodiments, MT-tRFs comprise tRFs derived from a mitochondrial portion or fraction of a cell, as disclosed herein.
[0099] In some embodiments, MT-tRFs comprise the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0100] In some embodiments, tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise the nucleic acid sequence GGTCCCTGGTTCAA (SEQ ID NO: 2). In some embodiments, nuclear genome-originated tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise the nucleic acid sequence GGTCCCTGGTTCAA (SEQ ID NO: 2).
[0101] In some embodiments, determining is in vitro or ex vivo determining.
[0102] In some embodiments, the method is performed in vitro or ex vivo.
[0103] It would be apparent to a person of ordinary skill in the art that determining in vitro or ex vivo is performed in a tube, a plate, or any equivalent thereof, and not in a subject's body.
[0104] In some embodiments, determining is by a method selected from: small RNA- sequencing, quantitative polymerase chain reaction (qPCR), or polynucleotide hybridization.
[0105] In some embodiments, any method known to a person of skill in the art for detecting and / or quantifying a nucleic acid sequence of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) are contemplated by the current invention.
[0106] In some embodiments, the method utilized polynucleotide amplification.
[0107] In some embodiments, the method utilizes polynucleotide hybridization.
[0108] In some embodiments, polynucleotide hybridization comprises usage of pre-prepared chip(s) (e.g., a microarray), Nanostring test, or both.
[0109] In some embodiments, the method further comprises a step comprising administering to a subject diagnosed with PD, a therapeutically effective amount of an anti PD therapy.
[0110] In some embodiments, the method comprises: (a) determining in a sample obtained or derived from the subject whether: (i) an abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1 ;); (ii) a ratio between an abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in the sample; or (iii) both (i) and (ii), being greater than a pre-determined threshold; and (b) administering to the subject determined as having: (i) the abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1); (ii) the ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and the abundance of all tRFs in the sample; and (iii) both (i) and (ii), being greater than the pre-determined threshold, a therapeutically effective amount of an anti PD therapy.
[0111] In some embodiments, anti PD therapy comprises deep brain stimulation.
[0112] In some embodiments, anti PD therapy comprises at least one compound selected from: 1-3,4-dihydroxyphenylalanine (L-DOPA), monoamine oxidase B inhibitor, a DOPA decarboxylase inhibitor, a catechol-O-methyltransferase (COMT) inhibitor, bromocriptine, pergolide, pramipexole, ropinirole, piribedil, cabergoline, apomorphine, lisuride, or any combination thereof.
[0113] Means and methods for treating TBI are common and would be apparent to one of ordinary skill in the art. Non-limiting examples of such methods include, but are not limited to, medications (Diuretics, Anti-seizure drugs, and Coma-inducing drugs), Surgery (Removing clotted blood (hematomas), Repairing skull fractures, and Opening a window in the skull (craniotomy), Stem cell therapy, Neurostimulation (transcranial magnetic stimulation (TMS) and deep brain stimulation (DBS)), Hyperbaric oxygen therapy (HBOT), or any other treatment acknowledged by the skilled artisan as suitable for treating TBI.
[0114] According to another aspect, there is provided a method for monitoring progression of PD in a subject afflicted therewith.
[0115] According to another aspect, there is provided a method for determining efficacy of an anti PD therapy in a subject administered therewith.
[0116] According to another aspect, there is provided a method for monitoring progression of TBI in a subject afflicted therewith.
[0117] According to another aspect, there is provided a method for determining efficacy of an anti TBI therapy in a subject administered therewith.
[0118] In some embodiments, the method comprises: (a) determining in a plurality of samples obtained from the subject comprising a first sample and at least one second sample, wherein the at least one second sample is obtained from the subject chronologically after the first sample is obtained from the subject: (i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF) in a sample of the plurality of samples; (ii) a ratio between the abundance of the RGTTCRA-tRF (SEQ ID NO: 1) of (i) and an abundance of all tRFs in the sample of the plurality of samples; or (iii) both (i) and (ii); and (b) comparing any one of: the abundance of (i), the ratio of (ii), and (iii) determined in the first sample of the plurality of samples to any one of the abundance of (i), the ratio of (ii), and (iii) determined in the at least one second sample of the plurality of samples.
[0119] In some embodiments, an abundance of (i), a ratio of (ii), or (iii) determined in at least one second sample of a plurality of samples being equal to or lower than an abundance of (i), a ratio of (ii), or (iii) determined in a first sample of a plurality of samples, is indicative of stagnation, remission, slowing down, reversal, any equivalent thereof, or any combination thereof, of PD in a subject.
[0120] In some embodiments, an abundance of (i), a ratio of (ii), or (iii) determined in at least one second sample of a plurality of samples being greater than an abundance of (i) a ratio of (ii), or (iii) determined in a first sample of a plurality of samples, is indicative of worsening, progression, advancement, acceleration, any equivalent thereof, or any combination thereof, of PD in a subject.
[0121] In some embodiments, an abundance of (i), a ratio of (ii), or (iii) determined in at least one second sample of a plurality of samples being lower than an abundance of (i), aratio of (ii), or (iii) determined in a first sample of a plurality of samples, is indicative of an anti PD therapy being effective in a subject.
[0122] In some embodiments, an abundance of (i), a ratio of (ii), or (iii) determined in at least one second sample of a plurality of samples being equal to or greater than an abundance of (i), a ratio of (ii), or (iii) determined in a first sample of a plurality of samples, is indicative of an anti PD therapy being ineffective in a subject.
[0123] According to another aspect, there is provided a kit for diagnosing a mitochondrial- related disease or condition. In some embodiments, the kit is for determining the abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1); (ii) a ratio between an abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs; or (iii) both (i) and (ii), in a sample. In some embodiments, the sample is obtained or derived from a subject.
[0124] According to another aspect, there is provided a kit for diagnosing PD, determining severity of PD, or both. In some embodiments, the kit is for determining the abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1); (ii) a ratio between an abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs; or (iii) both (i) and (ii), in a sample. In some embodiments, the sample is obtained or derived from a subject.
[0125] According to another aspect, there is provided a kit for diagnosing TBI, determining severity of TBI, or both. In some embodiments, the kit is for determining the abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1); (ii) a ratio between an abundance of the RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs; or (iii) both (i) and (ii), in a sample. In some embodiments, the sample is obtained or derived from a subject.
[0126] In some embodiments, the kit comprises primers, e.g., DNA primers for amplifying: (i) tRFs or complementary DNA (cDNA) thereof comprising the motif RGTTCRA (SEQ ID NO: 1); (ii) total or all tRFs or cDNA thereof, of a sample, in a polymerase chain reaction (PCR).
[0127] In some embodiments, PCR comprises denaturing double-stranded DNA in a sample (to separate the complementary strands), annealing the primers to the dissociated DNA strands, and extension reaction from the primers catalyzed by a thermostable DNA polymerase, the cycle is then repeated.
[0128] In one embodiment, a kit as described herein further comprises a DNA polymerase. In one embodiment, a kit as described herein further comprises a thermostable DNA polymerase.
[0129] In some embodiments, the primer (DNA primer or PCR primer) comprises the DNA sequence RGTTCRA (SEQ ID NO: 1).
[0130] In some embodiments, the primer (DNA primer or PCR primer) comprises the DNA sequence: GGTCCCTGGTTCAA (SEQ ID NO: 2). In some embodiments, the primer comprises the DNA sequence TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0131] In some embodiments, the DNA sequence: GGTCCCTGGTTCAA (SEQ ID NO: 2) is suitable for amplifying nuclear genome-originated tRFs, the abundance of which is indicative of PD affliction, severity thereof or both.
[0132] In some embodiments, the DNA sequence: GGTCCCTGGTTCAA (SEQ ID NO: 2) is suitable for amplifying tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) or cDNA thereof.
[0133] In some embodiments, the DNA sequence: TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3) is suitable for amplifying mitochondrial genome-originated (MT)-tRFs.
[0134] In some embodiments, a pre-determined threshold, of the level or abundance of (a), the ratio of (b), or (c) is obtained from a healthy control. In some embodiments, a healthy control is matched to the subject by one or more criteria selected from: age, gender, lack of genomic predictors of risk of inherited Parkinson's disease, or any combination thereof.
[0135] In some embodiments, the higher the level or abundance of (a), ratio of (b), or (c), the more severe is the form of PD in the subject.
[0136] In some embodiments, the method comprises repeatedly obtaining a sample from the subject undergoing anti PD therapy. In some embodiments, repeatedly comprises periodically.
[0137] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human subject. In some embodiments, the subject is an athlete or a sportsman. In some embodiments, the subject is a professional athlete and / or a professional sportsman. In some embodiments, the subject is afflicted with or suffered a head injury. In some embodiments,head injury is a direct head injury. In some embodiments, head injury comprises or is concussion. In some embodiments, the subject is afflicted with or suffers from a concussion. In some embodiments, the subject is clinically diagnosed with a concussion. In some embodiments, clinically diagnosed comprises physical diagnosis, cognitive diagnosis, or both. In some embodiments, the subject is diagnosed with concussion using computed tomography (CT) scan, magnetic resonance imaging (MRI), or both. In some embodiments, the subject is diagnosed with concussion using physical test, cognitive test, CT scan, MRI, or any combination thereof.
[0138] In some embodiments, the level or abundance of tRFs as described herein is quantified or determined in counts per million (CPM).
[0139] According to another aspect, there is provided a method for matching the type and / or regimen of an anti PD therapy to be administered to a subject in need thereof, so as to alleviate the severity of PD or at least one symptom associated therewith.
[0140] In some embodiments, the method comprises determining the severity of PD according to the method of the invention, and matching the type and / or regimen of an anti PD therapy according to the severity of the disease.
[0141] In some embodiments, the type and / or regimen of an anti PD therapy is selected from: type of drug, dose of drug, frequency of administration, DBS application, frequency and / or intensity of DBS, or any combination thereof.
[0012] According to another aspect, there is provided a method for determining the abundance of tRF comprising the motif RGTTCRA (SEQ ID NO: 1) in a sample.
[0143] In some embodiments, the determining comprises amplifying a nucleic acid product comprising the motif RGTTCRA (SEQ ID NO: 1). In some embodiments, the amplified nucleic acid product comprises the motif RGTTCRA (SEQ ID NO: 1) and is at most 14 base pairs (bp) long, at most 15 base pairs (bp) long, at most 16 base pairs (bp) long, at most 17 base pairs (bp) long, at most 18 base pairs (bp) long, at most 19 base pairs (bp) long, at most 20 base pairs (bp) long, at most 21 base pairs (bp) long, at most 22 base pairs (bp) long, at most 24 base pairs (bp) long, at most 24 base pairs (bp) long, at most 25 base pairs (bp) long, at most 26 base pairs (bp) long, or at most 28 base pairs (bp) long, or any value and rangetherebetween. In some embodiments, the amplified nucleic acid product comprises the motif RGTTCRA (SEQ ID NO: 1) and is 14 to 26 base pairs long (bp), 16 to 26 base pairs long(bp), 18 to 26 base pairs long (bp), 20 to 26 base pairs long (bp), 22 to 26 base pairs long(bp), 24 to 26 base pairs long (bp), 14 to 28 base pairs long (bp), 16 to 28 base pairs long(bp), 18 to 28 base pairs long (bp), 20 to 28 base pairs long (bp), 22 to 28 base pairs long(bp), or 24 to 28 base pairs long (bp), or 14 to 30 base pairs long (bp). Each possibility represents a separate embodiment of the invention. As exemplified herein below (e.g., Example 10), determining (e.g., by amplifying and / or hybridization) the presence and / or abundance of a shorter fragment including SEQ ID NO: 1 may be advantageous as it captures more tRFs and thus retain sufficient power or ability to segregate between groups (e.g., PD vs non-PD) compared to a longer fragment including SEQ ID NO: 1 (e.g., identical to the short one with the exception that it includes at least one additional nucleotide in either the 5’ or 3’ end).
[0144] For these 31 sequences one can see a clear reduction in the received AUC when adding more nucleotides. In view of the above, the inventors conclude a shorter fragment including SEQ ID NO: 1, captures more tRFs and retain sufficient power or ability to segregate between groups (e.g., PD vs non-PD) compared to a longer fragment (e.g., identical to the short one with the exception that it includes at least one additional nucleotide in either the 5’ or 3’ end).
[0145] Methods for amplifying nucleic acids are common and would be apparent to a person of ordinary skill in the art. Non-limiting examples for such methods include, but are not limited to, PCR, RT-PCR, real-time RT-PCT, inverse PCR, AFLP, RFLP, next generation sequencing, or the like.
[0016] In some embodiments, amplifying is by polymerase chain reaction (PCR).
[0147] In some embodiments, the method further comprises determining the abundance of MT-tRFs in the sample.
[0148] In some embodiments, determining the abundance of MT-tRFs in the sample comprises amplifying MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
[0149] In some embodiments, the method further comprises comparing and / or normalizing the determined abundance of the tRF comprising the motif RGTTCRA (SEQ ID NO: 1) to the abundance of the MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3). Comparing and / or normalizing the determined abundance of the tRF comprising the motif RGTTCRA (SEQ ID NO: 1) to the abundance of the MT-tRFs may be advantageous, as exemplified hereinbelow (e.g., Example 10, and Fig. 19).
[0150] In some embodiments, comparing comprises determining the ratio between the abundance of the tRF comprising the motif RGTTCRA (SEQ ID NO: 1) and the abundance of the MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3). In some embodiments, the sample is a biological sample. In some embodiments, the sample is obtained or derived from a subject.
[0151] As used herein, the terms “treatment” or “treating” of a disease, disorder or condition (e.g., PD) encompasses alleviation of at least one symptom thereof, a reduction in the severity thereof, or inhibition of the progression thereof. Treatment may be palliative in nature and need not mean that the disease, disorder or condition is totally cured. To be an effective treatment, a useful composition herein needs only to reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject’s quality of life.
[0152] As used herein, "treating" comprises ameliorating.
[0153] As used herein, the terms “administering”, “administration”, and like terms refer to any method which, in sound medical practice, delivers a composition containing an active agent to a subject in such a manner as to provide a therapeutic effect. One aspect of the present subject matter provides for dermal or transdermal administration of a therapeutically effective amount of a composition of the present subject matter to a subject in need thereof. Other suitable routes of administration can include oral, dermal, transdermal, parenteral, subcutaneous, intravenous, intramuscular, or intraperitoneal. In some embodiments, the administering is systemic administering.
[0154] In some embodiments, the composition is formulated with a carrier. In some embodiments, the composition is encapsulated.
[0155] In one embodiment, the amount of a composition to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
[0156] The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
[0157] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0158] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1,000 nucleobases refers to a length of 1,000 nucleobases ± 100 nucleobases.
[0159] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."
[0160] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic isdefined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
[0161] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a”, “an” and “at least one” are used interchangeably in this application.
[0162] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0163] In the description and claims of the present application, each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.
[0164] Other terms as used herein are meant to be defined by their well-known meanings in the art.
[0165] Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.
[0166] Throughout this specification and claims, the word “comprise” or variations such as “comprises” or “comprising,” indicate the inclusion of any recited integer or group of integers but not the exclusion of any other integer or group of integers.
[0167] As used herein, the term “consists essentially of’, or variations such as “consist essentially of’ or “consisting essentially of’ as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition.
[0168] As used herein, the terms "comprises", "comprising", "containing", "having" and the like can mean "includes", "including", and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. In one embodiment, the terms "comprises", "comprising", "having" are / is interchangeable with "consisting".
[0169] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.EXAMPLES
[0170] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include chemical, molecular, biochemical, computational, statistics and cell biology techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); The Organic Chemistry of Biological Pathways by John McMurry and Tadhg Begley (Roberts and Company, 2005); Organic Chemistry of Enzyme-Catalyzed Reactions by Richard Silverman (Academic Press, 2002); Organic Chemistry (6thEdition) by Leroy "Skip" G Wade; Organic Chemistry by T. W. Graham Solomons and, Craig Fryhle.Material and MethodsShort-RNA sequencing of human substantia nigra (SN) samples
[0171] Brain tissues were obtained from the Netherland Brain Bank and from the Dept, of Neurosurgery at the Jerusalem Shaarei Zedek hospital. To generate short RNA sequencing, libraries were made from eight brain samples of PD patients (all males), using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolab - E7300S). Samples were then sequenced using NextSeq 500 High Output Kit (20024906, Illumina) at the Hebrew University’s Center for Genomic Technologies. TH and DAT levels for these samples are taken from the previously published data Hanan et al., (2020).Short-RNA sequencing of post-mortem blood samples
[0172] Blood samples were obtained from the Netherland Brain Bank. To generate short RNA sequencing, libraries were made from, using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolab - E7560S). Samples were then sequenced using NextSeq 1000 / 2000 P2 Reagents (20046811, Illumina) at the Hebrew University’s Center for Genomic Technologies.Alignment of tRFs
[0173] FASTQ files (of in-house sequencing, or of downloaded data) were checked for quality using FastQC and then adaptors (if existed) were removed using FLEXBAR according to pipelines’ manuals. Output (adaptor-less) fastq files were then aligned to tRFs using MINT-map.Analysis of the CSF dataset
[0174] Prior to each differential expression (DE) analysis the inventors ran a PCA on the data based on the tRF expression. If all samples were clustered but one or two samples these samples were removed from the dataset a priori.
[0175] Six (6) controls, 6 PD patients and 4 AD patients were removed based on PCA. Five (5) controls were further removed since they had moderate SN depigmentation (compared to no or mild depigmentation in other controls) and 2 other controls were removed due to combination of high A0 plaque density (frequent) and high Tau tangles score (above 10). Thirteen (13) PD patients were removed since they had AD-like levels of Braak, plaques or tangles score, and 7 AD patients were removed due to severe SN depigmentation. Lastly,one control and one AD patient were removed due to an age younger than 60. All removals were done a priori and before any analysis was conducted. To further prevent any potential bias, differential expression (DE) analysis accounted for patients’ age, sex, and post-mortem interval.Analysis of the PPMI dataset
[0176] Short-RNA sequencing data was obtained from the Progression Markers Initiative (PPMI) database (updated information on the PPMI study is available at ppmi-info.org. data is accessible at ppmi-info.org / data). Only samples of RNA Integrity number (RIN) > 6, were used. The inventors additionally filtered out samples of participants who were disqualified by PPMI or had undetermined sex Tolosa et al., (2021).
[0177] For DBS analysis the inventors used the 20 PD patients with DBS from the PPMI dataset. Since all DBS patients were from the batch termed by PPMI “Phase 2”, patients from “Phase 1” were excluded a priori. All patients, but one, have genetic PD (mostly with PD-related mutations in LRRK2, and some of them with PD-related mutation in GBA). The inventors dropped the one patient of idiopathic background and compared the levels of RGTTCRA-tRFs in these patients to PD patients with the same PD-related mutations and without DBS (n=l 1) and to control patients with the same mutations (n=9). Since, regularly, patients that have received DBS treatment are suffering from PD for a long period of time already, the inventors selected only non-DBS patients (PD and Controls) from the latest timepoint (V8).
[0178] For prodromal patient analysis the inventors subseted, from the above-described PPMI data, Prodromal and control patients with known genetic background (idiopathic or GBA+), known ethnicity and without prescribed PD medications, above the age 58. Further, patients with psychiatric anxiety, muscles inflammation, urinary bladder and diabetes were removed since they were underrepresented in either the prodromal or control group. Moreover, in order to examine the earliest stage at hand, the inventors used only patients that had sequencing data from timepoints “BL”, “V02” or “V04” (corresponding to initial diagnosis, 6 months or 12 months later). For each such patient the inventors used the earliest timepoint available (See “Statistical analysis” section below for classification process).
[0179] For the production of the receiver operating curves (ROC curves) in PD patients, the inventors used PD patients and controls with known genetic background and without prescribed PD medications. In order to reduce factors that cannot be controlled and vary between the control and PD groups, the inventors used patients from “Phase 1” only, and only from the following ethnicities: “White”, “Black or African American”, “Hispanic or Latino” or “Ashkenazi Jewish”. Further, in order to analyze the early stages of diagnosed PD patients, the inventors used only timepoint “BL” and only PD patient for whom PD duration was 0.
[0180] PPMI is funded by the Michael J. Fox Foundation for Parkinson’s Research and funding partners, including 4D Pharma, AbbVie Inc., AcureX Therapeutics, Aller-gan, Amathus Therapeutics, Aligning Science Across Parkinson’s (ASAP), Avid Radiopharmaceuticals, Bial Biotech, Biogen, BioLegend, Bristol Myers Squibb, Calico Life Sciences LLC, Celgene Corporation, DaCapo Brainscience, Denali Therapeutics, The Edmond J. Safra Foundation, Eli Lilly and Company, GE Healthcare, GlaxoSmithKline, Golub Capital, Handl Therapeutics, Insitro, Janssen Pharmaceuticals, Lundbeck, Merck & Co. Inc., Meso Scale Diagnostics, LLC, Neurocrine Biosciences, Pfizer Inc., Piramal Imaging, Prevail Therapeutics, F. Hoffmann-La Roche Ltd and its affiliated company Genentech Inc., Sanofi Genzyme, Servier, Takeda Pharmaceutical Company, Teva Neuroscience Inc., UCB, Vanqua Bio, Verily Life Sciences, Voyager Therapeutics Inc., and Yumanity Therapeutics Inc.Binding energy of tRFs to the Ribosome-Essential tRF and rRNAs
[0181] To assess the affinity of the CSF-expressed tRFs (1,017 tRFs that were expressed above median of 10 CPM in the CSF dataset) to the Ribo-Essential tRF (Shreffler et al., 2023) and to the rRNAs (Eusebi et al., 2017), the inventors used the RNAup web server (Poggiolini et 1., 2022). The inventors checked each of the expressed tRFs against the sequences of the Ribo-Essential tRFs and against the open regions in the rRNAs that the inventors found to contain reverse complement sequences to the RGTTCRA sequence (see sequences below) and retrieved the total energy for each tRF (total energy equals to the sum of opening energies of each of the sequences minus their binding energy to each other).Ribo-Essential tRF: TCGAATCCCACTCCTGACACCA (SEQ ID NO: 4); 18S RGTTCRA reverse complement open region: AGGGGCGAAAGACTAATCGAACCATTCTA (SEQ ID NO: 5); 28S RGTTCRA reverse complement open region: TAACCCGTTGAACCCCAT (SEQ ID NO: 6).Quantitative PCR (qPCR)
[0182] cDNA was prepared using the Quanta qScript microRNA cDNA Synthesis Kit (Quantabio 95091-025, Beverly, MA, USA) according to the manufacturer’s instructions and diluted 1 : 10 in double-distilled water prior to qPCR plate preparation (with final volume in wellbeing 2.3 pL). qPCR was performed in 384-well plates, using PerfeCTa SYBR Green FastMix Low ROX (Quantabio 95074-250) at a final well volume of 2.7 pL. Expression of the tested tRFs was normalized to miR-28-5p as a housekeeping. This miRNA was chosen since it was unchanged in CSF samples of PD and Ctrl patients.Cell lines
[0183] Human-derived SHSY-5Y (ATCC CRL-2266) and LA-N-2 (DSMZ ACC 671) neuroblastoma cells were grown at 37 °C in 5% CO2, in a 1: 1 medium of EMEM:F12 nutrient mixture, supplemented with 10% fetal calf serum, 1% L-glutamine, and 1% prostate-specific antigen (all from Sartorius). After taken out from the liquid nitogen, cells were grown 1-2 weeks before any experiment. All cells were of passeges 5-16. Cells were splitted 1:5 once a week and half of their medium was replaced once a week. In all experiments, cells were seeded one or two days prior to any other treatment.
[0184] Exogenous expression of tRFs: To transfect cells with oexogenous tRFs the inventors used HiPerFect (QIAGEN 301704) according to manufacturer’s instructions. Briefly, to 30 / 100 pL per 24 / 96 well or 2 mL per 10 cm plate of fresh medium (EMEM) the inventors added the RNA oligo to a final concentration of 50 nM. The inventors then added 1:100 HiPerFect (for example, or 2 mL the inventors added 20 pL). The mixture was vortexed and then left in room temperature for 15 minutes. The cells were left with 100 / 30 pL of their growth medium in 96 / 12 well plates or with ImL in a 10 cm plate. Then, the mixture was pipeted dropwise to the cells which were returned to the icubator for 6 hours, afterwhich whole medium was added to the final volume of the well / plate (the inventors regarded 100pL as the final volume of 96 wells, and 1 or 8 mL as the final volumes of 12 wells or 10 cm plate). Cells were then left for 24 hours and imaged / harvested.Cells immunofluorescence and in-situ hybridization
[0185] Cells were grown on coverslips in 24 wells plates. On harvesting day, cells were fixed with 4% paraformaldehyde, and then permeabilized with 0.5 mL of PT 2 per well. Then, cells were washed with FISH buffer ( 2 SCC with 15% Formamide), following by overnight incubation with in-situ probe (Motif / Scr) containing AF488 fluorophore (see “Oligo used for this study”) in a concentration of 200 nM (in 2 SCC with 10% Dextran sulfate and 15% Formamide). Then blocking solution (PBS with NaAz containing 5% donkey serum) was applied to the wells. Following blocking, cells were exposed to primary antibody for 12 hours (4 °C). Then cells were stained with a secondary antibody containing an AF647 fluorophore (Thermo Fisher; Donkey anti rabbit) for 2 hours.Oligos used for this studym - methylated nucleotide; underlined nucleotides - the RGTTCRA motif or a reverse anc complementary sequence thereof.Statistics and analysis
[0186] All multiple comparisons were corrected using FDR and all visualizations were done using ggplot2 (Grossaueret al., 2023) in R (Magalhaeset and Lashuel., 2022). Whenever differential analysis was done it was carried out using edgeR (Grigoriev and Karaiskos, 2016). Matching analysis was done with Matchit (Kumar et al., 2016), where the matched factors are sex, age, and batch (“Study”), with distance=’glm’ and with link=’probit’. For each of the ROC calculations (either prodromal + controls or PD + controls), the inventorsfirst used an “optimal” matching in each of prodromal / PD patient were matched with one control patient (based on the abovementioned factors). Then the ratio between RGTTCRA- tRFs to MT-tRFs was normalized per each pair of prodromal / PD and control by dividing both of pair scores by the pair’s mean. Afterwards, the inventors used an Al algorithm to calculate ROC (MLeval). The dimensions used for the ROC calculations included genetic background, ethnicity, and either or both of tRFs normalized score (described above) and UPDRS.III along Hohen & Yahr score. The training control was done using method=’cv’, summaryFunction=twoClassSummary, number=5 and classProbs and savePredictions = T. The prediction was done using method=’gbm’. ROC curves were plotted using the pROC package (Emara et al., 2010). The inventors further ran iterations of a “full” matching in which patients were divided into cluster where each cluster contains at least one prodromal / PD and one control. Then the inventors used the same pipeline as described for the “optimal” matched data and conducted 100 iterations of the “full” data to compute ROC- AUC.EXAMPLE 1Nucleus-originated tRFs accumulate but mitochondrial-originated tRFs decline in PD patients’ brain and CSF
[0187] Brain, CSF, and blood consistently reflect altered brain-derived RNA profiles along the course of multiple cerebral pathologies. As PD symptoms are primarily related to brain changes, the inventors first sought corresponding PD-related alterations in tRF profiles by analyzing a short RNA-seq dataset (phs.000727 NIH) of post-mortem CSF samples from 60 PD patients (23:37 females / males) and 55 age-matched healthy controls (25:30; Fig. 1A). This analysis revealed consistent elevations in the levels of 30-40 nucleotides long tRFs of nuclear origin (NtRF) in PD patients’ CSF, accompanied by declined levels of mitochondria- originated tRFs (MTtRF) that likely reflect the PD-characteristic mitochondrial damage. This trend was consistent also when mining each of the sexes separately (Figs. 7A-7B). All but one of the elevated NtRFs were 35 bases or longer (Fig. IB), consisting mainly of 5’- halfs, 3 ’-tRFs and i-tRFs, and reflecting non-coincidental changes in the CSF tRF profiles compared to healthy controls. In contrast, the downregulatedMTtRFs wereall 3’-tRFs (Figs.1C and 8). That the levels of nuclear-originated tRFs were generally elevated in PD patients’ brain and CSF revealed a novel PD-related phenomenon.EXAMPLE 2CSF-elevated NtRFs carry a PD-specific common RGTTCRA motif
[0188] To exert a pronounced PD-related impact, the inventors expected the sequence of the differentially expressed (DE) tRFs in the CSF to share common features. To challenge this prediction, the inventors employed the MEME (Multiply Elicited Motif Entities) tool designed to identify novel 'signals' in sets of biological sequences. This search revealed that the 30-40 bases long CSF-elevated NtRFs tend to share a particular motif sequence - [A / G]GTTC[A / G]A (RGTTCRA (SEQ ID NO: 1); Figs. 1D-1E). A binomial test predicted RGTTCRA-tRFs (SEQ ID NO: 1) to have 63% prospects of being elevated in the NIH cohort ofPD CSF (p<4 10'7, FDR). These prospects were considerably higher than those of nuclear tRFs devoid of the RGTTCRA motif, which had 49% prospects of being elevated in PD (p<0.83, False Discovery Rate, FDR). In contrast, total mitochondrial genome-originated tRFs had 96% prospects to decline in PD (p<1.5xl0‘16, FDR). RGTTCRA-tRFs (SEQ ID NO: 1) were elevated in PD vs. healthy controls to 122% of what was expected by random distribution, while tRFs devoid of the RGTTCRA motif declined by 115% compared to what was expected by random distribution (p<8 10'9, Chi-square test). The same finding emerged also when selectively examining only the tRF families from which RGTTCRA-tRFs (SEQ ID NO: 1) are derived (i.e., i / 3’-NtRFs; p<5xl0'9, Chi-square test) and also when checking each of the sexes alone (Figs. 9A-9B).
[0189] Intriguingly, RGTTCRA-tRFs (SEQ ID NO: 1) were derived from numerous nuclear-originated parental tRNA genes but were missing among CSF-derived mitochondrial-originated MtRFs. Also, none of the RGTTCRA-tRFs (SEQ ID NO: 1 was downregulated in PD patients’ CSF, and all of the CSF-upregulated tRFs devoid of this motif were shorter than 30 bases (Fig. IE). Moreover, the median levels of RGTTCRA-tRFs (SEQ ID NO: 1) longer than 30 bases were higher in PD patients than in either healthy controls or Alzheimer’s disease (AD) patients from the phs000727 dataset (Fig. IF; p<0.038, p<0.062, Dunnett, FDR) and considerably higher than the median level of all CSF tRFs. Together,these findings indicated that the elevation of RGTTCRA-tRFs (SEQ ID NO: 1) in the PD CSF was PD-specific and indicated that RGTTCRA-tRFs (SEQ ID NO: 1) and MT-tRFs could become candidate PD joint biomarkers.EXAMPLE 3RGTTCRA-tRF levels in the SN of PD patients elevate with disease duration and Lewy body levels
[0190] To seek pathological implications of RGTTCRA-tRFs (SEQ ID NO: 1) accumulation, the inventors next conducted small RNA-seq in their in-house SN data of 8 post-mortem PD patients from the Netherlands Brain Bank (NBB). Extending the current findings in the CSF, the inventors found PD- elevated NtRFs, most of which RGTTCRA- tRFs (SEQ ID NO: 1) whose elevation further accompanied the elevated Lewy-body levels in these patients’ SN (Figs. 2A-2C), and declined MTtRF levels. Moreover, the RGTTCRA- tRF (SEQ ID NO: 1) fraction of the analyzed SN samples revealed positive correlation to donors’ disease duration (R=0.82, p<0.024, Pearson; Fig. 2C), but did not reflect their age (R=-0.27, p<0.7, Pearson; Fig. 10). Intriguingly, a single patient displayed RGTTCRA-tRF (SEQ ID NO: 1) levels that did not correlate with disease duration (Fig. 2C, orange point). However, that patient also presented characteristics of SWEDD (Scans Without Evidence of Dopaminergic Deficit), with seemingly healthy SN levels of the dopamine synthesizing enzyme tyrosine hydroxylase (TH) and dopamine transporter (DAT) (Figs. 11A-11B), further tightening the links between RGTTCRA-tRF (SEQ ID NO: 1) levels and PD symptoms. Together, this identified RGTTCRA-tRF (SEQ ID NO: 1) levels as being linked both to the clinical and pathological aspects of PD and to the loss of dopaminergic neurons in the SN.
[0191] Interestingly, the fraction of MT-tRFs showed a positive correlation to age as well (Fig. 2D). In general, the NBB PD patients showed reduced total amount of tRFs with disease progression, but MT-tRFs and RGTTCRA-tRFs (SEQ ID NO: 1) remained unchanged (Fig. 12), possibly reflecting nuclease resistance of these two groups and / or PD- related demise of SN neurons in the brain of advanced PD patients. To seek corresponding changes in the parental tRNAs, the inventors mined their in-house long-RNA-seq data ofpost-mortem SN PD patients and controls from the Netherlands Brain Bank (3) (n=25 samples; 8 of which identical to the samples from which short-RNA-seq was drawn). The inventors found the sum of MT tRNA transcripts to be significantly lower in PD patients compared to controls (Fig. 12B; p<0.04, Mann-Whitney test), and to correlate with PD duration (Fig. 12B; p<0.05, Spearman), suggesting a loss of mitochondrial-derived tRFs which accompanies PD. Together, these findings supported the inventors’ primary predictions for both the accumulating nuclear-originated RGTTCRA-tRFs (SEQ ID NO: 1) and the PD-declined MT tRFs.EXAMPLE 4Blood RGTTCRA-tRF and MT-tRF changes identify PD in early and advanced patients and correlate with symptoms severity in late PD patients
[0192] To examine the relevance of MT-tRFs and RGTTCRA-tRFs (SEQ ID NO: 1) as blood-based biomarkers, the inventors sequenced small-RNAs from post-mortem (PM) blood samples from PD patients and controls, received from the NBB (nPD=21, nControl=16; Fig. 3A). Intriguingly, this PM cohort of advanced PD patients revealed that RGTTCRA-tRF (SEQ ID NO: 1) and MT-tRF both presented significant correlation to the Lewy body scores of the advanced patients (Figs. 3B-3C; RGTTCRA-tRFs (SEQ ID NO: 1) p<0.035; MT-tRFs p<0.0094; Spearman correlation, FDR), further tightening the linkage of these two tRF groups to the PD progression. Next, the inventors utilized samples from the PPMI dataset (living subjects in early disease stages and controls). The inventors analyzed subjects lacking PD-related mutations and non-treated by deep brain stimulation (DBS) from timepoint V08 (taken two years post first evaluation) (Idiopathic; nPD=252, nControl=133), as well as the latest timepoint available for PD patients carrying a PD-related mutation and symptoms-free patients carrying the same mutations (“Genetic”; nPD=55, nControl=16). Importantly, blood samples from both genetic and idiopathic early and advanced patients showed a general trend of elevated RGTTCRA-tRF (SEQ ID NO: 1) fractions in PD patients compared to controls (Fig. 3D; p<0.1 ANOVA) and yet higher elevation in advanced (PM) patients (p<0.0515, ANOVA). In comparison, MT-tRFs showed no overt constant trend throughout these groups (Fig. 3E): Early genetic PD patients exhibited reduced MT-tRF levels compared to unaffected mutation- carrying controls (p<0.022 ANOVA), whereasadvanced (PM) PD patients showed significantly higher blood MT-tRFs in PD than in control patients (p<0.003, ANOVA). Consequently, the ratio between RGTTCRA-tRFs (SEQ ID NO: 1) to MT-tRFs showed an overall significant elevation in PD vs. control samples (Fig. 3F; p<0.0013, ANOVA), especially in early patients of genetic background (Early Idiopathic patients p<0.02; Early Genetic patients p<0.00044; ANOVA). Examining all four aforementioned datasets (CSF, SN and blood from early and advanced DP patients and controls) show that each pair of tissues shared no more than 60% of the tRFs (and often much less), and that MT-tRFs and RGTTCRA-tRFs (SEQ ID NO: 1) showed lower and higher tendencies for tissue specificity of tRFs, respectively (Fig. 17). Nonetheless, and despite the differences in the expressed tRFs, the current data show that all the tested tissues manifested similar trends of PD-related elevation of RGTTCRA-tRFs (SEQ ID NO: 1) and reduction of MT-tRFs. These findings suggest that a blood test analysis based on these two tRF groups may reflect disease severity and enable segregation of PD patients from healthy controls already at the very early PD stages and throughout disease progression.EXAMPLE 5Deep brain stimulation reversibly declines blood RGTTCRA-tRF levels in PD patients
[0193] To challenge the specificity of the link between RGTTCRA-tRFs (SEQ ID NO: 1) and the hallmark movement impairments of PD patients, the inventors quantified blood RGTTCRA-tRF (SEQ ID NO: 1) levels in 18 PPMI PD patients with implanted deep brain stimulation (DBS) electrodes in their subthalamic nucleus that serve to alleviate tremor symptoms in PD patients (Fig. 4A). The tested patients all carried PD-related mutations, mostly in the LRRK2 or GBA genes. Of note, RGTTCRA-tRF (SEQ ID NO: 1) levels in PD patients with LRRK2 or GBA mutations without DBS (n=12) were higher than in apparently healthy carriers of these mutations (n=9; p<0.027, ANOVA), strengthening the link of blood RGTTCRA-tRF (SEQ ID NO: 1) levels to PD symptoms. Importantly, DBS-treated mutations-carrying patients (with alleviated tremor symptoms) showed considerably lower blood RGTTCRA-tRF (SEQ ID NO: 1) levels compared to those of non-DBS treated PD patients with the same PD-related mutations (p<0.095, ANOVA; Fig. 4B). Specifically, DBS-treated mutation-carrying PD patients showed RGTTCRA-tRFs levels close to thoseof healthy control carriers of those PD-related mutations (p<0.6, ANOVA; Fig. 4B). To challenge the timeline of this response, the inventors explored an in-house short RNA-seq dataset of nucleated blood cells from healthy controls and PD patients with DBS -on or following one hour of DBS disconnection. These tests revealed declined RGTTCRA-tRF (SEQ ID NO: 1) levels in DBS-treated compared to untreated patients, and re-elevated blood RGTTCRA-tRF (SEQ ID NO: 1) levels following IRB-approved one hour of disconnected DBS stimulation, during which time DBS-suppressible tremor symptoms escalate (p<0.7, ANOVA; Fig. 4C). Of note, MT-tRFs showed no significant difference between DBS treated and other PD patients in neither of these cohorts (Fig. 13). Together, these findings demonstrate clinical capacity of DBS stimulation in co-suppressing both the tremor symptoms of PD patients and blood RGTTCRA-tRF (SEQ ID NO: 1) levels. Furthermore, these data strengthen the ability of blood samples to reflect PD-related changes in RGTTCRA-tRF profiles.EXAMPLE 6Electrophysiological depolarization of neuroblastoma cells declines both ribosomal- associated RGTTCRA-tRFs and cytosolic MT-tRF levels
[0194] To challenge the impact of RGTTCRA-tRFs (SEQ ID NO: 1) in the context of neuronal activity and to assess their potential connection to the altered electrical stimulation accompanying patients’ tremor symptoms, the inventors mined the GSE155727 dataset including short-RNA seq and ribosomal profiling of SHSY-5Y neuroblastoma cells harvested prior to, right after or two hours following electrophysiological depolarization (2 h pDP; Fig. 4D). While RGTTCRA-tRFs (SEQ ID NO: 1) constituted a small portion of the total cytoplasmic short RNA counts, their share of the ribosomal-interacting RNAs was ~10 folds higher (p<8xl0'n, ANOVA; Fig. 4D). However, the ribosome-interacting RGTTCRA-tRFs (SEQ ID NO: 1) fraction decreased substantially by two hours postdepolarization (resting vs. 2 h pDP p<0.001, depolarized vs. 2 h pDP p<0.0002, ANOVA; Fig. 4D; upper panel). Also, since RGTTCRA-tRFs (SEQ ID NO: 1) mainly originate from the 3’ and i-tRFs subtypes, the inventors further examined these two subtypes alone. Comparing the share of RGTTCRA-tRFs (SEQ ID NO: 1) to only these families of tRFs revealed identical association patterns. Importantly, RGTTCRA-tRFs (SEQ ID NO: 1)mainly originate from the 3’-tRF and i-tRF subtypes. Therefore, the inventors further sought specific changes in these two tRF subtypes prior to, right after or two hours postdepolarization. RGTTCRA-3’-tRFs (SEQ ID NO: 1) and i-tRFs presented identical ribosomal enrichment, and 2 h pDP decline, whereas motif-lacking i / 3’-tRFs showed less significant enrichment in ribosome compared to cytoplasmic profiling (~1.5 fold higher, p<3e'6, ANOVA). Further, ribosomal profiling of motif-lacking i / 3’-tRFs remained unchanged in the 2 h pDP condition (Fig. 14). In comparison, MT-tRFs were unchanged in the ribosomal-bound fraction but were reduced in the cytosolic fraction 2 hours postdepolarization (Fig. 4D; lower panel; p<0.003, ANOVA).
[0195] Extending the patients’ data, the ratio between RGTTCRA-tRFs (SEQ ID NO: l) and MT-tRFs in the cytosolic fraction was reduced immediately post-depolarization and elevated significantly after two hours (corresponding with the inventors' findings in DBS treated patients; Fig. 4E; resting-depolarization: p<0.065, resting-2 hours post depolarization p<0.014, depolarization-2 hours post depolarization p<0.0004, ANOVA). In the ribosomal- bound fraction, depolarization was followed by elevation of the RGTTCRA-tRFs (SEQ ID NO: l) / MT-tRFs ratio both immediately and in the long term (p<0.0135, Mann-Whitney). That RGTTCRA-tRFs (SEQ ID NO: 1) showed ribosomal association that was selectively loosened within two hours following electrophysiological depolarization suggested that the depolarizing qualities of DBS may reflect a ribosomal association that reversibly reduces the blood levels of RGTTCRA-tRFs (SEQ ID NO: 1) back to healthy control levels, such that RGTTCRA (SEQ ID NO: 1)- and MT-tRFs are affected both at the cellular levels and in terms of electrophysiological stimuli-derived activity of neurons.EXAMPLE 7RGTTCRA-tRFs and MT-tRFs enable classification of Prodromal patients from controls
[0196] To estimate the ability of RGTTCRA-tRFs (SEQ ID NO: 1) and MT-tRFs to constitute a joint PD biomarker, the inventors compared prodromal PD patients from the PPMI dataset at the earliest tested timepoint (n=60) to matched healthy controls (n=129; Fig. 5A). An optimal matching method, including patient’s sex, age and collection batch yieldeda subset of 60 controls optimally matched to the prodromal patients. Then, for each patient, the inventors divided the sum of RGTTCRA-tRFs (SEQ ID NO: 1) by the sum of MT-tRFs (RGTTCRA (SEQ ID NO: l) / MT-score hereafter) and normalized the RGTTCRA (SEQ ID NO: l) / MT-score of each pair of prodromal and control patients via dividing both by the pair’s mean (normalized score - Nrm-RGTTCRA (SEQ ID NO: l) / MT-score). Next, the inventors employed a gradient boost machine learning algorithm (GBM) to classify the samples into prodromal and controls considering their genetic background and ethnicity, in combination with either UPDRS (Unified Parkinson's Disease Rating Scale) motor scores and Hohen and Yahr scores (clinical measurements; purple), or the Nrm-RGTTCRA(SEQ ID NO: 1) / MT-score alone (tRF measurements; yellow), or both clinical and tRF measurements together (red). To further challenge the validity of their findings, the inventors also classified the patients using both clinical and tRF measurements albeit with scrambled tags (control; grey). This resulted in an area under the curve (AUCs) of 0.73, 0.72 and 0.78 for the only clinical, only tRFs and combined tRF and clinical measurements, respectively. In contradistinction, a control classification (done via scrambling the “prodromal” and “control” tags) yielded an AUC value of 0.59. To further challenge the current findings, the inventors performed 100 permutations of the aforementioned classifications, each time sampling a different subgroup of 60 control patients from the 129 controls pool. The clinical and combined (clinical and tRF-based) measurements showed similarly significant abilities to classify the patients into prodromal and controls. Moreover, both methods reached slightly better classification than using only tRFs for the classification (p<0.0001 ANOVA), and all methods were better than the scrambled control test (p<0.0001, ANOVA).
[0197] To create a primer-based separation that can be easily handled in clinics and that reflects as much of the variability between controls and prodromal patients as possible, the inventors designed two single PCR primers that can recognize as many RGTTCRA-tRFs (SEQ ID NO: 1) and MT-tRFs as possible. The inventors checked all 14-nucleotides-long sequences that include the RGTTCRA (SEQ ID NO: 1) motif, and which are shared between at least 100 different tRFs. The inventors summed, for every patient, the counts of all of the tRFs containing each sequence and selected the sequence which led to the largest median difference between prodromal patients and healthy controls (GGTCCCTGGTTCAA (SEQ ID NO: 2), shared between 285 RGTTCRA (SEQ ID NO: 1) tRFs from different tRNAs ofdistinct chromosomal origins; p<0.013; Mann- Whitney). Next, the inventors sought a sequence shared between as many MT-tRFs as possible that maximizes the median differences between prodromal and controls and minimizes the standard deviation within each group. This step revealed the sequence TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3), shared between 106 different Lys tRNA-originated MT-tRFs.
[0198] Re-classification with the GBM tool using, this time, only tRFs containing these two motives served to produce the tRF measurement of Nrm-RGTTCRA (SEQ ID NO: 1) / MT- score which yielded an AUC of 0.87 for the combined tRF-based and clinical measurements, and 0.86 for the tRF-based measurement alone, considerably higher than the 0.73 AUC using clinical measurements alone (Fig. 5B). This observation was further validated using 100 permutations, each time sampling different 60 controls (Fig. 5C). Next, the inventors sought segregation of subjects to prodromal and controls with regard to their genetic and ethnic contexts. Intriguingly, the Nrm-RGTTCRA (SEQ ID NO: l) / MT-score using the two motives enabled segregating all subpopulations (Fig. 5D; p<4xl0'n, ANOVA), even when examining the non-normalized score (Fig. 15A; p<5*10'6, ANOVA). Thus, two thirds of the prodromal patients had a score of 6 or above whereas two thirds of the current controls had a score lower than 6 (p<4xl0‘5, Chi square test). An exception were African-American subjects, where controls had a higher Nrm-RGTTCRA (SEQ ID NO: l) / MT-score than prodromal patients. However, this was also the case for the UPDRS scores of African- American controls which were higher than those of the corresponding prodromal patients (Fig. 15B), suggesting that the current test reliably reflected clinical measurements in these patients as well.
[0199] In later stages of PD with overt motor symptoms, the clinical measurements enabled a perfect separation between affected patients and controls. Correspondingly, segregating PD patients from controls yielded a clinical measurements-based AUC of 1, leaving no room for an added value of other biomarkers of any sort (Fig. 5E; Indeed, the necessity for biomarker is specifically apparent in the earliest stages of the disease, before any overt phenotype rather than later on). Together, these findings suggest that a two-primer based RGTTCRA (SEQ ID NO: l) / MT-score can be used as a reliable PD marker in the earliest stages of the disease, alone or combined with clinical measurements.EXAMPLE 8RGTTCRA / MT-scores positively correlate with PD progression
[0200] PPMI patients tested at least three times served for seeking correlations of disease progression with time of the RGTTCRA-tRFs captured by the GGTCCCTGGTTCAA (SEQ ID NO: 2) motif, the MT-tRFs captured by the TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3) motif, and the ratio between these two motives. Importantly, SWEDD patients showed no significant trend of correlation with time in this analysis, and controls showed some tendency for negative correlation of MT-tRFs with time (62%, p<5><10'4; binomial test, FDR), possibly reflecting general age-related mitochondrial damage. Correspondingly, prodromal patients showed a tendency for negative correlation of both RGTTCRA-tRFs and RGTTCRA (SEQ ID NO: l) / MT-scores with time (Fig. 5F; 73%, p<0.0025; 71%, p<0.0053; binomial test, FDR), whereas more advanced PD patients showed a strong bias for MT-tRFs decline and RGTTCRA (SEQ ID NO: 1) / MT elevation with time (Fig. 5F; 64%, p<2><10'7; 63%, p<5'7; binomial test, FDR). This changing of the dual RGTTCRA (SEQ ID NO: l) / MT-score along disease progression, especially in later stages of the disease, suggests that it can both distinguish patients from controls in early stages, and reflect disease progression.EXAMPLE 9RGTTCRA-tRFs show sequence complementarity to both rRNAs and a ribosomeessential tRF
[0201] While the depletion of MT-tRFs reflects well-studied mitochondrial depletion in PD, RGTTCRA-tRFs (SEQ ID NO: 1) accumulation is new and may reflect altered PD-related levels of particular nucleases as accelerating PD progression. However, Bakowska-Zyvicka et.al., reported that four different tRFs in Saccharomyces cerevisiae, which the inventors found to include the RGTTCRA (SEQ ID NO: l)-motif, interrupt translation by interacting with ribosomal RNA regions other than the ordinary tRNA binding sites. Moreover, the inventors identified a murine RGTTCRA (SEQ ID NO: 1 (-complementary region in leucine tRNA-derived tRF (LeuCAG3') which is essential for assembly of the translation complex, protein translation and cellular viability (Figs. 6A-6B). Correspondingly, minimal energyassessment (RNAup) predicted thermodynamically preferred interaction (Total energy of - 10.46 kcal / mol) of RGTTCRA-tRFs (SEQ ID NO: 1) with the ribosome-essential LeuCAG3' tRF (Fig. 6B), far lower binding energy than all other 1,017 CSF-identified tRFs (p<l *10"30; Fig. 6B)
[0202] Supporting the ribosomal-binding prediction, the inventors found sequences complementary to the RGTTCRA (SEQ ID NO: l)-motif in both the 18S and 28S ribosomal RNAs that are both amenable to hybridization as they are not involved in specific secondary structures (Figs. 6A and 6C). Intriguingly, the capacity of RGTTCRA-tRFs (SEQ ID NO: 1) to bind both the 18S and the 28S sequences is predictably better than that of all other CSF- expressed tRFst test, FDR; Fig. 6C). The potential dual binding to the ribosome-essential LeuCAG3' tRF and to ribosomal RNA indicated a putative “duallock” interruption of both the initiation and execution of translational processes under RGTTCRA-tRF (SEQ ID NO: 1) accumulation, essentially making this tRF into a ‘poisonous waist’.
[0203] Further validation using an independent sequencing of ribosome-bound short RNAs in three human originated cell lines showed significant enrichment of ribosome-bound RGTTCRA-tRF (SEQ ID NO: 1) after 3 hours of arginine or leucine starvation which interferes with translation (p<0.023, p<0.027, Dunnett test; Fig. 16). Briefly, to seek interactions of the motif-carrying tRFs with ribosomes by an independent approach, the inventors analyzed the GSE113751 dataset of short RNA-seq of pulled-down ribosomes from the HeLa, HCT116 and HEK293T cell lines, before and after 3- or 6-hours exposure to Arginine or Leucine starvation. Intriguingly, in both healthy and starved cells RGTTCRA- tRFs (SEQ ID NO: 1) constituted of 50-70% of the total tRF reads, demonstrating pronounced enrichment of motif-carrying tRFs compared to their share in tRF subtypes (-38% of all tRFs carry the motif; p values for all but one of the different samples ranged from 5e'6to 2e'43, chi square test, FDR). The enrichment of ribosomal bound motif-carrying tRFs was consistent even when comparing the share of motif-containing tRFs to the random (50%) chance (p values of all samples with over 15 reads ranged from 0.014 to l e-10, chi square test, FDR). Altogether, these data and the above depolarization and DBS-triggered alternations suggest that RGTTCRA-tRFs (SEQ ID NO: 1) may have an evolutionarily- conserved causal role in PD progression that is amenable for suppression by DBS treatment.Interestingly, staining of RGTTCRA-tRFs (SEQ ID NO: 1) using in-situ hybridization showed punch of these tRFs within the nucleus endogenously (Fig. 6D), whereas overexpression of an RGTTCRA-tRF (SEQ ID NO: 1) RNA mimic yielded localization of these tRFs in the nucleus envelop rather than in the nucleus itself, as well as more spread localization rather than very defined punch (Fig. 6E).EXAMPLE 10Shorter probes, and nuclear to mitochondrial tRF ratio, are advantageous for diagnosis
[0204] To test whether the current findings indeed reflect the biological role of these motifs rather than the mere training of the algorithm, the inventors ran the exact same GBM-based process 10,000 times on ratios between random native motifs (that did not include the RGTTCRA (SEQ ID NO: 1) sequence and appeared in at least the same number of tRFs as the RGTTCRA (SEQ ID NO: 1)- and the MT-motifs; see Methods). The mean AUC received for the ratio between random motifs was 0.768 (SD=0.0537), and 99% of the AUCs were below 0.81 (Fig. 18). These findings support the notion that the AUC resulting from the tRF - score reflects a biological rather than a mere training phenomenon.
[0205] Further, the results show that using a ratio of nuclear-originated tRFs to MT-tRFs is advantageous over the use of each of these tRFs individually (Fig. 19).
[0206] Further, the inventors have examined the effect of the length of the probe on the reliability and specificity of the method (reflected by the AUC).
[0207] For that, the inventors examined all possible combinations of adding 1 to 5 nucleotides at one or on both ends of the probe (RGTTCRA (SEQ ID NO: 1)).
[0208] This analysis provided 3,209 potential sequences, of which 31 (Table 1) were also identified in the current data set.Table 1
[0209] For these 31 sequences one can see a clear reduction in the received AUC when adding more nucleotides. In view of the above, the inventors conclude a shorter fragment including SEQ ID NO: 1, captures more tRFs and retain sufficient power or ability to segregate between groups (e.g., PD vs non-PD) compared to a longer fragment (e.g., identical to the short one with the exception that it includes at least one additional nucleotide in either the 5’ or 3’ end).Discussion
[0210] Enabling early blood test diagnosis of PD may both alleviate the burden of uncertainty on suffering individuals and assist the clinicians’ care of these patients early on in the disease process. Importantly, an efficient diagnostic test for PD has to: (1) provide accurate and disease-specific results, (2) avoid clinician surgical requirements in CSF sampling and be easy to perform, (3) ensure inexpensive costs, and (4) entail minimal risks to the tested patient and (5) provide a reliable approach for assessing the therapeutic value of tested novel medications aimed to change the course of PD progression. These terms must all be met for such a test to be applied in massive numbers and in diverse patient groups. In this respect, CSF-based tests may be risk- involved, costly in manpower and procedure and should be followed by complex molecular and biochemical tests. To allow quick and handy procedure that does not depend on hospital care, minimally invasive body fluid tests and amplifiable signals would be largely preferable.
[0211] Seeking suitable biomarkers, the inventors selected tRFs because RNA oligonucleotides can be easily detected in a simple qPCR-based process, and thanks to their shared short motifs which enable capturing multiple nuclear- or mitochondrial-originated tRFs using a single primer, thus compensating for individual variations in the accumulation of such short motifs between patients. Examining multiple tissues of men and women patients living with PD at different disease stages, the inventors found a family of tRFs sharing the sequence motif of RGTTCRA (SEQ ID NO: 1), which significantly enhance their detection capacity. These motif-carrying tRFs presented consistent linkage to PD symptomatology in both brain and blood at different disease stages; their levels were elevated in correlation to disease duration in the SN and accumulated with Loewy body scores in the SN, CSF and blood. Moreover, these motif tRFs emerged at high levels in CSF samples from PD but not AD patients or healthy controls, and their blood levels were effectively reduced under the tremor-suppressing DBS stimulation, proving a specific link to PD tremor symptoms. Compatible with the known mitochondrial damage in PD, the inventors further found declining levels of MT -tRFs in the CSF of idiopathic PD patients and in the blood of early PD patients carrying disease-related mutations, accompanied by decreases in their levels in correlation to the Loewy body score in the SN. Moreover, the ratio between RGTTCRA-tRFs (SEQ ID NO: 1) to MT-tRFs segregated early prodromal patients from healthy controls, with better results than those of the gold standard clinicalUPDRS and Hohen and Yahr measurements. In addition, the RGTTCRA-tRFs (SEQ ID NO: l) / MT-tRFs ratio presented positive correlation with PD progression of the disease in diagnosed PD patients, making RGTTCRA-tRFs (SEQ ID NO: l) / MT-tRFs a potentially powerful blood diagnostic tool for the earliest stages of PD as well as for following its progress.
[0212] Importantly, using the tRF-based measurements may enable clinicians to base their decisions on single individual blood tests revealing score numbers corresponding to the risk of the patients to suffer from PD and from PD tremor symptoms. To perform such tests, the clinicians will only need information on the patients’ ethnicity and use a single qPCR-based dual test to determine their tRF-based score. The sensitivity, speed, and low cost of this test contribute to its value for enabling improved early (pre-symptomatic) diagnosis of PD, as well as efficient and informative data assisting further clinical decisions of PD patients at diverse stages of their disease.EXAMPLE 11Levels of RGTTCRA motif are elevated post-combat, and positively correlate with head injury
[0213] The inventors tested the small RNA-sequencing data of 217 saliva samples from 42 mixed martial arts (MMA) fighters (GSE123336). The samples were collected one week and one day prior to- or one hour, 2-3 days, one week or more than three weeks post MMA combat. Additionally, part of the fighters suffered a direct head injury during the combat whereas others did not. Interestingly, the percentage of RGTTCRA tRFs increased with time after the combat (Fig. 20; p<0.00013, Pearson). Furthermore, the levels of RGTTCRA-tRFs were higher in samples collected after head injury (p<0.0045, t test)
[0214] While the present invention has been particularly described, persons skilled in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims, which follow.
Claims
CLAIMSWhat is claimed:
1. A method for diagnosing a mitochondrial-related disease or disorder in a subject, the method comprising determining in a sample obtained or derived from said subject, any one of:(i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1 ; RGTTCRA-tRF);(ii) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in said sample; and(iii) both (a) and (b), wherein any one of: said abundance determined in (a), said ratio determined in (b), and both, being greater than a pre-determined threshold, is indicative of said subject being afflicted with a mitochondrial-related disease, and wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long, thereby diagnosing a mitochondrial-related disease in the subject.
2. The method of claim 1, wherein said mitochondrial-related disease is PD.
3. The method of claim 1, wherein said mitochondrial-related disease is induced by or comprises traumatic brain injury (TBI).
4. A method for determining the abundance of tRF comprising the motif RGTTCRA (SEQ ID NO: 1) in a sample, the method comprising amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long.
5. The method of claim 4, wherein said amplifying is by polymerase chain reaction (PCR).
6. The method of claim 4 or 5, further comprising determining the abundance of MT- tRFs in said sample.
7. The method of claim 6, wherein determining the abundance of MT-tRFs in said sample comprises amplifying MT-tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
8. The method of claim 7, further comprising comparing the determined abundance of said tRF comprising the motif RGTTCRA (SEQ ID NO: 1) to the abundance of said MT- tRFs comprising the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
9. The method of any one of claims 1 to 8, wherein said determining is in a plurality of samples being obtained or derived from said subject in a plurality of sampling events.
10. The method of claims 1 to 9, wherein said subject is administered with an effective amount of an anti PD therapy.
11. The method of claim 9, further comprising comparing any one of: said abundance of (a), said ratio of (b), and (c) determined in a first sample of said plurality of samples to any one of said abundance of (a), said ratio of (b), and (c) determined in at least one second sample of said plurality of samples, wherein said at least one second sample of said plurality of samples being obtained from said subject chronologically after said first sample of said plurality of samples being obtained from said subject, thereby determining efficacy of said anti PD therapy in said subject.
12. The method of claim 11, wherein said abundance of (a), said ratio of (b), and (c) determined in said at least one second sample of said plurality of samples being lower than any one of said abundance of (a), said ratio of (b), and (c) determined in said first sample of said plurality of samples, is indicative of said anti PD therapy being effective in said subject.
13. The method of any one of claims 1 to 12, wherein sample comprises: whole blood, plasma, or cerebrospinal fluid (CSF) of said subject.
14. The method of any one of claims 1 to 13, wherein said tRFs are nuclear genome- originated tRFs.
15. The method of any one of claims 1 to 14, wherein said all tRFs in said sample is or comprises all mitochondrial genome-originated tRFs (MT-tRFs) in said sample.
16. The method of claim 15, wherein said MT-tRFs comprise the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
17. The method of any one of claims 1 to 16, wherein said tRFs comprising the motif RGTTCRA (SEQ ID NO: 1) comprise the nucleic acid sequence GGTCCCTGGTTCAA (SEQ ID NO: 2).
18. The method of any one of claims 1 to 17, wherein said determining is in vitro or ex vivo determining.
19. The method of any one of claims 1 to 18, wherein said determining is by a method selected from the group consisting of: small RNA-sequencing, quantitative polymerase chain reaction (qPCR), and polynucleotide hybridization.
20. The method of claim 19, wherein said polynucleotide hybridization comprises preprepared chip, Nanostring test, or both.
21. A method for treating PD in a subject in need thereof, the method comprising: a. determining in a sample obtained or derived from said subject whether any one of: (i) an abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1;); (ii) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in said sample; and (iii) both (i) and (ii), being greater than a pre-determined threshold, wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long; and b. administering to said subject determined as having any one of: (i) said abundance of tRFs comprising the motif RGTTCRA (SEQ ID NO: 1;); (ii) said ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) and said abundance of all tRFs in said sample; and (iii) both (i) and (ii), being greater than said pre-determined threshold, a therapeutically effective amount of an anti PD therapy, thereby treating PD in the subject.
22. The method of claim 21, wherein said all tRFs in said sample are or comprise all mitochondrial genome-originated tRFs (MT-tRFs) in said sample.
23. The method of claim 22, wherein said MT-tRFs comprise the motif TAACTTAGCATTAACCTTTTAA (SEQ ID NO: 3).
24. The method of any one of claims 21 to 23, wherein said anti PD therapy comprises deep brain stimulation.
25. The method of any one of claims 21 to 24, wherein said anti PD therapy comprises at least one compound selected from the group consisting of: 1-3,4-dihydroxyphenylalanine (L-DOPA), monoamine oxidase B inhibitor, a DOPA decarboxylase inhibitor, a catechol- O-methyltransferase (COMT) inhibitor, bromocriptine, pergolide, pramipexole, ropinirole, piribedil, cabergoline, apomorphine, lisuride, and any combination thereof.
26. A method for monitoring progression of PD in a subject afflicted therewith, the method comprising:(a) determining in a plurality of samples obtained from said subject comprising a first sample and at least one second sample, wherein said at least one second sample is obtained from said subject chronologically after said first sample is obtained from said subject, any one of:(i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF) in a sample of said plurality of samples;(ii) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) of (i) and an abundance of all tRFs in said sample of said plurality of samples; and(iii) both (i) and (ii), wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long; and(b) comparing any one of: said abundance of (i), said ratio of (ii), and (iii) determined in said first sample of said plurality of samples to any one of said abundance of (i), said ratio of (ii), and (iii) determined in said at least one secondsample of said plurality of samples, thereby monitoring the progression PD in the subject.
27. A method for determining efficacy of an anti PD therapy in a subject administered therewith, the method comprising:(b) determining in a plurality of samples obtained from said subject comprising a first sample and at least one second sample, wherein said at least one second sample is obtained from said subject chronologically after said first sample is obtained from said subject, any one of:(i) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF) in a sample of said plurality of samples;(ii) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) of (i) and an abundance of all tRFs in said sample of said plurality of samples; and(iii) both (i) and (ii) wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long; and(c) comparing any one of: said abundance of (i), said ratio of (ii), and (iii) determined in said first sample of said plurality of samples to any one of said abundance of (i), said ratio of (ii), and (iii) determined in said at least one second sample of said plurality of samples, thereby determining efficacy of an anti PD therapy in the subject.
28. A method for diagnosing Parkinson’s disease (PD) in a subject, the method comprising determining in a sample obtained or derived from said subject, any one of:(a) an abundance of transfer RNA fragments (tRFs) comprising the motif RGTTCRA (SEQ ID NO: 1; RGTTCRA-tRF);(b) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in said sample; and(c) both (a) and (b),wherein any one of: said abundance determined in (a), said ratio determined in (b), and both, being greater than a pre-determined threshold, is indicative of said subject being afflicted with PD, and wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long, thereby diagnosing PD in the subject.
29. A method for determining the severity of PD in a subject afflicted therewith, the method comprising:(i) determining in a sample obtained or derived from said subject, any one of:(a) an abundance of RGTTCRA-tRF (SEQ ID NO: 1);(b) a ratio between said abundance of said RGTTCRA-tRF (SEQ ID NO: 1) and an abundance of all tRFs in said sample; and(c) both (a) and (b); and(ii) comparing a value determined for any one of (a) to (b) to a pre-determined threshold, wherein any one of: (1) said value being lower than said pre-determined threshold is indicative of said subject being afflicted with a mild form of PD; (2) said value being equal to said pre-determined threshold is indicative of said subject being afflicted with a moderate form of PD; and (3) said value being greater than said pre-determined threshold is indicative of said subject being afflicted with immoderate form of PD, and wherein said determining comprises amplifying a nucleic acid product comprising said motif and being 14 to 26 base pairs long, thereby determining the severity of PD in the subject afflicted therewith.
Citation Information
Patent Citations
Methods and kits for diagnosing, prognosing and monitoring parkinson's disease
US20160244833A1
tRNA-DERIVED FRAGMENTS AS BIOMARKERS FOR PARKINSON'S DISEASE
US20210340625A1
COMPOSITIONS AND METHODS OF USING HisGTG TRANSFER RNAS (tRNAs)
WO2017136760A1