Lentivirus for treating craniopharyngioma, and preparation method therefor and use thereof
By injecting lentiviruses carrying the hTERT promoter and CDC6shRNA gene to treat craniopharyngiomas, a safe and effective gene therapy has been achieved, which significantly inhibits the growth of cystic ameloblastic craniopharyngiomas and shrinks the tumor size, thus solving the problems of high risk and recurrence of existing treatment methods.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2026-03-19
AI Technical Summary
Existing treatments for craniopharyngioma, such as surgery, radiotherapy, and drug therapy, are high-risk, have high recurrence rates, and lack effective methods to inhibit growth. There is also a lack of safe and efficient gene therapy options.
A lentivirus carrying the hTERT promoter and CDC6shRNA gene was used to deliver the therapeutic gene into craniopharyngioma cells via injection, and the resulting Omeya capsule injection formulation was prepared for the treatment of cystic ameloblastic craniopharyngioma.
It significantly inhibits the proliferation of craniopharyngioma, induces apoptosis, and the treatment process is painless and has no adverse reactions. CT images show that the tumor gradually shrinks, providing a safe and effective treatment option.
Smart Images

Figure CN2025104658_19032026_PF_FP_ABST
Abstract
Description
Lentivirus for treating craniopharyngioma and preparation method and application thereof
[0001] Cross-reference to Related Applications
[0002] The present application claims priority to the Chinese patent application No. 202411296490.4, filed on September 14, 2024, and entitled "Lentivirus for treating craniopharyngioma and preparation method and application thereof", the content of which is incorporated herein by reference in its entirety. TECHNICAL FIELD
[0003] The present application relates to the field of tumor gene therapy, and in particular, the present application provides a lentivirus for treating craniopharyngioma and a preparation method and application thereof. BACKGROUND
[0004] Craniopharyngioma is a rare, benign tumor formed by residual cells of the craniopharyngeal duct, which is usually located in the sellar region, i.e., above the pituitary at the base of the brain. Although craniopharyngioma is benign, due to its special growth location, adjacent to many important and complex anatomical structures, the treatment faces great challenges.
[0005] The current treatment methods for craniopharyngioma mainly include surgical treatment, radiotherapy and drug treatment. Surgical treatment is the preferred treatment for craniopharyngioma. However, due to the particularity of the location of craniopharyngioma, the surgical risk is high, which is prone to cause postoperative complications and easily damage the surrounding important structures such as the optic nerve and pituitary. Therefore, the surgery is very difficult and has a high recurrence rate. Radiotherapy is suitable for patients with tumors that are difficult to resect by surgery or patients with postoperative recurrence. Some patients receive radiotherapy, which instead stimulates the growth of the tumor. Drug treatment is mainly used to improve the endocrine dysfunction of patients and alleviate the symptoms of increased intracranial pressure, and is used as an adjuvant therapy for craniopharyngioma.
[0006] According to the above three treatment methods, there is still no effective treatment method to inhibit the growth of craniopharyngioma. Therefore, it is of great practical significance to find a new, efficient and safe treatment method, especially a gene therapy method, for the treatment of craniopharyngioma. SUMMARY
[0007] The present application provides a lentivirus for treating craniopharyngioma and a preparation method and application thereof, which can effectively deliver a therapeutic gene to craniopharyngioma cells to achieve the purpose of gene therapy.
[0008] In one aspect, the present application provides a lentivirus for treating craniopharyngioma, which carries an hTERT promoter and a CDC6 shRNA gene.
[0009] Further, the hTERT promoter sequence is SEQ ID NO. 2.
[0010] Further, the CDC6 shRNA gene sequence is SEQ ID NO. 3.
[0011] Further, the lentivirus carries the hTERT promoter-CDC6 shRNA combined gene.
[0012] Further, the hTERT promoter-CDC6 shRNA combined gene sequence is SEQ ID NO. 1.
[0013] In another aspect, the present application provides the use of the above-mentioned lentivirus in the preparation of a medicament for treating craniopharyngioma.
[0014] Further, the craniopharyngioma is cystic craniopharyngioma.
[0015] Further, the cystic craniopharyngioma is cystic adamantinomatous craniopharyngioma.
[0016] In another aspect, the present application provides a pharmaceutical composition comprising the above-mentioned lentivirus for treating craniopharyngioma.
[0017] Further, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
[0018] Further, the pharmaceutical composition is in the form of an injection.
[0019] Further, the pharmaceutical composition is in the form of an Omnia capsule injection.
[0020] In another aspect, the present application provides a preparation method of the above-mentioned lentivirus for treating craniopharyngioma.
[0021] (1) inserting the hTERT promoter and CDC6 shRNA gene sequence after the enzyme cutting site of the vector to obtain a plasmid;
[0022] (2) transferring the plasmid into an expression strain and culturing to screen successfully transferred strains;
[0023] (3) shaking the successfully transferred strains obtained in step (2) to obtain an hTERT-CDC6 shRNA expression plasmid;
[0024] (4) packaging the expression plasmid of step (3) to obtain an hTERT-CDC6 shRNA lentivirus.
[0025] In another aspect, the present application provides a method for treating craniopharyngioma, comprising administering the above-mentioned lentivirus to a patient in need thereof.
[0026] Further, the craniopharyngioma is a cystic adamantinomatous craniopharyngioma.
[0027] Further, the administration mode is injection, the administration frequency is one or more times, the administration dose is 5.39 x 10 6 TU / time.
[0028] The strain can be self-made or commercially available E. coli, yeast, etc., and optionally the competent cells of E. coli are used. The packaging can use various commercially available or literature recorded packaging qualities and cells, and optionally the mixed packaging plasmids pLP1, pLP / VSVG, pLP2 and 293F cells are used.
[0029] The skilled in the art can select suitable excipients for the pharmaceutical composition involved in the present application according to the general knowledge in the pharmaceutical field, and the available excipient categories include but are not limited to solvents, cosolvents, stabilizers, dispersants, viscosity regulators, antioxidants, pH regulators, sustained-release agents, fillers, sweeteners, binders, gas generating agents, coating agents, etc. Particularly, the excipients suitable for injection are optionally selected. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 is an electrophoresis map of plasmid hTERT-CDC6shRNA (2 lanes);
[0031] Figure 2 is a CT picture after recurrence of surgical treatment;
[0032] Figure 3 is a CT picture after 3 months of injection treatment;
[0033] Figure 4 is a CT picture after 4 months of injection treatment;
[0034] Figure 5 is a CT picture after 5 months of injection treatment;
[0035] Figure 6 is a CT picture after 6 months of injection treatment;
[0036] Figure 7 is a CT picture after 8 months of injection treatment;
[0037] Figure 8 is a CT picture after 11 months of injection treatment;
[0038] Figure 9 is a CT picture after 14 months of injection treatment;
[0039] Figure 10 is a CT picture after 15 months of injection treatment. DETAILED DESCRIPTION
[0040] Example 1 hTERT-CDC6shRNA overexpression clone construction
[0041] The relevant gene sequence was retrieved from Genbank, and the CDC6 shRNA sequence was designed. The hTERT-CDC6 shRNA overexpression clone was constructed by using the seamless cloning method.
[0042] The steps are as follows:
[0043] The vector Plenty6.3 / V5-TOPO (referred to as D) purchased from Thermo Fisher Scientific was digested with the enzyme cutting sites ClaI and MluI, the upstream primer was aattcaaaattttatcgataagacaattcacaaacacagccc (SEQ ID NO. 4), and the downstream primer was actaaccggtacgcgttcagtctgagtcaggcccttc (SEQ ID NO. 5). The hTERT promoter and CDC6 shRNA gene sequence were inserted to obtain the hTERT-CDC6 shRNA plasmid.
[0044] The steps are as follows:
[0045] 1. Vector digestion
[0046] The enzyme cutting system was prepared:
[0047] (Note: enzyme cutting reaction conditions 37℃ / 3h)
[0048] 2. Seamless cloning connection
[0049] (Note: seamless cloning connection reaction conditions 37℃ / 30min)
[0050] 3. Transformation and plating of the connection product
[0051] 50 μl of TOP10 competent cells were thawed on ice, 5 μl of the connection product and the competent cells were mixed, and then ice-bathed for 30 min, 42℃ water-bathed for 90 sec, and ice-bathed for 2 min. The transformation product was transferred to an EP tube containing 500 μl of non-resistant LB liquid medium, and placed in a shaker for 37℃, 180 rpm culture for 30 min. The EP tube containing the transformed bacteria was centrifuged at 4000 rpm for 2 min. The supernatant was poured out in a clean bench, and about 100 μl of medium was left to mix the precipitate evenly and evenly coated on the LB resistant culture plate. The plate was inverted and placed in a 37℃ bacterial incubator for overnight culture (12-16h). Single colony colonies were picked from the above plate in 6ml LB liquid medium, 37℃, 250 rpm, and cultured overnight (12-16h). The plasmid was extracted, sequenced and identified, and the sequencing results were compared with the sequence of the target gene to identify the correct plasmid.
[0052] The plasmid hTERT-CDC6shRNA was obtained (electrophoretogram as shown in Figure 1).
[0053] The gene sequences involved:
[0054] hTERT-CDC6shRNA gene sequence, SEQ ID NO. 1
[0055] hTERT promoter sequence, SEQ ID NO. 2
[0056] CDC6shRNA gene sequence, SEQ ID NO. 3
[0057] Example 2 Preparation and production process of lentivirus
[0058] The plasmid hTERT-CDC6shRNA of Example 1 was transformed into Stbl3 competent cells, and a resistant monoclonal strain was screened. The specific operation is as follows:
[0059] The competent cells Stbl3 (purchased from Thermo Fisher Scientific) and the hTERT-CDC6shRNA plasmid were taken out from the -80°C refrigerator and placed on ice to thaw. 1 μg of the plasmid was added to the competent cells, mixed gently, and placed in ice for 25 min. The plasmid-added competent cells were quickly placed in a preheated 42°C water bath for heat shock for 45 sec, and then placed in ice for 2 min again. 250 μl of LB liquid medium was added to the plasmid-added competent cells, and incubated at 220 rpm / min and 37°C for 1 h. The LB solid medium was completely dried, 50 μl of the recovered transformation bacterial solution was taken, and the prepared LB solid medium was coated evenly with a coating rod, and the culture dish was sealed with a sealing film. The sealed LB solid medium was placed in a 37°C incubator upside down and cultured for 12-16 h to obtain a resistant monoclonal strain.
[0060] The above monoclonal strain was shaken to obtain the hTERT-CDC6shRNA plasmid.
[0061] A typical single colony was selected in a super-clean bench and placed in a 15 ml sterile centrifuge tube (with 5 ml of LB liquid medium) and cultured at 37°C, 220 rpm / min for 12-16 h, with OD600 of 0.6-0.9. The next day, it was inoculated in LB medium at a volume ratio of 1:100, cultured at 37°C, 220 rpm / min for 16 h, and the plasmid was extracted.
[0062] The plasmid extracted in the previous step is packaged with the mixed packaging plasmids pLP1, pLP / VSVG, and pLP2 to obtain the hTERT-CDC6 shRNA lentivirus. The specific packaging procedure is as follows:
[0063] The packaging cells were 293F cells, and the cell transfection density was 4.0-4.5 × 10⁻⁶ cells / year. 6 / ml.
[0064] Cell transfection procedure: A: Dilute the plasmid with 5% Opti-MEM, with a total plasmid volume of 2.5 μg / ml. The ratio of packaging plasmids pLP1, pLP / VSVG, and pLP2 to lentiviral plasmid is 1:1:1:2. B: Dilute the plasmid with 5% Opti-MEM. Use 6 μl / ml of transfection reagent (Thermo Fisher Scientific, catalog number: A35348) and incubate at room temperature for 1 min. Add the diluted plasmid to the diluted transfection reagent, incubate at room temperature for 15 min, then add to 293F cells and mix thoroughly. After 4 h, add 5% supplement and 4% enhancer. Collect the supernatant after 56 h. After purification by a purification column, concentrate and change the medium. First, concentrate the solution 5 times, then use 3 times the volume of washing and filtration buffer (buffer solution: 0.02M phosphate buffer pH 7.2 with 1% glycerol, 20 mg / ml sucrose, 1 mg / ml L-arginine, 2 mg / ml glycine, and 2% PEG400 added) to obtain lentivirus. After aliquoting, store at -80℃.
[0065] The activity titer of lentivirus detected by qPCR was 5.39 × 10⁻⁶. 7 TU / ml.
[0066] The steps for lentivirus activity detection are as follows:
[0067] The specific procedure for detecting lentiviral activity using 293T cells is as follows:
[0068] 1×10 5 / 293T cells were seeded into 6-well plates. After 24 hours of seeding, the cell density was B (approximately 2 x 10⁻⁶). 5 / ml), 2ml of culture medium per well. The next day, discard the culture medium and replace it with 1ml / well of fresh DMEM medium. Add 50μl of lentivirus (Shanghai Jikai Gene Technology) as a control and 50μl of virus gently to each well, and also serve as a blank control. After 24 hours of infection, replace the culture medium with 2ml of fresh medium and continue culturing for 48 hours. Extract cell genome to detect cell activity.
[0069] After culturing, the cells are digested and the genome is extracted, as follows:
[0070] Aspirate the medium, and gently wash the cells by adding 1 ml of 1x PBS per well, then discard the PBS, and trypsinize the cells with 0.5 ml of trypsin, then add 1 ml of DMEM medium to resuspend the cells into a 1.5 ml centrifuge tube. Extract the genomic DNA using a genomic extraction kit (Tiangen Biotech (Beijing)), and elute the genomic DNA with 100 μl of Elution buffer; use a microplate reader to detect the dsDNA concentration and purity.
[0071] The QPCR experiment was performed according to the steps to detect the lentivirus activity. The specific operation steps are as follows:
[0072] The 293T cell reference gene DNA standard was diluted 10 times, and the dilution concentration was 1.0 x 10 8 copy-1.0 x 10 4 copy. The target plasmid standard was diluted, and the dilution concentration was 1.0 x 10 8 copy-1.0 x 10 4 copy, and a standard curve was established.
[0073] The prepared PCR reaction system was added to the PCR reaction wells on the plate at 19 μl per well, and the 293T cell reference gene DNA and the target gene primers were arranged alternately. The 293T cell reference gene DNA was placed in rows A and B, and the target gene primers were placed in rows C and D. 1 μl of DNA template was added to each reaction well, and a negative control was set by replacing the template with water;
[0074] The PCR reaction system is as follows, and two repeats were performed for each sample:
[0075] PCR amplification program
[0076] Result analysis
[0077] The Ct values of the target gene and the reference gene obtained were respectively substituted into the standard curve to obtain the respective copy numbers Q1 and Q2, and the ratio of the target gene to the reference copy number Q1 / Q2 was calculated. Then, the titer (transduction units per ml, TU / ml) was calculated according to the following formula
[0078] TU / ml = (Q1 / Q2) x B x 2 x dilution factor x 1000 / virus volume V (μL)
[0079] The 293T cell reference gene DNA primer probe sequence is as follows:
[0080] Forward primer TGC AGATTT GGACCT GCG AG (SEQ ID NO. 6)
[0081] Reverse primer GAATAG CCAAGG TGAGCG GC (SEQ ID NO. 7)
[0082] Probe ACC TGAAGG CTC TGC GCG GAC TTG T (SEQ ID NO. 8)
[0083] Primer and probe sequences for the target gene are as follows:
[0084] Forward primer GCT CCT TTC CGG GAC TTT CG (SEQ ID NO. 9)
[0085] Reverse primer ATT GTC AGT GCC CAA CAG CC (SEQ ID NO. 10)
[0086] Probe TCC CTA TTG CCA CGG CGG AAC TCATCG (SEQ ID NO. 11)
[0087] Example 3 Treatment Case
[0088] In the study of craniopharyngioma, in vitro culture of craniopharyngioma cells is an important link, but in practice it is found that craniopharyngioma cells face many challenges in in vitro culture. Craniopharyngioma cells need to maintain their unique biological characteristics, such as cell morphology, cell cycle, and proliferation ability, in in vitro culture. However, due to factors such as the source and growth environment of craniopharyngioma cells, in vitro cultured cells cannot completely simulate the in vivo environment, leading to changes in cell characteristics. Therefore, it is currently not possible to perform an invasion experiment of craniopharyngioma cells. In our research, we encountered a patient with craniopharyngioma who had postoperative recurrence and had undergone radioisotope internal radiotherapy treatment and still had recurrence. In the case of repeated recurrence after using all other treatment methods, the patient and his family members pleaded to use the lentivirus for experimental treatment. The patient received 13 months of lesion direct injection treatment, a total of 13 treatments, 100 μl each time (lentivirus content: 5.39 x 10 6 TU), and the total injection dose was 1300 μl. The injection method is as follows:
[0089] The craniopharyngioma was confirmed to be cystic ameloblastic type by pathological examination before the Ommaya reservoir implantation surgery was performed in the Department of Neurosurgery of the General Hospital of the Chinese People's Liberation Army in May 2010. Then, the Ommaya reservoir implantation surgery was performed. Two days after the Ommaya reservoir implantation, the test treatment was implemented according to the method of injecting lentivirus once every 30 days, as follows:
[0090] 1. Before injection, first use a syringe to completely suck out the Ommaya reservoir and the liquid in the craniopharyngioma;
[0091] 2. Use a 1ml syringe to slowly inject 100ul of lentivirus into the Ommaya reservoir;
[0092] 3. Then, inject 1ml of normal saline into the Ommaya reservoir to dilute and evenly distribute the lentivirus, and push the lentivirus into the tumor body;
[0093] 4. The above injection process is performed once every 30 days until the liquid in the cyst cannot be effectively sucked out. At the same time, CT images can be observed to clearly see that the tumor body is gradually shrinking, and the CT images before and after treatment are shown in Figures 2-10.
[0094] It can be clearly seen from the CT images that the craniopharyngioma body is gradually shrinking, and the patient does not have any adverse reactions during the treatment process. The whole process is a painless treatment that does not affect the normal life of the patient.
[0095] In summary, the lentivirus described in the present application has obvious inhibitory proliferation and induction of self-apoptosis effects on craniopharyngioma cystic ameloblasts, which will provide a safe and effective treatment method for craniopharyngioma patients.
Claims
A lentivirus for treating craniopharyngioma, characterized by The lentivirus carries an hTERT promoter and a CDC6 shRNA gene. The lentivirus according to claim 1, wherein the hTERT promoter sequence is SEQ ID NO.
2. The lentivirus according to claim 1 or 2, wherein the CDC6 shRNA gene sequence is SEQ ID NO.
3. The lentivirus according to claim 1, wherein the lentivirus carries an hTERT promoter-CDC6 shRNA combined gene. The lentivirus according to claim 4, wherein the hTERT promoter-CDC6 shRNA combined gene sequence is SEQ ID NO.
1. The lentivirus according to any one of claims 1-5 for use in the preparation of a medicament for treating craniopharyngioma. The use according to claim 6, wherein the craniopharyngioma is a cystic ameloblastic craniopharyngioma. Pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the lentivirus according to any one of claims 1-5. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. The pharmaceutical composition according to claim 8 or 9, wherein the pharmaceutical composition is in the form of an injection. The pharmaceutical composition according to claim 10, wherein the pharmaceutical composition is in the form of an Omitha capsule injection. The method of producing a lentivirus according to any one of claims 1 to 5, characterized in that, The method comprises: (1) inserting an hTERT promoter and a CDC6 shRNA gene sequence after the enzyme cutting site of a vector to obtain a plasmid; (2) transferring the plasmid into an expression strain and culturing to screen successfully transferred strains; (3) performing shake culture on the successfully transferred strains obtained in step (2) to obtain an hTERT-CDC6 shRNA expression plasmid; (4) packaging the expression plasmid of step (3) to obtain an hTERT-CDC6 shRNA lentivirus. A method for treating craniopharyngioma, comprising administering the lentivirus according to any one of claims 1-5 to a patient in need thereof. The method according to claim 13, wherein the craniopharyngioma is a cystic ameloblastic craniopharyngioma. The method of claim 13, wherein the mode of administration is injection, the number of administrations is one or more, and the dose administered is 5.39 x 10 6 TU per administration.
Citation Information
Patent Citations
Microvesicle, and manufacturing method for same
CN105209617A
Multi-gene expression lentivirus as well as preparation method and application thereof
CN118995641A
Lentivirus for treating cancer as well as preparation method and application of lentivirus
CN119530301A
Lentivirus for treating craniopharyngeal tubuloma as well as preparation method and application of lentivirus
CN119709646A
Lentiviral vector THTD, aging agent, cancer inhibitor, and medicinal composition containing said THTD, protein packaged in viruslike hollow particle, and production method for viruslike hollow particle
WO2015020215A1