Dual targeting cancer cell therapy for CD19 and CD20
The dual-targeting cancer cell therapy co-expressing CAR and BiTE addresses antigen loss and manufacturing complexity by enhancing tumor specificity and activation, achieving effective treatment of B-cell malignancies.
Patent Information
- Application Number
- PCT/IB2025/058501
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-23
- Filing Date
- 2025-08-23
- Publication Date
- 2026-02-26
AI Technical Summary
Existing CAR-T cell therapies face challenges such as antigen loss relapse, tumor editing, and manufacturing complexity due to dual targeting, with limitations in stability, solubility, short half-life, and uneven expression of dual antigen-binding constructs.
A dual-targeting cancer cell therapy that co-expresses a chimeric antigen receptor (CAR) and bispecific T-cell engager (BiTE) to enhance tumor specificity and activation, using polynucleotide sequences and vectors to ensure coordinated expression of multiple targeting moieties, including bidirectional or in-line promoters and self-cleaving peptides.
Enhances tumor targeting and eradication by leveraging both CAR-T and non-CAR-T cells, addressing antigen escape and persistence issues, and improving treatment durability and effectiveness against B-cell malignancies.
Smart Images

Figure IB2025058501_26022026_PF_FP_ABST
Abstract
Description
DUAL TARGETING CANCER CELL THERAPY FOR CD19AND CD20FIELD OF THE INVENTION
[0001] The present invention pertains to immunotherapy, specifically focusing on the advancement of dual -targeting cancer cell therapy. It involves a dual antigen targeting system that can co-express a Chimeric Antigen Receptor (CAR) and / or bispecific T-cell engagers (BiTEs) for cancer treatment. This novel approach seeks to improve the precision and effectiveness of immunotherapeutic strategies against B-cell malignancies and autoimmune diseases by concurrently targeting multiple tumor-associated antigens and activating T-cell mediated cytotoxicity.BACKGROUND OF THE INVENTION
[0002] Chimeric antigen receptor (CAR) is an engineered fusion protein comprising extracellular target binding domain usually derived from the singlechain variable fragment (scFv) of antibody against a target antigen (E.g., CD20, CD 19, CD22 etc.), spacer domain, transmembrane domain, and intracellular signaling domain containing CD3z linked with zero or more than one costimulatory molecule selected from group comprising of CD28, CD137, and CD134. T cells engineered to express CAR by gene transfer technology are capable of specifically recognizing their target antigen through the scFv binding domain, resulting in T cell activation. In the past several years, clinical trials from several institutions to evaluate CAR- T cell therapy for B cell malignancies including B cell acute lymphoblastic leukemia (B-ALL), B cell non-Hodgkin’s lymphoma (B-NHL), Diffuse large B cell lymphoma (DLBCL), chronic lymphocytic leukemia (CLL), and Hodgkin’s lymphoma (HL) have demonstrated promising outcomes by targeting CD 19 and CD20.
[0003] CD19-targeted therapies based on T cells that express CD19-specific chimeric antigen receptors (CARs) have been utilized for their anti-tumor therapeutic efficacy in patients with CD19+lymphomas and leukemias, first against NHL, then against CLL, and then against ALL. CAR- 19 T cells are geneticallymodified T cells that express a targeting moiety on their surface that confers T cell receptor (TCR) specificity towards CD19+cells. Binding of Anti-CD19 to its target receptor (CD 19) activates the TCR signaling cascade that leads to CAR T cell proliferation, cytokine production, and ultimately targeted lysis of the tumor cells, which in this case are CD19+B cells.
[0004] There are challenges to the broad application of CAR-T cell therapy in the future, such as antigen loss relapse, an emerging threat to CAR-T cell therapy, mainly observed in anti-CD19 CAR-T cells for B-ALL. The main mechanisms for relapse after treatments with single-CAR-T cells are the restricted persistence of CAR T-cells (CAR-T), inhibition of CAR T-cell function, and antigen escape. Antigen escape occurs when tumor cells evolve to express a low level of antigen to prevent the recognition of single-CAR-T cells, resulting in the failure of single CAR CAR-T cell to bind to the intended target.
[0005] CD 19 is expressed by most B-cell malignancies including NHL, ALL, CLL, hairy cell leukemia and a subset of acute myelogenous leukemia. Loss of CD 19 expression is an important mechanism for failure of anti-CD19 CAR T cell therapy. Loss of CD 19 expression has been detected in acute lymphoid leukaemia and B cell lymphomas. Some cases of B cell lymphomas lack CD 19 expression even before anti-CD19 CAR T cell therapy. Apart from CD 19, the other highly attractive target for immunotherapy of B-cell neoplasms is CD20, which is expressed by most B cell malignancies. As the loss of CD 19 expression is one of the known mechanisms of failure of anti-CD19 CAR T cell therapy. Similarly, loss of CD20 is observed in patients treated with CD20 specific immunotherapy example using Rituximab.
[0006] Use of CAR-T as specific targeting therapies always runs the risk of tumor editing, thus, highlighting the importance of developing new CAR-T constructs to prevent and treat tumors that escape therapy via antigen loss. Studies to overcome relapse due to tumor antigen loss are mainly focused on generating T cells capable of recognizing multiple tumor antigens.
[0007] Dual-targeting CAR T-cell therapy contains CAR T cells recognizing two targets on cancer cells and can overcome the resistance in cancers shown using single-CAR-T or any other antigen targeting cancer therapy. However, these dualtargeting CAR-T therapy have potential limitations in terms of stability, solubility, short half-life, immunogenicity and silencing or non-expression of one or both CAR. The design and production of CAR-T cells with dual targeting capabilities require complex genetic engineering to ensure both CARs are effectively expressed and functional. This complexity can increase the difficulty and cost of manufacturing. Bicistronic constructs, which use a single promoter to drive the expression of two genes (e.g., CAR / s and a reporter or safety switch), can sometimes result in uneven expression levels of the two genes. This imbalance can affect the therapeutic efficacy or safety of the therapy.
[0008] US2018355052 discloses chimeric antigen receptors containing CD19 / CD20 or CD20 / CD19 antigen binding domains, nucleic acids, recombinant expression vectors, host cells, antigen binding fragments, and pharmaceutical compositions relating to the chimeric antigen receptors. It also teaches methods of treating or preventing cancer in a subject, and methods of making chimeric antigen receptor T cells. Tandem CAR constructs, combine dual antigen binding (e.g., CD 19 and CD20) in a single receptor with shared signaling domains. While they broaden tumor targeting, they often face challenges like steric hindrance and misfolding leading to poor Car expression. Single signalling domain could cause imbalanced signaling, and reduced efficacy against single-antigen tumors. These design limitations can impact T-cell function and lead to manufacturing complexity.
[0009] US20210189336 discloses CAR-T cells providing highly effective therapies for diverse cancer types, e.g., solid cancers, hematological cancers, and metastatic forms thereof. US20210189336 also described methods of generating CAR-T cells, compositions comprising such CAR-T cells, methods of treatment using the cells, methods of identifying subjects susceptible to immune checkpoint immunotherapy treatment and methods of evaluating susceptibility of a subject to develop Cytokine- Release Syndrome. US20210189336 discloses BiTE being added exogenously to activate T cells before CAR transduction. BiTE is not encoded; it is a recombinant protein used for in vitro selection. It teaches a two-step method: (1) Activate T cells using BiTE, (2) select and transduce with CAR. BiTE is used to select high-activity T cells before CAR is introduced. Thus, there is a need to provide a single productthat encodes both a chimeric antigen receptor (CAR) and a bispecific T cell engager (BiTE) which is capable of constitutive secretion of the BiTE, thereby simplifying the production process and reducing overall manufacturing costs.
[0010] US11795240 discloses administering a T cell, genetically modified to express a chimeric antigen receptor (CAR), a bispecific antibody, or a combination thereof to a subject. The CAR and bispecific antibody of the invention can comprise a human antibody, a humanized antibody, or antigen-binding fragments thereof. It discloses ex vivo or in vitro method of generating a modified T cell, comprising introducing into a T cell a composition comprising : (a) a first RNA molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain; and (b) a second RNA molecule encoding a bispecific antibody, wherein the bispecific antibody comprises a first antigen recognition domain that recognizes the same antigen as the antigen binding domain of the CAR, and a second antigen recognition domain that recognizes CD3 wherein the bispecific antibody encoded by the second RNA molecule is secreted by the cell. US11795240 discloses both the CAR and the BiTE target the same antigen (e.g., CD19) and not independently target CD 19 and CD20. Further this conventional BiTE therapy requires continuous or repeated intravenous infusions due to the molecule’s short half-life, often necessitating prolonged hospitalization. Thus, there is a need to provide endogenous BiTE secretion from the modified T cell, which provides sustained, localized activity at the tumor site, reducing reliance on external infusion and improving therapeutic efficiency.
[0011] US 11207349 discloses a combined chimeric antigen receptor targeting CD19 and CD20 and application thereof. Specifically, US11207349 provides a combined chimeric antigen receptor targeting CD 19 and CD20, which comprises a scFv targeting CD 19 and CD20, a hinge region, a transmembrane region, and an intracellular signaling domain. US11207349 provides a nucleic acid molecule encoding the chimeric antigen receptor and a corresponding expression vector, a CAR-T cell, and applications thereof. The experimental results show that the chimeric antigen receptor provided by the present invention shows extremely highkilling ability against tumor cells. The chimeric antigen receptor of the present invention targets CD 19 and / or CD20 positive cells and can be used to treat CD 19 and / or CD20 positive B-cell lymphoma, leukemia and other diseases. These intracellular signaling domains are located downstream of the extracellular tandem scFv module, which includes both the CD 19 and CD20 binding regions. A tandem scFv CAR targeting both CD 19 and CD20 in a single construct can face challenges like improper folding, steric hindrance between binding domains, tonic signaling, and vector size limitations. These issues may affect CAR expression, antigen binding efficiency, and T cell function.
[0012] The present invention focuses on innovative dual targeting construct designs to combat relapsing tumors resulting from antigen escape or the loss of CD 19 or CD20. It aims to provide a tumor-specific, effective dual CAR-T cell therapy that targets multiple tumor antigens. Additionally, it envisions a tumor-specific dual targeting construct that co-expresses a CAR-T cell and a bispecific T-cell engager (BiTE). This approach seeks to expand the treatment options for B-cell malignancies and autoimmune conditions.SUMMARY OF THE INVENTION
[0013] The present invention aims to develop dual-targeting cancer cell therapy. It provides a genetically engineered construct co-expressing a chimeric antigen receptor (CAR) targeting the first tumor antigen, along with bispecific T-cell engagers (BiTEs) or a second CAR for targeting the second or a distinct tumor antigen different from the first antigen. This innovative approach combines the tumor-antigen specificity of CAR-T cells with the bridging, activation, and targeting capabilities of BiTEs. By utilizing both CAR-T and non-CAR-T cells, it addresses challenges such as tumor antigen escape and CAR-T persistence. The T cells expressing both the CAR and the BiTE enhance synergistic tumor targeting and eradication. The invention also includes polynucleotide sequences for expressing the dual-targeting construct, having CAR with or without a BiTE (CAR+CAR or CAR+BiTES), as well as vectors and cell compositions containing these elements. Additionally, it describes methods for using these compositions in cancer treatment.
[0014] In some embodiments, a dual-targeting construct is designed to co-express anti-CD19 CAR with a BiTE for CD20; or co-express anti-CD20 CAR with a BiTE for CD 19. In some embodiments, the dual-targeting CAR constructs are designed to express dual targeting anti-CD19 CAR and anti-CD20 CAR in a single T cell, allowing them to target CD 19 and CD20 antigens on tumor cells. These dual construct designs aim to enhance CAR T cell therapy by targeting multiple antigens, using various configurations including co-expressing the CAR and the BiTE or coexpressing the dual CARs or expressing the CAR or the BiTE using a suitable bidirectional or in-line promoter, or using a self-cleaving peptide. This strategy aims to improve the effectiveness and durability of cancer treatment. The BiTE component of the design promotes immune synapse formation, enhancing T-cell engagement, activation, and targeted cytotoxicity against cancer cells, by both CAR-T and non- CAR-T cells even if one of the target antigens is downregulated or lost. The BiTE component with the CAR recruits additional T cells to the cancer site thus engaging non-CAR T Cells for targeting cancer cells, which can result in the amplification of the anti-tumor response by the immune system.
[0015] In an embodiment, the present invention further discloses a polynucleotide sequence encoding a dual targeting construct, wherein the polynucleotide sequence encodes a CAR and a BiTE, or a dual CARs. A vector containing said polynucleotide, and a host cell transformed or transfected with said polynucleotide or vector. In addition, the present invention provides a method for producing such a construct according to the present invention, a medical use of said dual CAR constructs, and a kit containing the dual targeting CAR constructs.
[0016] In an embodiment, the dual targeting construct co-expressing the CAR, and the BiTE of the present invention may further comprise a dual in-line and / or a bidirectional promoter to enhance the functionality of the dual targeting CAR by coordinating or regulating gene expression more effectively. The present invention utilizes one or two promoters to simultaneously co-regulate and thus co-express the CAR’s with and without BiTE in the construct, ensuring coordinated and efficient expression of multiple targeting moieties. This design enhances the likelihood of recognizing and attacking malignant B -cells expressing one or more antigens thereof.
[0017] In an embodiment, the dual targeting CAR constructs express the dual CARs capable of targeting two different antigens. In specific embodiment, dual targeting CAR construct of the present invention expresses an anti-CD19 and an antiCD 20 CAR T-cell capable of targeting tumor cells expressing CD 19 or CD20 or both thereof.
[0018] In an embodiment, the present invention discloses genetically designed dual-targeting CAR constructs with or without the BiTEs.
[0019] In an embodiment the present invention discloses a dual targeting construct co-expressing a CAR and a BiTE.
[0020] In certain embodiments, the present invention discloses a dual targeting construct co-expressing an anti-CD19 CAR and a BiTE for CD20.
[0021] In another embodiment, the present invention discloses a dual targeting construct co-expressing an anti-CD20 CAR and a BiTE for CD 19.
[0022] In another embodiment, the present invention discloses a dual targeting construct with a bi-directional promoter.
[0023] In another embodiment, the present invention discloses a dual targeting construct with a dual in-line promoter.
[0024] In an embodiment, the present invention discloses a nucleotide and / or amino acid sequences for the dual targeting construct co-expressing a CAR and a BiTE wherein the construct uses either a bi-directional or an in-line promoters to enable reproducibility and implementation of the therapy.
[0025] In an embodiment, the present invention discloses nucleotide and / or amino acid sequences for co-expressing the dual CARs having either a bi-directional or an in-line promoter.
[0026] In an embodiment, the dual in-line promoter and bi-directional promoters are selected from EFla, CMV, PGK, MND and thereof for co-regulating the coexpression of dual targeting CARs or the CAR and the BiTE.
[0027] In some embodiments, the dual targeting construct co-expressing the CAR, and the BiTE includes one or more self-cleaving peptides. Non-limiting examples of self-cleaving peptides include T2A, P2A, E2A, F2A or a combination thereof.
[0028] In certain embodiments, where the dual targeting construct is designed with a bidirectional or in-line promoter, cleavage peptides are not used.
[0029] In some embodiments, the dual targeting construct co-expressing the CARs, or CAR with the BiTE may include one or more inducible response elements (IRE).
[0030] In some embodiments the IRE is NFAT. The NFAT, with IL-2, IL-5, IL-7, IL-8, IL- 15, IL- 18 promoters or the mini promoters or a combination thereof is used in the construct for expressing cytokines such as IL-15, IL-18, IL-2, IL-7, IL-8, IL- 21, IL-22 or others thereof to improve CAR persistence.
[0031] In an embodiment, the dual targeting CAR construct co-expressing the CAR, and the BiTE of the present invention facilitates enhanced local expression of BiTE in the tumor microenvironment, thus minimizing non specificity.
[0032] In an embodiment, the dual targeting CAR construct co-expressing the CAR, and the BiTE of the present invention further facilities recruitment of normal T-Cells in the tumor microenvironment.
[0033] In some embodiments, the dual targeting CAR construct co-expressing the CAR, and the BiTE includes one or more cytokines, chemokines, interferons, interleukins, tumor necrosis factor, or colony stimulating factors or others thereof. In some aspect the cytokine is interleukins.
[0034] In some embodiments of the present invention the T- cell are co-transduced using two vectors encoding anti-CD19 CAR and BiTE or a CAR for CD20 or anti- CD20 CAR and BiTE or CAR for CD 19 separately and a combination thereof.
[0035] In an embodiment, the present invention provides polynucleotide sequence for a dual targeting construct co-expressing the CAR and the BiTE suitable for targeting CD19-low or CD20-positive B-cells / tumors or CD 19-positive- CD20-low B-cells / tumors or CD19-positive-CD20-positive B-cells / tumors. Further, provides polynucleotide sequence for a dual targeting CAR construct co-expressing the dual CARs suitable for targeting CD19-low or CD20-positive B-cells / tumors or CD 19- positive CD20-low B-cells / tumors or CD 19-positive CD20-positive B-cells / tumors.
[0036] In an embodiment, the present invention provides a pharmaceutical composition comprising the dual targeting construct co-expressing the CAR and theBiTE as disclosed herein with one or more pharmaceutically acceptable excipients / carriers.
[0037] In another embodiment, the present invention provides methods of administration or methods of treatment or medical use of the pharmaceutical composition comprising the dual targeting construct co-expressing the CAR with or without the BiTE or the dual CARs disclosed herein to a subject diagnosed with B cell malignancies, or B-cell related autoimmune disorders and other B-cell related indications, and for preventing antigen escape of B cells.
[0038] In selected embodiments, the B cell malignancy is selected from the group consisting of: leukemias, lymphomas, and multiple myelomas.
[0039] In some embodiments, the B cell malignancy is selected from the group consisting of: acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia, hairy cell leukemia (HCL), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CIVIL), chronic myelomonocytic leukemia (CMML) and polycythemia vera, Hodgkin lymphoma, nodular lymphocyte-predominant Hodgkin lymphoma, Burkitt lymphoma, small lymphocytic lymphoma (SLL), diffuse large B-cell lymphoma, follicular lymphoma, immunoblastic large cell lymphoma, precursor B- lymphoblastic lymphoma, mantle cell lymphoma, marginal zone lymphoma, mycosis fungoides, anaplastic large cell lymphoma, Sezary syndrome, precursor T- lymphoblastic lymphoma, multiple myeloma, overt multiple myeloma, smoldering multiple myeloma, plasma cell leukemia, non-secretory myeloma, IgD myeloma, osteosclerotic myeloma, solitary plasmacytoma of bone, and extramedullary plasmacytoma.
[0040] In some embodiments, B-cell related autoimmune disorders is selected from the group consisting of multiple sclerosis (MS), rheumatoid arthritis (RA), inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), a wide range of other immune-mediated inflammatory diseases (IMIDs).BRIEF DESCRIPTION OF THE FIGURES
[0041] Figure 1 illustrates the CAR expression from 3 donors showed high CAR expression on humanized CD 19 scFv 3 and humanized CD 19 scFv 6 comparable to the murine construct.
[0042] Figure 2A-C shows the cytotoxicity effect of the humanized scFv in Nalm6 cell line. The CD 19 scFv 6 (amino acid SEQ ID NO.27) shows increased cytotoxicity in 2 of the 3 donor CAR T cells cocultured with Nalm6 when compared to other scFv’s.
[0043] Figure 3A-C shows the cytotoxicity effect of the humanized CD 19 scFv inCD 19 negative U266 cell line. The CD 19 scFv 2 (amino acid SEQ ID NO.23), CD 19 scFv 3 (amino acid SEQ ID NO.24) and CD 19 scFv 6 (amino acid SEQ ID NO.27) indicated no or minimal cytotoxicity with U266 cell line.
[0044] Figure 4 illustrates the Schematic illustrations of the bidirectional and Dualin line promoters in the dual targeting CAR constructs.
[0045] Figure 5 illustrates the Schematic illustration of the various embodiments of dual targeting construct designs of this invention. Each construct includes specific promoters, CARs or BiTE components utilized to target multiple antigens on cancer cells: (a & c) illustrates an construct features dual chimeric antigen receptors or a CAR+BiTE targeting distinct tumor antigens, regulated by bidirectional promoter at drives either the dual CAR or the CAR +BiTE, (b & d) illustrates the dual targeting constructs with dual in-line promoter controlling the dual CAR or CAR+BiTE, (e & f) illustrates the dual targeting construct driven by a single promoter for dual CAR and CAR+BiTE, incorporating at least one cleavage peptide.
[0046] Figure 6 illustrates schematic representations of various dual-targeting bicistronic anti-CD19-CD20 CAR constructs, featuring either single or dual promoters to drive CAR expression.
[0047] Figure 7 illustrates the CAR design of present invention, where CD20 and CD19 CARs are used in a bicistronic configuration or in a multivalent approach, incorporating a single construct having a CAR targeting one antigen and a BiTE targeting a second antigen.
[0048] Figure 8 shows the Brief flow chart outlining the CAR-T cell culture steps.
[0049] Figure 9 illustrates the Flowcytometry dot plots depicting the expression of CD 19 CAR and CD20 CAR on the dual CD20-CD19 CAR construct driven by single or dual promoters. A. CAR expression on Day 4. B. CAR expression on Day 8.
[0050] Figure 10 illustrates the Line graph showing the cytotoxicity percentage of CAR-T cells and untransduced cells against. A. Nalm6 cell line for 4 hours; and B. K562 cell line for 4 hours.
[0051] Figure 11 illustrates the Flow plots illustrating G4S expression in all dual and single CD 19 & CD20 CAR-T cells on Day 8 of culture.
[0052] Figure 12 shows CAR-T cells expression in n >6 samples. A. Anti-G4S linker antibody expression on Day 8 CAR- T cells; and B. recombinant CD 19 PE and CD20 protein +streptavidin APC-stained CAR-T cell expression on Day 8.
[0053] Figure 13 illustrates the Bar graph showing average cell counts (xl06 cells). A. CAR-T cell counts, and B. Total cell counts in n>4.
[0054] Figure 14 illustrates the Flow cytometry dual plots showing anti-His vs. G4S expression on dual bicistronic CAR and (co-expression of CAR+BiTE) cells from two different donor T cells.
[0055] Figure 15 illustrates the Bar graphs displaying anti-CD69 antibody expression on Day 8 dual constructs having bicistronic configuration or coexpressing CAR and BiTE.
[0056] Figure 16 illustrates the Grouped bar graph showing cytotoxicity percentages of all constructs at various E:T ratios against CD19+CD20+ Ramos cell line.
[0057] Figure 17 illustrates the Grouped bar graph showing cytotoxicity percentages of all the constructs at various E:T ratios against CD19+CD20- Nalm6 cell line.
[0058] Figure 18 illustrates the Grouped bar graph showing cytotoxicity percentages of all the constructs at various E:T ratios against CD19-CD20- K562 cell line.
[0059] Figure 19 illustrates the A. fFNy secretion in CAR-T-Ramos co-culture supernatants, B. Granzyme B (GB) secretion in CAR-T-Ramos co-culture supernatants, C. fFNy secretion in CAR-T-Nalm6 co-culture supernatants, D.Granzyme B (GB) secretion in CAR-T-Nalm6 co-culture supernatants, E. IFNy secretion in CAR-T-K562 co-culture supernatants, F. Granzyme B (GB) secretion in CAR-T-K562 co-culture supernatants.
[0060] Figure 20 illustrates the Flow cytometry analysis showing bicistronic CAR expression before and after construct modification through codon optimization. The upper panel shows expression of only the CD 19 CAR in the original Dual construct, while the lower panel shows co-expression of both CARs (dual CAR expression) after codon optimization of the CAR components was applied to improve expression balance.DETAILED DESCRIPTION OF THE INVENTION
[0061] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" or "an" means "at least one" or "one or more." It is understood that aspects and variations described herein include "consisting of" and / or "consisting essentially of aspects and variations.
[0062] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.
[0063] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.
[0064] The term “Antibody” or “functional fragment” means an immunoglobulin molecule that specifically binds to or is immunologically reactive with a particular antigen or epitope and includes both polyclonal and monoclonal antibodies. The term antibody includes genetically engineered or otherwise modified forms of immunoglobulins, such as chimeric antibodies, fully human antibodies, humanized antibodies, intrabodies, and peptibodies (e.g. bicistronic antibody, bispecific antibodies, diabodies, triabodies, and tetrabodies). The term functional antibody fragment includes antigen binding fragments of antibodies, including e.g., Fab', F(ab')2, Fab, Fv, rlgG, and scFv fragments. The term “scFv” as used herein refers to a single chain Fv antibody in which the variable domains of the heavy chain and of the light chain of a traditional two chain antibody have been joined to form one chain.
[0065] The term “scFv antibody” in this application refers to artificially produced antibody fragments consisting of covalently bonded VH and VL domains of an antibody. Both domains are present in a single polypeptide chain and are connected to one another via a polypeptide linker composed of multiple amino acids. With the exception of the Fc-mediated effector functions, scFv antibodies retain all functions of an antibody, more particularly its selectivity and affinity. The scFv binding domains can comprise chimeric, humanized or human antibody fragments. In the present invention preferably, the scFv binding domains comprise human or humanized antibody fragments.
[0066] “Bispecific T-cell engager” or “BiTE” molecules are recombinant protein constructs composed of two flexibly connected scFv. One of said scFv antibodies binds specifically to a selected, target cell-expressed tumor antigen, the second binds specifically to CD3, a subunit of the T-cell receptor complex on T cells. The BiTE antibodies are capable of binding T cells transiently to target cells and, at the same time, activating the cytolytic activity of the T cells. The BiTE-mediated activation of the T cells requires neither specific T-cell receptors on the T cells, nor MHC I molecules, peptide antigens or co-stimulatory molecules on the target cell. The terms “BiTE” or “bispecific T cell engager” as used herein encompass a first scFv engaging a CD3 on T-cells linked to a second scFv targeting a tumor antigen. The CD3 scFv used can be derived from OKT3 monoclonal antibody or a humanized variant thereof.The BiTE recognizes both CD3 on the T cells and a surface target antigen on cancer cells well-known in the art.
[0067] The terms “Bispecific” or “bifunctional antibody” is an artificial, hybrid antibody having two different pairs of heavy and light chain and also two different antigen-binding sites.
[0068] The term “Dual targeting cancer cell therapy” or “dual targeting CAR” or “dual targeting construct” or “dual targeting” or “dual targeting CAR-T” or “dual targeting CAR system” as used herein refers to polynucleotide encoding one or more chimeric antigen receptor (CARs) concurrently / simultaneously with or without a bispecific T cell engager (BiTE), in other word co-expressing a CAR targeting first tumor antigen and a BiTE targeting second tumor antigen or it can also mean a single T cells expressing more than one CARs for targeting multiple tumor targets / anti gens without the BiTE. In some embodiments, dual targeting construct means a CAR and a BiTE. In some other embodiments dual targeting constructs mean dual CARs without any BiTE.
[0069] The terms "Specifically binds" or "Specifically bound" or "Specific binding" or "Specifically targets" or “First Target” or “Second target” as used herein, describe binding of an anti -CD 19 or CD20 antibody or antigen binding fragment thereof (or a CAR comprising the same or a BiTE comprising the same) to CD 19 or CD20 at greater binding affinity than background binding.
[0070] The term ‘Inducible response element’ (IRE), or ‘inducible response element cassette,’ refers to specific nucleic acid sequences within gene promoters or enhancers that respond to external signals, such as antigen stimulation, to activate gene expression. In T cells during immune responses, IREs are crucial for regulating cytokine production and other immune-related functions. An example of an IRE is NF AT (Nuclear Factor of Activated T-cells), a family of transcription factors that play a significant role in immune responses by inducing the expression of various cytokines, such as IL-2, IL-3, IL-4, IL-8, and TNF -alpha, in T cells. NF AT signaling regulates gene transcription by translocating the activated, dephosphorylated NF AT into the nucleus to bind to the NF AT response element in the promoter of target genes. IRE as used herein, refers to a tandem repeat of the NF AT sequence coupled to IL-2or IL-8 promoters or mini promoters, which constitutively drive the transcription of cytokines such as IL- 15, IL- 18, and IL-21 upon CAR activation and signaling
[0071] The term “Promoter” as used herein is intended to encompass a region in a DNA sequence where proteins bind to initiate the transcription process to produce RNA. Located upstream of the DNA or towards the 5' region of the sense strand. The term “bidirectional promoter” as used herein, regulates the expression of two genes arranged in a head-to-head manner on the opposite strands of DNA or the two bidirectional promoter can be arranged in tandem or dual promoter system in divergent orientation (e.g., elongation factor 1 -alpha (EFla) and myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) or MND and cytomegalovirus (CMV) or EFla and CMV with a spacer having at least 100 to 200 bp to ensure the coregulation and co-expression of both the genes or alternatively the construct can use a single bidirectional promoter (e.g., EFla) located in the center transcribing the two gene in sense and antisense direction (i.e., initiate transcription in either 5' or 3' direction). The term “in-line promoter” as used herein, regulates the expression of two genes wherein the promoters are arranged in a manner that transcribes the genes in forward or sense direction or it can be arranged in opposite side driving the transcription of the two gene in sense and antisense direction of the DNA wherein both are moving inwards. The term bidirectional and in-line promoters are used based on the orientation of the promoters.
[0072] The term “Self-Cleavage peptide” is intended to mean 2A peptides known in the art which can be used in a single cassette having two genes. In the present invention use of 2Apeptide-mediated cleavage results in co-expression of functional dual CARs or functional CAR and a BiTE. The four 2 A peptides are F2A, E2A, P2A and T2A.
[0073] The term “Nucleic acid sequence” or “Polynucleotide sequence” is intended to encompass a polymer ofDNAorRNA, i.e., a polynucleotide, which can be singlestranded or double-stranded and which can contain non-natural or altered nucleotides. The terms "nucleic acid" and "polynucleotide" as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) ordeoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule, and thus include double- and single-stranded DNA, and double- and single-stranded RNA. The terms include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to methylated and / or capped polynucleotides.
[0074] The term “Variant” as used herein refers to polypeptides having amino acid sequences that differ to some extent from a native / wild type / parent sequence polypeptide. Ordinarily, amino acid sequence variants possess at least 80% sequence identity, more preferably, at least about 90% homologous by sequence. The amino acid sequence variants may possess substitutions, deletions, and / or insertions at certain positions within the reference amino acid sequence.
[0075] The term “Dual CAR”, or “Bispecific CAR”, used herein means cotransduction of T cells with two separate vectors encoding individual CAR structures, bispecific-CAR-T cell are produced by transduction of a two vectors to introduce two separate CARs with one tumor specific antigen-binding domain per CAR.
[0076] The term ‘bicistronic CARs’ refers to constructs that encode two CARs within a single vector backbone.
[0077] The term ‘Tandem CARs’ link two different scFvs within one CAR domain, while ‘loop CARs’ link the VL-VH regions of one scFv to the VL-VH regions of another scFv within a single CAR domain.
[0078] The term “patient” refers to (human or animal) individuals receiving a preventive or therapeutic treatment using the composition comprising present invention.
[0079] The term “treatment” as used herein refers to the use or administration of a therapeutic substance of the invention on / to a patient, or to the use or administration of a therapeutic substance of the invention on / to an isolated tissue or on / to a cell line of a patient, who is suffering from a disease, is showing a symptom of a disease, or has a predisposition to a disease, with the goal of curing, improving, influencing, stopping or alleviating the disease, its symptoms or the predisposition to the disease.
[0080] The term “Effective dose” or “therapeutically effective dose” as used herein refers to active-ingredient amount which is sufficient to at least partially cure adisease, or to at least partially eliminate adverse effects in the patient that are caused by the disease. The amounts required for this purpose are dependent on the severity of the disease and on the general immune status of the patient.
[0081] The term “B-cell malignancies”, means certain types of leukemia and lymphoma, represent a significant clinical challenge due to their aggressive nature and resistance to conventional therapies. Recent advancements in immunotherapy, particularly CAR-T cell therapy and bispecific T-cell engagers, have shown promise in targeting and eliminating malignant cells. However, limitations such as antigen escape and suboptimal T-cell activation necessitate the development of more robust therapeutic strategies.
[0082] Dual targeting CAR-T and bicistronic CAR-T cell therapies have innovative designs that offer several advantages but also present specific challenges such as increased cost and manufacturing complexity, risk of off-target effects, potential for increased toxicity. Similarly, the challenges in the case of bicistronic CAR-T cells include uneven expression, reduced functionality, risk of unintended interactions, and technical challenges in vector design.
[0083] The present invention broadly focuses on developing a dual -targeting cancer cells therapy comprising of genetically engineered cells to concurrently or simultaneously co-express a chimeric antigen receptor (CAR) and a bispecific T-cell engagers (BiTEs) or CARs. This innovative approach provides construct which combines CAR-T cells’ tumor-targeting specificity with the BiTEs’ bridging and activation capabilities, aiming to overcome challenges like tumor antigen escape by leveraging both technologies. T cells co expressing the CAR and the BiTE enhance synergistic tumor targeting and eradication. The invention also discloses polynucleotide sequences expressing the dual -targeting CAR construct with or without a BiTE, along with a vector and a cell composition containing these elements. Additionally, it outlines a method for using these compositions in cancer treatment.
[0084] In an embodiment, present invention provides a polynucleotide encoding a dual targeting construct targeting both CD 19 and CD20 comprising: (a) a first sequence encoding a first chimeric antigen receptor (CAR), said first CAR comprising a first antigen-binding domain specific for a first antigen; (b) a secondsequence encoding a second targeting molecule; wherein said second targeting molecule is selected from: a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain specific for said second antigen, or abispecific T cell engager (BiTE) comprising an antigen-binding domains specific for CD3 and the second antigen-binding domain specific for said second antigen; wherein said first and second anti gen -binding domain are independently selected from CD 19 and CD20 antigen-binding domain, and wherein said antigen-binding domain is encoded by a nucleotide sequence that encodes a single variable fragment (scFv) that specifically binds: (i) to CD19, having sequence ID selected from SEQ ID NO: 128 or SEQ ID NO: 131; (ii) to CD20, having sequence ID selected from SEQ ID NO: 132 or SEQ ID NO: 133; and to CD3, having sequence ID selected from SEQ ID NO: 124 or SEQ ID NO: 125.
[0085] In an embodiment, present invention provides, an isolated polynucleotide of a dual targeting construct / system comprising a first gene encoding a first polypeptide and a second gene encoding a second polypeptide, wherein said first polypeptide comprises of (i) a signal peptide, (ii) a binding protein, (iii) a hinge region, (iv) a transmembrane domain, (v) a co-stimulatory domain CD28 and (vi) a CD3 zeta signaling domain; and said second polypeptide comprises of: (i) a signal peptide, (ii) a binding protein, (iii) a hinge region, (iv) a transmembrane domain, (v) a co-stimulatory domain of 4-1BB and (vi) a CD3 zeta signaling domain; wherein at least one of the binding protein binds to an antigen on cancer cells. In another aspect of the invention, the first and the second polypeptide are co-expressed at same or a similar level. The first gene and second gene are sequentially linked or connected by a self-cleavage peptide or a 2A peptide. In another aspect of the invention, the first and the second polypeptide are co-expressed at same or a similar level by using bidirectional promoters or dual in-line promoters for two genes.
[0086] In an embodiment, present invention provides, an isolated polynucleotide of a dual targeting construct / system comprising a first gene encoding a first polypeptide and a second gene encoding a second polypeptide, wherein said first polypeptide comprises of (i) a signal peptide, (ii) an antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a co-stimulatory domainCD28 and(vi) a CD3 zeta signaling domain; and said second polypeptide comprises of: (i) a signal peptide, (ii) an antigen binding domain, that specifically binds the T-cell receptor-CD3 complex and a second antigen binding domain; wherein at least one of the antigen binding domain binds to an antigen on cancer cells, and the polypeptide sequences of said antigen binding domain is independently selected from sequence having sequence SEQ ID NO: 24 or SEQ ID NO:27; SEQ ID NO: 28 or SEQ ID NO:29; and SEQ ID NO: 20 or SEQ ID NO: 21. In another aspect of the invention, the first and the second polypeptide are co-expressed at same or a similar level. The first gene and second gene are linked by a self-cleavage peptide or 2A peptide. In another aspect of the invention, the first and the second polypeptide are co-expressed at same or a similar level by using bidirectional promoters or dual in-line promoters for two genes.
[0087] In some embodiments, the present invention discloses a dual CARs construct expressing two separate CARs on the same cell simultaneously, with each CAR cell having its own hinge and extracellular binding region with a transmembrane domain and intracellular domains having the costimulatory and signaling domain along with a self-cleaving peptide or a promoter and / or an inducible response element. In certain aspects, dual targeting CAR can be a bivalent tandem CAR, a bivalent loop CAR, and / or a bicistronic CAR.
[0088] In an embodiment, the promoters can be dual in-line promoters (i.e., initiate transcription in one direction) or bi-directional promoters (i.e., initiate transcription in either 5' or 3' direction or both).
[0089] In an embodiment, self -cleavage peptide can be used to link the CAR with other protein or peptide, or a BiTE or second CAR.
[0090] Self-cleavage peptide-linked bicistronic vectors can be used to express two proteins from a single open reading frame. The cleavage peptide sequences, when cloned between genes, allow for efficient production of discrete protein products within a single vector through a novel “cleavage” event within the cleavage peptide sequence. Non-limiting examples of cleavage peptide include F2A, E2A, P2A and T2A and the sequences are well known the art.
[0091] In some embodiments, where the dual targeting construct includes a cleavage peptide, the bi-directional or in-line promoter may be absent
[0092] In one embodiment of the present invention, the activation of immune effector cells involves one or more NF AT binding sites, which can range from 1 to 9 or more. The NFAT binding sequence is GAGGAATTTCCATT. In some embodiments, these NFAT binding sites consist of tandem repeats of the sequence GAGGAATTTCCATT, repeated (e.g.,1, 2, 3, 4, 5, 6, 7, 8, 9 or more times). In a specific embodiment, the NFAT binding site may include 6xIL-8 NFAT response elements having the nucleotide sequence SEQ.ID. NO. 56. These NFAT-responsive elements can be located in the promoter region or distal to it, such as 5' of the proximal promoter, within intronic regions, or 3' of the gene. In some embodiments, the NFAT-responsive promoter is associated with a cytokine or cytokine receptor, including IL-2, IL-2 receptor (IL-2R), IL-3, GM-CSF, IL-4, IL-7, IL-8, IL- 10, and IFN-y. In certain embodiments, the NFAT-responsive promoter or mini-promoter is linked to a calcineurin-regulated gene. In specific embodiment, the IL-8 mini promoter comprises the nucleotide sequenceTAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQ ID. NO. 57).
[0093] In some embodiment dual targeting constructs of present invention may include one or more cytokines such as interleukins selected from IL-15, IL-18 IL-1- alpha, IL-l-beta, IL-7, IL-2, IL-10, IL-21, IL-12, IL-22, IL-23 and thereof, preferably IL-15 or IL-18.
[0094] In an embodiment, present invention discloses bicistronic chimeric antigen receptor construct targeting CD 19 and CD20, an expression vector, composition and application thereof, wherein in some aspect, the bicistronic chimeric antigen receptor construct comprises a signal peptide, a first antigen binding domain (anti-CD19 scFv), a linker a second antigen binding domain (anti-CD20 scFv), a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide, one or more promoters or one or more cleavage peptides, may include one or more IRE which are sequentially connected in the construct and expressed within the cells.
[0095] In an embodiment, the first tumor antigen / first antigen or second tumor antigen / second antigen is CD 19.
[0096] In some embodiments, the first antigen / first tumor antigen or second antigen / second tumor antigen is CD20.
[0097] In some embodiments, the first and second antigens are expressed on a cancer cell.
[0098] In an embodiment, a bicistronic chimeric antigen receptor construct design comprises a anti-CD 19-CAR targeting first tumor antigen, having a signal peptide, a CD 19 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide which are sequentially connected and an anti-CD20 CAR targeting second tumor antigen, having a signal peptide, a CD20 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signal peptide which are also sequentially connected. Further, the CAR construct may have one or more promoters or one or more self-cleaving peptides and one or more inducible response elements such as NF AT, with IL -2, IL -5, IL-6, IL-7, IL-8, IL-15, IL18 promoters or the mini promoters or a combination thereof for expressing cytokines.
[0099] In an embodiment, the promoter can be a bidirectional promoter or in-line promoters. In certain aspects, wherein a bidirectional promoter or two in-line promoters is used in the construct’s the self- cleavage peptide is not used.
[0100] In certain embodiments, the bidirectional promoter can be overlapping or non-overlapping or divergent. In an embodiment the construct can use one or more bidirectional promoters. The bidirectional promoters allow transcription from both the sense and antisense direction thus the bidirectional promoters allow the two genes to be co-regulated and co-expressed efficiently.
[0101] In some embodiments, a dual targeting chimeric antigen receptor constructs a single bidirectional promoter is used for co-expressing the dual-CAR cassettes in both the sense and the antisense direction. In certain aspects two bidirectional promoters may be used in tandem with a spacer for more efficient co-regulation and co-expression.
[0102] In an embodiment, a dual targeting construct co-expressing a CAR and a BiTE in a single cassette is transcribed in the sense and the antisense direction using a single, compact, bidirectional promoter. In certain aspects two or more bidirectional promoters may be used in tandem with a spacer.
[0103] In an embodiment, the dual targeting construct comprises an anti-CD19 CAR targeting first tumor antigen, having an in-line promoter 1, a signal peptide, an anti-CD19 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide which are sequentially connected with an anti-CD20 CAR targeting second tumor antigen, having an in line promoter 2, signal peptide, an anti-CD20 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide. Further, the CAR construct may have one or more self-cleaving peptides and one or more inducible response elements.
[0104] In an embodiment, the dual targeting chimeric antigen receptor construct or dual targeting construct may further comprises a bidirectional promoter transcribing a cassette comprising an anti-CD19 CAR targeting first tumor antigen, having a signal peptide, an anti-CD19 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide which are sequentially connected with an anti-CD20 CAR targeting second tumor antigen, having a signal peptide, an anti-CD20 scFv, a hinge region, a transmembrane region, one or more co-stimulatory factor and an intracellular signaling peptide. In certain aspects a single bidirectional promoter is used in the center of the cassette to transcribe the anti-CD19 and anti-CD20 CARs in sense and antisense direction. In other embodiments, two bidirectional promoters are used in tandem with a spacer for transcribing the dual CARs. Further, the CAR construct may have one or more inducible response elements. The bidirectional promoters used in the construct can enhance transcriptional activity in both directions, compared with unidirectional promoters.
[0105] In an embodiment the examples of bidirectional promoters include EFla, CMV, PGK, MND or a combination thereof.
[0106] In an embodiment, the EFla nucleotide sequence is SEQ.ID.NO.58.
[0107] In an embodiment, the MND nucleotide sequence is SEQ.ID.NO.59.
[0108] In some embodiments, where the bidirectional promoter is absent, and a cleavage peptide is used between the two CAR cassette to transcribe the dual CARs.
[0109] In an embodiment, the dual targeting CAR constructs of the present invention having a bidirectional promoter which transcribes the anti-CD19 CAR in the sense or forward direction or orientation and anti-CD20 CAR in the antisense or reverse orientation. Alternatively, it can be an anti-CD20 CAR in the forward / sense direction and anti-CD19 CAR in the antisense / reverse orientation.
[0110] In an embodiment, the dual targeting CAR constructs of the present invention with a bidirectional promoter, comprises of anti-CD19 CAR having a CD8a signal peptide, humanized anti-CD19 scFv, a CD8a hinge and transmembrane, a 4- 1BB intracellular co-stimulatory domain and a CD3(^ activation domain expressed or transcribed in sense direction or forward orientation from the bidirectional promoter. Next a CD20 CAR having a IgGl signal peptide, fully human anti-CD20-scFv, a CD8a hinge and transmembrane domain, a CD28 intracellular co-stimulatory domain and the CD3(^ activation domain, expressed or transcribed in the antisense direction or reverse orientation from the bidirectional promoter. In certain aspect at least one bidirectional promoters are used to transcribe the construct, (ref to figure 4 and 5).[OHl] In another embodiment, the invention relates to adoptive cell transfer of T cells modified to express chimeric antigen receptor (CAR) and a bispecific T cell engager (BiTE).
[0112] In another embodiment, the present invention discloses the dual targeting constructs expressing a CAR with a BiTE having at least one bidirectional promoter. Wherein the construct comprises of a CAR for first tumor target having a signal peptide, humanized scFv region for antigen targeting, a hinge, a transmembrane, a intracellular co-stimulatory domain and an activation domain expressed or transcribed in sense direction or forward orientation from bidirectional promoter which is sequentially connected to a BiTE for targeting a another / second tumor target which is expressed or transcribed in the antisense direction or reverse orientation from bidirectional promoter. The BiTEs consist of two single-chain variablefragments (scFvs) of different antibodies, one of the scFvs binds to T cells via the CD3 receptor, and the other to a tumor cell antigen (Figures 4 and 5).
[0113] Figure 4 illustrates various promoters in different orientations. Figure 4A shows use of bi-directional promoter or two dual promoters in divergent orientation driving two different genes respectively. Figure 4B shows the use of in-line promoters to regulate two genes efficiently.
[0114] In some embodiments the above-described dual targeting CAR constructs with the BiTE may further include one or more inducible response elements.
[0115] In some embodiment the above-described dual targeting CAR constructs with the BiTE may further includes one or more cytokines such as interleukins selected from IL15, IL18 IL-l-alpha, IL-l-beta, IL-7, IL-2, IL-10, IL-21, IL-12, IL- 22, IL-23 and thereof, preferably IL- 15 or IL18.
[0116] In an embodiment, the dual targeting constructs co-expressing a CAR and a BiTE using at least one bidirectional promoter(s), comprises of a CAR consisting of a CD8a signal peptide, humanized anti-CD19 scFv, a CD8a hinge and transmembrane, a 4- IBB intracellular co-stimulatory domain and a CD3^ activation domain expressed or transcribed in sense direction or forward orientation from bidirectional promoter(s) sequentially connected to a BiTE for CD20 which is being expressed or transcribed in the antisense or reverse orientation from the bidirectional promoter(s).
[0117] In an embodiment, the dual targeting construct comprising of a CAR consisting of an in-line promoter, signal peptide, antigen- binding domain(scFv) for first target, a hinge and transmembrane domains, a co-stimulatory domain, a signaling domain, linked to a second in-line promoter, a single peptide, an antigen binding region(scFv) for second target, anti-CD3. Examples of dual-in-line or in-line promoters include EFla, CMV, PGK, MND or others thereof.
[0118] In an embodiment the present invention provides a polynucleotide encoding dual targeting chimeric antigen receptor constructs with or without the BiTE linked to one or more cytokine to prolong T cell longevity or persistence.
[0119] In certain aspect dual targeting chimeric antigen receptor constructs with or without the BiTE may not be linked to a cytokine.
[0120] In some embodiments AAV, retroviral or lentiviral vectors are used to deliver the dual targeting construct of the invention to a T cell.
[0121] In an embodiment, the nucleic acid sequence encoding a dual targeting CAR construct with or without the BiTE disclosed here may be introduced into a cell by transfection, transformation, transduction or co-transduction. Phage or viral vectors can be introduced into host cells, after suitable packaging, many of which are commercially available.
[0122] In some embodiments of the invention, an expression vector encoding the hu CD19-CD20 dual CAR is provided, where the vector may be a lentiviral vector, a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a plasmid.
[0123] In some embodiments of the invention, an expression vector encoding the anti-CD19 CAR-BiTE for CD20 or anti-CD20 -CAR-BiTE for CD 19 dual targeting construct is provided, where the vector may be a lentiviral vector, a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a plasmid.
[0124] In an embodiment, present invention provides molecules such as chimeric and / or fusion molecules, including receptors, such as recombinant receptors, that include the inventive antigen-binding, e.g., an antibody, of any of the embodiment (e.g., contained in or part of an extracellular domain) and additional domains, such as intracellular signaling domains, spacers, linkers and / or transmembrane domains. Further, the CAR constructs may include one or more self-cleaving peptides and inducible response elements. In certain aspects, the CAR construct may include one or more cytokines. In another aspect, the CAR construct may include one or more promoters selected from bidirectional or dual or in-line promoters. The bidirectional promoter may be overlapping or divergent.
[0125] In some embodiments, the chimeric antigen receptor comprises an intracellular signaling domain, a transmembrane domain, and an extracellular domain comprising an antigen binding region.
[0126] In some embodiments, CARs comprise an intracellular activation domain, a transmembrane domain, and an extracellular domain consisting of a tumor associated antigen binding region. In preferred aspects, CARs comprise fusions ofsingle-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta a transmembrane domain and an endodomain.
[0127] The invention provides a cells comprising of a nucleic acid sequence encoding recombinant antigen-binding proteins, such as antibodies (including fragments) from any of the described embodiments, or receptors like chimeric antigen receptors (CARs) or synthetic immune receptors (SIRs) or bispecific T -cell engager, from any of the disclosed embodiments. This includes vectors containing these nucleic acids and cells containing the vectors and / or nucleic acids, for example, for the expression of the antibodies and / or molecules.
[0128] In another embodiment, the present invention provides cells and vectors for the production and expression of these molecules, including CARs, and mono- specific or bi-specific CARs or dual targeting CAR with or without the BiTE. In certain aspects the invention includes genetically engineered cells expressing the CARs and the BiTE.
[0129] The embodiments of the invention utilize a dual targeting construct coexpressing CAR and BiTE molecules that enables immune cell (T cell) to specifically and distinctly recognize and attack two cancer target molecules simultaneously, or to attack a cancer cell that has lost expression of either CD20 or CD 19 or has low expression of either CD 19 or CD20.
[0130] In certain aspects, the immune cell is a T cell, an NK cell, NKT cell, or another type of immune cell.
[0131] In some embodiments, the dual -targeting cancer cell therapy comprising a genetically engineered construct co-expressing a CAR and a BiTE (bispecific T cell engager) that improves the identification and elimination of cancer cells expressing either CD 19 or CD20 tumor antigens or both thereof. This design ensures that T cells can effectively target cancer cells expressing either antigen, additionally the BiTE recruits non-CAR T cells or normal T cells to tumor cells, thus leading to a stronger immune response.
[0132] In an embodiment, the dual targeting cell therapy for the tumor may be achieved using several methods known in the art such as co-transduction of T cell using two vectors encoding separate CD 19 and CD20 CARs; co-administration oftwo CAR-T products targeting CD 19 and CD20 separately; bicistronic vectors permitting the co-expression of 2 independent receptors in parallel on the cell surface; tandem CARs, with CD 19 and CD20 binders being expressed on a endodomain. Designing and manufacturing the dual targeting cell therapy is quite challenging and requires in depth experience of the CAR and BiTE function plus it should be designed to ensure co-expression of the multiple scFv domain for targeting the multiple tumor antigen in a cost-effective manner.
[0133] In one embodiment, a bispecific T cell engager (BiTE) with an anti-scFv domain comprises two different binding specificities and thus binds to two different antigens. In one embodiment, BiTE comprises a first antigen recognition domain that binds to a first antigen and a second antigen recognition domain that binds to a second antigen. In one embodiment, the first antigen recognition domain binds to a tumor associated antigen. In one embodiment, the second antigen recognition region binds to an antigen on T cells. In a particular embodiment, the second antigen recognition region binds to CD3 on T cells.
[0134] The BiTE molecule described in this invention identifies and targets tumor antigens that have evaded CAR-T cells, either due to low expression of the tumor antigen or through the tumor cell’s antigen escape mechanisms. Additionally, the BiTE molecule recruits more T cells to the tumor microenvironment.
[0135] In some embodiments, the present invention discloses a genetically designed dual-targeting cell therapy comprising a CAR construct with or without BiTEs using at least one bidirectional or in-line promoters.
[0136] In an embodiment, the dual targeting cell therapy comprises of an anti-CD19 CAR with a bispecific T-cell engagers (BiTEs) for CD20; or anti-CD20 CAR with a bispecific T-cell engagers (BiTEs) for CD 19; or anti CD 19 CAR and anti-CD20 dual CARs or a combination thereof.
[0137] In an embodiment, the dual targeting cell therapy is an anti-CD19 CAR with a bispecific T-cell engagers (BiTEs) for CD20.
[0138] In an embodiment, the dual targeting cell therapy is an anti-CD20 CAR with a bispecific T-cell engagers (BiTEs) for CD 19. 1
[0139] In an embodiment, the dual targeting cell therapy is a single T cell expressing hu anti-CD20 CAR and hu anti -CD 19 CAR.
[0140] In an embodiment, the dual targeting cell therapy is a single T cell expressing hu anti-CD19 CAR and hu anti-CD20 CAR without a BiTE.
[0141] In some embodiments, the dual targeting construct is being designed to express both humanized anti-CD19 CAR and human anti-CD20 CAR in a single T cell, thus allowing them to target CD 19 or CD20, or CD 19 and CD20 antigens expressed by the tumor cells.
[0142] In some embodiments, the dual targeting construct is designed to co-express an humanized anti-CD19 CAR with a BiTE for CD20(fully human); or co-express an fully human anti-CD20 CAR with a BiTE for CD19(humanized). This dual targeting cell therapy aims to enhance CAR and BiTE to target multiple know tumor antigens using various configurations including co-expression of the CAR and the BiTE or co-expression of the dual CARs or otherwise, co-expressing the CAR or the BiTE either using a suitable bidirectional promoter, or an in-line promoter, or using a cleavage peptide. The strategy aims to improve the effectiveness and durability of cancer treatment. The BiTE component of the construct promotes immune synapse formation, enhancing T-cell engagement, activation, and targeted cytotoxicity against cancer cells, by both CAR-T and non-CAR-T cells even if one of the target antigens is downregulated or lost. Further the BiTE component recruits additional T cells to the cancer site which amplifies the anti-tumor immune response.
[0143] In some embodiments, the dual -targeting CAR construct co-expressing the CAR, and the BiTE (bispecific T cell engager) improves the identification and elimination of cancer cells expressing either CD 19 or CD20 tumor antigens. This design ensures that T cells can effectively target cancer cells expressing either of the antigens, additional BiTE recruits non-CAR T cells or normal T cells to tumor cells, thus leading to a stronger immune response.
[0144] In an embodiment, the dual targeting construct co-expressing the CAR, and the BiTE facilitates enhanced local expression of BiTE in the tumor microenvironment, thus minimizing non specificity.
[0145] In an embodiment, the dual targeting construct co-expressing a CAR, and a BiTE enables recruitment of normal T-Cells in the tumor microenvironment.
[0146] In an embodiment, the present invention further discloses a polynucleotide sequence encoding the dual targeting construct comprising the CAR and the BiTE or the dual CARs, a vector containing said polynucleotide, and a host cell transformed or transfected with said polynucleotide or vector. In addition, the present invention provides a method for producing such construct according to the present invention, a medical use of the dual targeting constructs, and a kit containing the dual targeting construct.
[0147] In an embodiment, dual construct co-expressing a CAR, and a BiTE may include one or more promoter selected from an in-line and / or a bidirectional promoter to enhance the safety and functionality of the dual targeting construct by coregulating the co-expression of the genes more effectively. The present invention utilizes at least one in-line promoter or one bidirectional promoter to simultaneously co-regulate the co-expression of the CAR’s with and without BiTE. Bidirectional promoters are used to ensure coordinated and efficient co-expression of multiple targeting moi eties. The various construct design as described here enhance the likelihood of recognizing and attacking malignant B-cells expressing one or more antigens.
[0148] In another embodiment, the dual targeting CAR construct with or without the BiTE utilizes bi-directional promoters. The non-limiting examples of bidirectional promoters include EFla, CMV, PGK, MND or a combination thereof.
[0149] In another embodiment, the dual targeting CAR construct with or without the BiTE utilizes dual in-line promoters. The non-limiting examples of in-line promoters include EFla, CMV, PGK, MND, others thereof.
[0150] In some embodiments, dual targeting construct co-expressing the CAR, and the BiTE includes one or more self-cleaving peptides such as T2A, P2A, E2A, F2A or a combination thereof.
[0151] In some embodiments, dual targeting constructs co-express the CAR, and the BiTE includes one or more inducible response elements.
[0152] In an embodiment, the IRE comprises one or more, e.g., 1, 2, 3, 4, 5, 6, or more, NF AT binding sites, e.g., 3 or 6 NF AT binding sites, and a minimal IL-2 promoter or minimal IL-8 promoter.
[0153] In some embodiments, dual targeting CAR construct co-expressing the CAR, and the BiTE include one or more cytokines, chemokines, interferons, interleukins, tumor necrosis factor, or colony stimulating factors or others thereof. In some aspect the cytokine is interleukins. The non-limiting examples of cytokine include interleukin-2 (IL-2), interleukin -7 (IL-7), interleukin -15 (IL- 15), interleukin -18 (IL-18) and interleukin- 21 (IL-21).
[0154] In an embodiment, the present invention provides polynucleotide sequence encoding a dual targeting construct co-expressing the CAR with the BiTE.
[0155] In an embodiment, the present invention provides polynucleotide sequence encoding a dual targeting CAR construct co-expressing the CARs without the BiTE.
[0156] In an embodiment present invention discloses the polynucleotide sequence encoding an anti-CD19 CAR and an anti-CD20 CAR on single immune cell; or an anti-CD19 CAR with a BiTE for CD20 or anti-CD20 CAR with a BiTE for CD 19 or a combination thereof that are suitable for targeting CD19-low or CD20-positive B- cells / tumors or CD 19-positive CD20-low B-cells / tumors.
[0157] In an embodiment, the present invention provides a pharmaceutical composition comprising dual targeting CAR construct co-expressing a BiTE, or a dual targeting CAR construct without a BiTE as disclosed herein with one or more pharmaceutically acceptable excipients / carriers.
[0158] In another embodiment, the present invention provides methods of administration or methods of treatment or medical use of the pharmaceutical composition comprising CAR T construct co-expressing BiTE for dual targeting as disclosed herein to a subject diagnosed with B cell malignancies, or B-cell related autoimmune disorders and other B cell -related indications, and for preventing antigen escape of B cells.
[0159] The dual targeting capability of the present invention enhances the specificity and reduces the likelihood of antigen escape, as malignant cells must lose both CD 19 and CD20 expression to evade the therapeutic effect. By integrating theBiTEs with the dual CAR-T cells, the invention leverages the strengths of both modalities, providing a multi-faceted attack on B-cell malignancies.
[0160] In an embodiment, the bispecific T-Cell Engagers (BiTEs) molecules linked with an antigen binding region (such as anti-CD19 scFv or anti-CD20 scFv) are engineered to bind simultaneously to CD 19 or CD20 present on a malignant B-cell and CD3 on T-cells. This dual binding facilitates the close proximity of T-cells to the malignant cells, promoting effective T-cell activation and targeted cell killing.
[0161] In some embodiments, the dual CAR-T Cells are genetically modified to express receptors that recognize both CD 19 and CD20 antigens. Upon infusion into the patient, these dual CAR-T cells can recognize and bind to malignant cells expressing either or both antigens, initiating a potent immune response. Accordingly, the present invention also provides a pharmaceutical composition comprising the genetically modified T cell transduced with dual targeting construct and a pharmaceutically acceptable excipient / carrier.
[0162] In some embodiments, the integration dual CAR with BiTE creates a synergistic effect, where the BiTEs enhance the T-cell activation and cytotoxicity mediated by the CAR-T cells. This dual targeting approach maximizes the likelihood of recognizing and eliminating malignant cells, thereby improving the overall efficacy of the treatment.
[0163] In some embodiments dual targeting can be achieved by co-transduction of T cells using two vectors encoding anti -CD 19 CAR and BiTE for CD20 or anti-CD20 CAR and BiTE for CD 19 separately. In certain aspects, the T cells are co-transduced using two vectors encoding two separate anti- CD 19 CAR and anti-CD20 CAR. Dual targeting can also be achieved by co-administration of the anti-CD19 CAR and a BiTE for CD20 or by co-administration of anti-CD20 CAR and a BiTE for CD 19 or by co-administration of anti-CD20 CAR and anti-CD19 CAR.
[0164] In some embodiments, the dual targeting construct of the present invention co-expresses the CAR, and the BiTE enhances the specificity and reduces the risk of antigen escape and increases the precision of the therapy, improves the T-cell activation and cytotoxicity, reduces relapse rates by targeting multiple antigens, the likelihood of relapse due to antigen-negative tumor variants is thus minimized.
[0165] In another embodiment, the dual targeting CAR construct co-expressing the CAR, and the BiTE have versatile application and can be used for a wide range of B- cell malignancies and B-cell associated autoimmune conditions providing a robust treatment option for various patient populations.
[0166] In an embodiment, present invention discloses a polynucleotide sequence encoding CAR comprises an extracellular antigen-binding domain that binds to CD 19 and CD20, at least one transmembrane domain, and at least one intracellular signaling domain.
[0167] In an embodiment, present invention discloses a polynucleotide sequence encoding a CAR and a BiTE, wherein the CAR comprises of an extracellular antigenbinding domain that binds to CD 19, a transmembrane domain, and an intracellular signaling domain; and wherein the BiTE comprises of signal peptide, an anti-CD20 scFv with linked to the anti-CD3 scFv (BiTE) with sortable tags such as FLAG tag or histidine (His) Tag or G4S tags.
[0168] In an embodiment, present invention discloses a polynucleotide sequence encoding CAR and a BiTE, wherein the CAR comprises an extracellular antigenbinding domain that binds to CD20, a transmembrane domain, and an intracellular signaling domain; and wherein the BiTE comprises of an anti-CD19 specific scFv with signal peptide linked to the anti-CD3 scFv (BiTE) with sortable tags such as FLAG tag or histidine (His) Tag.
[0169] In an embodiment, the anti-CD19, anti-CD20, anti-CD3 binding (e.g., scFv) region can be derived from murine, human, camel, guinea pig, chimeric, or humanized. Preferably the scFvs in the construct of the present invention are of fully human or humanized.
[0170] In an embodiment, the anti-CD19, anti-CD20 and anti-CD3 binding (e.g., scFv) region is human or humanized.
[0171] In an embodiment, the anti-CD19 and anti-CD3 binding (e.g., scFv) region are humanized and anti-CD20 is fully human.
[0172] The term "humanized antibody" is intended to refer to antibodies in which CDR sequences derived from the germline of another mammalian species,such as a mouse, have been grafted onto human framework sequences. Additional CDR and / or framework region modifications may be made.
[0173] Humanization of murine scFv is an important design feature to optimize CAR-T cell persistence following infusion. A scFv is composed of four framework regions and three complementarity- determining regions (CDRs), which are responsible for antigen recognition. Using antibody engineering techniques, the hypervariable CDRs and other essential murine framework residues are carefully incorporated into a human framework, producing a human-like sequence that preserves the binding properties of the original antibody. For this, we used an in silico approach using BioPhi automated humanization workflow which enables bulk processing using a novel humanization method based on deep learning on large-scale natural antibody repertoires (Sapiens) or canonical humanization methods based on CDR grafting. The humanized sequence was produced by taking the most probable predicted residue at each CDR and framework position using Kabat, IMGT and Chothia antibody-based numbering systems.
[0174] In an embodiment, the present invention provides dual targeting construct expressing the CAR and BiTE, wherein a BiTE comprises two scFv antibody-binding domains, with the first scFv binding domain being able to bind to human CD3 and the second scFv binding domain targeting a specific tumor surface antigen or an antigen of cancer cells or a tumor associated antigen.
[0175] In an embodiment the CARs design can have two different structures by placing the VL and VH of scFv in different order / orientation, i.e., with VL-VH of one scFv directly linked to the VL-VH of the other scFv or with VL-VH of one scFv separated by the VL-VH of the other scFv.
[0176] In an embodiment, the light chain variable region and heavy chain variable region of the scFvs region can be in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region- linker-light chain variable region. In certain embodiment, the two antigen-binding domains can have two different structures by placing the VL and VH of scFv in different order, i.e., with VL-VH of one scFv directly linked to the VL-VH of the other scFv or with VL-VH of one scFv separated by the VL-VH of the other scFv.
[0177] In an embodiment, the encoded scFv domain includes a (GLY4-SER)n linker wherein n is 1 to 7. In some embodiments, the polynucleotide encoded human or humanized anti-CD19, anti-CD20 binding domain include a (GLY4-SER)n linker wherein n is 1 to 7. In an embodiment the nucleotide sequence for the linker comprises SEQ.ID.NO.35.
[0178] In some embodiments, the non -limiting examples of hinge include the non- Ig based CD receptors expressed on T cells such as CD8, CD8 alpha, CD28, NGFR, CD34 or IgG-based hinges, such as IgGl, IgG2, or IgG4 and the like.
[0179] In a certain embodiment, the nucleotide sequences encoding the hinge have been modified to enhance the CAR expression and are represented by SEQ. ID. NO. 36, SEQ ID NO. 37, SEQ ID NO. 38and the amino acid of the hinge is represented by SEQ.ID.NO. 39. Each of the nucleotide sequence SEQ ID NO: 36, 37 and 38 is codon-engineered variant encoding the same amino acid sequence as SEQ ID NO:39.
[0180] In an embodiment, the non-limiting examples of transmembrane domain (TD) include alpha, beta or zeta chain of the T-cell receptor, CD4, CD3 epsilon, CD45, CD5, CD8, CD8a, CD9, CD28, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD 137, CD154, GITR, ICOS, 4-1BB, or KIR2DS2 thereof.
[0181] In some embodiments, the nucleotide sequences encoding the TD have been modified to enhance the CAR expression and are represented by SEQ. ID. NO. 40, SEQ ID NO. 41, SEQ ID NO. 42 and the amino acid of the TD is represented by SEQ. ID. NO. 43. Each of the nucleotide sequence SEQ ID NO: 40, 41, and 42 is a codon-engineered variant encoding the same amino acid sequence as SEQ ID NO: 43.
[0182] In an embodiment, the hinge and transmembrane domain has at least 80, 85, 90, 95, 98, or 99% sequence identity with a naturally occurring hinge and transmembrane domain, e.g., a human, or other mammalian. These hinge and transmembrane domains are of human or murine origin.
[0183] In certain embodiments, the hinge and transmembrane regions used in the dual targeting construct are derived from humans.
[0184] In preferred embodiment, the hinge and the transmembrane regions used in the dual targeting construct co-expressing the CAR and the BiTE or CARs is from human.
[0185] Further provides an intracellular signaling domain which is the signaltransmission portion of the CAR. The most commonly used is the CD3-zeta which contains 3 ITAMs. This transmits an activation signal to the T cell after the antigen is bound. CD3-zeta may not provide a fully competent activation signal and additional co-stimulatory signaling may be needed. For example, one or more costimulating domains can be used with CD3-Zeta to transmit a proliferative / survival signal. A costimulatory domain comprises a functional fragment, or analog, of a costimulatory molecule. It can have the entire intracellular region, or a fragment of the intracellular region, which is sufficient for generation of an intracellular signal, when an antigen binding domain to which it is fused, or coupled by a dimerization switch, binds cognate antigen.
[0186] In another embodiment, the polynucleotide sequence encoding dual targeting CAR construct of the present invention further comprises one or more costimulatory domains selected from the group consisting of 0X40 of the tumor necrosis factor (TNF) receptor superfamily, or CD28 of the immunoglobulin (Ig) superfamily, 4-1BB (CD137), CD27, CD40, DAPIO, HVEM, GITR(AITR), inducible costimulatory ligand (ICOS) (CD278), intercellular adhesion molecule (ICAM), MYD88-CD40, TLR2, PD-L1, PD-L2,HLA-G, MICA, MICB lymphotoxin beta receptor, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, or any combination thereof. In an embodiment, the costimulatory domain has at least 80, 85, 90, 95, 98, or 99% sequence identity with a naturally occurring costimulatory molecule, e.g., a human, or other mammalian. These co-stimulatory signals are of human or murine origin.
[0187] In a certain embodiment, the costimulatory domain is CD28 or 41-BB comprising amino acid SEQ.ID.NO.47 or SEQ.ID.NO.45 respectively (nucleotide SEQ.ID.NO.46 and SEQ.ID.NO.44 respectively).
[0188] The dual targeting CAR construct with or without the BiTE of the invention further provides an activation or signaling domain. Examples of activation domains include CD3 zeta (CD247), FcgR, ITAM, DAP12.
[0189] In some embodiments, the signaling domain is CD3 zeta comprising amino acid SEQ.ID. NO. 51. In an embodiment, the nucleotide sequences encoding CD3zeta have been modified to enhance the CAR expression, and are the nucleotide sequences are selected from SEQ. ID. NO. 48, SEQ ID NO. 49, and SEQ ID NO. 50. Each of the nucleotide sequence SEQ ID NO: 48, 49, and 50 is a codon-engineered variant encoding the same amino acid sequence as SEQ ID NO: 51.
[0190] In some embodiments, the non-limiting examples of cytokines include chemokines, interferons, interleukins, tumor necrosis factor, colony stimulating factors and thereof. In a specific embodiment, the cytokines are interleukin. In a preferred embodiment the interleukin is IL-15 and IL-18.
[0191] In an embodiment, the amino acid sequence of IL-15 is SEQ ID NO: 54 and IL-18 is SEQ ID NO: 55 which are of human origin.
[0192] In an embodiment, the non-limiting examples of signal peptide include CD8, CD8a, IL-2, GM-CSF receptor (GM-CSF) a chain, or murine Ig-kappa (IgK), IgGl, IgG4 or a combination thereof. In some embodiments the signal peptide is CD8 alpha or IgGl or IgG4 or ILR2.
[0193] In an embodiment the signal peptide polypeptide sequence is selected from SEQ ID no. 30, SEQ ID no. 31 SEQ. ID NO 32, SEQ. ID. NO. 33 and / or SEQ. ID. NO 34.
[0194] In an embodiment, the non-limiting examples of self-cleaving peptide include T2A, P2A, E2A, F2A or a combination thereof.
[0195] In an embodiment, amino acid sequence for self-cleaving peptides T2A is SEQ.ID.NO.53 and amino acid sequence of the self-cleaving peptides P2A is SEQ.ID.NO.52.
[0196] In an embodiment, the nucleotide sequence encoding the 6XIL-8 NFAT response element is SEQ.I.D.NO.56. wherein the nucleotide sequence encoding the IL-8 mini promoter is SEQ.I.D. NO. 57.
[0197] In one embodiment, the amino acid sequence encoding the humanized anti- CD19 binding domain consists of a variable light chain selected from SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 16 and a variable heavy chain region selected from SEQ ID NO 13, SEQ.ID.NO.14, SEQ ID NO.15 or SEQ ID NO.17.
[0198] The light chain variable region and heavy chain variable region of the antiCD 19 scFv can be in any of the following orientations: light chain variable region- linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region. The amino sequence of the humanized anti-CD19 CDR region is accordingly enlisted in table.1.
[0199] In one embodiment, the 6 humanized scFv region of CD 19 comprises of a light chain and a heavy chain and the humanized scFv amino acid sequence is selected from SEQ ID NO: 22 (scFvl -antiCD 19 amino acid), SEQ ID NO: 23 (scFv2- antiCD19 amino acid), SEQ ID NO: 24 (scFv3-antiCD19 amino acid), SEQ ID NO: 25 (scFv4-antiCD19 amino acid), SEQ ID NO: 26 (scFv5-antiCD19 amino acid), or SEQ ID NO: 27 (scFv6-antiCD19 amino acid). In particular embodiments, the anti- CD19 antigen binding fragment comprises one or more CDRs as set forth in Table 6.
[0200] In some embodiments, the variable region (VH) of the humanized antigen binding molecule (CD 19) comprises one or more of (a) a CDR1, (b) a CDR2, and (c) a CDR3. In a specific embodiment, the anti-CD 19 binding domain comprises a heavy chain CDR1 selected from the group consisting of SEQ ID NOs: 6 and 9. In some embodiments, the antigen binding molecule comprises a heavy chain CDR2 selected from the group consisting of SEQ ID NOs: 7 and 10. In some embodiments the antigen binding molecule comprises a heavy chain CDR3 having SEQ ID NOs: 8.
[0201] In some embodiments, the variable region (VL) comprises one or more of (a) a CDR1, (b) a CDR2, and (c) a CDR3. In some embodiments, the antigen binding molecule comprises a light chain CDR1 selected from the group consisting of SEQ ID NOs: 1 and 4. In some embodiments, the antigen binding molecule comprises a light chain CDR2 selected from the group consisting of SEQ ID NOs: 2 and 5. In some embodiments, the antigen binding molecule comprises a light chain CDR3 having SEQ ID NO: 3.
[0202] In an embodiment, the humanized anti-CD 19 binding domain (e.g., an scFv) comprises: a light chain variable region comprising an amino acid sequence having at least one, two or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 35, 30, 20, 25, 10 or 5 modifications (e.g., substitutions, e.g., conservative substitutions) of an amino acid sequence of a light chain variable region provided in Table 6 or SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 16, or a sequence with 80-99% identity with an amino acid sequence of Table 6 or SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 16; and / or a heavy chain variable region comprising an amino acid sequence having at least one, two or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 35, 30, 20, 25, 10 or 5 modifications (e.g., substitutions, e.g., conservative substitutions) of an amino acid sequence of a heavy chain variable region provided in Table 6 or SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, or SEQ ID NO: 17, or a sequence with 80-99% identity to an amino acid sequence of Table 2 or SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 17.
[0203] The anti-CD 19 CAR of the present invention comprises a single chain variable fragment (scFv) that binds specifically to the CD 19 antigen on tumor. The heavy chain (H chain) and light chain (L chain) fragments of an antibody are linked via a linker sequence. For example, a linker can be 5-20 amino acids. The scFv structure for antiCD 19 can be VL-linker-VH, or VH-linker-VL, from N-terminus to C-terminus. The examples of linker include (G4S)n flexible linker, a short (EAAAK)l rigid linker, and a long (EAAAK)3 rigid linker.
[0204] In some embodiments, the linker used between the heavy and light chain is preferably (G4S)3 linker and the amino acid SEQ ID NO. 35.
[0205] In an embodiment, the humanized anti-CD 19 CAR construct of the present invention comprises of a signal peptide, an antigen binding domain scFv region specific for CD 19, a hinge and transmembrane domain, a co-stimulatory and intracellular signaling domain by selecting any of the combinations exemplified in the above paragraphs.
[0206] In specific embodiment, the nucleic acid sequence encoding the humanized anti-CD 19 CAR construct is selected from SEQ ID NO. 60 (amino acid SEQ. ID.NO.61), SEQ. ID. NO. 62 (amino acid SEQ ID NO.63), SEQ ID NO. 64 (amino acid SEQ. ID. NO.65), SEQ ID NO. 66 (amino acid SEQ. ID. NO.67), SEQ. ID. NO. 68 (amino acid SEQ. ID. NO.69) OR SEQ. ID. NO. 70 (amino acid SEQ. ID. NO.71).
[0207] In an embodiment, the humanized anti -CD 19 CAR construct may include one or more cytokines. In a specific embodiment the cytokine is IL-15 or IL-18. The nucleotide sequence of the anti-CD19 CAR with IL- 15 is SEQ. ID. NO. 84 and amino acid sequence is SEQ. ID. NO.85. The nucleotide sequence of anti-CD19 CAR with IL18 is SEQ. ID. NO. 86 and amino acid sequence is SEQ. ID. NO.87.
[0208] In an embodiment nucleic acid sequence encoding an anti-CD19 CAR as disclosed herein comprises of a nucleic acid having at least about 95%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity.
[0209] In one embodiment, the amino acid sequence encoding the anti-CD20 binding domain comprises a variable light chain having SEQ ID NO: 18 and a variable heavy chain region having SEQ ID NO 19.
[0210] The light chain variable region and heavy chain variable region of the anti- CD20 scFv can be in any of the following orientations: light chain variable region- linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
[0211] In one embodiment, fully human anti-CD20 binding domain is a scFv comprising a light chain and a heavy chain and the anti-CD20 scFv amino acid sequence is selected from SEQ ID NO: 28, or SEQ ID NO: 29.
[0212] In an embodiment, the fully human anti-CD20 binding domain (e.g., an scFv) consists of a light chain variable region encoded by the amino acid sequence encoding the same having at least one, two or three modifications (e.g., substitutions, e.g., conservative substitutions) but not more than 35, 30, 20, 25, 10 or 5 modifications (e.g., substitutions, e.g., conservative substitutions) of an amino acid sequence of a light chain variable region provided is in Table 2 and the amino acid sequence is SEQ ID NO: 18 or a sequence with 80-99% identity with an amino acid sequence of SEQ ID NO: 18, and / or a heavy chain variable region encoded by the amino acid sequence having at least one, two or three modifications (e.g.,substitutions, e.g., conservative substitutions) but not more than 35, 30, 20, 25, 10 or 5 modifications (e.g., substitutions, e.g., conservative substitutions) of an amino acid sequence of a heavy chain variable region of SEQ ID NO: 19, or a sequence with 80- 99% identity to an amino acid sequence of SEQ ID NO: 19.
[0213] The anti-CD20 CAR of the present invention comprises a single chain variable fragment (scFv) that binds specifically to the CD20 antigen on tumor. The heavy chain (H chain) and light chain (L chain) fragments of an antibody are linked via a linker sequence. For example, a linker can be 5-20 amino acids. The scFv structure for anti-CD19 can be VL-linker-VH, or VH-linker-VL, from N-terminus to C-terminus. The examples of linker include (G4S)n flexible linker, a short (EAAAK)l rigid linker, and a long (EAAAK)3 rigid linker.
[0214] In some embodiments, the linker used between the heavy and light chain is preferably (G4S)3 linker and the amino acid SEQ ID NO. 35.
[0215] In an embodiment, the anti-CD20 CAR construct of the present invention comprises of a signal peptide, an antigen binding domain (Anti-CD20 scFv), a hinge and transmembrane domain, a co-stimulatory and an intracellular signaling domain by selecting any of the combinations exemplified in the above paragraphs.
[0216] In an embodiment, the nucleotide sequence encoding the fully human anti- CD20 CAR construct is selected from SEQ ID NO. 72 (amino acid SEQ. ID. NO.73), SEQ. ID. NO. 74 (amino acid SEQ ID NO.75), SEQ ID NO. 76 (amino acid SEQ. ID. NO.77), SEQ ID NO. 78 (amino acid SEQ. ID. NO.79).
[0217] In an embodiment, the nucleotide sequence encoding the fully human anti- CD20 CAR construct with cytokines IL -15 is SEQ. ID. NO. 80 (amino acid SEQ. ID. NO.81) and with IL 18 is SEQ. ID. NO. 82 (amino acid SEQ. ID. NO.83).
[0218] In an embodiment a bicistronic or bispecific or dual chimeric antigen receptor (CAR) construct expressing two antigens in single T cell was designed to target the CD20 and CD 19 antigens on the tumor cells simultaneously. The construct consists of two separate CAR sequences joined by a P2A self-cleaving peptide, allowing for the co-expression of both CARs in the same T cell. The first CAR targets CD20, while the second CAR targets CD 19, leveraging the unique specificities ofeach CAR for dual antigen targeting. In certain aspects a bidirectional CAR or two in-line promoters are used instead of cleavage peptide.
[0219] In an embodiment, the bicistronic or bispecific or dual CAR construct comprising anti-CD20 CAR and anti -CD 19 CAR wherein the anti-CD20 CAR consists of one or more signal peptide, a variable light chain specific to CD20, a flexible glycine-serine linker (G4S)3 that provides spatial separation between the light chain and heavy chain to maintain proper folding and function, a variable heavy chain specific to CD20, CD8a hinge and transmembrane domain, CD28 costimulatory domain, CD3(^ signaling domain, P2A self-cleaving peptide, and wherein the anti-CD19 CAR, consists of a variable light chain specific to CD 19, a linker (G4S)3, a variable heavy chain antibody specific to CD19, a CD8a hinge and second transmembrane domain (CD8a), a 4-1BB (CD137) co-stimulatory domain, a CD3(^ signaling domain. In some aspect it may include one or more IRE. In other aspects it may or may include interleukins.
[0220] In an embodiment, the present invention uses CD28 or 4- IBB costimulatory domains. Use of different co-stimulatory domains in a dual targeting CAR provides a robust activation signal, promoting T cell activation, proliferation, and persistence.
[0221] In an embodiment, the nucleotide sequence of the bicistronic full CAR construct is SEQ.ID. NO. 88, SEQ.ID.NO. 106 and the amino acid sequence is SEQ.ID. NO. 89, SEQ ID NO. 107.
[0222] The challenge with the bicistronic or dual or bispecific CAR construct currently is the unequal expression of the CARs. The present invention provides modified dual or bispecific CAR constructs to co-regulate and improve co-expression of dual CARs using at least one promoter. The promoter can be bidirectional promoters or an in-line promoters in various orientations to enable co-regulation and co-expression of the multiple scFv in the constructs.
[0223] In an embodiment, present invention provides a dual targeting CAR construct co-expressing a CAR and a BiTE. The dual targeting CAR construct sequentially comprises of a CAR having the following elements; a CD8a signal peptide, a CD 19 variable light chain (VL), a (G4S)3 linker, a CD 19 variable heavychain (VH), a CD8a hinge and transmembrane domains, a 4-1BB (CD137) costimulatory domain, and a CD3 zeta signaling domain, Followed by a P2A selfcleaving peptide, and a BiTE for anti-CD20 structure comprising a IgGl second signal peptide, a variable light chain (VL) CD20, (G4S)3 linker, a CD20 variable heavy chain (VH), a G4S (G4S)3 linker, an anti-CD3 domain, with either a FLAG tag or histidine (His) Tag. In certain embodiment, the construct may include IRE. In certain aspect the construct may include one or more interleukins selected from IL15 or IL 18.
[0224] In an embodiment, anti-CD3 domain is derived from mouse. In a preferred embodiment, the anti-CD3 domain is humanized.
[0225] In one embodiment, the amino acid sequence encoding the anti-CD3 scFv is selected from SEQ ID NO: 20, or SEQ ID NO 21. In another embodiment, the amino acid sequence encoding the humanized anti-CD3 scFv is SEQ. ID. NO. 21. In an embodiment amino sequence encoding an anti-CD3 scFv as disclosed herein comprises of an amino acid having at least about 95%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity.
[0226] In an embodiment, present invention provides a dual targeting construct coexpressing a CAR and a BiTE having a sequential arrangement of an antiCD-20 CAR with a anti- CD 19 BiTE. Wherein the anti-CD20 CAR consists of IgGl signal peptide, a variable light chain (VL) CD20, a first (G4S)3 linker, a CD20 variable heavy chain (VH), a CD8a hinge and transmembrane domains, a CD28 costimulatory domain, a CD3 zeta signaling domain, a P2A self-cleaving peptide, a CD8a signal peptide, an anti-CD 19 variable light chain (VL), a second (G4S)3 linker, an anti-CD 19 variable heavy chain (VH), a third G4S linker, an anti-CD3 domain, with either a FLAG tag or histidine (His) Tag. In certain embodiment the anti-CD3 domain is humanized. In some embodiments, the construct may further include an IRE. In certain aspect the construct may include one or more interleukins selected from IL15 or IL 18.
[0227] The invention provides a cell comprising a nucleic acid sequence encoding the dual targeting CAR construct co-expressing a CAR and a BiTE, wherein the nucleic acid sequence comprises the nucleic acid sequence selected from the groupconsisting of SEQ ID NO.90 (amino acid sequence SEQ ID NO.91), SEQ ID NO.94 (amino acid sequence SEQ ID NO.95), SEQ ID NO.108 (amino acid sequence SEQ ID NO.109), and SEQ ID NO. 110 (amino acid sequence SEQ ID NO.111),.
[0228] The invention provides a cell comprising a nucleic acid sequence encoding the dual targeting CAR construct co-expressing a CAR and humanized BiTE, wherein the nucleic acid sequence comprises the nucleic acid sequence selected from the group consisting of SEQ ID NO.92, (amino acid sequence SEQ. ID. NO. 93), SEQ ID NO.96(amino acid sequence SEQ ID NO.97), SEQ ID NO.112 (amino acid sequence SEQ ID NO.113), and SEQ ID NO.114 (amino acid sequence SEQ ID NO.115).
[0229] In some embodiment, the present invention discloses a dual targeting CAR construct having a bidirectional promoter comprising a sequential arrangement of CD 19 CAR having a CD8a signal peptide, humanized anti CD 19 scFv, a CD8a hinge and transmembrane, a 4-1BB intracellular co-stimulatory domain and a CD3(^ activation domain expressed in forward orientation (5' to 3' sense) from a bidirectional promoter with a BiTE having fully human anti-CD20 scFv, a IgGl signal peptide linked to anti-CD3 scFv expressed in the reverse orientation from the bidirectional promoter. The bidirectional promoter can be EFla, CMV, PGK, MND or a combination thereof.
[0230] In certain embodiment, the present invention discloses a dual targeting CAR integrated with BiTE having a bidirectional promoter comprising sequential arrangement CD 19 CAR having a CD8a signal peptide, humanized anti-CD19 scFv, a CD8a hinge and transmembrane, a 4-1BB intracellular co-stimulatory domain and a CD3(^ activation domain expressed in forward (5' to3') orientation from bidirectional promoter with a BiTE for anti-CD20, wherein the BiTE for anti-CD20 consists of a IgGl signal peptide, a fully human anti-CD20 scFv, a linker and humanized anti-CD3 scFv which is transcribed in the reverse orientation from bidirectional promoter. In specific embodiment the BiTE is humanized.
[0231] In an embodiment, present invention provides a cell comprising a nucleic acid sequence encoding the dual targeting construct co-expressing the CAR and the BiTE with at least one bidirectional promoter or a dual CAR with at least onebidirectional promoter, wherein the nucleic acid sequence encoding the dual CAR with bidirectional promoter is selected from the group consisting of SEQ.ID NO.98 (amino acid sequence SEQ.ID. NO. 99), or SEQ.ID. NO.116, (amino acid sequence SEQ.ID. NO. 117) and the nucleic acid sequence encoding the CAR and BiTE with at least one bidirectional promoter is selected from the group consisting of SEQ.ID NO.100 (amino acid sequence SEQ.ID. NO. 101), SEQ.ID NO.118 (amino acid sequence SEQ.ID. NO. 119).
[0232] In some embodiment, the present invention discloses a dual targeting CAR construct without BiTE using a dual in-line promoters comprising a sequential arrangement of an in-line promoter 1, signal peptide, a scFv region for the first target (consisting a variable light chain, a linker, a variable heavy chain), a hinge and transmembrane domain, a co-stimulatory and signalling domain, an in-line promoter 2, a signal peptide, a scFv region for the second target (having a variable light chain, linker, a variable heavy chain), a hinge and transmembrane domain, a co-stimulatory domain, and a signalling domain.
[0233] In some embodiment, the present invention discloses a dual targeting CAR construct with BiTE is using a dual in-line promoters comprising a sequential arrangement of a dual in-line promoter 1, signal peptide, a scFv region for the first target (consisting a variable light chain, a linker, a variable heavy chain), a hinge and transmembrane domain, a co-stimulatory and signalling domain, an in-line promoter, a BiTE wherein the BiTE consists of signal domain, a scFv region for the second target (having a variable light chain, linker, a variable heavy chain), linker and anti- CD3 scFv domain.
[0234] In some embodiment, the present invention discloses a dual targeting CAR construct with at least one dual in-line promoter comprising a sequentially arranged a EFl alpha in-line promoter, IgGl signal peptide, a variable light chain of CD20, a linker, a variable heavy chain CD20, a CD8a hinge and transmembrane domain, a CD28 co-stimulatory and CD3 zeta signalling domain, a MND in-line promoter and BiTE for CD 19 having CD 8a signal domain, a variable light chain of CD 19, linker, a variable heavy chain of CD 19, linker and an anti-CD3 scFv domain.
[0235] In specific embodiment, the present invention discloses a dual targeting CAR with BiTE having at least one in-line promoters comprising a sequentially arranged EFl alpha promoter, a CD8a signal peptide, a variable light chain of CD 19, a first linker, a variable heavy chain of CD 19, a CD8a hinge and transmembrane domain, a 4-1BB (CD' 137) co-stimulatory domain, a CD3 zeta signalling domain and a BiTE, wherein the BiTE consists of MND in-line promoter, a IgGl signal domain, a variable light chain of CD20, linker, a variable heavy chain of CD20, a linker, and an antiCD3 scFv domain.
[0236] In an embodiment, a nucleic acid sequence encoding the dual targeting construct co-expressing the CAR and the BiTE with at least one in-line promoter or a dual CAR with at least one in-line promoters, wherein the nucleic acid sequence encoding a dual CAR with at least one in-line promoter is selected from the group consisting of SEQ.ID NO.102 (amino acid sequence SEQ.ID. NO. 103), or SEQ.ID. NO.120, (amino acid sequence SEQ.ID. NO. 121), and the nucleic acid sequence encoding the CAR and BiTE with at least one in-line promoter is selected from the group consisting of SEQ.ID NO. 104 (amino acid sequence SEQ ID NO. 105), SEQ.ID NO. 122 (amino acid sequence SEQ ID NO. 123).
[0237] Figure 4 illustrates the schematic representation of dual-targeting CAR construct designs utilizing either two CARs or a CAR combined with a BiTE, each directed against distinct tumor antigens. The constructs are driven by specific promoter configurations, including bidirectional and dual-in-line promoters. Figures 5 illustrate the schematic designs of the dual construct envisaged by the present invention where the expression of CARs or (CAR+BiTE) components is regulated through bidirectional promoters for coordinated targeting.
[0238] In an embodiment, the polynucleotide sequence of various parts of the construct disclosed in the embodiments herein may be modified to enhance the CAR and the BiTE expression. The active variants / mutant may have the amino acid sequence of the parent CAR or BiTE with at least one non-conservative amino acid substitution which may enhance the biological activity of the variant / mutant, such that the biological activity of the variant is increased as compared to the parent CARor BiTE. In certain embodiments, the vector is an expression vector. In additional embodiments, the vector is an episomal vector.
[0239] In particular embodiments, the vector is a viral vector.
[0240] In further embodiments, the vector is a retroviral vector.
[0241] In other embodiments, the vector is a lentiviral vector.
[0242] In one embodiment, a vector encoding a dual targeting construct coexpressing CAR and BiTE comprising polynucleotide sequence selected from SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 122.
[0243] In one embodiment, a vector encoding a dual targeting construct coexpressing dual CAR is selected from SEQ ID NO: 98, SEQ ID NO: 96, SEQ ID NO: 102, SEQ ID NO: 88, SEQ ID NO: 106, SEQ ID NO: 113, SEQ ID NO: 116 and SEQ ID NO: 120 respectively.
[0244] An expression vector carrying the coding sequence of a dual targeting CARs contemplated herein can be introduced into a population of human donor T cells, NK cells or NKT cells.
[0245] An expression vector carrying the coding sequence of a dual targeting CAR and a BiTE contemplated herein can be introduced into a population of human donor T cells, NK cells or NKT cells.
[0246] In a further embodiment, a mixture of, e.g., one, two, three, four, five or more, different expression vectors can be used in genetically modifying a donor population of immune effector cells wherein each vector encodes a different chimeric antigen receptor protein as contemplated herein. The resulting modified immune effector cells form a mixed population of modified cells, with a proportion of the modified cells expressing more than one different CAR protein (e.g., anti CD19 CAR and anti CD20 CAR).
[0247] In a yet another embodiment, a mixture of, e.g., one, two, three, four, five or more, different expression vectors can be used in genetically modifying a donor population of immune effector cells wherein each vector encodes a chimeric antigen receptor protein, and a BiTE as contemplated herein. The resulting modified immuneeffector cells form a mixed population of modified cells, with a proportion of the modified cells expressing CAR proteins and BiTE (e.g., anti-CD19 CAR and BiTE for CD20 or anti-CD20 CAR and BiTE for CD 19).
[0248] In another embodiment, present invention provides a method for stimulating a T cell-mediated immune response to a target cell population or tissue in a human, the method comprising administering to the human an effective amount of an engineered cell genetically modified to express a first CAR and a second CAR wherein the first CAR comprises a CD 19 antigen binding domain, a transmembrane domain, a costimulatory signaling region comprising CD28, and a CD3 Zeta signaling domain, and wherein the second CAR comprises a CD20 antigen binding domain, a transmembrane domain, a costimulatory signaling region comprising 4- 1BB, a CD3 Epsilon (or a CD3 Zeta) signaling domain and an IRE.
[0249] The subject invention provides novel construct, methods, and compositions comprising of the construct disclosed herein for treating B cell malignancies and restricting the progression of B cell malignancies, in particular, B cell derived cancers, for example, non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma and multiple myeloma (MM), B-cell prolymphocytic leukemia, lymphoplasmacytic leukemia, splenic marginal zone lymphoma, marginal zone lymphoma (extra-nodal and nodal), plasma cell neoplasms (e.g., plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition diseases, heavy chain diseases), and follicular lymphoma (e.g., Grades I, II, III, or IV).
[0250] In some embodiments, the B cell malignancy is selected from the group consisting of: acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia, hairy cell leukemia (HCL), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CIVIL), chronic myelomonocytic leukemia (CMML) and polycythemia vera, Hodgkin lymphoma, nodular lymphocyte-predominant Hodgkin lymphoma, Burkitt lymphoma, small lymphocytic lymphoma (SLL), Diffuse Large B-Cell Lymphoma (DLBCL), Mantle Cell Lymphoma (MCL), follicular lymphoma, immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma,marginal zone lymphoma, mycosis fungoides, anaplastic large cell lymphoma, Sezary syndrome, precursor T-lymphoblastic lymphoma, multiple myeloma, overt multiple myeloma, smoldering multiple myeloma, plasma cell leukemia, non- secretory myeloma, IgD myeloma, osteosclerotic myeloma, solitary plasmacytoma of bone, and extramedullary plasmacytoma.
[0251] In some embodiments, B-cell related autoimmune disorders is selected from the group consisting of: multiple sclerosis (MS), rheumatoid arthritis (RA), inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE) a wide range of other immune-mediated inflammatory diseases (IMIDs).
[0252] Method of Treatment
[0253] In another embodiment, the disclosure features a method of treating a subject having cancer. The method includes providing a preparation comprising dual targeting construct co-expressing cancer-killing CAR-T cells and BiTE or CARs, made by a method described herein; and administering the preparation to the subject. In yet another aspect, disclosure provides a method of treating a subject having cancer, said method including the steps: a) providing a sample from the subject, wherein the sample comprises a T cell and a cancer cell contacting the sample with dual targeting construct co-expressing CAR and BiTE or CARs, under conditions such that dual CAR- T cells or CAR-T cell and BiTE are produced; b) enriching for, or expanding, the dual targeting construct co-expressing CAR and BiTE or dual CAR- T cells; Step b) is optional, c) administering the dual targeting construct coexpressing CAR and BiTE or CAR-T cells formulated as a pharmaceutical composition with one or more excipient to the subject, thereby treating the subject.
[0254] Pharmaceutical composition
[0255] In another embodiment, the present disclosure provides a pharmaceutical composition comprising any of the dual -targeting constructs described herein, in combination with a pharmaceutically acceptable carrier / excipient. The choice of carrier is not particularly limited, provided it is pharmaceutically acceptable and meets chemico-physical requirements such as solubility and compatibility with the active agent. Suitable carriers, including vehicles, excipients, and diluents, are well known to those skilled in the art and are readily available. Preferably, the carrier doesnot cause adverse side effects or exhibit toxicity. Methods for formulating compositions suitable for administration (e.g., parenteral administration) are well established and can be found, for example, in Remington: The Science and Practice of Pharmacy, 22nd ed., Pharmaceutical Press (2012).
[0256] A suitable pharmaceutically acceptable carrier for injectable formulations of the dual-targeting constructs may include isotonic solutions such as normal saline, NORMOSOL-R (Abbott, Chicago, IL), PLASMA-LYTE A (Baxter, Deerfield, IL), approximately 5% dextrose in water, or Ringer’s lactate, DMSO or HSA. In some embodiments, the carrier may be supplemented with human serum albumin. Various aqueous carriers may be used, including buffered saline and similar solutions, which are typically sterile and free of undesirable contaminants.
[0257] The compositions may be prepared in unit dosage forms for administration to a subject. The dosage and frequency of administration can be determined by the treating clinician based on the desired therapeutic outcome. The pharmaceutical composition may be formulated for systemic administration (e.g., intravenous) or localized delivery (e.g., intratumoral). In certain embodiments, the composition includes approximately 0.1 to 10 million cells.
[0258] Examples:
[0259] Six humanized single-chain variable fragments (scFvs) targeting the CD 19 antigen were designed and evaluated alongside a murine scFv-based anti-CD19 CAR. Each of the six humanized scFvs was individually incorporated as the antigen recognition domain to construct corresponding CARs. These CAR constructs were expressed in human T cells derived from three independent donors, and CAR surface expression and cytotoxicity was assessed across the donor cells. Among the six humanized scFv-based CARs, those containing scFv3 and scFv6 exhibited surface expression levels similar to those of the CAR comprising the original murine scFv. Based on these findings, scFv3 was selected for further functional characterization in subsequent in vitro studies.
[0260] Example 1: CAR-T cell designs analyzed using different humanized scFvs, with assessment of CD19-CAR expression and cytotoxic activity.
[0261] T cells from 3 donors were activated and transduced with LVV at MOI 2.5, on day 4, and analysed for CAR expression.
[0262] T cells were isolated from three healthy donors and activated using TransAct beads. 16hrs post- activation, cells were transduced with lentiviral vector (LVV) encoding the CAR at a multiplicity of infection (MOI) of 2.5. CAR expression was assessed by flow cytometry. For functional potency, CAR-T cells were cocultured with the CD19+Nalm6 cell line in 3 donor T cells. Cytotoxic activity was measured using a luciferase-based assay to determine target cell killing. The assay was performed in duplicates for each donor-derived CAR-T cell batch.
[0263] Results of the CAR expression across 3 donors is depicted in figure 1. Of the six humanized antigen recognition domains targeting CD 19, two designated humanized scFv 3 (amino acid sequence SEQ ID NO. 24) and humanized scFv 6 (amino acid sequence SEQ ID NO. 27) showed high CAR expression. Notably the CAR expression levels achieved using these humanized scFv were comparable to those observed with the murine scFv based CAR construct. These findings indicate that the humanized scFv variants retain efficient CAR expression while offering potential advantages in reducing immunogenicity for clinical applications.
[0264] Cytotoxicity Assay performed showed killing of Nalm6 cell line after 4 hrs of incubation with different CD 19 scFv CAR- T cells. The killing of cells was detected by luciferase-based activity assay. Figure 2 A-C depicts the CD 19 scFv 6 (amino acid sequence SEQ ID NO. 27) show increased cytotoxicity in 2 of the 3 donor CAR T cells cocultured with Nalm6 when compared to other scFv’s.
[0265] The different scFv CAR-T cells were cocultured with U266, a CD19neg cell line with no or minimal cytotoxicity. Figure 3 shows the result wherein the scFv 2(amino acid sequence SEQ ID NO. 23), scFv3 (amino acid sequence SEQ ID NO. 24) and scFv6 (amino acid sequence SEQ ID NO. 27) shows no or minimal cytotoxicity with U266 cell line.
[0266] The humanness score was calculated for the variable light chain and variable heavy chain of humanized sequence based on human antibody database in Biophiplatform. Results show the six CD 19 humanized constructs humanness score, in comparison to the murine CD19 scFv (see table 1). All the 6 humanized constructs had a humanness score of around 56- 71%.Table 1: shows the humanness score (Biophi tool) of all the humanized. CD19 scFv and the murine scFV.
[0267] Example 2: Design and Evaluation of Dual-Targeting ConstructsAcross Key Parameters: Figure 6 shows the schematic overview of the dual targeting construct designs, featuring both single and dual promoter configurations used to drive the expression dual CARs. Although the schematic representations of the dual CAR constructs Figures 6 depict promoter elements such as EFla and MNDp, the corresponding full-length nucleotide sequences provided in the sequence listing (e.g., SEQ ID NOs: 106, 116, 120) do not include promoter sequences. This is because the promoter elements are standard regulatory sequences known in the art, and their nucleotide sequences are publicly available. The EFla and MNDp promoter sequences, which are used in the described constructs, are individually listed as SEQ ID NO: 58 and SEQ ID NO: 59, respectively. Table below summarizes the three dual CAR constructs of figure 6:Table 2 Types of Dual CAR construct designsdesign strategies: Construct (1) represents a bicistronic CAR targeting CD20 and CD19 and / (2), (3), (3), (4) and (5) depict dual targeting constructs designs employing a multivalent approach, where one antigen is targeted by a CAR and the other by a BiTE all driven by a single promoter.Table 3: Types of dual targeting construct design
[0269] The nucleotide sequences disclosed in the Sequence Listing (e.g., SEQ ID NO: 106, 116, 120, 114, 110, 108 and 112) correspond to the coding regions of the dual CAR constructs and CAR+BiTE). These sequences do not include promoter sequences, which are depicted in Figures 6 and 7 for illustrative purposes. Promoter elements such as EFla (SEQ ID NO: 58) and MNDp (SEQ ID NO: 59) are standard regulatory sequences known in the art and are operably linked to the coding regions in the actual expression vectors. As such, the omission of the promoter sequencesfrom the listed SEQ ID NOs does not affect the integrity or completeness of the disclosed coding constructs.
[0270] The CAR plasmids were synthesized by de novo and sub-cloning strategies into LV transfer vector backbone (OB) containing kanamycin antibiotic resistance gene. The plasmids at concentration of Img / ml were used for LVV generation. The LVV from the plasmids were generated using suspension culture and concentration based on ultracentrifuge.
[0271] Example 3: Method of generating the dual construct:
[0272] In an embodiment the dual targeting construct of the present invention having a chimeric antigen receptor T (CAR-T) cells and Bispecific T cell engager (BiTE) or dual CARs through a multi-step process that includes the preparation of specialized T cell media, isolation and activation of T cells, and transduction with lentiviral vectors encoding dual CAR constructs. The T cells are then phenotypically analyzed for CAR expression and exhaustion markers, followed by functional assessment using a luciferase-based cytotoxicity assay to evaluate target cell killing. The CAR-T cells are subsequently cryopreserved for further use. This approach enables efficient identification of CAR-T cell functionality and transduction efficiency, suitable for therapeutic applications, (flowchart of the process is shown in figure 8).
[0273] Example 4: CAR Expression: Flow cytometry analysis (Figure 9) demonstrates the superior efficacy of the HuCD20-HuCD19SCFV3 Kan. pIMN -LV- OB LVV construct (having nucleotide sequence SEQ ID 106) in driving the dual CAR expression on T cells (in figure 9 refer to “EFla-biscistronic CD20-CD19” flow data). T cells transduced with lentiviral vector carrying the construct of the invention achieved 24.34% dual CAR expression on Day 4.
[0274] The figure 20 illustrates flow cytometry analysis demonstrating the impact of codon optimization of CD8a HTM (Hinge, transmembrane) and CD3z (intracellular signalling domain) on the expression of a bicistronic chimeric antigen receptor (CAR) construct. Donor T cells activated with TransAct and post 16hrs transduced with LVV at MOI 2.5. CAR expression was assessed by flow cytometry using recombinant CD 19 and CD20. In the initial design (upper panel), the constructexhibited detectable expression of only the CD19-targeting CAR, with no or minimal expression of the second CD20 targeting CAR, suggesting when the two CAR constructs containing similar sequences recombination events such as template switching can occur and disrupt the expression of second CAR. The modified construct (lower panel) shows robust co-expression of both CARs, indicating that codon optimization successfully restored balanced expression of the dual CARs. The change of orientation where CD20 as first CAR and CD 19 as second CAR (lower right panel), additionally improved the dual CAR expression. A targeted codon modification of functionally identical protein domains can significantly improve the expression profile of complex multi-CAR systems. The improved design supports enhanced therapeutic efficacy and functional synergy of dual -targeting CAR T cells, representing an inventive step in CAR construct engineering. The present invention achieves a more balanced and efficient expression of both CARs, significantly improving the percentage of cells co-expressing them at similar levels. This is accomplished without the need to increase the multiplicity of infection (MOI) or the vector copy number integrated into the cell genome, thereby enhancing the safety profile of the approach.
[0275] Example 5: Increased CD20 and CD19 CAR Expression on T Cells Transduced with LVV Driven by a Single EF1A Promoter
[0276] Another key aspect of the invention relates to the design and evaluation of genetic constructs for co-expressing dual CARs targeting CD20 and CD 19 antigens in a single T cell. The study assessed three distinct bicistronic / dual construct designs, each employing different promoter configurations, namely, dual or in-line promoters, a bidirectional dual promoter, and a single promoter. The three construct designs evaluated are as follows: (i) BiDi-Promoter - dual promoter arranged in a divergent, bidirectional configuration: HuCD20.Of-HuCD19SCFV3.BL-Kan.pIMN-LV-OB, ("Construct-BiDi” or “C-BiDi” or “bi-directional-CD20-EFla-MNDp-CD19”)(SEQ ID NO.116) (fig. 6(1)); (ii) Dual-inline-dual promoters aligned in a linear(in-line) configuration: HuCD20.Of-HuCD19SCFV3. BL-Kan.pIMN-LV-OB (“Constructinline” or “C-inline” or “EFla-CD20-MNDp-CD19”) (SEQ ID NO.120) (fig. 6(2)); and (iii) and single-promoter-driven co-expression of two genes in a bicistronicformat: Mono-BiCistronic- single bicistronic co-expression of two genes: HuCD20- HuCD19SCFV3 Kan.pIMN-LV-OB ("Construct-Mono” or “C-Mono” or “EFla- biscistronic CD20-CD19”) (fig 6(3) (SEQ ID NO 106)).
[0277] Example 6: Assessment of CAR Expression (Day 4 and Day 8)
[0278] CAR expression levels from the three dual -targeting construct designs C-BiDi or bi-directional-CD20-EFla-MNDp-CD19-SEQ ID NO.116 (i), C-Inline or EFla- CD20-MNDp-CD 19 SEQ ID NO 120 (ii), and C-Mono or EFla-biscistronic CD20- CD19 SEQ ID NO 106 (iii) (ref figure 6) were evaluated on Day 4. Among these the C- Mono driven by single EFl A promoter, demonstrated the highest level of dual CAR expression. Specifically, it showed a five-fold increase compared to the C-Inline (ii) and a ten-fold increase compared to the C-BiDi (i) as shown in [Figure 9(A)],
[0279] On Day 8, the single EFl A promoter driven C-mono continued to exhibit the highest dual CAR expression, maintaining superior expression levels comparable to or exceeding those of the other constructs that showed detectable CAR expression. In contrast, the C-BiDi still failed to produce measurable dual CAR expressions even on day 8, thereby reinforcing the functional limitations of this construct design as depicted in Figure 9B.
[0280] Example 7: Evaluation and Further Development
[0281] Based on its markedly superior dual CAR expression, the single EFl A promoter-driven C-mono (HuCD20.Of-HuCD19SCFV3.BL-Kan.pIMN-LV-OB) SEQ ID NO.106 was evaluated for subsequent analysis and development. This construct design was further taken forward for comparing the functionality with the CAR and BiTE. The selection was progressed for subsequent testing and development due to its consistently high expression levels and efficient performance.
[0282] Example 8: Functional Assessment of Dual CAR-T Cells in Tumor Cell Killing
[0283] On Day 8, dual bicistronic construct CAR-T cells engineered with single EF1A promoter, C-mono (SEQ ID NO 106) achieved approximately 60% lysis of CD19 positive Nalm6 cells at an effector-to-target (E:T) ratio of 2.5: 1, whereas cells engineered with the dual promoter driven constructs (C-BiDi (SEQ ID NO. 116) and C-inline (SEQ ID NO 120) demonstrated only 20% lysis. These results indicate thatthe single EFl A promoter-driven construct (SEQ ID NO 106) provides significantly enhanced cytotoxicity compared to the dual inline and BiDi promoter construct design (Figure 10).
[0284] Example 9: Usage Of G4S Linker as an Alternate of CD19 and CD20 Proteins for CAR and BiTE Detection in the Dual Targeting Construct.
[0285] In the described CAR constructs, a flexible glycine-serine (G4S)npeptide linker is employed to connect the variable heavy (VH) and light (VL) domains, thereby ensuring proper spatial orientation for antigen recognition. This linker, critical for maintaining the functional conformation of the CAR, is incorporated as a repeated (G4S)s sequence within single CAR, dual CAR and dual construct coexpressing a CAR and BiTE (CAR+BiTE) designs. The nucleotide sequences corresponds to SEQ ID NO: 112(CD19-CD20huB) (hu anti CD 19 CAR+ human anti- CD20 BiTE with humanized CD3), SEQ ID. NO: 108(CD19-CD20muB) (hu anti CD19 CAR+ human anti CD20 BiTE with murine CD3), SEQ ID NO: 114 (CD20- CD19huB) (human anti CD20 CAR+ humanized anti CD 19 BiTE with humanized CD3), SEQ ID NO: 110(CD20-CD19muB) (human anti CD20 CAR+hu anti CD19 BiTE with murine CD3) and SEQ ID NO: 106(Bicistronic CAR)To evaluate CAR expression, an anti-GtS linker antibody — specifically recognizing the GtS motif — was used in flow cytometric analysis. As illustrated in Figure 11, staining with the anti-G4S antibody successfully detected CAR expression in single CAR, dual CAR- T cell and CAR+BiTE cell populations, with expression levels ranging from 3% to 91%. The nucleotide sequences corresponds to SEQ ID NO: 112(CD19-CD20huB), SEQ ID. NO: 108(CD19-CD20muB), SEQ ID NO: 114 (CD20-CD19huB), SEQ ID NO: 110(CD20-CD19muB and SEQ ID NO: 106(Bicistronic CAR))
[0286] Further analysis was conducted using donor samples (n=6), where CAR-T cells were assessed for binding to recombinant CD 19 and / or CD20 protein in parallel with anti-GtS staining (Figures 12a and 12b). The results revealed a coherent pattern, demonstrating that G4S detection closely mirrors antigen-specific CAR expression. Additionally, in samples exceeding n=4, increased levels of expression were observed using both anti-GtS antibody and recombinant CD20 protein in CAR-T cells expressing the CD20.CD19muBiTe construct. However, this increase was notsubstantial, indicating that while sensitivity may vary slightly, the G4S-based detection remains a reliable and representative surrogate.
[0287] These findings underscore the utility of anti-G4S antibody as a cost- effective, scalable, and antigen-agnostic alternative to conventional recombinant protein-based assays. This method is particularly advantageous for the manufacturing, quality control, and characterization of CAR-T cells, especially those incorporating GtS-based linkers in complex multi-targeting constructs.
[0288] Example 10: Dual CAR-T cell Expansion and Yield on Day 8
[0289] Figure 13B presents the total cell counts at Day 8 for the various constructs.T cells activated with antiCD3 and recombinant human fibronectin fragment (Retronectin®). After 16 hrs activated T cells were transduced with LVV as labelled in the figure at MOI2.5. CAR expression was detected using CD19 and CD20 recombinant protein by flowcytometry. The data shows comparable expansion profiles across all BiTE-containing dual CAR constructs when benchmarked against the Dual Bicistronic construct, with average cell counts ranging from approximately 13.67 x io6to 14.28 x 106. Notably, the CD19.CD20huBiTe construct (nucleotide sequence SEQ ID 112) demonstrated a slightly lower expansion profile, averaging 11.10 x 106cells, though this difference was not statistically significant.
[0290] In contrast, analysis of average CAR-T cell counts across all constructs, as depicted in Figure 13 A, revealed significantly greater expansion in cells expressing single CD 19 or CD20 CARs. This trend was statistically validated using a one-way ANOVA, which yielded a p-value < 0.05, confirming the enhanced proliferation in single CAR settings.
[0291] To further investigate the expansion profile of CD20.CD19muBiTe in comparison with other constructs, a multiple-effect analysis was conducted. Results summarized in Table 4 demonstrate significantly higher expansion of CD20.CD19muBiTe (SEQ ID 110) relative to both CD19-CD20muBiTe (SEQ ID 108) and CD20-CD19huBiTe (SEQ ID 112) constructs. This was confirmed via Dunnett’s multiple comparisons test, reinforcing the superior yield associated with the CD20.CD19muBiTe configuration.
[0292] These findings suggest that specific dual CAR designs, particularly CD20.CD19muBiTe (SEQ ID 110), may offer enhanced proliferation potential — an attribute critical for scalable manufacturing and clinical efficacy of CAR-T cell therapies.
[0293] Table 4 One-way Anova multiple comparison results of all constructs with CD20.CD 19muBiTe (SEQ ID 110) construct.
[0294] The present invention offers a distinct advantage in CAR-T cell process by demonstrating that the anti-CD20 CAR. Anti-CD19 / mu antiCD3 BiTe construct achieves significantly higher T cell expansion compared to anti-CD19 CAR-anti-CD20 / mu anti-CD3 BiTE, anti-CD20CAR-anti-CD19 / hu anti-CD3 BiTE and anti- CD20CAR-anti-CD19 / huantiCD3BiTE. This enhanced Dual construct cell yield facilitates more efficient manufacturing of dual targeting construct, reduces the cost of input requirements, and may improve therapeutic scalability. The superior expansion is attributed to the unique design and configuration of the anti- CD20CAR.anti-CD19 / muantiCD3-BiTe construct, indicating improved constructspecific functionality. Such properties support its utility in clinical applications where robust cell expansion is critical, thereby distinguishing the invention over existing dual CAR-T designs and contributing to its inventive step.
[0295] Example 11: CAR-T and Non -CAR-T cells bind to the T-cell engager in the absence of non-specific activation
[0296] Evaluation of Day 8 CAR-T cells using anti-His and anti-G4S antibodies revealed construct-specific surface marker expression. Flow cytometry identified anti-His antibody binding exclusively on cells transduced with antiCD 19C AR. antiCD20-mu anti-CD3BiTe (SEQ ID 108) and anti-CD20C AR. antiCD 19 / muanti-CD3 BiTe (SEQ ID 110) constructs (Figure 14). These constructs include a His-tag at the C-terminal domain of the BiTE moiety. Co-expression of anti-G4S and anti-His expression on T cells confirmed binding of His-tagged BiTEs to CAR-expressing T cells.
[0297] However, a notable fraction of anti-His-positive cells lacked G4S expression (mean 33% in anti-CD19CAR. anti-CD20 / mu-antiCD3-BiTe (SEQ ID 108); 43.02% in CD20.CD19muBiTe (SEQ ID 110)), indicating BiTE binding to non-CAR-expressing T cells. This observation demonstrates the unique design of the invention, wherein BiTE components are capable of engaging non-CAR-expressing bystander T cells, thereby potentially enhancing the breadth and potency of the antitumor immune response.
[0298] T cell engagement occurs through the binding of BiTE molecules to the CD3 subunit on T cells, while the other part of the BiTE binds to a tumor- specific antigen on tumor cells. This cross-linking of T cells and tumor cells by BiTEs triggers T cell activation, leading to the release of cytotoxic molecules such as granzymes and perforin, which mediate tumor cell lysis. Given that BiTEs can bind both CAR andnon-CAR T cells, we sought to evaluate the activation status of these cells in the absence of tumor cells, where activation is not expected to occur. To assess this, we measured the early activation marker CD69 on freeze-thawed Day 3 CAR-T cells. Despite detecting anti-His antibody binding on the T cell surface, indicating BiTE presence, no increase in Anti-CD69 antibody expression was observed (Figure 15). This demonstrates that BiTE binding alone does not cause non-specific T cell activation without tumor antigen stimulation.
[0299] These findings establish that while His-tagged BiTEs can bind both CAR+ and CAR- T cells, such interactions do not trigger unintended activation, supporting the functional specificity and safety of the designed constructs in early-phase CAR- T manufacturing.
[0300] Example 12: Target specific cytotoxicity identified with RAMOS and NALM 6 as compared to non-specific with K562 cell line
[0301] Cytotoxic T lymphocyte (CTL) assays were conducted using freeze-thawed Day 8 CAR-T cells across three tumor cell lines: Ramos (CD20+), Nalm6 (CD19+), and K562 (CD197CD20 ", control), with incubation periods ranging from 4 to 5 hours. Figures 16, 17, and 18 present pooled data from 2-6 independent donor- derived CAR-T cell cultures co-incubated with target cells. The corresponding cytotoxicity percentages are summarized in Tables 5, 6, and 7.
[0302] At effector-to-target (E:T) ratios of 10:1, 2.5: 1, and 0.6: 1, CAR-T cells expressing CD19.CD20muBiTe (SEQ ID 108), CD20.CD19huBiTe (SEQ ID 114), and CD20.CD19muBiTe (SEQ ID 110) consistently demonstrated enhanced cytolytic activity against both Ramos and Nalm6 cells, compared to CD19.CD20huBiTe (SEQ ID 112) and dual bicistronic constructs (Bicis), as shown in Table 5. Notably, at the 0.3: 1 ratio tested in two donors, CD19.CD20muBiTe (SEQ ID 108) and CD20.CD19muBiTe (SEQ ID 110) exhibited comparable killing of Ramos cells, while only CD20.CD19muBiTe retained measurable cytotoxicity (6%) against Nalm6, indicating superior sensitivity and functionality at low T cell doses. While the murine BiTE-based constructs outperformed other formats, the humanized BiTE constructs (e.g., SEQ ID NO: 114) had the advantage of improved immunogenicitywhen administered into human body and also demonstrated cytolytic activity, supporting their potential for use in clinical applications.
[0303] Importantly, control assays using the antigen-negative K562 cell line showed limited non-specific cytotoxicity. At a high E:T ratio of 10:1, cytotoxicity ranged between 11% and 21%, with the highest activity observed in untransduced T cells, suggesting background killing. At reduced ratios of 2.5: 1 and below (0.6: 1 and 0.3: 1), non-specific lysis dropped below 7.8%, confirming antigen-specific targeting by BiTe constructs.
[0304] These findings highlight the superior cytotoxic potency of the CD20.CD19muBiTe CAR-T cells (SEQ ID 110) across all tested E:T ratios, including the lowest tested ratio of 0.2: 1, which corresponds to a condition where one CAR-T cell engages approximately five tumor cells. This robust performance at low effector frequencies demonstrates the heightened functional avidity and potential therapeutic advantage of this construct design.
[0305] Table 5: Mean, standard deviation (SD) and number of samples(n) results from Figure 16.
[0306] Table 6: Mean, standard deviation (SD) and number of samples(n) results from Figure 17
[0307] Table 7: Mean, standard deviation (SD) and number of samples(n) results from Figure 18
[0308] Example 13: ELISA Based Analysis of Secreted Cytokine Namely IFN gamma and Granzyme-B In Supernatants from CTL Assay
[0309] ELISA-based quantification of IFN-y and Granzyme B was performed using coculture supernatants from CAR-T cells and tumor cell lines. The assays were conducted at multiple effector-to-target (E:T) ratios — 10: 1 (n=2 for Ramos and K562), 2.5: 1 (n=2 for Ramos, Nalm6, and K562), 0.625: 1 (n=4 for Ramos, Nalm6, and K562), and 0.312: 1 (n=2 for Ramos, Nalm6, and K562), as illustrated in Figures 19A-F.
[0310] CAR-T cells expressing CD19.CD20mubiTe, CD20.CD19hubiTe, and CD20.CD19mubiTe secreted higher levels of IFN-y in Ramos and Nalm6 cocultures compared to dual bicistronic CAR-T cells, including at the lowest E:T ratio of 0.3: 1.These findings suggest that BiTE-based constructs maintain or improve T-cell functional response, even at suboptimal T-cell numbers (Figures 19A and 19C).
[0311] Granzyme B secretion was consistently elevated in all BiTE CAR-T groups relative to bicistronic CAR-T groups across multiple E:T ratios (Figures 19B and19D). However, no single BiTE construct demonstrated markedly superior Granzyme B release, suggesting functional parity among the BiTE constructs in this context.
[0312] In contrast, cocultures with K562 cells — a negative control for target antigen — demonstrated minimal IFN-y and Granzyme B secretion across all E:T ratios, supporting the antigen-specific activation and cytolytic function of the CAR- T cells (Figure 19E and 19F).
[0313] The present invention demonstrates an inventive step by incorporating BiTE (bispecific T-cell engager) domains into dual CAR constructs targeting CD 19 and CD20, resulting in enhanced effector function of CAR-T cells at lower effector-to- target (E:T) ratios. Unlike conventional bicistronic CAR constructs, the disclosed BiTE-based CARs stimulate higher secretion of key effector cytokines (IFN-y) and cytotolytic enzymes (Granzyme B) even at sub-optimal CAR-T to tumor cell ratios (as low as 0.3: 1). This effect is not only consistent but also antigen-specific, as evidenced by the minimal activation in K562 cocultures.
[0314] Furthermore, the ability of BiTE in the constructs to elicit comparable or superior cytokine release without triggering off-target activation suggests a finely tuned immune response, a result not predictable from the prior art or conventional CAR-T constructs.
[0315] Through a comprehensive experimental evaluation, the present inventors have identified HuCD20-HuCD19SCFV3 Kan. pIMN-LV-OB (Dual Bicis) and CD20.CD19 SCFV3 BiTE-Kan. pIMN-LV-OB (CD20.CD19muBiTe) as the topperforming constructs for dual CAR design targeting CD 19 and CD20 antigens.
[0316] The dual bicistronic construct demonstrated a high lentiviral vector (LVV) titer of -1E+08, indicative of a stable and optimized CAR architecture. High vector titers are crucial in CAR-T manufacturing as they directly correlate with efficient gene transfer, higher transduction rates, and improved scalability — a key enabler for clinical-grade CAR-T cell production.
[0317] Although the dual bicistronic construct exhibited effective cytotoxicity against both CD 19 and CD20 positive cell lines and showed comparable killing ability to single CARs (data not shown), CD20.CD19muBiTe and CD19.CD20muBiTe constructs consistently outperformed dual bicistronic at lowereffector-to-target (E:T) ratios, specifically at 0.6: 1. For instance, when cocultured with CD19+CD20+ Ramos cells, CD20.CD19muBiTe and CD19.CD20muBiTe achieved 36% and 40% cytotoxicity, respectively, compared to only 2.5% by dual bicistronic (n=4), demonstrating superior tumor-killing efficiency under limiting effector conditions.
[0318] Further, cytokine profiling of fFN-y and Granzyme B revealed comparable or enhanced secretion levels in the BiTE CAR constructs relative to dual bicistronic when stimulated with CD19+CD20+Ramos and Nalm6 targets. This functional equivalence in immune effector molecule production supports the robust activation and cytolytic potential of the BiTE-integrated CAR-T designs.
[0319] The strategic design of CAR co-expressing BiTE constructs, particularly CD20.CD19mubiTe, introduces a novel mechanism combining dual-antigen targeting with intrinsic bispecific T-cell engager functionality. This dual -modality not only enhances antigen engagement but also facilitates potent tumor cell killing at low E:T ratios - an inventive improvement over conventional bicistronic CAR configurations.
[0320] The constructs disclosed herein provide a clinically relevant advantage by enabling efficient and potent tumor lysis with fewer CAR-T cells, improving therapeutic outcomes while potentially reducing manufacturing burden. The combination of high LVV titer, enhanced cytotoxicity, and robust cytokine response collectively position CD20.CD19muBiTe as a strong clinical candidate in dualtargeting CAR-T cell therapy.Table 6. Sequences listing:
Claims
CLAIMS:
1. A polynucleotide encoding a dual targeting construct targeting both CD 19 and CD20 comprising:(a) a first sequence encoding a first chimeric antigen receptor (CAR), said first CAR comprising a first antigen-binding domain specific for a first antigen;(b) a second sequence encoding a second targeting molecule; wherein said second targeting molecule is selected from: i. a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain specific for said second antigen, or ii. a bispecific T cell engager (BiTE) comprising an antigenbinding domains specific for CD3 and the second antigen - binding domain specific for said second antigen; wherein said first and second antigen-binding domain are independently selected from CD 19 and CD20 antigen-binding domain, and wherein said antigen-binding domain is encoded by a nucleotide sequence that encodes a single variable fragment (scFv) that specifically binds: (i) to CD19, having sequence ID selected from SEQ ID NO: 128 or SEQ ID NO 131; (ii) to CD20, having sequence ID selected from SEQ ID NO: 132 or SEQ ID NO: 133; and to CD3, having sequence ID selected from SEQ ID NO: 124 or SEQ ID NO: 125.
2. The polynucleotide encoding a dual targeting construct as claimed in claim 1, wherein said nucleic acid further comprises nucleotide sequences encoding a hinge domain selected from Sequence ID NO: 36, SEQ ID NO: 37, or SEQ ID NO: 38.
3. The nucleic acid sequence encoding a dual targeting construct as claimed in claims 1, wherein said nucleic acid sequence further comprises nucleotide sequences encoding a transmembrane domain selected from SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42.
4. The nucleic acid sequence encoding a dual targeting construct as claimed in claim 1, further includes a nucleotide sequences encoding a signaling domain selected from Sequence SEQ ID NO: 48, SEQ ID NO: 49, or SEQ ID NO: 50.
5. A vector comprising said nucleic acid sequence as claimed in claim 1.
6. The vector as claimed in claim 5, wherein said vector is selected from lentiviral vector, a retroviral vector, an adenoviral vector, an adeno- associated viral vector, or a plasmid.
7. A cell comprising said vector as claimed in any of claims 5 or 6.
8. A genetically modified T cell comprising the nucleic acid sequence as claimed in any of claims 1 to 4.
9. A pharmaceutical composition comprising the genetically modified T cell of claim 8 and a pharmaceutically acceptable carrier.
10. Use of the genetically modified T cell of claim 9 for the treatment of a disease associated with CD 19 and / or CD20 expressing B cells, wherein the disease is a B cell malignancy or an autoimmune disease.
11. A method of treating a subject in need thereof, comprising administering the pharmaceutical composition of claim 9, wherein the subject has a disease associated with CD 19 and / or CD20 expressing B cells, the disease being selected from: (a) a B cell malignancy, or (b) an autoimmune disease.
12. A dual targeting construct targeting both CD 19 and CD20 encoded by the nucleic acid sequence as claimed in claim 1.
13. The dual targeting construct as claimed in claim 12, wherein said construct is a dual CAR-T construct.
14. The dual targeting construct as claimed in claim 13, wherein said dual CAR- T construct comprises a first polypeptide and a second polypeptide, wherein said first polypeptide comprises of (i) a signal peptide, (ii) an antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a costimulatory domain CD28 and (vi) a CD3 zeta signaling domain;said second polypeptide comprises of: (i) a signal peptide, (ii) an antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a costimulatory domain of 4- IBB and (vi) a CD3 zeta signaling domain; and wherein said antigen binding domain in said first polypeptide and said second polypeptide is independently selected from sequence having sequence ID SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28, or SEQ ID NO: 29.
15. The dual targeting construct as claimed in claim 13, wherein said CAR construct comprises one or more promoters or one or more self-cleaving peptides and one or more inducible response elements selected from NF AT, with IL -2, IL -5, IL-6, IL-7, IL-8, IL-15, IL18 promoters or the mini promoters or a combination thereof for expressing cytokines.
16. A dual targeting construct comprising a first polypeptide encoding a CAR and a second polypeptide encoding a BiTE, wherein:(a) said CAR is an anti-CD-20 CAR comprising: an IgGl signal peptide, an antigen-binding domain targeting CD20, a CD8a hinge and transmembrane domains, a CD28 co-stimulatory domain, a CD3 zeta signaling domain, a P2A self-cleaving peptide,(b) said BiTE is a CD19 / CD3 BiTE comprising: a CD8a signal peptide, an antigen-biding domain targeting CD 19, and an anti-CD3 binding domain; wherein said polypeptide sequence encoding said antigen binding domain targeting CD20 is selected from SEQ ID 28 or SEQ ID NO: 29; wherein the polypepetide sequence encoding the antigen binding domain targeting CD 19 is selected from SEQ ID NO:24 and SEQ ID NO: 27; wherein the polypeptide sequence encoding said anti-CD3 domain is selected from SEQ ID NO: 20 and SEQ ID NO: 21; and wherein said first polypeptide and said second polypeptide are configured for co-expression in a host cell.
17. A dual targeting construct comprising a first polypeptide encoding a CAR and a second polypeptide encoding a BiTE, wherein:(a) said CAR is an anti CD- 19 CAR comprising: a CD8a signal peptide, an antigen-binding domain targeting CD 19, a CD8a hinge and transmembrane domains, a 4- IBB co-stimulatory domain, a CD3 zeta signaling domain, a P2A self-cleaving peptide,(b) said BiTE is a CD20 / CD3 BiTE comprising: an IgGl signal peptide, an antigen binding domain targeting CD20, and an anti-CD3 binding domain, wherein said polypeptide sequence encoding said antigen binding domain targeting CD 19 is selected from SEQ ID 24 and SEQ ID NO:27; wherein the polypeptide sequence encoding the antigen binding domain targeting CD20 is selected from SEQ ID NO:28 and SEQ ID NO: 29; wherein the polypeptide sequence encoding the anti-CD3 binding domain is selected from SEQ ID NO: 20 and SEQ ID NO: 21; and wherein said first polypeptide and said second polypeptide are configured for co-expression in a host cell.
18. The dual targeting construct of claim 16 or 17, comprising polypeptide sequence selected from SEQ ID NO 109, SEQ ID NO 111, SEQ ID NO 113, or SEQ ID NO 115.
19. A method for treating B cell malignancies and restricting the progression of B cell malignancies, in particular, B cell derived cancers, and an autoimmune condition wherein said method comprising administering therapeutic amounts of a composition comprising the dual targeting construct as claimed in any of claims 12 to 18.
20. The method as claimed in claim 19, wherein said B cell derived cancers is selected from non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma and multiple myeloma (MM), B-cell prolymphocytic leukemia, lymphoplasmacytic leukemia, splenic marginal zone lymphoma, marginal zone lymphoma (extra-nodal and nodal), plasma cell neoplasms (e.g., plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition diseases, heavy chain diseases), and follicular lymphoma (e.g., Grades I, II, III, or IV); and the autoimmune disease selected from systemic lupus erythematosus (SLE), rheumatoidarthritis, multiple sclerosis, type 1 diabetes, Sjogren’s syndrome, myasthenia gravis, or autoimmune hemolytic anemia.
21. A method of treating a subject having cancer, said method comprising: a) providing a sample from the subject, wherein the sample comprises a T cell and a cancer cell contacting the sample with dual targeting construct as claimed in any of claims 12 to 18, under conditions such that dual CAR- T cells or CAR-T cell and BiTE are produced; b) optionally enriching for, or expanding, the dual targeting construct co-expressing CAR and BiTE or dual CAR- T cells; c) administering the dual targeting construct co-expressing CAR andBiTE or CAR-T cells formulated as a pharmaceutical composition with one or more excipient to the subject, thereby treating the subject.
22. A pharmaceutical composition comprising the dual targeting construct as claimed in any of claims 12 to 18 and a pharmaceutically acceptable carrier.