Double-stranded ribonucleic acid for inhibiting gene expression of complement factor b (CFB), and conjugate thereof

Abstract

The present application relates to an RNA inhibitor for inhibiting gene expression of a complement factor B (CFB) in a cell, comprising an antisense strand. The antisense strand and at least 15 consecutive nucleotides in an mRNA (SEQ ID NO: 8) encoding a CFB form a target sequence complementary region, the target sequence complementary region has 0, 1, 2, 3, 4 or 5 mismatches, and preferably, the complementary region has a length of 15-30 nucleotide pairs, and more preferably 17-23 nucleotide pairs.

Description

Double-stranded ribonucleic acid and its conjugates for inhibiting complement factor B (CFB) gene expression

[0001] Cross-referencing

[0002] This application claims priority to Chinese Patent Application No. 202411195131.X, filed on August 28, 2024, and Chinese Patent Application No. 202510081350.3, filed on January 17, 2025, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application relates to the field of biomedicine, specifically to double-stranded ribonucleic acid that inhibits complement factor B (CFB) gene expression, its conjugates, and their use in the preparation and treatment of drugs for diseases related to complement factor B expression. Background Technology

[0004] RNA interference (RNAi) technology refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). RNA molecules inhibit gene expression by disrupting specific mRNAs. Because RNAi technology can specifically knock out or shut down the expression of specific genes, it has rapidly become one of the most popular research tools in gene function research and gene therapy, and is widely used to explore gene function and treat metabolic diseases, infectious diseases, and malignant tumors.

[0005] Under physiological conditions, the complement system acts as a vital pillar of the host's defense by assisting in the rapid identification and elimination of invading microorganisms. The complement system is an important component of the innate immune system, composed of a group of 30 proteins synthesized by the liver and circulating in the blood as inactive precursors. The complement system is organized through three activation pathways: the classical pathway, the lectin pathway, and the alternative pathway. Abnormal activation, inadequate regulation and control of the complement system, as well as impaired and deteriorated effector function, are the basis of many complement system-mediated diseases.

[0006] The alternative pathway is a magnesium-dependent cascade that is activated by the deposition and activation of complement protein C3 on certain susceptible surfaces, such as cell wall polysaccharides in yeast and bacteria, and certain biopolymer materials. Spontaneous hydrolysis of C3 leads to the production of potent anaphylatoxins C3a and C3b. C3b can then recruit nearby complement proteins to form a protease complex called C3 convertase (C3bBb). C3 convertase cleaves more C3 into C3a and C3b, forming an amplified loop and leading to the formation of the membrane attack complex (MAC). MAC can create pores in the membrane of the target cell, leading to cell lysis and death.

[0007] Complement factor B (CFB) is a key player in the alternative pathway. Upon complement activation, CFB is cleaved by factor D and produces the active enzyme C3 convertase. Therefore, CFB may be a suitable target for inhibiting complement pathway amplification, as its plasma concentration in humans is typically around 200-500 pg / mL (or about 2-5 pM).

[0008] Mutations in CFB are associated with a variety of autoimmune and inflammatory diseases, including atypical hemolytic uremic syndrome (aHUS), a rare thrombotic microangiopathy characterized by microvascular thrombosis, hemolysis, and acute kidney injury; age-related macular degeneration (AMD), a common cause of vision loss in older adults; C3 glomerulonephropathy, a rare kidney disease characterized by the deposition of complement component C3 in the glomeruli; and membranoproliferative glomerulonephritis (MPGN), a rare kidney disease characterized by thickening of the glomerular basement membrane and deposition of complement components. There is also evidence that CFB is involved in IgA nephropathy (IgAN) by promoting kidney inflammation and tissue damage. Higher levels of CFB are associated with a more severe IgAN phenotype and worse outcomes, and genetic variations in the CFB gene are associated with an increased risk of IgAN in certain populations. Several clinical trials of small molecule inhibitors and antisense oligonucleotides of CFB have shown promising data on reducing proteinuria in IgAN. siRNA technology has demonstrated significant advantages over conventional approaches in terms of improved specificity, robustness, and safety. Targeting CFB with siRNA has the potential to provide excellent therapeutic agents for many autoimmune and inflammatory diseases. Summary of the Invention

[0009] The RNA inhibitor, its conjugates, and pharmaceutical compositions provided by this invention exhibit good stability, good animal tolerability, potent and long-lasting inhibitory effects (significantly reducing CFB mRNA levels even on day 197 post-administration), and low off-target effects. In multiple-dose groups, a single subcutaneous injection of the test compound showed inhibition rates and cycles, dose-dependent effects on alternative hemolysis, and good correlations with experimental complement factor B (CFB) mRNA, CFB protein, and CAP. It can significantly treat CFB expression-related diseases and / or conditions, and has great therapeutic potential in alternative complement-related autoimmune diseases.

[0010] On the one hand, this application provides an RNA inhibitor for inhibiting the expression of complement factor B (CFB) gene in cells, comprising an antisense strand, wherein the antisense strand is capable of forming a target sequence complementary region with at least 15 consecutive nucleotides in the mRNA encoding CFB (SEQ ID NO:8), wherein the target sequence complementary region has 0, 1, 2, 3, 4 or 5 mismatches, preferably the length of the complementary region is 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.

[0011] In some embodiments, the sequence of 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides starting from the 5' end of the antisense strand and the mRNA (SEQ ID NO: 8) encoding CFB forms a complementary region to the target sequence: nucleotides 1829-1831.

[0012] In some embodiments, the sequence of 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides starting from the 5' end of the antisense strand and the mRNA (SEQ ID NO: 8) encoding CFB forms a complementary region to the target sequence: nucleotide 1830.

[0013] In some embodiments, according to claim 3, the length of the complementary region of the target sequence is 19-23 nucleotide pairs, 20-22 nucleotide pairs, or 21 nucleotide pairs.

[0014] In some embodiments, according to claim 4, the 23 nucleotides of the antisense strand from the 3' end comprise a sequence capable of forming a target sequence complementary region with at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides in the mRNA encoding CFB (SEQ ID NO: 8).

[0015] In some embodiments, according to claim 5, the RNA inhibitor of claim 5, wherein the 23 nucleotides of the antisense strand from the 3' end comprise a sequence capable of forming a target sequence complementary region with 21 consecutive nucleotides in the mRNA encoding CFB (SEQ ID NO: 8).

[0016] In some embodiments, the RNA inhibitor is ribonucleic acid.

[0017] In some embodiments, the RNA inhibitor is an antisense oligonucleotide (ASO), miRNA, shRNA, or siRNA.

[0018] In some embodiments, the antisense strand comprises at least 15 consecutive nucleotides in sequences such as SEQ ID NO:1-3, 5-6.

[0019] In some embodiments, the antisense chain includes the following sequence

[0020] 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO: 1).

[0021] In some embodiments, the RNA inhibitor comprises a sense strand capable of forming a complementary double strand with the antisense strand, wherein the antisense strand comprises a sequence capable of forming a double-stranded complementary region with at least 15 consecutive nucleotides in the sense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably the double-stranded complementary region being 15-30 nucleotide pairs in length, more preferably 17-23 nucleotide pairs.

[0022] In some embodiments, the RNA inhibitor, wherein the sense strand comprises at least 15 consecutive nucleotides in the sequence described in SEQ ID NO:4, 7.

[0023] In some embodiments, the RNA inhibitor, wherein the sense strand comprises the following sequence

[0024] 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO: 4).

[0025] In some embodiments, the sense and antisense strands exist on two different nucleic acid strands, and preferably the RNA inhibitor is siRNA.

[0026] In some implementations, the sense and antisense strands exist on the same nucleic acid strand, and preferably the RNA inhibitor is shRNA.

[0027] In some implementations, the sense strand and antisense strand are each optionally composed of a 3' overhang of 1-3 nucleotides.

[0028] In some implementations, both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' overhang of 1-3 nucleotides in length.

[0029] In some embodiments, the RNA inhibitor comprises a combination of the following sense and antisense strands:

[0030] Justice chain: 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO:4); Antisense chain: 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO:1).

[0031] In some embodiments, at least one nucleotide in the RNA inhibitor is a chemically modified nucleotide.

[0032] In some embodiments, the modification includes one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocked nucleic acid (UNA) modification, glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinylphosphonate (VP) modification (VP), N6- The modifications include methyl adenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, invAb, invAB, and M06.

[0033] (M06 structural formula) ).

[0034] In some embodiments, the 3' or 5' end of the antisense strand is modified with an inverted non-base nucleotide (invAB).

[0035] In some embodiments, the inverted non-base nucleotide (invAB) is attached to the 3' or 5' end of the antisense strand via a phosphate ester or thiophosphate bond.

[0036] In some implementations, the 3' or 5' end of the antisense chain is modified with M06:

[0037] In some embodiments, M06 is attached to the 3' or 5' end of the antisense chain via a phosphate ester or thiophosphate bond.

[0038] In some embodiments, the 3' or 5' end of the positive strand is modified with an inverted non-base nucleotide (invAB).

[0039] In some embodiments, the inverted non-basic nucleotide (invAB) is attached to the 3' or 5' end of the positive strand via a phosphate ester or thiophosphate bond.

[0040] In some implementations, the 3' or 5' end of the justice chain is modified with M06:

[0041] In some embodiments, M06 is attached to the 3' or 5' end of the positive chain via a phosphate ester or thiophosphate bond.

[0042] In some implementations, the antisense chain includes the following sequence:

[0043] 5'-(InvAB)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:2), where (invAB) is an inverted, non-base nucleotide modification.

[0044] In some implementations, the antisense chain includes the following sequence:

[0045] 5'-(M06)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:3), where (M06) is modified by M06.

[0046] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 9th nucleotide position of the sense strand.

[0047] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 10th nucleotide position of the sense strand.

[0048] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 11th nucleotide position of the sense strand.

[0049] In some embodiments, the RNA inhibitor, counting from the 5' end, has 2'-F modifications at positions 7, 9, 10, and 11 of the sense strand.

[0050] In some embodiments, the RNA inhibitor, counting from the 5' end, has a phosphate thioester linker between the fourth and fifth nucleotides of the antisense strand.

[0051] In some embodiments, the RNA inhibitor, counting from the 3' end, has a phosphate thioester link between the first and second nucleotides of the antisense strand.

[0052] In some embodiments, the RNA inhibitor, counting from the 3' end, has a phosphate thioester linker between the second and third nucleotides of the antisense strand.

[0053] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the first position of the antisense strand.

[0054] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the second position of the antisense strand.

[0055] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 5th position of the antisense strand.

[0056] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 17th position of the antisense strand.

[0057] In some embodiments, the RNA inhibitor, counting from the 5' end, has a 2'-F modification at the 19th position of the antisense strand.

[0058] In some embodiments, the RNA inhibitor, counting from the 5' end, has 2'-F modification at positions 1, 2, 5, 17, and 19 of the antisense strand.

[0059] In some embodiments, the RNA inhibitor includes phosphate or phosphate mimicry modifications at the 3' and / or 5' ends of the sense and / or antisense strands.

[0060] In some embodiments, phosphate analogs include 5'-(E)-vinylphosphonate (VP), 5'-methylphosphonate (MP), (S)-5'-C-methyl analogs, and 5'-thiophosphate (5'-PS).

[0061] In some implementations, the 3'-end and / or 5'-end of the justice chain and / or antisense chain include (M06):

[0062] In some embodiments, (M06) is attached to the 5'-end of the antisense chain via a phosphate ester or thiophosphate bond.

[0063] In some implementations, the 3'-end and / or 5'-end of the sense chain and / or antisense chain are modified with invAB.

[0064] In some embodiments, the inverted abase-free nucleotide is linked to the 5' end of the first nucleotide of the antisense strand via a thiophosphate ester.

[0065] In some embodiments, the RNA inhibitor further comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0066] In some embodiments, the ligands are independently conjugated to one or more internal sites of the double-stranded RNA.

[0067] In some embodiments, the internal position is located on a nucleobase, sugar ring, methylphosphonate bond, thiophosphate diester bond, or phosphate diester bond.

[0068] In some embodiments, the ligand is conjugated to the 5' end and / or 3' end of the antisense strand or antisense nucleic acid fragment.

[0069] In some embodiments, the ligand is conjugated to the 5' end and / or 3' end of the positive strand or positive nucleic acid fragment.

[0070] In some embodiments, the ligand is conjugated to the 5' end of the antisense strand or antisense nucleic acid fragment and to the 3' end of the sense strand or sense nucleic acid fragment, and the two ligands may be the same or different.

[0071] In some embodiments, the ligand is conjugated to the 3' end of the antisense strand or antisense nucleic acid fragment and to the 5' end of the sense strand or sense nucleic acid fragment, and the two ligands may be the same or different.

[0072] In some embodiments, the ligand is conjugated to the 5' end of the antisense strand or the antisense nucleic acid fragment, and the ligand is conjugated to the 5' end of the sense strand or the sense nucleic acid fragment, and the two ligands may be the same or different.

[0073] In some embodiments, the ligand is conjugated to the 3' end of the antisense strand or the antisense nucleic acid fragment, and the ligand is conjugated to the 3' end of the sense strand or the sense nucleic acid fragment, and the two ligands may be the same or different.

[0074] In some implementations, the number of ligands is 1, 2, 3, 4, 5, or 6.

[0075] In some embodiments, the ligand is an L96 monomer, the structure of which is shown below.

[0076] In some implementations, the justice chain and the antisense chain are selected from the following combinations:

[0077] Justice chain: g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7), Antisense chain: (invAB)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:5);

[0078] Justice chain: g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7), Antisense chain: (M06)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:6);

[0079] in,

[0080] The lowercase letters a, u, c, and g indicate that the nucleotide represented by their corresponding uppercase letters (A, U, C, G) is modified with 2'-O-methyl (2'-OMe). invAB modification refers to the attachment of an inverted, baseless deoxynucleotide at the 5' or 3' end of the nucleotide. Af, Uf, Cf, and Gf indicate that the nucleotide represented by their corresponding uppercase letters (A, U, C, G) is modified with 2'-deoxy-2'-fluoro (2'-F). The structure of M06 is shown below: (M06):

[0081] * indicates a link via thiophosphate.

[0082] On the other hand, this application provides a pharmaceutical composition comprising an RNA inhibitor as described in any one of claims 1-57, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

[0083] On the other hand, this application provides the use of the RNA inhibitor or the pharmaceutical composition described herein in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or symptom.

[0084] In some embodiments, the disease or pathology includes diseases or symptoms associated with elevated levels of complement factor B (CFB).

[0085] In some embodiments, the disease or pathology includes autoimmune diseases and inflammatory diseases.

[0086] In some embodiments, the disease or pathology described includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

[0087] In some embodiments, the method includes administering an effective amount of the RNA inhibitor and the pharmaceutical composition to a subject in need.

[0088] In some embodiments, the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

[0089] On the other hand, this application provides a method for inhibiting the expression of complement factor B (CFB) in cells, tissues or subjects, comprising administering an effective amount of the RNA inhibitor or the pharmaceutical composition to the cells, tissues or subjects.

[0090] In some embodiments, the disease or pathology includes diseases or symptoms associated with elevated levels of complement factor B (CFB).

[0091] In some embodiments, the disease or pathology includes autoimmune diseases and inflammatory diseases.

[0092] In some embodiments, the disease or pathology includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

[0093] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0094] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and accompanying drawings described in detail below. A brief description of the drawings is as follows:

[0095] Figures 1 and 2 show the inhibitory effect of the RNA inhibitor described in this application on the CFB protein content in monkey serum;

[0096] Figure 3 shows the inhibitory effect of the RNA inhibitor described in this application on the content of CFB mRNA in mouse liver;

[0097] Figure 4 shows the inhibitory activity of the RNA inhibitor described in this application on CFB mRNA in the liver of cynomolgus monkeys;

[0098] Figure 5 shows the inhibitory effect of the RNA inhibitor described in this application on the CFB protein content in monkey serum;

[0099] Figure 6 shows the alternative hemolytic activity of the RNA inhibitor described in this application in cynomolgus monkey serum.

[0100] Figure 7 shows the nucleotide sequence provided in this application. Detailed Implementation

[0101] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0102] Terminology Definition

[0103] In this application, the term complement factor B (CFB) refers to a protein (human complement factor B (CFB) gene (human: NCBI refseqID NM_001710.6, as sequenced) encoded by the CFB gene. This gene encodes complement factor B, a component of the alternative pathway for complement activation. Factor B circulates in the blood as a single-chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D, producing the non-catalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease that binds to C3b to form the alternative pathway C3 convertase. Bb participates in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. The gene is located in the major histocompatibility complex (MHC class III) region on chromosome 6. This cluster includes several genes involved in regulating immune responses. The polyadenylation site of this gene is located at 421 bp from the 5' end of the complement component 2 gene.

[0104] In this application, the terms "complement factor B disease" or "CFB-related disease" refer to a disease or condition caused by or associated with complement activation. The term "CFB-related disease" includes diseases, disorders, or conditions that would benefit from reduced CFB gene expression, replication, or protein activity. Non-limiting examples of CFB-related diseases include, for example, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and hypoplasmosis. HELLP syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; oligoimmune vasculitis; bullous epidermolysis; recurrent miscarriage; preeclampsia; traumatic brain injury; myasthenia gravis; cold agglutinin disease; dermatomyositis; bullous pemphigoid; Shiga toxin-associated Escherichia coli-associated hemolytic uremic syndrome; C3 nephropathy; antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatous disease with polyangiitis (formerly known as Wegener's granulomatosis), allergic granulomatous vasculitis, and microscopic polyangiitis); humoral and vascular transplant rejection; transplantation Medical dysfunction, myocardial infarction (e.g., tissue damage and ischemia during myocardial infarction), allogeneic transplantation, sepsis (e.g., adverse outcomes of sepsis), coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasser syndrome, Degos disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disorders Myocarditis, cerebrovascular disorders, peripheral (e.g., musculoskeletal) vascular disorders, renal vascular disorders, mesenteric / enterovascular disorders, vasculitis, purpuric nephritis, systemic lupus erythematosus-associated vasculitis, rheumatoid arthritis-associated vasculitis, immune complex vasculitis, Goyan's disease, dilated cardiomyopathy, diabetic angiopathy, Kawasaki's disease (arteritis), venous air embolism (VGE) and restenosis after stent placement, rotational atherosclerotic plaque removal and percutaneous transluminal coronary angioplasty (PTCA) (see, for example, Holers (2008) Immunological Reviews 223:300-316; Holers and Thurman (2004) Molecular Immunology 41:147-152; US Publication No. 20070172483).

[0105] In this application, the terms "RNA inhibitor," "iRNA," "siRNA," "RNAi agent," "iRNA agent," and "RNA interference agent" are used interchangeably and generally refer to agents containing RNA as defined in this application, which can mediate targeted cleavage of RNA transcripts by forming an RNA-induced silencing complex (RISC) within cells. The RNA inhibitor directs sequence-specific degradation of mRNA via a process called RNA interference (RNAi). The RNA inhibitor described in this application can regulate or inhibit the expression of the CFB gene in cells, and in some embodiments, the cells may be cells of a mammalian subject. In some embodiments, the RNA inhibitor can regulate or inhibit the mRNA sequence of the complement factor B (CFB) gene.

[0106] In some embodiments, the “RNA inhibitor” used in this application is a single-stranded siRNA (ssRNAi), which can be introduced into cells or organisms to inhibit target mRNA. The single-stranded RNA inhibitor can bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded RNA inhibitor is typically 15 to 30 nucleotides long and chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the full contents of which are incorporated herein by reference. Any antisense nucleotide sequence described in this application may be used as a single-stranded siRNA chemically modified by the methods described in this application or by methods described in Lima et al. (2012) Cell 150:883-894.

[0107] In some embodiments, the “RNA inhibitor” used herein is shRNA. As used herein, the term “shRNA” (i.e., short hairpin RNA) refers to an artificial single-stranded interfering RNA molecule that contains the sense and / or antisense strands of a “siRNA double strand” within a stem-loop or hairpin structure. The stem of this hairpin structure is typically 19 to 29 nucleotides in length, and the loop is typically 4 to 15 nucleotides in length (see, for example, Siolas, D. et al. (2004) Nat. Biotechnol. 23, 227-231). Typically, shRNA molecules are encoded within a DNA expression vector under the control of an RNA polymerase III promoter (e.g., the U6 promoter).

[0108] In some embodiments, the “RNA inhibitor” used in this application is a miRNA. The term “miRNA” or “microRNA” as used herein, according to its common meaning in the art, refers to a small, non-protein-coding RNA molecule that is expressed in genes and involved in RNA-based gene regulation in a variety of eukaryotes, including mammals. A mature, fully processed miRNA is about 15 to about 30 nucleotides in length. A representative group of known endogenous miRNAs is described in the publicly available miRBase sequence database, described in Griffith-Jones et al., Nucleic Acids Research, 2004, 32:D109-D111 and Griffith-Jones et al., Nucleic Acids Research, 2006, 34:D140-D144, and is accessible on the World Wide Web of the Wellcome Trust Sanger Institute website. Mature, fully processed miRNAs publicly available in the miRBase sequence database are incorporated herein by reference. A representative group of miRNAs is also included in Table 1 below. Each mature miRNA is partially complementary to one or more messenger RNA (mRNA) molecules, which are the target of the miRNA, thereby regulating the expression of target-related genes.

[0109] In some embodiments, the “RNA inhibitor” used herein is an ASO. As used herein, the term “ASO” (i.e., antisense nucleic acid) refers to a nucleic acid molecule having a “siRNA double helix” of both a sense strand and / or an antisense strand that binds to the target RNA via RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid; Egholm et al., 1993 Nature 365, 566) interactions and alters the activity of the target RNA through spatial interactions or through RNase H-mediated target recognition (for reviews, see Stein and Cheng, 1993 Science 261, 1004 and Woolf et al., U.S. Patent No. 5,849,902). Generally, the antisense molecule is complementary to the target sequence along a single adjacent sequence of the antisense molecule. However, in some embodiments, the antisense molecule may bind to a substrate, thereby causing the substrate molecule to form a loop, and / or the antisense molecule may bind, thereby causing the antisense molecule to form a loop. Therefore, antisense molecules can be complementary to two (or more) non-adjacent substrate sequences, or two (or more) non-adjacent sequence portions of the antisense molecule can be complementary to the target sequence or both. For a review of current antisense strategies, see Schmajuk et al., 1999, J. Biol. Chem., 274, 21783-21789; Delihas et al., 1997, Nature, 15, 751-753; Stein et al., 1997, Antisense NADrug Dev., 7, 151; Crooke, 2000, Methods Enzymol., 313, 3-45; Crooke, 1998, Biotech. Genet. Eng. Rev., 15, 121-157; Crooke, 1997, Ad. Pharmacol., 40, 1-49. Furthermore, antisense DNA or antisense molecules modified with 2'-MOE and other modifications as known in the art can target RNA via DNA-RNA interactions, thereby activating RNase H, which digests the target RNA in the duplex. Antisense oligonucleotides may contain one or more RNase H activation regions capable of activating RNase H cleavage of the target RNA. Antisense DNA can be chemically synthesized or expressed using a single-stranded DNA expression vector or its equivalent. The antisense molecules of the present invention can be chemically modified as generally known in the art or as described herein.

[0110] In some embodiments, the “RNA inhibitor” used in this application is double-stranded RNA, and is referred to herein as “siRNA double strand,” “double-stranded RNA inhibitor,” “double-stranded siRNA molecule,” “double-stranded siRNA,” or “dsRNA.” The term “siRNA double strand” refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and partially complementary nucleic acid strands, having “sense” and “antisense” orientations relative to the target RNA (i.e., the CFB gene). In some embodiments, the siRNA double strand directs the specific degradation of a sequence of mRNA (such as the mRNA sequence of the CFB gene) via a process called RNA interference (RNAi). Typically, siRNA contains a double-stranded region of fewer than 60, 50, 40, or 30 complementary base pairs; preferably, it contains a double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 complementary base pairs. In some embodiments, the sense and antisense strands of the siRNA are each independently 15-30 nucleotides in length, forming a complementary double-stranded region of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 base pairs in length. In some embodiments, the sense and antisense strands of the siRNA are completely complementary and have a length of 15-30 base pairs. In some embodiments, the sense and antisense strands of the siRNA are completely complementary and have a length of 17, 18, 19, 20, 21, or 22 base pairs.

[0111] Generally, the majority of the nucleotides in each chain of an RNA inhibitor are ribonucleotides. Unless otherwise specified, they are ribonucleotides. However, as detailed herein, each or both of the two chains may also include one or more non-ribonucleotides, such as a deoxyribonucleotide and / or a modified nucleotide. Furthermore, "RNA inhibitor" may include chemically modified ribonucleotides. These modifications may include all types of modifications disclosed herein or known in the art. Any such modifications used in an RNA inhibitor molecule are encompassed by the term "RNA inhibitor" for the purposes of this specification and the claims.

[0112] The double-stranded structure can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can be in the length range of about 15 to 36 base pairs, for example, about 19-30 base pairs, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. The ranges and lengths between the above ranges and lengths are also included in this application. In some embodiments, the RNA inhibitor of this application is a dsRNA containing 15-23 nucleotides per strand, which interacts with the target RNA sequence (e.g., the CFB gene) to guide the cleavage of the target RNA. In some embodiments, the RNA inhibitor of this application is a dsRNA of 24-30 nucleotides, which interacts with the target RNA sequence (e.g., the mRNA sequence of the CFB gene) to guide the cleavage of the target RNA.

[0113] In this application, the term "antisense strand" generally refers to a strand on an RNA inhibitor (e.g., double-stranded siRNA) that is substantially complementary to a target nucleic acid (e.g., the mRNA sequence of a target genomic sequence, including mRNA precursors and mRNA molecules, for example, the mRNA sequence of the CFB gene). The term "complementary region" as used in this application generally refers to a region on the antisense strand that is substantially complementary to the target sequence (the mRNA sequence of the CFB gene) used in this application. When the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or in terminal regions. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0114] In this application, the term "mismatch" refers to pairings of non-adenine (A) with thymine (T), non-adenine (A) with uracil (U), non-guanine (G) with cytosine (C), the absence of hydrogen bonds between the bases of the relative nucleotides, and the absence of bases between the relative nucleotides. The term "mismatch" as used herein includes, but is not limited to:

[0115] 1) Two opposing (independent natural or non-natural) nucleotides (other than AT, AU, or GC) pairing;

[0116] 2) No hydrogen bonds are formed between two opposing (independent natural or non-natural) nucleotides;

[0117] 3) A base is missing between two opposing (independent natural or non-natural) nucleotides.

[0118] In some embodiments, mismatches include wobbly base pairing and Hoogstein base pairing.

[0119] In this application, the term "antisense nucleic acid fragment" refers to a continuous fragment on the antisense strand, the fragment of which may contain 15-35 nucleotides in length. For example, the antisense nucleic acid fragment may be a continuous fragment of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 nucleotides in length on the antisense strand. The antisense nucleic acid fragment is complementary to any continuous nucleotide fragment of length in the mRNA encoding CFB. In some embodiments, at least three continuous nucleotide fragments on the antisense nucleic acid fragment are complementary to a corresponding continuous nucleotide fragment of length in the mRNA encoding CFB.

[0120] In this application, the term "sense strand" generally refers to a strand of an RNA inhibitor that includes a region substantially complementary to the region referred to herein as the antisense strand. The "sense" strand is sometimes called the "sense" strand, the "passenger" strand, or the "antiguide" strand. With their sequence, the antisense strand targets the desired mRNA, while the sense strand targets a different target. Therefore, if the antisense strand is incorporated into a RISC, the correct target is targeted. Incorporation of the sense strand can lead to off-target effects. These off-target effects can be limited by using modifications on the sense strand or by using a 5' cap.

[0121] In this application, the term "positive nucleic acid fragment" refers to a continuous fragment on the positive strand, the fragment of which may contain 15-35 nucleotides in length. For example, the positive nucleic acid fragment may be a continuous fragment of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 nucleotides in length on the positive strand.

[0122] In this application, the term "complementarity" refers to the ability of a polynucleotide containing an RNA inhibitor antisense strand or an antisense nucleic acid fragment to hybridize (form base pair hydrogen bonds) with a polynucleotide containing an RNA inhibitor sense strand or a sense nucleic acid fragment or CFB mRNA under certain conditions to form a double-stranded or double-helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include native or modified nucleotides or nucleotide mimics, provided that the above requirements regarding their hybridization ability are met. "Complementarity" does not necessarily require complementary bases on every nucleotide; some mismatches may occur in some cases.

[0123] In this application, the term "fully complementary" generally means that all (100%) bases in a sequential sequence of the RNA inhibitor antisense strand or antisense nucleic acid fragment will hybridize with the same number of bases in a sequential sequence of the RNA inhibitor sense strand or sense nucleic acid fragment or CFB mRNA. The sequential sequence may comprise all or part of the aforementioned sequence. As used herein, "partially complementary" generally means that in the hybridized nucleobase sequence pairs, at least about 70% of the bases in a sequential sequence of the RNA inhibitor antisense strand or antisense nucleic acid fragment will hybridize with the same number of bases in a sequential sequence of the RNA inhibitor sense strand or sense nucleic acid fragment or CFB mRNA. The terms "complementary," "fully complementary," and "substantially complementary" as used herein may be used with respect to base matching between the RNA inhibitor sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment, or between the RNA inhibitor antisense strand or antisense nucleic acid fragment and the CFB mRNA sequence. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af are complementary to U (or T) and identical to A.

[0124] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.

[0125] Nucleotides can be substituted with their analogues, including both natural and non-natural analogues. Examples of guanosine analogues include, but are not limited to, 6-thioguanosine, 8-azaguanosine, 8-oxoguanosine, and 2-aminopurine nucleoside. Examples of adenosine analogues include, but are not limited to, cordycepin (3′-deoxyadenosine), n6-benzyladenosine, and 2-chloroadenosine. Examples of cytidine analogues include, but are not limited to, gemcitabine (2',2'-difluoro-2'-deoxycytidine), cytarabine (1-β-d-arabinoseurerylcytosine), and decitabine (5-aza-2'-deoxycytidine). Examples of uracil analogues include, but are not limited to, 5-fluorouracil, pseudouracil, 5-bromouracil, 4-thiouracil, and 5-azidouracil.

[0126] As used herein, "ribonucleic acid" (RNA) is the carrier of genetic information found in cells and some viruses and viroids. RNA is a long chain molecule formed by ribonucleotides linked by nucleotide bonds, including single-stranded RNA and double-stranded RNA. The natural nucleotide bond is the phosphodiester bond. In some embodiments, the ribose, bases, and nucleotide bonds in RNA may be modified independently and optionally.

[0127] As used herein, "double-stranded ribonucleic acid" is a complex consisting of two nucleic acid strands bonded together from natural or non-natural nucleotides, similar in structure and function to natural ribonucleic acid. These two nucleic acid strands contain antiparallel and substantially complementary sequences. "Substantially complementary" means that, while maintaining function, the antiparallel regions of the two nucleic acid strands may contain a certain number of base mismatches and non-matches. In some embodiments, the certain number refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the certain number refers to 1, 2, 3, 4, or 5. In some embodiments, the certain number refers to 1, 2, or 3.

[0128] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.

[0129] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. The natural nucleotides used in this article refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. The term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of its sugar moiety. "Deoxyribonucleoside" refers to a nucleotide having a hydrogen atom at the 2' position of its sugar moiety.

[0130] As used herein, a "monomer" is a class of compounds that can be assembled into a ribonucleic acid chain and exert a certain function. As used herein, a "monomer" includes, but is not limited to, natural nucleosides, non-natural nucleosides (such as modified nucleosides, nucleoside analogs, inverted non-base deoxynucleosides, GNA, LNA, etc.), M06, and ligands.

[0131] As used herein, the term "nucleotide link" refers to the connection (e.g., bond or linking group) between two parts of an oligonucleotide disclosed herein (e.g., between two monomers), including connections between nucleosides, between a nucleoside and a ligand, between a nucleoside and M06, and between a nucleoside and a baseless nucleoside.

[0132] The natural bases of RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine). As used herein, the prefix "d" before a nucleotide (e.g., A, U, C, G, and T) indicates that the nucleotide is 2'-deoxy modified. As used herein, the prefix "f" after a nucleotide (e.g., A, U, C, G, and T) indicates that the nucleotide is 2'-deoxy-2'-fluorinated (2'-F modification). As used herein, the prefix "GNA-" before a nucleotide (e.g., A, U, C, G, and T) indicates that the nucleotide is ethylene glycol modified (GNA modification). As used herein, Tgn is the abbreviation for GNA-T and has the same meaning. As used herein, lowercase letters (a, u, c, g, t, etc.) indicate that the corresponding uppercase letters (A, U, C, G, and T, etc.) represent nucleotides modified with 2'-O-methyl (2'-OMe).

[0133] In this invention, unless otherwise specified, "G", "C", "A", "T" and "U" refer to guanine ribonucleotide, cytosine ribonucleotide, adenine ribonucleotide, thymine ribonucleotide and uracil ribonucleotide, respectively, with the following structures:

[0134] In this invention, the prefix "d" before a nucleotide (A, U, C, G, and T, etc.) indicates that the nucleotide is 2'-deoxy modified. An exemplary nucleotide structure with 2'-deoxy modification is as follows:

[0135] In this invention, the label "f" following a nucleotide (A, U, C, G, and T, etc.) indicates that the nucleotide is modified with 2'-deoxy-2'-fluorine (2'-F modification). An exemplary nucleotide structure with 2'-F modification is as follows:

[0136] In this invention, the prefix "GNA-" before nucleotides (A, U, C, G, and T, etc.) indicates that the nucleotide has been modified with ethylene glycol nucleic acid (GNA modification). In this invention, Tgn is the code for GNA-T, and they are equivalent. An exemplary structure of a GNA-modified nucleotide is as follows:

[0137] In this invention, lowercase letters (a, u, c, g, t, etc.) indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G, and T, etc.) is modified with 2'-O-methyl (2'-OMe). An exemplary nucleotide structure modified with 2'-OMe is as follows:

[0138] In this invention, invAB modification refers to the bonding of an inverted, baseless nucleotide to the 5' or 3' end of a nucleotide.

[0139] For example, The structure modified by invAB:

[0140] In this invention, invAb modification refers to the replacement of a nucleotide with an inverted, baseless nucleotide (invAb). For example, The structure modified by invAb:

[0141] In this invention, VP modification refers to the modification of the 5' position of a nucleotide with 5'-(E)-vinyl phosphate. For example, the structures of U, u, and dU after modification are as follows:

[0142] In this invention, the marking "*" between monomers (such as A, U, C, G and T, etc.) indicates that the two monomers are connected by a thiophosphate bond (i.e., a thiophosphate diester bond), that is, modified by thiophosphate (PS).

[0143] In this invention, the absence of an asterisk (*) between monomers (such as A, U, C, G, and T) indicates that the two nucleotides are linked by a phosphate ester bond (i.e., a phosphate diester bond).

[0144] For example, “5'-A(dU)g(Cf)*(dT)-3'” means that the sequence starts from the 5' end, with adenine ribonucleotide at position 1, uracil deoxyribonucleotide at position 2, guanine ribonucleotide modified with 2'-methoxy at position 3, cytosine ribonucleotide modified with 2'-fluorine at position 4, and thymine deoxyribonucleotide linked to position 4 by a phosphate thioester bond at position 5.

[0145] In this invention, M06 modification refers to the bonding of monomers (such as nucleotides) to the 5' or 3' end. For example, Structure modified by M06: In this invention, (M06) It is M06 monomer The residues. In some embodiments, (M06) is via a precursor compound. It is bonded to a nucleotide.

[0146] The phosphate groups in the above chemical formulas are merely illustrative representations. Those skilled in the art will understand that when thiophosphate linkage is required, an oxygen atom in the phosphate group can be replaced with sulfur.

[0147] For example, “5'-A(dU)gCf*(dT)-3'” means that the sequence starts from the 5' end, with adenine ribonucleotide at position 1, uracil deoxyribonucleotide at position 2, guanine ribonucleotide modified with 2'-methoxy at position 3, cytosine ribonucleotide modified with 2'-fluorine at position 4, and thymine deoxyribonucleotide linked to position 4 by a phosphate thioester bond at position 5.

[0148] For example, the structure shown as “5'-(M06)*A(dT)gCf*(invAB)-3'” is as follows:

[0149] For example, the structure shown as “5'-(M06)*A(dT)gCf*[L96]-3'” is as follows:

[0150] As used in this article, the structures of NAG37 monomer and L96 monomer are respectively

[0151] [NAG37] and [L96] represent its residues, respectively. For example, the sequence [NAG37]AfGfu*[L96] has the following structure:

[0152] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of a nucleotide (deoxyribonucleotide or ribonucleotide or the like) of any length. The polynucleotide may have any three-dimensional structure and perform any function. The polynucleotide may contain one or more modifications or substitutions at one or more bases, sugars, and / or phosphate esters as described in this application or known in the art. In some embodiments, the modified nucleotide may be a methylated nucleotide or a nucleotide analog. In some embodiments, the nucleotide structure may be modified before or after the assembly of the polynucleotide polymer. The polynucleotide may be modified post-polymerization, for example, by coupling with a labeled component. The polynucleotide polymer may be blocked by a non-nucleotide component. In this application, the terms "nucleic acid" and "polynucleotide" can refer to double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment of a polynucleotide in this application includes both double-stranded forms and each of two complementary single-stranded forms known or predicted to constitute a double-stranded form. For example, polynucleotides can include, but are not limited to: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents and primers.

[0153] In this application, the term "oligonucleotide" generally refers to a polymer composed of multiple nucleotide residues (deoxyribonucleotides or ribonucleotides, or their associated structural variants or synthetic analogs) linked by phosphodiester bonds (or their associated structural variants or synthetic analogs). Therefore, while the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and their linkages are naturally occurring, it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), aminophosphates, thiophosphates, methylphosphates, 2'-O-methylribonucleic acid, etc. The exact size of the molecule may depend on the specific application. Oligonucleotides are generally short in length, typically containing about 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.

[0154] In some embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified oligonucleotide" generally means an oligonucleotide comprising at least one modified nucleotide and / or at least one modified nucleotide linked together.

[0155] In this application, the term "modified nucleoside" generally refers to a nucleoside that contains at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise modified sugar moieties and / or modified nucleobases.

[0156] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). Nucleotides may include modified nucleotides or nucleotide mimics, base-free sites (Ab or X), or substitute substituted portions. As used in this application, "nucleobase sequence" generally refers to a sequence of consecutive nucleobases independent of any sugar, linking, or nucleobase modification. The terms "unmodified nucleobase" or "naturally occurring nucleobase" generally refer to naturally occurring heterocyclic nucleobases in RNA or DNA: the purine bases adenine (a) and guanine (g); and thymine (t), cytosine (c) (including 5-methylc), and uracil (u). "Modified nucleobase" generally refers to any nucleobase that is not naturally occurring.

[0157] In this application, the term "sugar moiety" generally means either a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means ribofuranosyl as found in naturally occurring RNA or ribofuranosyl as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or a sugar substitute.

[0158] In this application, the terms "nucleoside bond" or "nucleoside linkage" generally refer to a covalent bond between adjacent nucleosides in an oligonucleotide. "Naturally occurring nucleoside linkage" refers to a 3' to 5' phosphodiester linkage. "Modified nucleoside linkage" refers to any nucleoside linkage other than a naturally occurring one.

[0159] In this application, the terms "target nucleic acid" or "target sequence" generally refer to a continuous portion of the nucleotide sequence of the mRNA molecule formed during CFB gene transcription, including mRNA of the RNA processing product, which is the major transcription product. The target portion of the sequence should be at least long enough to serve as a substrate for iRNA-guided cleavage at or near the location of that portion of the nucleotide sequence of the mRNA molecule formed during CFB gene transcription. In one embodiment, the target sequence is located within the protein-coding region of CFB. The target sequence may be about 19-36 nucleotides in length, for example, preferably about 19-30 nucleotides in length. Ranges and lengths between the above ranges and lengths also include portions of this application.

[0160] In this application, the term "blocking group" refers to a group that can selectively bind to the double-stranded siRNA or a drug containing double-stranded siRNA as described in this application, said blocking group being located on the sense strand or sense nucleic acid fragment, the antisense strand or antisense nucleic acid fragment, or both strands. The blocking group may be attached to the 3' end, 5' end, or both ends of the sense strand or sense nucleic acid fragment, the antisense strand or antisense nucleic acid fragment, or both strands. In some embodiments, the blocking group binds to the antisense strand or antisense nucleic acid fragment, particularly the 5' end of the antisense strand or antisense nucleic acid fragment. In some embodiments, the blocking group binds to an oligonucleotide (e.g., the 5' end of the antisense strand or antisense nucleic acid fragment) via an internucleotide link, and this internucleotide link may optionally be modified as described above. In some embodiments, the blocking group is linked to the double-stranded oligonucleotide drug via a phosphosulfate ester. In some embodiments, the blocking group is linked to the double-stranded oligonucleotide drug via a phosphodiester. In this application, to reduce or inhibit exonuclease degradation, a "blocking group" may bind to the 5' end of the antisense strand of the double-stranded siRNA or the antisense nucleic acid fragment described in this application. In some embodiments, the blocking group may reduce or inhibit the RNA interference effect of the oligonucleotide. In some embodiments, the blocking group is cleaved from the oligonucleotide before providing the RNA interference effect. Examples of blocking groups include, but are not limited to, baseless residues, reverse baseless residues, and (M06).

[0161] In this application, the term "ligand" generally refers to any compound or molecule capable of covalently or otherwise chemically binding to a biologically active substance (such as an oligonucleotide). In some embodiments, the ligand is capable of interacting directly or indirectly with another compound, such as a receptor. The receptor interacting with the ligand may be present on the cell surface, or alternatively may be an intracellular and / or intercellular receptor. The interaction between the ligand and the receptor may result in a biochemical reaction, or may simply be a physical interaction or binding.

[0162] In this application, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. For example, "double-stranded ribonucleic acid conjugated compound" refers to a compound or complex formed by covalently linking one or more chemical parts with specific functions (such as a delivery system, ligand group, or conjugating group) to a double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may be attached to a phosphate group, sugar ring (including the delivery system, ligand group, or conjugating group covalently linked to the 3' or 5' atom of the nucleotide via a phosphodiester bond), 2'-hydroxyl group, 5'-hydroxyl group, or base of any nucleotide of the double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may also be attached to the 2' position of the nucleotide, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. In some embodiments, the delivery system, ligand group, or conjugate group may also be attached to the 3' position of the nucleotide, in which case the nucleotides are linked by a 3'-5' phosphodiester bond. In some embodiments, the connection between the delivery system, ligand group, or conjugate group and the nucleotide may be further modified, such as by thiomodification (i.e., linked by a phosphothiodiester bond).

[0163] In this application, the terms “inducing,” “inhibiting,” “enhancing,” “increasing,” “reducing,” “lowering,” etc., generally refer to a quantitative difference between two states. For example, “the amount of CFB activity or expression effectively inhibited” means that the level of CFB activity or expression in the treated sample will be lower than the level of CFB activity or expression in the untreated sample. These terms apply, for example, to expression levels and activity levels. The terms “reducing” and “lowering” are used interchangeably and generally refer to any change less than the original. “Reducing” and “lowering” are relative terms and need to be compared between before and after measurement. “Reducing” and “lowering” include complete depletion.

[0164] In some embodiments, the term "reduction" refers to an overall reduction, detectable by standard methods known in the art (such as those described herein), of the expression level / amount of a gene, gene product (e.g., protein), or biomarker in a first sample compared to the expression level / amount of the corresponding gene, gene product (e.g., protein), or biomarker in a second sample by approximately 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the term "reduction" refers to a reduction in the expression level / amount of a gene or biomarker in the first sample, wherein the reduction is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold in the expression level / amount of the corresponding gene or biomarker in the second sample. In some embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.

[0165] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0166] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may typically contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. These pharmaceutically acceptable formulations may also typically contain compatible solid or liquid fillers, diluents, or encapsulation materials suitable for human administration. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0167] In this application, the term "prevention and / or treatment" includes not only the prevention and / or treatment of disease, but also generally includes preventing the onset of disease, slowing or reversing the progression of disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated with it and / or preventing a further increase in the severity of the disease and / or any symptoms associated with it, preventing, reducing or reversing any physiological damage caused by the disease, and any pharmacological effects that are generally beneficial to the patient being treated. The RNAi agents or pharmaceutical compositions of this application do not need to achieve a complete cure or eradication of any symptom or manifestation of the disease to be considered a useful therapeutic agent. As recognized in the relevant art, a medicine used as a therapeutic agent may reduce the severity of a given disease state, but does not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a treatment administered prophylactically constitutes a viable preventive agent and does not need to completely and effectively prevent the onset of the condition. It is sufficient to simply reduce the effects of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reduce the likelihood of the disease occurring or worsening.

[0168] In this application, the terms "disease" or "symptom" are used interchangeably and generally refer to any deviation of a subject from a normal state, such as any change in the state of the body or certain organs, that impairs or disrupts the performance of function, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person who is ill or in contact with such a person. Disease or symptom may also be referred to as disorder, ailing, ailment, malady, disorder, sickness, illness, or complaint.

[0169] In this application, the term "administration" generally refers to the introduction of the pharmaceutical preparation of this application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intra-arterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal, or oral administration. The daily dose may be divided into one, two, or more doses in suitable forms to be administered at one, two, or more times during a certain time period.

[0170] In this application, the term "contact" generally refers to two or more substances of different types coming into contact with each other in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In some embodiments, it may refer to direct contact of the RNAi agent or composition of this application with cells or tissues. In other embodiments, the term refers to indirect contact of the RNA inhibitor or composition of this application with cells or tissues. For example, the method of this application includes a method in which a subject is exposed to the RNA inhibitor or composition of this application, and then the RNA inhibitor or composition contacts cells or tissues by diffusion or any other active or passive transport process known in the art (through which the compound circulates in vivo).

[0171] In this application, the terms "effective amount" or "effective dose" generally refer to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent generally refers to any amount of drug that, when used alone or in combination with another therapeutic agent, promotes disease remission (proven by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of the disease, or prevention of damage or disability due to the disease). A "preventive effective amount" or "preventive effective dose" of a drug generally refers to an amount of drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or relapse, inhibits the development or relapse of the disease. The ability of a therapeutic agent or preventive agent to promote disease remission or inhibit disease progression or relapse can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in an in vitro assay. In some embodiments, "effective amount" refers to an amount of RNA inhibitor that produces the expected pharmacological, therapeutic, or preventive outcome.

[0172] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) requiring diagnosis, prognosis, improvement, prevention, and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens, ducks, horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models.

[0173] In this application, the terms “comprising,” “including,” “having,” “may,” “containing,” and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. The term “composed of” generally indicates that no other components can exist (or similarly, features, integers, steps, etc.). Unless the context clearly specifies otherwise, the singular forms such as “a,” “an,” “the” in English, and “a,” “a,” “the,” and “the” in Chinese generally include the plural form of the things referred to.

[0174] In this application, the term "about" generally means large, roughly, or around. When the term "about" is used to refer to a range of values, a cutoff value or a specific value is used to indicate that the stated value may differ from the listed value by up to 10%. Therefore, the term "about" can be used to cover variation of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a specific value.

[0175] It should be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least," and all subsequent numbers or integers logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides in a nucleic acid molecule of 21 nucleotides" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in that series or range.

[0176] It should be understood that "not more than" or "less than" as used herein refers to the value or integer adjacent to the phrase and logically lower, such as to zero, as the context suggests. For example, a double strand with "not more than 3 nucleotides" overhangs has 3, 2, 1, or 0 nucleotide overhangs. When "not more than" appears before a series of numbers or ranges, it should be understood that "not more than" can modify each number in that series or range. The ranges used herein include both upper and lower limits.

[0177] Invention Details

[0178] Antisense Chain and Justice Chain

[0179] On the one hand, this application provides an RNA inhibitor for inhibiting CFB expression, comprising an antisense strand, wherein the antisense strand forms a target sequence complementary region with at least 15 consecutive nucleotides in the mRNA encoding CFB (SEQ ID NO:8), wherein the target sequence complementary region has 0, 1, 2, 3, 4 or 5 mismatches.

[0180] The antisense strand and the mRNA (SEQ ID NO:8) encoding CFB, starting from the 5' end, form a sequence of 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that form the complementary region of the target sequence: nucleotide 1830.

[0181] In some embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of the CFB gene in a cell (such as the cell of a subject, e.g., a mammal). The RNA inhibitor includes an antisense strand or antisense nucleic acid fragment having a complementary region that is complementary to at least a portion of the mRNA formed during the expression of the CFB gene. This complementary region is about 12-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).

[0182] The justice chain and the antithesis chain can be on the same chain or on two separate chains.

[0183] When an RNA inhibitor comprises two strands, they can hybridize and form a double-stranded structure (complementary region) under the conditions under which the RNA inhibitor is used. The first strand of the RNA inhibitor (the antisense strand or antisense nucleotide fragment) includes a complementary region that is substantially complementary to, and usually perfectly complementary to, the target sequence. The target sequence may be derived from the sequence that forms mRNA during CFB gene expression. The second strand of the RNA inhibitor (the sense strand or sense nucleotide fragment) includes a region complementary to the antisense strand or antisense nucleotide fragment, such that when combined under appropriate conditions, the two strands can hybridize and form a double-stranded structure. Typically, the length of the double-stranded structure is 12 to 30 base pairs. Similarly, the complementary region to the target sequence is 12 to 30 nucleotides in length, for example, in 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19 The length between -29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides.

[0184] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the length of the dsRNA is sufficient to serve as a substrate for the Dicer enzyme. For example, it is known in the art that dsRNAs longer than about 21-23 nucleotides can be used as substrates for Dicer. Those skilled in the art also understand that the region of RNA targeted for cleavage is typically a portion of a larger RNA molecule (typically an mRNA molecule). A “portion” of the target is a continuous nucleotide sequence of the mRNA target, long enough to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0185] Those skilled in the art will also understand that complementary regions are the main functional parts of dsRNA, for example, double-stranded regions of about 19 to about 30 base pairs, such as about 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21. 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs.

[0186] In some implementations, there is at least about 80% base complementarity between the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment.

[0187] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 19-30 nucleotides.

[0188] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 17-25 nucleotides.

[0189] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 19-23 nucleotides.

[0190] In some implementations, the sense strand or sense nucleic acid fragment is selected from the following sequences or at least 15 consecutive nucleotide sequences that differ from it by no more than 3 nucleotides, such as 15, 16, 17, 18, 19, or 20 consecutive nucleotides:

[0191] 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO: 4).

[0192] In some implementations, the antisense strand or antisense nucleic acid fragment is selected from the following sequences or at least 15 consecutive nucleotide sequences differing from them by no more than 3 nucleotides, such as 15, 16, 17, 18, 19, or 20 consecutive nucleotides:

[0193] 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:1)

[0194] In some embodiments, the RNA inhibitor has a 3' overhang of 2-3 nucleotides on both strands, or a 3' overhang of 2-3 nucleotides on the sense strand or sense nucleic acid fragment, or a 3' overhang of 2-3 nucleotides on the antisense strand or antisense nucleic acid fragment.

[0195] In some implementations, the RNA inhibitor has only a 3' overhang of 2 nucleotides in length on the antisense strand or antisense nucleic acid fragment.

[0196] In some implementations, RNA inhibitors comprise the following combinations of sense and antisense strands:

[0197] Justice chain: 5'-GAAUUCCUGAAUUUUAUGACU-3'(SEQ ID NO:4); Antisense chain

[0198] 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO: 1).

[0199] Modified nucleotides

[0200] To enhance the stability of the aforementioned RNA inhibitors in vivo, without affecting or even enhancing their activity, the sense and antisense strands of the RNA inhibitors can be modified. The nucleotides may have modifying groups, and the entire strand or parts of the strand may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.

[0201] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.

[0202] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. The natural nucleotides used in this article refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of its sugar moiety. "Deoxyribonucleoside" refers to a nucleotide having a hydrogen atom at the 2' position of its sugar moiety.

[0203] The natural bases of RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine).

[0204] The chemical modifications of this invention are well known to those skilled in the art. The modification of the phosphodiester bond refers to the modification of the oxygen in the phosphodiester bond, including thiophosphate modification and boronyl phosphate modification. Both modifications can stabilize the structure of the RNA inhibitor, maintaining high specificity and high affinity of base pairing.

[0205] The ribose modification refers to the modification of the 2'-OH group in the pentose of the nucleotide, that is, the introduction of certain substituents at the hydroxyl position of the ribose, such as 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylidene methoxy modification, 2,4'-dinitrophenol modification, locked nucleic acid (LNA), 2'-amino modification, and 2'-deoxy modification.

[0206] The base modification refers to the modification of the bases of nucleotides, such as 5'-bromouracil modification, 5'-iodouracil modification, N-methyluracil modification, and 2,6-diaminopurine modification.

[0207] In some embodiments, the modification of the ribose includes fluorine substitution and / or methoxy substitution of the 2'-OH.

[0208] In some embodiments, the modification of the ribose further includes modification with UNA, LNA, or GNA.

[0209] The term "LNA" refers to a bicyclic nucleoside analog containing a C2*-C4* bibase (bridge) and is called a "locked nucleic acid". It can refer to an LNA monomer, or, when used in the context of "LNA oligonucleotide", LNA refers to an oligonucleotide containing one or more such bicyclic nucleotide analogs. In some respects, bicyclic nucleoside analogs are LNA nucleotides, and these terms are therefore used interchangeably, and in such embodiments, both are characterized by the presence of a linking group (such as a bridge) between the C2' and C4' of the ribose ring.

[0210] UNA (unlocked nucleic acid) has a structure similar to RNA, but lacks the C2 and C3 chemical bonds of the ribose ring. Its structure is shown below:

[0211] B is a base.

[0212] GNA (glycerol-containing nucleic acid) is a chemical substance similar to DNA or RNA, but with a different composition and does not exist in any currently known living organisms in nature. GNA contains an acyclic, three-carbon propylene glycol (1,2-propanediol) backbone that replaces the (deoxy)ribose sugar of DNA and RNA, forming the simplest structure of chemically stable nucleic acids. The S-(GNA) structure is shown below.

[0213] B is a base.

[0214] In some embodiments, the RNA inhibitor is wherein at least one nucleotide in the RNA inhibitor is a chemically modified nucleotide.

[0215] In some embodiments, the RNA inhibitor is wherein all nucleotides in the RNA inhibitor are chemically modified nucleotides.

[0216] In some embodiments, the RNA inhibitor, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate (VP) modification. Modifications include VP, N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, invAb, and invAB.

[0217] In some embodiments, the 3' or 5' end of the antisense strand is modified with an inverted non-base nucleotide (invAB).

[0218] In some embodiments, the inverted non-base nucleotide (invAB) is attached to the 3' or 5' end of the antisense strand via a phosphate ester or thiophosphate bond.

[0219] In some implementations, the 3' or 5' end of the antisense chain is modified with M06:

[0220] In some embodiments, M06 is linked to the 3' or 5' end of the antisense chain via a phosphate ester or thiophosphate bond.

[0221] In some embodiments, the 3' or 5' end of the positive strand is modified with an inverted non-base nucleotide (invAB).

[0222] In some embodiments, the inverted non-basic nucleotide (invAB) is attached to the 3' or 5' end of the positive strand via a phosphate ester or thiophosphate bond.

[0223] In some implementations, the 3' or 5' end of the justice chain is modified with M06:

[0224] In some implementations, the antisense chain includes one of the following:

[0225] 5'-(InvAB)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:2), where (invAB) is an inverted, non-base nucleotide modification;

[0226] 5'-(M06)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:3), where (M06) is modified by M06.

[0227] In some implementations, RNA inhibitors comprise the following combinations of sense and antisense strands:

[0228] (1) The sense strand 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO:4), the antisense strand 5'-(invAB)CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO:2), where (invAB) is an inverted, baseless nucleotide modification;

[0229] (2) The justice chain 5'-GAAUUCCUGAAUUUUAUGACU-3'(SEQ ID NO:4), the antisense chain 5'-(M06)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:3), where (M06) is modified by M06.

[0230] In some implementations, counting from the 5' end, there is a phosphate thioester link between the first and second nucleotides of the positive strand.

[0231] In some implementations, counting from the 5' end, there is a phosphate thioester link between the second and third nucleotides of the positive strand.

[0232] In some implementations, counting from the 5' end, the nucleotide at position 7 of the positive strand has a 2'-F modification.

[0233] In some implementations, counting from the 5' end, the nucleotide at position 9 of the positive strand has a 2'-F modification.

[0234] In some implementations, counting from the 5' end, the nucleotide at position 10 of the positive strand has a 2'-F modification.

[0235] In some implementations, counting from the 5' end, the nucleotide at position 11 of the positive strand has a 2'-F modification.

[0236] In some implementations, counting from the 5' end, the nucleotides at positions 7, 9, 10, and 11 of the positive strand have a 2'-F modification.

[0237] In some implementations, counting begins from the 5' end, and there is a phosphate thioester link between the fourth and fifth nucleotides of the antisense strand.

[0238] In some implementations, counting begins from the 3' end, and there is a phosphate thioester link between the first and second nucleotides of the antisense strand.

[0239] In some implementations, counting begins from the 3' end, and there is a phosphate thioester link between the second and third nucleotides of the antisense strand.

[0240] In some implementations, counting from the 5' end, the nucleotide at position 1 of the antisense strand has a 2'-F modification.

[0241] In some implementations, counting from the 5' end, the nucleotide at position 2 of the antisense strand is 2'-F modified.

[0242] In some implementations, counting from the 5' end, the nucleotide at the 5th position of the antisense strand has a 2'-F modification.

[0243] In some implementations, counting from the 5' end, the nucleotide at position 17 of the antisense strand has a 2'-F modification.

[0244] In some implementations, counting from the 5' end, the nucleotide at position 19 of the antisense strand has a 2'-F modification.

[0245] In some implementations, counting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand are 2'-F modified.

[0246] In some embodiments, the 3' and / or 5' ends of the sense and / or antisense strands of the RNA inhibitor are modified with phosphate or phosphate mimicry.

[0247] In some embodiments, the phosphate mimics in the RNA inhibitors include 5'-(E)-vinylphosphonate (VP), 5'-methylphosphonate (MP), (S)-5'-C-methyl analogs, and 5'-thiophosphate (5'-PS).

[0248] In some embodiments, in the said RNA inhibitor, the 3'-end and / or 5'-end of the sense strand and / or antisense strand includes (M06):

[0249] In the RNA inhibitors described herein, (M06) is linked to the 5'-end of the antisense strand via a phosphate ester or thiophosphate bond.

[0250] In the RNA inhibitors described herein, the 3'-end and / or 5'-end of the sense strand and / or antisense strand are modified with invAB.

[0251] In the RNA inhibitor, the inverted abase-free nucleotide is linked to the 5' end of the first nucleotide of the antisense strand via a thiophosphate ester.

[0252] RNA inhibitors coupled with ligands

[0253] Another aspect of the RNA inhibitors in this application relates to a method of coupling interfering nucleic acids with ligands to enhance the stability, activity, cellular distribution, or cellular uptake of RNAi agents.

[0254] In some implementations, the distribution, targeting, or stability of RNA inhibitors is altered by introducing ligands for target tissue receptors. For example, specific ligands can provide enhanced affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cell or organ compartments, body tissues, organs, or regions)) compared to species where ligands are absent.

[0255] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, styrax, chitosan, chitin, inulin, cyclodextrin, N-acetylglucosamine, N-acetylglucosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, like synthetic polyamino acids.

[0256] The ligand may also include a targeting group, such as a cell or tissue target that binds to a specific cell type, such as kidney cells, for example, a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphate, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimics. In some embodiments, the ligand is a polygalactose, such as N-acetyl-galactosamine.

[0257] The sense and antisense strands contained in the RNA inhibitor of this application can be conveniently and routinely prepared using well-known solid-phase synthesis techniques. Other methods known in the art for such synthesis, such as liquid-phase synthesis or fermentation, can be used alternatively or as an alternative. The preparation of other oligonucleotides (such as phosphate thioides and alkylated derivatives) using similar techniques is also known.

[0258] In some embodiments, in addition to commercially available and standard nucleoside phosphoramide monomers and non-standard nucleoside phosphoramide monomers commonly used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of this application can be synthesized by an automated synthesizer using the phosphoramide method derived from the ligand-nucleoside phosphoramide monomer.

[0259] In some embodiments, the ligand conjugation of the present invention is coupled to the 5' end and / or 3' end of the antisense chain, and / or the 5' end and / or 3' end of the sense chain via a ligand structure.

[0260] For example, the ligand structure may be coupled to the 5' end and / or the 3' end of the sense strand; or the ligand structure may be coupled to the 5' end of the antisense strand and the ligand structure may be coupled to the 3' end of the sense strand; or the ligand structure may be coupled to the 3' end of the antisense strand and the ligand may be coupled to the 5' end of the sense strand; or the ligand structure may be coupled to both the 5' end and the 3' end of the sense strand; or the ligand structure may be coupled to the 3' end of the sense strand.

[0261] In some implementations, the RNA inhibitor comprises a combination of the sense and antisense strands:

[0262] (1) Chain of Justice: g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7),

[0263] Antonym chain: (invAB)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:5);

[0264] (2) Chain of Justice: g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7),

[0265] Antonym chain: (M06)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:6);

[0266] in,

[0267] The lowercase letters a, u, c, g indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G) is methylated by 2'-O-methylation.

[0268] (2'-OMe) modified nucleotides, invAB modification refers to the attachment of an inverted baseless deoxynucleotide at the 5' or 3' end of the nucleotide, Af, Uf, Cf, Gf represent nucleotides whose corresponding uppercase letters (A, U, C, G) are modified by 2'-deoxy-2'-fluoro(2'-F). The structure of M06 is shown below: (M06):

[0269] * indicates a link via thiophosphate.

[0270] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the fusion protein, preparation method and use of this application, and are not intended to limit the scope of the invention.

[0271] Pharmaceutical Composition

[0272] This application also includes pharmaceutical compositions comprising the RNA inhibitor of this application or a pharmaceutically acceptable salt thereof.

[0273] In one embodiment, this document provides a pharmaceutical composition comprising the RNA inhibitor described herein and a pharmaceutically acceptable pharmaceutical excipient.

[0274] Pharmaceutical compositions containing RNA inhibitors can be used to prevent and / or treat CFB-related disorders, such as thyroid eye disease. These pharmaceutical compositions are formulated according to a delivery mode. One example formulation is a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of this application can be administered at doses sufficient to inhibit CFB gene expression.

[0275] Pharmaceutically acceptable "excipients" or "components" are pharmaceutically acceptable solvents, suspending agents, or any other pharmaceutically inert media for delivering one or more nucleic acids to animals. Excipients may be liquids or solids and are selected with consideration for the planned administration method to provide the required volume, consistency, etc., when combined with the nucleic acid and other components in a given pharmaceutical composition. RNA inhibitors may be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0276] In some embodiments, the pharmaceutical composition further comprises a delivery medium (such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems).

[0277] In some embodiments, the delivery medium includes liposomes.

[0278] In some embodiments, the delivery medium includes nanolipids capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0279] use

[0280] On the other hand, this application provides the use of the aforementioned RNA inhibitor that inhibits CFB gene expression or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition thereof, wherein the pharmaceutical composition is used to prevent or treat a disease or pathology or to reduce the risk of a disease or pathology.

[0281] In some embodiments, the disease or pathology includes diseases or pathologies associated with normal or elevated CFB levels.

[0282] In some implementations, the disease or pathology includes thyroid ophthalmopathy.

[0283] On the other hand, this application provides a method for preventing or treating a disease, symptom, or syndrome, the method comprising administering to a subject in need an effective amount of an RNA inhibitor comprising the aforementioned inhibitory CFB gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0284] In some embodiments, the RNA inhibitor that inhibits CFB gene expression, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

[0285] On the other hand, this application provides a method for inhibiting the expression of CFB mRNA or protein in cells, tissues or subjects, comprising administering to a subject in need an effective amount of an RNA inhibitor containing the aforementioned inhibitory CFB gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0286] Cells suitable for treatment using the method of this application can be any cells expressing the CFB gene. Cells suitable for use with the method of this application can be mammalian cells that, when contacted with cells expressing the CFB gene, inhibit the expression of the CFB gene (e.g., human, primate, non-primate, or rat CFB gene) by at least about 50%, for example by PCR or branched DNA (bDNA) based methods, or by protein-based methods such as immunofluorescence assay, Western blotting, or flow cytometry.

[0287] The term “inhibition” as used herein may be used interchangeably with “reduction,” “lowering,” “silencing,” “downregulation,” “suppression,” and other similar terms, and includes any level of inhibition. CFB gene expression can be assessed based on the level or change in the level of any variable associated with CFB gene expression, such as CFB mRNA or CFB protein levels. This level can be analyzed in a single cell or cell population (including, for example, samples derived from a subject). Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with CFB expression compared to a control level. A control level can be any type of control level used in the art, such as baseline levels before administration or levels measured in similar subjects, cells, or samples that have never been treated or have received a control (e.g., a buffer-only control or an active agent-free control).

[0288] Inhibition of CFB gene expression can be manifested by the reduction in the amount of mRNA expressed in a first cell or cell population (such cells may be present, for example, in a sample derived from a subject) where the CFB gene has been transcribed and treated (e.g., by contacting one or more cells with the RNA inhibitor of this application, or by administering the RNA inhibitor of this application to a subject in which the cells are present) that inhibits CFB gene expression, compared to a second cell or cell population that is substantially the same as the first cell or cell population but not so treated (control cells not treated with the RNA inhibitor or not treated with an RNA inhibitor targeting the target gene). In a preferred embodiment, inhibition is evaluated in a cell line that highly expresses CFB using an appropriate concentration of siRNA as provided in the examples, and the mRNA level in the intervened cells is expressed as a percentage of the mRNA level in the uninterrupted control cells.

[0289] In other embodiments, inhibition of CFB gene expression can be evaluated by a decrease in a parameter functionally associated with CFB gene expression, such as the level of CFB protein in the subject's blood or serum. CFB gene silencing can be performed in any CFB-expressing cells (endogenous or exogenous from the expression construct) and by any analytical method known in the art.

[0290] Inhibition of CFB protein expression can be represented by a decrease in the level of CFB protein expressed in cells or cell populations or in subject samples (e.g., protein levels in blood samples derived from the subject). As described above, for the evaluation of mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can similarly be expressed as a percentage of protein levels in control cells or cell populations, or a change in protein levels in subject samples (e.g., blood or serum derived from it).

[0291] Control cells, cell populations, or subject samples that can be used to evaluate CFB gene inhibition include cells, cell populations, or subject samples that have not been exposed to the RNAi agent of this application. For example, control cells, cell populations, or subject samples may be derived from a single subject (e.g., a human or animal subject) prior to treatment with the RNAi agent or from an appropriately matched population of controls.

[0292] The level of CFB mRNA expressed in cells or cell populations can be determined using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated using any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as tissue material to monitor decreased CFB gene or protein expression. In other embodiments, a blood sample is used as a subject sample to monitor decreased CFB protein expression.

[0293] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the fusion protein, preparation method and use of this application, and are not intended to limit the scope of the invention.

[0294] On the one hand, this application provides the use of the aforementioned RNA inhibitor and the aforementioned pharmaceutical composition in the preparation of a drug, the drug being used to prevent or treat a disease or pathology or to reduce the risk of a disease or symptom.

[0295] In some implementations, the disease or pathology includes diseases or symptoms associated with elevated levels of complement factor B (CFB).

[0296] In some implementations, the disease or pathology includes autoimmune diseases and inflammatory diseases.

[0297] In some embodiments, the disease or pathology includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

[0298] On the one hand, this application provides a method for preventing or treating diseases or symptoms using the aforementioned RNA inhibitor and the aforementioned pharmaceutical composition, the method comprising administering the aforementioned RNA inhibitor and the aforementioned pharmaceutical composition to a subject in need of such treatment.

[0299] In some embodiments, the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

[0300] On the one hand, this application provides a method for inhibiting the expression of complement factor B (CFB) in cells, tissues or subjects, comprising administering an effective amount of the aforementioned RNA inhibitor and the aforementioned pharmaceutical composition to the cells, tissues or subjects.

[0301] In some embodiments, the disease or pathology includes diseases or symptoms associated with elevated levels of complement factor B (CFB).

[0302] In some embodiments, the disease or pathology includes autoimmune diseases and inflammatory diseases.

[0303] In some embodiments, the disease or pathology includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

[0304] Example

[0305] Example 1: Synthesis of siRNA molecules

[0306] Oligonucleotides were synthesized using a phosphoramidite solid-phase synthesis technique. Synthesis was performed on a general-purpose controlled porous glass CPG. All 2'-modified RNA phosphoramidite and auxiliary reagents were commercially available. All phosphoramidite was dissolved in anhydrous acetonitrile and added to a molecular sieve, with coupling time of 1.0 min using 5-ethylthio-1H-tetrazole (ETT) as an activator. Phosphothiophosphate bonds were generated using a 50 mM solution of 3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazol-3-thione (DDTT) in anhydrous acetonitrile / pyridine (v / v = 1 / 1) for 1.8 min. All sequences were synthesized after the final removal of the DMT group.

[0307] Cleavage and deprotection of oligomers bound to CPG: After termination of solid-phase synthesis, the protecting group was removed by treatment with an acetonitrile solution containing 20% ​​diethylamine for 30 minutes without cleaving the oligonucleotide from the CPG. Subsequently, the dried CPG was treated with concentrated ammonia at 40°C for 18 hours. After centrifugation, the supernatant was transferred to a new tube and the CPG was washed with ammonia. The combined solutions were concentrated to obtain a solid mixture.

[0308] Purification of single-stranded oligonucleotides: Oligomers were purified by HPLC using NanoQ anion exchange. Buffer A consisted of 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% acetonitrile; buffer B consisted of 500 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% acetonitrile. The target product was isolated and desalted using a reverse-phase C18 column.

[0309] Annealing of single-stranded oligonucleotides to produce siRNA: Prepare a 200 μM solution of the single-stranded oligonucleotides to be annealed using sterile RNase-free H2O. Set up the annealing reaction system as follows: Place 100 μL of the mixture (10 nmol) in a 95°C water bath for 10 minutes (for amounts ≥100 nmol, a 20-minute high-temperature treatment is required) → immediately place in a 60°C water bath and allow to cool naturally → the annealed solution should not be stored at high temperatures. Combine equimolar amounts of the single-stranded oligonucleotide solution to form complementary strands.

[0310] The resulting siRNAs are shown in Tables 1-1, 1-2, 1-3, and 1-4 below. Lowercase letters a, u, c, and g indicate that the nucleotides represented by their corresponding uppercase letters (A, U, C, G) are modified with 2'-O-methyl (2'-OMe). invAB modification refers to the attachment of an inverted, base-free deoxynucleotide at the 5' or 3' end of the nucleotide. Af, Uf, Cf, and Gf indicate that the nucleotides represented by their corresponding uppercase letters (A, U, C, G) are modified with 2'-deoxy-2'-fluoro (2'-F). M represents M06, and the structure of M06 is shown below: (M06): * indicates a link via thiophosphate.

[0311] Table 1-1 RNA Inhibitors

[0312] Table 1-2 Modified double-stranded ribonucleic acid

[0313] Table 1-3 Unmodified double-stranded RNA

[0314] Table 1-4 Double-stranded RNAs modified with only blocking groups

[0315] Example 2: Evaluation of the in vitro inhibitory activity of siRNA compounds against the target gene CFB

[0316] 1. Research Objectives

[0317] The aim of this study was to evaluate the in vitro inhibitory activity of siRNA compounds against the target gene CFB.

[0318] 2. Materials and Methods

[0319] 2.1 Materials

[0320] 2.1.1 Test Compound

[0321] Test compound: Prepared as a 20 μM stock solution using PBS.

[0322] 2.1.2 Cell lines

[0323] Huh7 cells were cultured in DMEM medium (Gibco catalog number 11965-092) containing 10% fetal bovine serum (FBS, ExCell Bio catalog number FSP500), 1% glutamine (GlutaMAX, Gibco catalog number 35050061), 1% NEAA (gibco catalog number 11140050), and 1% penicillin-streptomycin (HyClone catalog number SV30010).

[0324] 2.1.3 Main Instruments

[0325] The main instruments used in this experiment included a fluorescence qPCR instrument (Quanstudio 7flex), a centrifuge (Beckman Allegra-X15R Centrifuge), and a cell counter (Countstar Rigel2).

[0326] 2.1.4 Main Reagents and Consumables

[0327] The main reagents used in this experiment included Lipofectamine. TMiRNAiMAX transfection reagent (INVITROGEN, catalog number 13778150), Faststart Universal SYBR Green Master (ROCHE catalog number 4913914001), RNA extraction kit (Qiagen, catalog number 74182), FastKing cDNA first-strand synthesis kit (TianGen, catalog number KR116-02), 96-well plates (Costar 3599). qPCR-specific primers for GAPDH and CFB were synthesized by Shanghai Sangon Biotech.

[0328] 3. Experimental Methods

[0329] 3.1 Compound transfection plate

[0330] Inoculate with Huh7 cells (2×10⁻⁶) 4 Cells were plated into 96-well cell culture plates, and siRNA was transfected into the cells using RNAiMAX. Two concentration points (10 nM, 0.5 nM) or eight concentration points were set for siRNA assay to calculate IC50. Cells were incubated overnight at 37°C in a 5% CO2 incubator, and assays were performed in duplicate. A control group containing RNAiMAX and without the compound was also included.

[0331] 3.2 RNA extraction and reverse transcription

[0332] 24 hours after transfection, remove the culture medium and collect the cells for RNA extraction. Use according to the kit instructions. Total RNA was extracted using a 96-kit (QIAGEN-74182). cDNA was synthesized using the FastKing RT Kit (With gDNase) (Tiangen-KR116-02) according to the manufacturer's instructions.

[0333] 3.3 qPCR detection of target gene mRNA expression levels

[0334] The target cDNA will be detected using SYBR Green qPCR, while GAPDH cDNA will be detected as an internal control in parallel. 8 μL of the prepared PCR reaction solution and 2 μL of sample cDNA will be added to each of 384 wells. The qPCR program is as follows: heat at 50°C for 2 min, heat at 90°C for 10 min, then cycle at 95°C for 15 sec, followed by 60°C for 1 min, for a total of 40 cycles.

[0335] Table 2. qPCR reaction system

[0336] 4. Data Analysis

[0337] The expression level of the target gene mRNA in each sample was calculated using the ΔΔCt relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCT.

[0338] The calculation formula is as follows:

[0339] ΔCT = Average Ct value of target gene - Average Ct value of internal reference gene

[0340] ΔΔCT = ΔCT (drug-treated group) - ΔCT (RNAiMAX control group)

[0341] Relative expression level of target gene CFB = 2 - ΔΔCT

[0342] CFB inhibition rate % = (1 - value of sample / Ave. value of RNAiMAX Control) * 100

[0343] The GraphPad Prism software was used for graphical analysis, and the inhibition rate results are expressed as mean ± SD.

[0344] Experimental results: see Table 3.

[0345] Table 3. IC50 of double-stranded RNA conjugate against target gene CFB mRNA in huh7 cells.

[0346] Conclusion: Both ds289 and ds322 demonstrated excellent inhibitory effects on CFB protein expression in cells, with ds322, whose antisense strand has the sequence shown in SED ID NO:1, exhibiting stronger inhibitory activity.

[0347] Example 3: Activity assay of the compound against the target gene CFB in primary human hepatocytes (PHH)

[0348] 1. Research Objectives

[0349] This study used human primary hepatocytes (PHH) to evaluate the in vitro inhibitory activity of the tested compounds on the target gene CFB mRNA through free uptake.

[0350] 2. Materials and Methods

[0351] 2.1. Test Compound

[0352] Test compound: Prepared as a 100 μM / 200 μM stock solution using PBS.

[0353] 2.2. Cells

[0354] Primary human hepatocytes (PHH) (lot number: JMJ) were provided by Shanghai WuXi AppTec Co., Ltd. PHH cells were revived and cultured in InvitroGRO CP medium (BIOIVT S0331) containing 10% fetal bovine serum (FBS, Gibco catalog number 10091148) and 1% penicillin-streptomycin (PS, HyClone catalog number SV30010).

[0355] 2.3. Main Instruments

[0356] The main instruments used in this experiment included a fluorescence qPCR instrument (Quanstudio 7flex), a centrifuge (Beckman Allegra-X15R Centrifuge), and a cell counter (Countstar Rigel2).

[0357] 2.4. Main Reagents and Consumables

[0358] The main reagents used in this experiment included Faststart Universal SYBR Green Master (ROCHE catalog number 4913914001), RNA extraction kit (Qiagen catalog number 74182), HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme catalog number R323-01), 96-well plate (Costar catalog number 3599), and qPCR-specific primers for GAPDH and CFB were synthesized by Shanghai Sangon Biotech.

[0359] 2.5. Experimental Methods

[0360] 2.5.1 Compound Free Uptake Plating

[0361] Inoculation with PHH (5.4×10) 4 Cells (per well) were plated into 96-well cell culture plates. Simultaneously, siRNA was added to the cells, allowing the compound to enter the cells via free uptake. For siRNA assays, three concentration points (10 nM, 1 nM, 0.1 nM) or eight concentration points were set for IC50 calculation. 50 Triple replicates were performed, with a control group containing PBS and no compound. The samples were then incubated at 37°C in a 5% CO2 incubator.

[0362] 2.5.2 RNA extraction and reverse transcription

[0363] After 48 hours, remove the culture medium and collect the cells for RNA extraction. Use according to the kit instructions. Total RNA was extracted using a 96-kit (QIAGEN-74182). cDNA was synthesized using a HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme catalog number R323-01) according to the manufacturer's instructions.

[0364] 2.5.3 qPCR detection of target gene mRNA expression levels

[0365] The target cDNA will be detected by qPCR, and the internal reference gene GAPDH cDNA will also be detected. 8 μL of the prepared PCR reaction solution and 2 μL of sample cDNA will be added to each of 384 wells. The qPCR program is as follows: heat at 50°C for 2 min, heat at 95°C for 10 min, then enter cycling mode, heat at 95°C for 15 sec, then at 60°C for 1 min, for a total of 40 cycles, and finally heat at 60°C for 1 min and at 95°C for 15 sec.

[0366] Table 4. qPCR reaction system

[0367] 3. Data Analysis

[0368] The expression level of the target gene mRNA in each sample was calculated using the ΔΔCt relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCT.

[0369] The calculation formula is as follows:

[0370] ΔCT = Average Ct value of target gene - Average Ct value of internal reference gene

[0371] ΔΔCT = ΔCT (drug-treated group) - ΔCT (RNAiMAX control group)

[0372] Relative expression level of target gene CFB = 2 - ΔΔCT

[0373] CFB inhibition rate % = (1 - value of sample / Ave. value of RNAiMAX Control) * 100

[0374] The GraphPad Prism software was used for graphical analysis, and the inhibition rate results are expressed as mean ± SD.

[0375] Experimental results: see Table 5.

[0376] Table 5. IC50 of double-stranded RNA conjugate against target gene CFB mRNA in primary human hepatocytes.

[0377] Conclusion: The tested samples ds289, ds322 and ds336 all demonstrated excellent inhibitory effects on CFB protein expression in cells. Among them, the tested samples ds322 and ds336, whose antisense strands have the sequence shown in SED ID NO:1, have stronger inhibitory activity.

[0378] ds322 and ds336 exhibited ideal activity in human hepatocytes, and it is foreseeable that they will also have good dose-related inhibition of plasma CFB protein in humans, achieving potent target inhibition in humans.

[0379] Example 4: Test of the inhibitory activity of the compound against the target gene CFB in human tail artery injection (HDI) mice

[0380] 1. Experimental Objective

[0381] This experiment used a mouse model of high-pressure tail vein injection of hCFB plasmid to evaluate the in vivo activity of the test compound.

[0382] 2. Materials and Methods

[0383] 2.1 Animals

[0384] BALB / c mice, female, 6-7 weeks old, were purchased from Shanghai Lingchang Biotechnology Co., Ltd., and housed in individually ventilated cages. The care and use of the mice followed the experimental protocol approved by WuXi AppTec IACUC (IACUC#:ID01-020-2022v1.0). Mice underwent a 6-day acclimatization period before the start of the experiment.

[0385] 2.2 CFB plasmid DNA

[0386] The pcDNA-CFB plasmid, provided by Shanghai WuXi AppTec Co., Ltd., with batch number 80-745026323-R3 / PA21797-4 N1024958 and a concentration of 4.3 μg / μL, was diluted with normal physiological saline for later use.

[0387] 2.3 Reagents and Consumables

[0388] The main reagents and consumables are listed in the table below.

[0389] Table 6 Main Reagents and Consumables

[0390] 2.4 Experimental Methods

[0391] 2.4.1 In vivo experimental design

[0392] CFB plasmid DNA was administered via tail vein high-pressure injection, followed by a single subcutaneous injection on day 0. The liver was collected 24 hours after plasmid injection, and the knockdown of the target gene was detected by RT-qPCR.

[0393] 2.4.2 Compound Treatment: Day 0 of the experiment was defined as the day the mice were administered the compound, Day -1 was the day before, and Day 1 was the day after, and so on. On Day 0, mice were subcutaneously injected with the solvent or the test compound at a volume of 5 mL / kg. Detailed information is shown in Table 4.

[0394] 2.4.3 High-pressure injection of CFB plasmid DNA solution into the tail vein of mice: On day 14, the plasmid DNA was prepared in advance with physiological saline and stored at 4°C until use. All mice were injected via the tail vein with 8% of their body weight of plasmid DNA solution within 5 seconds (injection volume (mL) = mouse body weight (g) × 8%), and the mass of the plasmid injected into each mouse was 10 μg.

[0395] 2.4.4 Experimental endpoint and liver sample collection: On day 15, 24 hours after high-pressure tail vein injection of CFB plasmid, all mice were euthanized by CO2 inhalation. Blood was collected from the heart after euthanasia, and liver samples were collected. Two liver tissue samples, approximately 70 mg each, were immersed in CO2. After incubating overnight at 4°C, the supernatant was discarded and transferred to a -80°C freezer for mRNA detection.

[0396] 2.5 Sample Analysis

[0397] 2.5.1 Quantitative PCR detection of CFB gene expression in mouse liver

[0398] RNA was extracted from the liver using Trizol. The method is briefly described below: 50-70 mg of liver tissue and 1.2 mL of Trizol were homogenized with Qiagen Tissue Lyser II at 26 Hz for 2 min; lysis was performed at room temperature for 5 min; 1 mL of supernatant was collected, 200 μL of chloroform was added, and the mixture was vigorously shaken for 15 s. After standing for 3 min, the supernatant was centrifuged and collected; an equal volume of isopropanol was added, and the mixture was incubated overnight at -20°C to precipitate the RNA; the sample was washed twice with 70% ethanol and dissolved in RNase-free water. The RNA concentration was determined using Nanodrop ONE, and the sample was diluted to 400 ng / μL with RNase-free water for reverse transcription.

[0399] The reverse transcription procedure was performed according to the FastKing cDNA First-Strand Synthesis Kit (Genomic Removal) instructions. A brief description is as follows: Prepare the gDNA removal mixture according to the table below. Add the mixture (5 μL / sample) and 400 ng / μL RNA sample to a 96-well PCR plate and incubate at 42°C for 3 min, then cool on ice. Prepare the reverse transcription mixture according to the table below. Add the reverse transcription mixture (10 μL / sample) and the DNA removal product from the previous step to a 96-well PCR plate for reverse transcription. Reaction conditions: 42°C, 15 min; 95°C, 3 min. Store the cDNA at 4°C for further analysis.

[0400] Table 7 gDNA Removal Reaction Components

[0401] Table 8 RT-PCR Reaction Components

[0402] The method for quantitative PCR detection of CFB and NEO gene expression levels in mouse liver is briefly described below: As shown in the table below, prepare the qPCR reaction mixture, add 2 μL of cDNA sample diluted 4-fold with RNase-free water, and perform the PCR reaction. Reaction conditions: 95℃, 10 min; 95℃, 15 s, 60℃, 1 min, 40 cycles.

[0403] Table 9. qPCR Reaction Components (CFB)

[0404] Table 10 qPCR Reaction Components (NEO)

[0405] 3. Data analysis.

[0406] Data are expressed as mean ± standard error for each group of mouse samples, unless otherwise specified, n = 4 or 5. Statistical analysis was performed using Student's t-test.

[0407] The expression of the target gene in each sample was analyzed using the ΔΔCt method, a relative quantification method. This method measures the Ct difference (ΔCt) between the target gene (CFB) and the internal reference gene (Neo), and compares the ΔCt values ​​of the compound-treated samples with those of the control group.

[0408] The formula is:

[0409] ΔCt = Average Ct of the target gene - Average Ct of the reference gene.

[0410] ΔCt = ΔCt of the sample after compound treatment – ​​average ΔCt of the control group.

[0411] Gene expression level = 2 - ΔΔCT

[0412] Table 11 Results of the inhibitory activity test of the compound against the target gene CFB 15 days after administration.

[0413] Conclusion: The test sample ds322 still showed excellent inhibitory effect on CFB protein expression in vivo 15 days after administration.

[0414] Example 5: Determination of CFB protein expression level in eluted cynomolgus monkey serum (Part 1)

[0415] Experimental methods:

[0416] The in vivo experimental design for subcutaneous injection of the test compound into eluted monkeys and the sample collection method is shown in the table below.

[0417] Compound treatment: Day 0 of the experiment was defined as the day the monkeys were eluted for drug administration, Day -1 was defined as the day before, and Day 1 was defined as the day after, and so on. On Day -2, monkeys were subcutaneously injected with the solvent or test compound at a volume of 0.5 mL / kg.

[0418] Animals need to be fasted for 12-16 hours before sampling. Serum samples are collected on Day-2, Day-7, Day-14, Day-21, Day-28, Day-35, Day-42, Day-49, Day-56, and Day-63.

[0419] Table 12 In vivo experimental design

[0420] Protein detection of CFB protein expression levels in monkey serum:

[0421] The human CFB ELISA kit was from Abcam (catalog number: ab137973). All experiments were performed strictly in accordance with the ELISA kit guidelines.

[0422] Experimental apparatus:

[0423] -80℃ refrigerator, metal bath, pipette, electric pipette, pipette tube

[0424] Experimental results: See Figure 1

[0425] Conclusion: The test samples ds322 and ds336 significantly inhibited CFB protein expression in vivo, and their inhibitory effect did not decay after 63 days, indicating that they have excellent long-term effects.

[0426] Example 6: Determination of CFB protein expression level in eluted cynomolgus monkey serum (Part 2)

[0427] Experimental methods:

[0428] The in vivo experimental design for subcutaneous injection of eluted monkeys, including drug administration and sample collection methods, is shown in the table below.

[0429] Compound treatment: Day 0 of the experiment was defined as the day the monkeys were eluted for drug administration, the day before that was Day -1, the day after that was Day 1, and so on. On Day 0, monkeys were subcutaneously injected with the solvent or test compound at a volume of 0.5 mL / kg.

[0430] Serum samples were collected on Day 0, Day 14, Day 28, Day 42, Day 56, Day 70, Day 84, and Day 98.

[0431] Table 13 In vivo experimental design

[0432] Protein detection of CFB protein expression levels in monkey serum:

[0433] The human CFB ELISA kit was from Abcam (catalog number: ab137973). All experiments were performed strictly in accordance with the ELISA kit guidelines.

[0434] Experimental apparatus:

[0435] -80℃ refrigerator, metal bath, pipette, electric pipette, pipette tube

[0436] Experimental results: See Figure 2

[0437] Conclusion: Both ds308 ​​and ds322 significantly inhibited CFB protein expression in vivo. Among them, the inhibitory effect of ds322, whose antisense strand has the sequence shown in SED ID NO:1, did not show significant decay after 98 days, indicating that it has excellent long-term effect.

[0438] Example 7: HDI mouse liver CFB mRNA level test

[0439] Compound handling: Day 0 of the experiment was defined as the day the mice were administered the compound, Day -1 was the day before, and Day 1 was the day after, and so on. On Day 0, mice were subcutaneously injected with the solvent or test compound at a volume of 5 mL / kg. To ensure sufficient animals were successfully injected on the day of HDI, two extra spare mice were provided for the test compound group, except for the PBS group. Spare mice that were not used on the day of HDI, or mice that failed to be injected on the day of HDI, were euthanized without endpoint sampling.

[0440] High-pressure injection of hCFB plasmid DNA solution into the tail vein of mice: On day 14, the plasmid DNA was prepared in advance with physiological saline and stored at 4°C until use. All mice were injected via the tail vein with 8% of their body weight of plasmid DNA solution within 5 seconds (injection volume (mL) = mouse body weight (g) × 8%), and the mass of the plasmid injected into each mouse was 10 μg.

[0441] Experimental endpoint and liver sample collection: On day 15, 24 hours after hyperbaric tail vein injection of hCFB plasmid, all mice were euthanized by CO2 inhalation. Blood was collected from the heart after euthanasia, and liver samples were collected. Two liver tissue samples, approximately 70 mg each, were immersed in CO2. After incubating overnight at 4°C, the supernatant was discarded and transferred to a -80°C freezer for mRNA detection.

[0442] Table 14 In vivo experimental design

[0443] Quantitative PCR detection of hCFB gene expression in mouse liver

[0444] Using the KingFisher Apex and MagMAX nucleic acid extraction instruments TM mirVana TM RNA was extracted from the liver using the Total RNA Isolation Kit. The method is briefly described below: Approximately 70 mg of liver tissue and 1.2 mL of Lysis Binding Mix (0.7 μL DTT added per 100 μL Lysis Buffer) were homogenized in Qiagen Tissue Lyser II at 26 Hz for 2 minutes. 100 μL of homogenate was transferred to a 96-well plate. 100 μL of isopropanol was added to each well and the mixture was vortexed for 2 minutes. 20 μL of Binding Beads Mix (an equal volume of RNA Binding Beads and Lysis / Binding Enhancer) was added to each well and the mixture was vortexed for 5 minutes. A magnetic wand was placed on the plate. A 96-well plate was prepared according to Table 7 below. The plate was placed in the nucleic acid extractor, and the program was run according to the prompts. After the program, the RNA concentration was measured using Nanodrop ONE, and the sample was diluted to 200 ng / μL with RNase-free water for reverse transcription.

[0445] The method for quantitative PCR detection of CFB and NEO gene expression levels in mouse liver is briefly described below: As shown in the table below, prepare the qPCR reaction mixture, add 2 μL of cDNA sample diluted 4-fold with RNase-free water, and perform the PCR reaction. Reaction conditions: 95℃, 10 min; 95℃, 15 s, 60℃, 1 min, 40 cycles.

[0446] qPCR reaction component table (CFB)

[0447] qPCR reaction composition table (NEO)

[0448] Experimental results: See Figure 3.

[0449] Conclusion: Both ds289 and ds322 showed significant inhibitory effects on human CFB protein expression in vivo, with ds322, whose antisense strand has the sequence shown in SED ID NO:1, exhibiting stronger inhibitory activity.

[0450] Example 8: Pharmacodynamic experiment of the compound in vivo by subcutaneous injection in male eluted cynomolgus monkeys.

[0451] Table 15 Experimental Design - Group Design

[0452] Table 16 Experimental Design - Dosing Methods for Different Groups

[0453] Administration:

[0454] The drug was administered subcutaneously, using PBS (pH 7.4, 1×) as the solvent.

[0455] Experiment 1: Test of the inhibitory activity of the compound on CFB mRNA in the liver of cynomolgus monkeys

[0456] Reagents and instruments:

[0457] Table 17 Information on Main Reagents and Consumables

[0458] Main instruments: tissue homogenizer, centrifuge, spectrophotometer, gel imaging system, PCR instrument, qPCR instrument

[0459] Experimental methods:

[0460] Trizol was added to liver tissue and homogenized using a tissue homogenizer (Qiagen, Tissue Lyser II). The homogenate was then further purified with chloroform. The aqueous phase was collected, and RNA was precipitated with isopropanol, dissolved in RNase-free water, and the RNA concentration was determined using Nanodrop ONE. The RNA was then diluted to 200 ng / μL. (Refer to...) III. Use the RT SuperMix for qPCR (+gDNA wiper) instructions to reverse transcribe and synthesize cDNA. Prepare the PCR reaction mixture according to the table below and add it to a 384-well plate. Run the qPCR program: 95℃, 10 min; 95℃, 15 sec, 60℃, 1 min, 40 cycles.

[0461] Table 18: qPCR reaction system (CFB)

[0462] Table 19: qPCR reaction system (GAPDH)

[0463] Data Analysis:

[0464] Exploit 2 -ΔΔCt The method calculates the relative expression level of the target gene.

[0465] Where ΔCt=Ct目的基因 -Ct 内参基因 ΔCt=ΔCt 各组注射后样本 –ΔCt is the average value of each group 24 hours before injection.

[0466] CFB mRNA gene relative expression level = 2 -ΔΔCt

[0467] The calculation method / formula for the percentage decrease in CFB mRNA at each time point in each group is as follows:

[0468] The average relative expression level of CFB mRNA gene in each group was 1 24 hours before injection (day -1).

[0469] The percentage decrease in CFB mRNA at each time point in each group = (average relative expression level of CFB mRNA after injection – average relative expression level of CFB mRNA 24 hours before injection) × 100%.

[0470] Data are expressed as mean ± standard error for each group of cynomolgus monkey samples, n = 6. Statistical analysis was performed using Excel and Graphpad software, Student's-test. p < 0.05 was considered statistically significant.

[0471] Results: See Figure 4. On day 0, cynomolgus monkeys were subcutaneously injected with the test substance at doses of 0, 0.5, 1, 3, 5, and 10 mg / kg. Liver biopsy samples were collected monthly on days -1, 29, 57, 85, 113, and 143 for analysis of hepatic CFB mRNA levels. Following a single subcutaneous administration, the test substance demonstrated a long-lasting and effective knockdown of hepatic CFB mRNA, with dose-dependent pharmacodynamic responses observed at 0.5 mg / kg and higher doses (1, 3, 5, and 10 mg / kg) to CFB mRNA levels (p < 0.05).

[0472] Conclusion: A single subcutaneous injection of the test compound (0.5 mg / kg, 1 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg) significantly reduced hepatic CFB mRNA levels in cynomolgus monkeys from day 29 to 169 post-administration, exhibiting a dose-dependent effect. The 0.5 mg / kg group showed a slight reduction on day 197, while the other dose groups (1 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg) continued to significantly reduce hepatic CFB mRNA levels on day 197. All animals tolerated the compound well during the experiment, with no obvious abnormalities observed. The compound can effectively and persistently silence hepatic CFB mRNA in cynomolgus monkeys, demonstrating significant therapeutic potential for alternative complement-related autoimmune diseases.

[0473] Experiment 2: Long-term inhibitory test of the compound on the expression of the target protein CFB in cynomolgus monkey serum

[0474] Reagents and consumables:

[0475] Human CFB ELISA kit (Abcam ab137973), sterile water for injection, cell culture plates (Costar 3799) Main instruments:

[0476] Microplate reader (TECAN, Spark), constant temperature metal bath (Shanghai Sangshai, DH300), microplate constant temperature shaker (BE-9008) Experimental method:

[0477] Serum was collected according to experimental requirements and stored at -80°C. The sample was equilibrated to room temperature before the experiment. The procedure was followed according to the kit instructions. Absorbance was read at 450nm and 570nm using a microplate reader. A standard curve was set up for each plate for concentration regression calculations.

[0478] Data Analysis:

[0479] Data analysis was performed using the Graphpad four-parameter function, and the sample concentration was calculated based on the OD value of the standard.

[0480] Inhibition rate = (1 - relative expression level of sample / average relative expression level of control group) × 100%

[0481] The calculation method / formula for the percentage decrease in CFB protein at each time point in each group is as follows:

[0482] The average relative expression level of CFB protein in each group was 1 in the 24 hours before injection (day -1).

[0483] The percentage decrease in CFB protein at each time point in each group = (average relative expression level of CFB protein after injection – average relative expression level of CFB protein 24 hours before injection) × 100%.

[0484] Data are expressed as mean ± standard error for each group of cynomolgus monkey samples, n = 6. Statistical analysis was performed using Excel and Graphpad software, Student's-test. p < 0.05 was considered statistically significant.

[0485] Results: See Figure 5. On day 0, cynomolgus monkeys were subcutaneously injected with the test substance at doses of 0, 0.5, 1, 3, 5, and 10 mg / kg. Serum samples were collected weekly to analyze the effect of the test substance on serum CFB protein. Following a single subcutaneous administration, the test substance showed a long-lasting and effective reduction in serum CFB protein expression. At doses of 0.5 mg / kg and higher (1, 3, 5, and 10 mg / kg), a dose-dependent pharmacodynamic response to CFB protein levels was observed (p < 0.05).

[0486] Conclusion: Compared with 24 hours prior to injection, the test compounds (0.5 mg / kg, 1 mg / kg, 3 mg / kg, 5 mg / kg, and 10 mg / kg) significantly reduced serum CFB protein levels in cynomolgus monkeys in a dose-dependent manner. All animals tolerated the test compounds well during the experiment, with no obvious abnormalities observed. The test compounds effectively and persistently inhibited CFB protein expression in cynomolgus monkey serum, demonstrating significant therapeutic potential for CFB-related autoimmune diseases.

[0487] Experiment 3: Test of the compound's hemolytic activity in cynomolgus monkey serum

[0488] Materials and instruments:

[0489] Cynomolgus monkey serum (storage conditions -60 to -90℃), GVB0 Buffer, 100mM MgEGTA, physiological saline, rabbit red blood cells, Nuclease-free water, plate reader, biochemical incubator, refrigerator (2 to 8℃), ultra-low temperature cryopreservation box (-60 to -90℃), vibrating plate shaker.

[0490] Pipettes, centrifuges, and electrically heated constant temperature water baths.

[0491] Data acquisition and processing:

[0492] OD values ​​for all samples were collected and processed using an ELISA reader. The mean, coefficient of variation (%CV), and percentage of hemolysis were calculated using Excel software. The mean of the blank (BLK) instrument response values ​​was subtracted from all data before processing.

[0493] The calculation method / formula for the percentage of hemolysis replacement in each group at each time point are as follows:

[0494] When the %CV of OD between duplicate wells is ≤25%, refer to the formula below to calculate and report the %hemolysis: %hemolysis = [(OD Sample – ODNC) / (ODPC – ODNC)] × 100.

[0495] When the %CV of OD between replicates is greater than 25%, if the response values ​​of individual wells are all lower than the average NC value, calculate and report the % hemolysis using the formula below: % hemolysis = [(OD Sample – ODNC) / (ODPC – ODNC)] × 100. Otherwise, the test needs to be repeated. Data are expressed as the mean ± standard error of each group of cynomolgus monkey samples, n = 6. Statistical analysis was performed using Excel and Graphpad software, and Student's t-test. p < 0.05 was considered statistically significant.

[0496] Results: See Figure 6. On day 0, cynomolgus monkeys were subcutaneously injected with the test substance at doses of 0, 0.5, 1, 3, 5, and 10 mg / kg. Serum samples were collected weekly to analyze the effect of the test substance on the inhibition rate of serum alternative hemolysis. Following a single subcutaneous administration, the test substance demonstrated long-term effective inhibition of serum alternative hemolysis, and a dose-dependent pharmacodynamic response to serum alternative hemolysis levels was observed at doses of 0.5 mg / kg and higher (1, 3, and 5 mg / kg) (p < 0.05).

[0497] Conclusion: The test compound exhibits potent and long-lasting inhibition of alternative complement. In multiple-dose groups, a single subcutaneous injection of the test compound showed inhibition of alternative hemolysis in a periodic, dose-dependent manner, and with good correlations with the experimentally measured complement factor B (CFB) mRNA, CFB protein, and CAP. Excessive activity of alternative complement directly contributes to alternative hemolysis in paroxysmal nocturnal hemoglobinuria (PNH), thus the test compound has the potential to inhibit alternative complement and improve alternative hemolysis in PNH patients.

Claims

1. An RNA inhibitor for inhibiting the expression of complement factor B (CFB) gene in cells, comprising an antisense strand capable of forming a target sequence complementary region with at least 15 consecutive nucleotides in an mRNA encoding CFB (SEQ ID NO:8), the target sequence complementary region having 0, 1, 2, 3, 4 or 5 mismatches; The antisense strand and the mRNA encoding CFB (SEQ ID NO:8) forming a sequence of 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides starting from the 5' end to the 1830th nucleotide in the sequence form the complementary region of the target sequence. The complementary region of the target sequence is 19-23 nucleotide pairs, 20-22 nucleotide pairs, or 21 nucleotide pairs in length. The antisense strand, comprising 23 nucleotides from its 3' end, includes a sequence capable of forming a complementary region to the target sequence with 21 consecutive nucleotides in the mRNA encoding CFB (SEQ ID NO: 8); and The RNA inhibitor is ribonucleic acid; further, the RNA inhibitor is single-stranded ribonucleic acid or double-stranded ribonucleic acid.

2. The RNA inhibitor according to claim 1, wherein the RNA inhibitor is an antisense oligonucleotide (ASO), shRNA, miRNA, or siRNA.

3. The RNA inhibitor according to claim 1 or 2, wherein the antisense strand comprises at least 15 consecutive nucleotides of any one of the sequences such as SEQ ID NO: 1-3, 5-6.

4. The RNA inhibitor according to any one of claims 1-3, wherein the antisense strand comprises the following sequence: 5'-(N1)(Z)(Y)(X2)GUCAUAAAAUUCAGGAAUUC(X3)(X4)-3', Among them, N1, Z, Y, X2, X3, and X4 each independently represent A, U, C, or G.

5. The RNA inhibitor according to claim 4, wherein Z is G.

6. The RNA inhibitor according to claim 4 or 5, wherein X2 is A or U.

7. The RNA inhibitor according to any one of claims 4-6, wherein Y is A or U.

8. The RNA inhibitor according to any one of claims 4-7, wherein N1 is C.

9. The RNA inhibitor according to any one of claims 4-8, wherein X3 is C and / or X4 is U.

10. The RNA inhibitor of claim 3, wherein the antisense strand comprises a sequence differing from the following sequence by no more than two or one nucleotides: 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO: 1).

11. The RNA inhibitor according to claim 10, wherein the nucleotide difference is located at any position among positions 1-4, 5-24, or 25-26 from the 5' end of SEQ ID NO:

1.

12. The RNA inhibitor of claim 9, wherein the antisense strand comprises the following sequence: 5'-CGAAGUCAUAAAAUUCAGGAAUUCCU-3' (SEQ ID NO: 1).

13. The RNA inhibitor of claim 12, wherein the antisense strand comprises the following sequence 5'-(N 0-4 )CGAAGUCAUAAAAAUUCAGGAAUUCCU-3', Each N independently represents A, U, C, or G.

14. The RNA inhibitor of claim 13, wherein the antisense strand is 26-30 nucleotides, 27 or 26 nucleotides in length.

15. The RNA inhibitor according to any one of claims 1-14, comprising a sense strand capable of forming a complementary double helix with the antisense strand, wherein the sense strand comprises a sequence capable of forming a double-stranded complementary region with at least 15 consecutive nucleotides in the antisense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably the double-stranded complementary region being 15-30 nucleotide pairs in length, more preferably 17-23 nucleotide pairs.

16. The RNA inhibitor according to claim 15, wherein the length of the complementary region of the double strand is 19-23 nucleotide pairs, 20-22 nucleotide pairs, or 21 nucleotide pairs.

17. The RNA inhibitor of claim 15, wherein the sense strand comprises a sequence capable of forming a double-stranded complementary region with at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides in a 23-nucleotide sequence from the 3' end of the antisense strand.

18. The RNA inhibitor of claim 16, wherein the sense strand comprises a sequence capable of forming a double-stranded complementary region with 21 consecutive nucleotides in a 23-nucleotide sequence starting from the 3' end of the antisense strand.

19. The RNA inhibitor according to any one of claims 7-18, wherein the sense strand comprises at least 15 consecutive nucleotides of the sequence as described in SEQ ID NO:4 or 7.

20. The RNA inhibitor according to any one of claims 15-19, wherein the complementary region of the double strand has no more than two or one mismatch.

21. The RNA inhibitor of claim 20, wherein the mismatch is located at nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 from the 5' end of sequence SEQ ID NO:

1.

22. The RNA inhibitor of claim 21, wherein the sense strand comprises a sequence differing from the following sequence by no more than two or one nucleotides: 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO: 4).

23. The RNA inhibitor according to claim 22, wherein the nucleotide difference is located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 from the 5' end of SEQ ID NO:

4.

24. The RNA inhibitor of claim 19, wherein the sense strand comprises the following sequence 5'-GAAUUCCUGAAUUUUAUGACU-3' (SEQ ID NO: 4).

25. The RNA inhibitor of claim 24, wherein the length of the positive strand is 21-25, 21-23, 22, or 21 nucleotides.

26. The RNA inhibitor of claim 25, wherein the sense strand is 21 nucleotides long.

27. The RNA inhibitor according to any one of claims 7-26, wherein the sense and antisense strands exist on two different nucleic acid strands, preferably the RNA inhibitor is siRNA.

28. The RNA inhibitor according to any one of claims 7-27, wherein the sense strand and the antisense strand exist on the same nucleic acid strand, preferably the RNA inhibitor is shRNA.

29. The RNA inhibitor according to any one of claims 7-28, wherein the sense strand and the antisense strand each optionally independently comprise a 3' overhang of 1-3 nucleotides.

30. The RNA inhibitor of claim 29, wherein both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' overhang of 1-3 nucleotides in length.

31. The RNA inhibitor according to any one of claims 1-30, wherein the sense strand has the sequence shown in SEQ ID NO:4; and / or the antisense strand has the sequence shown in SEQ ID NO:1, wherein each nucleotide is independently a chemically modified nucleotide or an unmodified nucleotide.

32. The RNA inhibitor according to any one of claims 1-31, wherein at least one nucleotide in the RNA inhibitor is a chemically modified nucleotide; optionally, each nucleotide in the RNA inhibitor is a chemically modified nucleotide.

33. The RNA inhibitor according to claim 32, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, ethylene glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinylphosphonate (VP) modification. Modifications include VP), N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted non-basic nucleotide (invAB), replacing the nucleotide with an inverted non-basic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, invAb, invAB, and M06.

34. The RNA inhibitor according to claim 32 or 33, wherein the 3' or 5' end of the antisense strand is further modified with an inverted non-base nucleotide (invAB).

35. The RNA inhibitor of claim 34, wherein the inverted abasic nucleotide (invAB) is attached to the 3' or 5' end of the antisense strand via a phosphate ester or thiophosphate bond.

36. The RNA inhibitor according to any one of claims 22-35, wherein the 3' or 5' end of the antisense strand is further modified with M06:

37. The RNA inhibitor of claim 36, wherein M06 is linked to the 3' or 5' end of the antisense strand via a phosphate ester or thiophosphate bond.

38. The RNA inhibitor according to any one of claims 32-37, wherein the 3' or 5' end of the sense strand is modified with an inverted non-base nucleotide (invAB).

39. The RNA inhibitor of claim 38, wherein the inverted abasic nucleotide (invAB) is attached to the 3' or 5' end of the positive strand via a phosphate ester or thiophosphate bond.

40. The RNA inhibitor according to any one of claims 32-39, wherein the 3' or 5' end of the sense strand has an M06 modification:

41. The RNA inhibitor of claim 40, wherein M06 is linked to the 3' or 5' end of the sense strand via a phosphate ester or thiophosphate bond.

42. The RNA inhibitor according to any one of claims 10-41, wherein the antisense strand comprises the following sequence: 5'-(invAB)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:2), (invAB) represents the inverted, non-base nucleotide modification.

43. The RNA inhibitor according to any one of claims 10-41, wherein the antisense strand comprises one of the following: 5'-(M06)CGAAGUCAUAAAAUUCAGGAAUUCCU-3'(SEQ ID NO:3), (M06) is modified by M06.

44. The RNA inhibitor according to any one of claims 32-43, wherein the nucleotide at position 7 of the sense strand, starting from the 5' end, is modified with 2'-F.

45. The RNA inhibitor according to any one of claims 32-44, wherein the nucleotide at position 9 of the sense strand, starting from the 5' end, is modified with 2'-F.

46. ​​The RNA inhibitor according to any one of claims 32-45, wherein the nucleotide at position 10 of the sense strand, starting from the 5' end, is modified with 2'-F.

47. The RNA inhibitor according to any one of claims 32-46, wherein the nucleotide at position 11 of the sense strand, starting from the 5' end, is modified with 2'-F.

48. The RNA inhibitor according to any one of claims 32-47, wherein, counting from the 5' end, the nucleotides at positions 7, 9, 10, and 11 of the sense strand are 2'-F modified; optionally, the other nucleotides of the sense strand are 2'-OMe modified.

49. The RNA inhibitor according to any one of claims 32-48, counting from the 5' end, has a phosphate thioester linker between the fourth and fifth nucleotides of the antisense strand.

50. The RNA inhibitor according to any one of claims 32-49, wherein, counting from the 3' end, there is a phosphate thioester link between the first and second nucleotides of the antisense strand.

51. The RNA inhibitor according to any one of claims 32-50, wherein, counting from the 3' end, there is a phosphate thioester link between the second and third nucleotides of the antisense strand.

52. The RNA inhibitor according to any one of claims 32-51, wherein, counting from the 5' end, there is a phosphate thioester link between the fourth and fifth nucleotides of the antisense strand; and, counting from the 3' end, there is a phosphate thioester link between the first and second nucleotides of the antisense strand, and between the second and third nucleotides; optionally, the other nucleotides of the antisense strand are linked by phosphodiester linkages.

53. The RNA inhibitor according to any one of claims 32-52, wherein, counting from the 5' end, the nucleotide at position 1 of the antisense strand is modified with 2'-F.

54. The RNA inhibitor according to any one of claims 32-53, wherein, counting from the 5' end, the nucleotide at position 2 of the antisense strand is modified with 2'-F.

55. The RNA inhibitor according to any one of claims 32-54, wherein, counting from the 5' end, the nucleotide at the 5th position of the antisense strand is modified with 2'-F.

56. The RNA inhibitor according to any one of claims 32-55, wherein, counting from the 5' end, the nucleotide at position 17 of the antisense strand is modified with 2'-F.

57. The RNA inhibitor according to any one of claims 32-56, wherein, counting from the 5' end, the nucleotide at position 19 of the antisense strand is modified with 2'-F.

58. The RNA inhibitor according to any one of claims 32-57, wherein, counting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand are 2'-F modified; optionally, the other nucleotides of the antisense strand are 2'-OMe modified.

59. The RNA inhibitor according to any one of claims 32-58, wherein the 3'-end and / or 5'-end of the sense strand and / or antisense strand comprises phosphate or phosphate mimicry modification.

60. The RNA inhibitor of claim 59, wherein the phosphate mimic comprises 5'-(E)-vinylphosphonate (VP), 5'-methylphosphonate (MP), (S)-5'-C-methyl analog and 5'-thiophosphate (5'-PS).

61. The RNA inhibitor according to claim 43, wherein (M06) is linked to the 5' end of the antisense strand via a phosphate ester or thiophosphate bond.

62. The RNA inhibitor of claim 42, wherein the inverted abase-free nucleotide is linked to the 5' end of the first nucleotide of the antisense strand via a phosphate thioester.

63. The RNA inhibitor according to any one of claims 1-62 further comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

64. The RNA inhibitor according to claim 63, wherein, The ligands are independently attached to one or more internal locations of the positive or negative chain.

65. The RNA inhibitor according to claim 64, wherein, The internal position is on the nucleobase, sugar ring, methylphosphonate bond, thiophosphate diester bond, or phosphate diester bond.

66. The RNA inhibitor of claim 63, wherein the ligand is conjugated to the 5' end and / or 3' end of the antisense strand.

67. The RNA inhibitor of claim 63, wherein the ligand is conjugated to the 5' end and / or 3' end of the sense strand.

68. The RNA inhibitor according to claim 66 or 67, wherein the RNA inhibitor comprises a first ligand and a second ligand, wherein the first ligand is conjugated to the 5' end of the antisense strand and the second ligand is conjugated to the 3' end of the sense strand, and the first ligand and the second ligand may be the same or different.

69. The RNA inhibitor of claim 68, wherein the first ligand is conjugated to the 3' end of the antisense strand and the second ligand is conjugated to the 5' end of the sense strand, and the first ligand and the second ligand may be the same or different.

70. The RNA inhibitor of claim 68, wherein the first ligand is conjugated to the 5' end of the antisense strand and the second ligand is conjugated to the 5' end of the sense strand, and the first ligand and the second ligand may be the same or different.

71. The RNA inhibitor of claim 68, wherein the first ligand is conjugated to the 3' end of the antisense strand and the second ligand is conjugated to the 3' end of the sense strand, and the first ligand and the second ligand may be the same or different.

72. The RNA inhibitor according to any one of claims 63-71, wherein the RNA inhibitor comprises 1, 2, 3, 4, 5 or 6 ligands.

73. The RNA inhibitor according to any one of claims 63-72, wherein the ligand is an L96 monomer with the structure shown below.

74. The RNA inhibitor according to any one of claims 1-73, or a pharmaceutically acceptable salt thereof, wherein the sense strand and the antisense strand are selected from the following combinations: (1) Justice chain (5'-3'): g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7), Antisense chain (5'-3'): (invAB)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:5); or (2) Justice chain (5'-3'): g*a*auucCfuGfAfAfuuuuaugacu[L96](SEQ ID NO:7), Antisense chain (5'-3'): (M06)*CfGfaa*GfucauaaaauucAfgGfaauuc*c*u(SEQ ID NO:6); where, The lowercase letters a, u, c, and g indicate that the nucleotide represented by their corresponding uppercase letters (A, U, C, G) is modified with 2'-O-methyl (2'-OMe). invAB modification refers to the attachment of an inverted, baseless deoxynucleotide at the 5' or 3' end of the nucleotide. Af, Uf, Cf, and Gf indicate that the nucleotide represented by their corresponding uppercase letters (A, U, C, G) is modified with 2'-deoxy-2'-fluoro (2'-F). The structure of M06 is shown below: (M06): * indicates a link via thiophosphate.

75. A pharmaceutical composition comprising an RNA inhibitor as described in any one of claims 1-74, and a physiologically acceptable excipient and / or carrier and / or diluent.

76. Use of the RNA inhibitor according to any one of claims 1-74 or the pharmaceutical composition according to claim 75 in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or symptom.

77. The use according to claim 76, wherein the disease or pathology includes a disease or symptom associated with elevated levels of complement factor B (CFB).

78. The use according to claim 76 or 77, wherein the disease or pathology includes autoimmune diseases and inflammatory diseases.

79. The use according to any one of claims 76-78, wherein the disease or pathology includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

80. A method for preventing or treating a disease or symptom, the method comprising administering to a subject in need an effective amount of an RNA inhibitor according to any one of claims 1-75 or a pharmaceutical composition according to claim 75.

81. The method of claim 80, wherein the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via a subcutaneous, intravenous, oral, rectal, or intraperitoneal route.

82. A method for inhibiting the expression of complement factor B (CFB) in cells, tissues or subjects, comprising administering to the cells, tissues or subjects an effective amount of the RNA inhibitor of any one of claims 1-74 or the pharmaceutical composition of claim 75.

83. The method of claim 80, wherein the disease or pathology includes a disease or symptom associated with elevated levels of complement factor B (CFB).

84. The method of claim 80, wherein the disease or pathology includes autoimmune diseases and inflammatory diseases.

85. The method of claim 80, wherein the disease or pathology includes atypical hemolytic uremic syndrome (aHUS), age-related macular degeneration (AMD), membranoproliferative glomerulonephritis (MPGN), IgA nephropathy (IgAN), and paroxysmal nocturnal hemoglobinuria (PNH).

Images