Lipid nanoparticle used for delivering HPV nucleic acid vaccine

By optimizing the composition of lipid nanoparticles and combining them with HPV antigens and immune co-stimulatory factors, the problems of low delivery efficiency and insufficient safety of HPV nucleic acid vaccines were solved, achieving effective immune activation and inhibition of HPV-related tumors.

WO2026056860A1PCT designated stage Publication Date: 2026-03-19BEIJING JITAI PHARM TECH CO LTD +1
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

In the existing technology, HPV nucleic acid vaccine delivery systems suffer from low efficiency and insufficient safety, especially in the field of tumor vaccines, where it is difficult to effectively activate the patient's immune system to control or eliminate HPV-related tumors.

Method used

Lipid nanoparticles containing ionizable lipids, structural lipids, neutral lipids, and polymeric lipids were optimized in composition and ratio, and combined with HPV antigens and immune co-stimulatory factors to form lipid nanoparticles for the delivery of HPV nucleic acid vaccines.

Benefits of technology

It improves the delivery efficiency of HPV nucleic acid vaccines, enhances the immune response, effectively activates the immune system, inhibits the growth of HPV-related tumors, and has high safety and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025120083-FTAPPB-I100001
    Figure PCTCN2025120083-FTAPPB-I100001
  • Figure PCTCN2025120083-FTAPPB-I100002
    Figure PCTCN2025120083-FTAPPB-I100002
  • Figure PCTCN2025120083-FTAPPB-I100003
    Figure PCTCN2025120083-FTAPPB-I100003
Patent Text Reader

Abstract

A lipid nanoparticle used for delivering an HPV nucleic acid vaccine, a preparation method therefor, a composition, an immunogenic composition and a pharmaceutical composition which include the lipid nanoparticle, and a use of the lipid nanoparticle, the immunogenic composition and the pharmaceutical composition in disease treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Lipid nanoparticles for delivery of HPV nucleic acid vaccines

[0001] This application claims priority to Chinese Patent Application No. 202411268635.X, filed on September 10, 2024, Chinese Patent Application No. 202411844998.3, filed on December 13, 2024, and Chinese Patent Application No. 202510120912.0, filed on January 24, 2025, which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0002] The present application relates to the field of biological medicine, in particular to lipid nanoparticles for delivery of HPV nucleic acid vaccines, compositions comprising the same and uses thereof in treating diseases. BACKGROUND

[0003] In recent years, the rapid development of mRNA technology and lipid nanoparticle (LNP) delivery systems has enabled mRNA therapy to be applied to the prevention and treatment of various diseases, with a very broad application scenario, including vaccines, protein replacement therapy, tumor immunotherapy, cell reprogramming, and gene editing, etc.

[0004] mRNA therapy can achieve higher protein expression efficiency and longer protein expression time, and has obvious advantages over DNA therapy, including: (1) mRNA begins to translate proteins after entering the cytoplasm, without the need to enter the nucleus to function, which is more efficient than DNA which needs to enter the nucleus to transcribe mRNA; (2) Unlike DNA and viral vectors, mRNA cannot insert into the genome and can only express the encoded protein transiently, with a lower risk of insertional mutagenesis; (3) mRNA is easy to synthesize in vitro and relatively inexpensive, allowing for rapid application; (4) mRNA can theoretically express any protein and can be used to treat almost any disease. To achieve clinical application of mRNA, efficient and safe delivery of mRNA is one of the biggest challenges of mRNA therapy. Currently, LNP is one of the most widely used in vivo nucleic acid delivery platforms, with the advantages of simple preparation, good biodegradability, no immunogenicity, and good safety. The main components of LNP include ionizable lipid molecules, cholesterol, neutral lipids, and PEGylated lipids (PEG lipids). Among them, ionizable lipids are the core part of the LNP structure, and their molecular structure plays a decisive role in the delivery efficiency, targeting, and formulation stability of the entire liposome nanoparticle. The latter three determine the structure and stability of the LNP.

[0005] Tumor vaccine is one of the hotspots in recent years. The principle is to introduce tumor antigens in various forms such as tumor cells, tumor-related proteins or polypeptides, genes expressing tumor antigens, etc. into the body of patients to overcome the immunosuppressive state caused by tumors, enhance immunogenicity, activate the patient's own immune system, and induce cellular and humoral immune responses, so as to control or eliminate tumors.

[0006] Human papillomavirus (HPV) is a group of highly infectious viruses, mainly transmitted through sexual contact. HPV infection can cause a variety of diseases, from benign lesions such as common warts and genital warts, to malignant lesions such as cervical cancer, anal cancer, oropharyngeal cancer, and genital cancer. High-risk HPV is closely related to the occurrence of cervical cancer, among which HPV16 and HPV18 are the most common high-risk types, accounting for about 70% of cervical cancer cases.

[0007] After HPV infection, it affects the normal function of host cells by encoding various key proteins. E6 and E7 are two major oncogenic proteins that play an important role in the development of HPV-related cancer. E6 protein can bind to tumor suppressor protein p53 and promote its degradation and inactivation, leading to abnormal cell growth, promoting malignant transformation and tumor occurrence. E7 protein mainly binds to retinoblastoma protein (pRb), preventing its binding to E2F transcription factor, leading to uncontrolled cell proliferation, further promoting the carcinogenic process.

[0008] WO2022 / 008519 describes a therapeutic RNA containing HPV E6 or E7, which encodes a vaccine antigen with the structure sec-GS(1)-E6 / E7-GS(2)-P2P16-GS(3)-MITD, where sec is a signal peptide that guides the nascent peptide chain to the endoplasmic reticulum; P2P16 is a tetanus toxin-derived amino acid sequence that breaks immune tolerance; MITD is the transmembrane and cytoplasmic domain of MHC class I molecules, which enhances antigen processing and / or presentation. The elements of the vaccine antigen are connected by GS linker peptides to form a fusion polypeptide.

[0009] WO2024 / 140767 describes an HPV mRNA vaccine containing E6 and E7 antigen polypeptide coding sequences of types 16 and 18 HPV, which contains tPA-SP, Flt3L, HPV E2 (if any), E6 / E7 protein or variant coding sequences connected in order from 5' to 3' end, expressed as a fusion polypeptide.

[0010] Among the malignancies in women, the incidence of cervical cancer is second only to breast cancer, and most cervical cancers are caused by human papillomavirus (HPV) infection. More than 100 types of HPV have been isolated, and both men and women can suffer from cancers caused by HPV, and HPV 16 and 18 infections are the leading causes of most HPV carcinogenesis. In fact, HPV 16 and 18 not only cause most of the incidence of cervical cancer, but also cause the production of vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), prostate cancer, and bladder cancer.

[0011] On this basis, there has been an urgent need for a nucleic acid vaccine against HPV and a lipid nanoparticle for delivering such a nucleic acid vaccine in the art, and the present application meets this need. SUMMARY

[0012] In one aspect, the present application provides a lipid nanoparticle for delivering an HPV nucleic acid vaccine, comprising an ionizable lipid, a structural lipid, a neutral lipid, and a polymeric lipid, wherein the ionizable lipid is a compound of Formula (II), or a pharmaceutically acceptable salt, isotopologue, tautomer, or stereoisomer thereof,

[0013] wherein,

[0014] a = 1, 2, 3, 4, 5, or 6;

[0015] b = 4, 5, 6, 7, 8, 9, or 10;

[0016] c = 1, 2, 3, 4, 5, or 6;

[0017] d = 0, 1, 2, 3, or 4;

[0018] c + d = 3, 4, 5, 6, 7, 8, or 9;

[0019] M1and M2are independently selected from the group consisting of -C(O)O-, -OC(O)-, -O-, -SC(O)O-, -OC(O)NR-, -NRC(O)NR-, -OC(O)S-, -OC(O)O-, -NRC(O)O-, -SC(O)-, -C(O)S-, -NR-, -C(O)NR-, -NRC(O)-, -NRC(O)S-, -SC(O)NR-, -C(O)-, -OC(S)-, -C(S)O-, -OC(S)NR-, -NRC(S)O-, -S-S-, and -S(O) 0-2 -;

[0020] R1and R2are independently selected from the group consisting of C 4-25 alkyl, C 4-25 alkenyl, and C 4-25alkyl, -L 1s substituted, and wherein one or more methylene units are optionally and independently replaced with -NR'-;

[0021] R 1s is independently selected from H, C 1-20 alkyl, -L c -OR c , -L c -SR c and -L c -NR c R’ c ;

[0022] R and R’ are each independently selected from H and C 1-20 alkyl;

[0023] L c is independently selected from a bond and C 1-20 alkylene;

[0024] R c and R’ c are independently selected from H, C 1-20 alkyl, C 3-14 cycloalkyl, and 3- to 14-membered heterocyclyl;

[0025] R4and R5are independently selected from C 1-8 alkyl optionally substituted with one or more R 4s ;

[0026] or R4, R5, together with the carbon atom to which they are attached, form C 3-14 cycloalkylene or 3- to 14-membered heterocyclylene optionally substituted with one or more R 4s ;

[0027] R 4s is independently selected from H, halogen, cyano, C 1-8 alkyl, C 1-8 haloalkyl, -L d -OR d , -L d -SR d and -L d -NR d R’ d ;

[0028] L d is independently selected from a bond and C 1-8 alkylene;

[0029] R d and R’ d are independently selected from H, C 1-8 alkyl, C3-14 cycloalkyl groups and 3 to 14-membered heterocyclic groups;

[0030] Preferably, R1 and R2 are independently selected from C 4-20 Alkyl, C 4-20 alkenyl and C 4-20 Alkyne group, which is optionally surrounded by one or more R groups 1s Substitution, and one or more methylene units therein optionally and independently being replaced by -NR'-, and where R 1s R' is as defined above.

[0031] In some embodiments, the present invention provides lipid nanoparticles for delivering HPV nucleic acid vaccines, comprising ionizable lipids, structural lipids, neutral lipids, and polymeric lipids, wherein the ionizable lipids are compounds of formula (II), or pharmaceutically acceptable salts, isotopic variants, tautomers, or stereoisomers thereof.

[0032] in,

[0033] a = 1, 2, 3, 4, 5 or 6;

[0034] b = 4, 5, 6, 7, 8, 9 or 10;

[0035] c = 1, 2, 3, 4, 5 or 6;

[0036] d = 0, 1, 2, 3 or 4;

[0037] c+d = 3, 4, 5, 6, 7, 8 or 9;

[0038] M1 and M2 are independently selected from -C(O)O-, -OC(O)-, -O-, -SC(O)O-, -OC(O)NR-, -NRC(O)NR-, -OC(O)S-, -OC(O)O-, -NRC(O)O-, -SC(O)-, -C(O )S-, -NR-, -C(O)NR-, -NRC(O)-, -NRC(O)S-, -SC(O)NR-, -C(O)-, -OC(S)-, -C(S)O-, -OC(S)NR-, -NRC(S)O-, -SS-, and -S(O) 0-2 -;

[0039] R1 and R2 are independently selected from C 4-20 Alkyl, C 4-20 alkenyl and C 4-20 Alkyne group, which is optionally surrounded by one or more R groups 1s Substitution, and one or more methylene units therein are optionally and independently substituted with -NR'-;

[0040] R1s independently selected from H, C 1-20 alkyl, -L c -OR c , -L c -SR c and -L c -NR c R’ c ;

[0041] R and R’ are each independently selected from H and C 1-20 alkyl;

[0042] L c is independently selected from a bond and C 1-20 alkylene;

[0043] R c and R’ c are independently selected from H, C 1-20 alkyl, C 3-14 cycloalkyl and 3- to 14-membered heterocyclyl;

[0044] R4and R5are independently selected from C 1-8 alkyl, optionally substituted with one or more R 4s ;

[0045] or R4, R5and the carbon atom to which they are attached form C 3-14 cycloalkylene or 3- to 14-membered heterocyclylene, optionally substituted with one or more R 4s ;

[0046] R 4s is independently selected from H, halogen, cyano, C 1-8 alkyl, C 1-8 haloalkyl, -L d -OR d , -L d -SR d and -L d -NR d R’ d ;

[0047] L d is independently selected from a bond and C 1-8 alkylene;

[0048] R d and R’ d are independently selected from H, C 1-8 alkyl, C 3-14 cycloalkyl and 3- to 14-membered heterocyclyl.

[0049] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein M1and M2are independently selected from -C(O)O- or -OC(O)-.

[0050] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R4and R5are independently C 1-8 alkyl, preferably C 1-3 alkyl, more preferably methyl.

[0051] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R1and R2are independently selected from C 4-20 alkyl, preferably C 6-14 alkyl and R2is C 8-20 alkyl, more preferably C 8-12 straight chain alkyl and R2is C 12-20 branched chain alkyl.

[0052] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein a is 2, b is 7, c is an integer from 2 to 5, e.g., 2, 3, 4, or 5, and d is an integer from 1 to 4, e.g., 1, 2, 3, or 4.

[0053] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein the compound of Formula (II) is selected from the following compounds or a pharmaceutically acceptable salt, isotopic variant, tautomer, or stereoisomer thereof:

[0054] In some embodiments, the structural lipid is a sterol; preferably, the sterol is selected from one or more of cholesterols, sitosterols, coprostanols, fecosterols, brassicasterols, ergosterols, tomatidine, ursolic acid, alpha-tocopherol, stigmasterol, avenasterol, ergocalciferol, and campesterol; preferably, the structural lipid is selected from cholesterols and / or beta-sitosterols; more preferably, the structural lipid is cholesterols.

[0055] In some embodiments, the neutral lipid is selected from phosphatidylcholines and / or phosphatidylethanolamines; preferably, the phosphatidylcholine is selected from one or more of DSPC, DLPC, DUPC, POPC, DPPC, DMPC, POPC, DOCP, DOPE, DMPE, POPE, DPPE, DOPC, DOPG, sphingomyelin, and mixtures thereof, more preferably DSPC and / or DOPE.

[0056] In some embodiments, the polymeric lipid is a PEGylated lipid;

[0057] Preferably, the PEGylated lipid is selected from one or more of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol;

[0058] Preferably, the PEGylated lipid comprises a PEG moiety of 1000 Da to 20 kDa, preferably a PEG moiety of about 1000 Da to about 5000 Da;

[0059] Preferably, the PEGylated lipid is selected from one or more of: DMPE-PEG1000, DPPE-PEG1000, DSPE-PEG1000, DOPE-PEG1000, DMG-PEG2000, Ceramide-PEG2000, DMPE-PEG2000, DPPE-PEG2000, DSPE-PEG2000, Azido-PEG2000, DSPE-PEG2000, DSPE-PEG2000-Mannose, DSPE-PEG2000 amine, DSPE-PEG3350, DSPE-PEG3500, DMG-PEG3500, DPPE-PEG3500, DSPE-PEG4000, DMG-PEG4000, Ceramide-PEG5000, DSPE-PEG5000, DMG-PEG5000, and ALC-0159, preferably DMG-PEG2000, DSPE-PEG2000, DMG-PEG3500, DMG-PEG4000, and / or DMG-PEG5000, more preferably DMG-PEG2000.

[0060] In some embodiments, the present application provides a lipid nanoparticle as described above comprising the following molar percentages of components:

[0061] Ionizable lipid: about 35-50%, preferably about 35-45%, more preferably about 38-45%, more preferably about 40-42%;

[0062] Structural lipid: about 30-55%, preferably about 35-45%, more preferably about 40-45%, more preferably about 41-44%;

[0063] Neutral lipid: about 5-30%, preferably about 5-20%, more preferably about 10-20%, more preferably about 15%;

[0064] Polymeric lipid: about 0.5-3.5%, preferably about 1-3%, more preferably about 1-2%, more preferably about 1.5-2%.

[0065] In some embodiments, the present application provides a lipid nanoparticle as described above, further comprising at least one cargo selected from a therapeutic agent and / or a prophylactic agent; preferably, wherein the cargo is a nucleic acid molecule for use as an HPV vaccine.

[0066] In some embodiments, the nucleic acid molecule for use as an HPV vaccine comprises an open reading frame (ORF) comprising:

[0067] a nucleotide sequence encoding an immune costimulatory factor; and

[0068] a nucleotide sequence encoding a self-cleaving peptide located between the nucleotide sequence encoding the HPV antigen and the nucleotide sequence encoding the immune costimulatory factor.

[0069] In some embodiments, the HPV antigen comprises at least one HPV immunogenic polypeptide from at least one HPV serotype.

[0070] In some embodiments, wherein the at least one HPV serotype is selected from the group consisting of serotypes 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39, preferably, the at least one HPV serotype is serotype 16 and / or serotype 18.

[0071] In some embodiments, wherein the HPV immunogenic polypeptide is selected from the group consisting of an El, E2, E3, E4, E5, E6, E7, LI or L2 polypeptide of HPV or an immunogenic variant thereof, preferably, the HPV immunogenic polypeptide is selected from the group consisting of an E6, E7, L2 polypeptide or an immunogenic variant thereof, more preferably, the HPV immunogenic polypeptide is selected from the group consisting of an E6, E7 polypeptide or an immunogenic variant thereof.

[0072] In some embodiments, the HPV antigen comprises two HPV immunogenic polypeptides from one HPV serotype, or, the HPV antigen comprises two HPV immunogenic polypeptides from two HPV serotypes.

[0073] In some embodiments, wherein the HPV antigen comprises

[0074] i) an E6 polypeptide and an E7 polypeptide from HPV serotype 16;

[0075] ii) an E6 polypeptide and an E7 polypeptide from HPV serotype 18; or

[0076] iii) an E6 polypeptide and an E7 polypeptide from HPV serotype 16 and an E6 polypeptide and an E7 polypeptide from HPV serotype 18.

[0077] In some embodiments, the E6 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 41 or SEQ ID NO: 67 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 41 or SEQ ID NO: 67;

[0078] In some embodiments, the E7 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 42 or SEQ ID NO: 68 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 42 or SEQ ID NO: 68;

[0079] In some embodiments, the E6 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 43 or SEQ ID NO: 69 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 43 or SEQ ID NO: 69;

[0080] In some embodiments, the E7 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 70 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 44 or SEQ ID NO: 70.

[0081] In some embodiments, the HPV antigen can further comprise a signal peptide, whereby secretion expression of the HPV immunogenic polypeptide is achieved, for example, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 48.

[0082] In some embodiments, the different polypeptides comprised in the HPV antigen are directly linked or linked via a peptide linker, for example, the peptide linker comprises the sequence GnS, n being an integer from 1 to 5, for example n is 1 or 3.

[0083] In some embodiments, wherein the immune co-stimulatory factor is selected from Flt3Lecd, GM-CSF, OX40L, HMGB1 or HSP70p, preferably GM-CSF and OX40L, more preferably GM-CSF.

[0084] In some embodiments, wherein the GM-CSF comprises the amino acid sequence set forth in SEQ ID NO: 50.

[0085] In some embodiments, wherein the self-cleaving peptide is a 2A polypeptide, preferably a T2A polypeptide or a P2A polypeptide, more preferably a T2A polypeptide.

[0086] In some embodiments, wherein the T2A polypeptide amino acid sequence is set forth in SEQ ID NO: 64.

[0087] In some embodiments, wherein the ORF comprises, in the 5’ to 3’ direction, the nucleotide sequence encoding the HPV antigen, the nucleotide sequence encoding the self-cleaving peptide and the nucleotide sequence encoding the immune co-stimulatory factor.

[0088] In some embodiments, wherein the ORF encodes an amino acid sequence comprising the structure: SP-HPV immunogenic polypeptide-2A-GMCSF, wherein SP is a signal peptide, 2A is a 2A polypeptide, and GMCSF is human or murine GM-CSF; preferably, the ORF encodes an amino acid sequence comprising the structure: SP-E6 16 -E7 16 -E6 18 -E7 18 -2A-GMCSF, wherein SP is a signal peptide, E6 16 and E7 16 are E6 and E7 polypeptides from HPV serotype 16, respectively, E6 18 and E7 18 are E6 and E7 polypeptides from HPV serotype 18, respectively, 2A is a 2A polypeptide, and GMCSF is human or murine GM-CSF.

[0089] In some embodiments, wherein the ORF encodes an amino acid sequence set forth in one of SEQ ID NOs: 3-6 and 8-18 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 3-6 and 8-18,

[0090] Preferably, the ORF encodes an amino acid sequence as set forth in SEQ ID NO: 11 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 11.

[0091] In some embodiments, wherein the ORF comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 23-26 and 28-38 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 23-26 and 28-38,

[0092] Preferably, the ORF comprises a nucleotide sequence as set forth in SEQ ID NO: 31 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 31.

[0093] In some embodiments, wherein the nucleic acid molecule is an mRNA molecule.

[0094] In some embodiments, wherein the mRNA molecule further comprises a 5’ UTR and / or a 3’ UTR.

[0095] In some embodiments, wherein the 5’ UTR comprises a nucleotide sequence as set forth in SEQ ID NO: 57 and the 3’ UTR comprises a nucleotide sequence as set forth in SEQ ID NO: 58; or the 5’ UTR comprises a nucleotide sequence as set forth in SEQ ID NO: 59 and the 3’ UTR comprises a nucleotide sequence as set forth in SEQ ID NO: 60.

[0096] In some embodiments, wherein the mRNA molecule further comprises a poly(A) sequence.

[0097] In some embodiments, wherein the poly(A) sequence comprises about 20 to about 500 adenine nucleotides (A), preferably, the poly(A) sequence comprises 120 adenine nucleotides (A).

[0098] In some embodiments, wherein the mRNA molecule comprises a nucleotide sequence as set forth in SEQ ID NO: 66 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 66.

[0099] In some embodiments, wherein the mRNA molecule further comprises a 5' cap structure, for example, the 5' cap structure is a Cap1 cap structure.

[0100] In some embodiments, wherein the mRNA molecule further comprises at least one modified nucleotide, preferably the modified nucleotide is selected from pseudouridine, N1 -methyl-pseudouridine, 5-methylcytidine, or a combination thereof.

[0101] In another aspect, the present application provides a method for preparing the lipid nanoparticle of the present application, comprising: mixing the lipid components in the lipid nanoparticle, and mixing with the cargo to obtain the lipid nanoparticle.

[0102] In another aspect, the present application provides a composition comprising the lipid nanoparticle of the present application.

[0103] In another aspect, the present application provides a pharmaceutical composition containing the nucleic acid molecule or the lipid nanoparticle of the present application and optionally a pharmaceutically acceptable excipient, such as a carrier, adjuvant or vehicle, preferably a liquid formulation, more preferably an injection.

[0104] In another aspect, the present application provides an immunogenic composition comprising the nucleic acid molecule or the lipid nanoparticle of the present application, and a pharmaceutically acceptable carrier. The immunogenic composition is used for preventing and / or treating HPV infection and / or HPV infection related pathologies in a subject.

[0105] In another aspect, the present application provides the use of the lipid nanoparticle or the composition or the pharmaceutical composition or the immunogenic composition of the present application in the manufacture of a medicament for preventing and / or treating a disease, wherein the disease is HPV infection and / or HPV infection related pathologies.

[0106] In another aspect, the present application also provides the use of the lipid nanoparticle or the composition or the pharmaceutical composition or the immunogenic composition of the present application in the manufacture of a vaccine for preventing and / or treating HPV infection and / or HPV infection related pathologies in a subject.

[0107] In the present application, the HPV infection can be an infection with any HPV serotype. In some embodiments, the HPV is a low-risk HPV, such as type 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, etc. In some embodiments, the HPV is a high-risk HPV, such as type 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39, etc. In some embodiments, the HPV infection is an infection with a single HPV serotype. In some embodiments, the HPV infection is a mixed infection with two or more different HPV serotypes. In some preferred embodiments, the HPV infection is an infection with HPV 16 and / or HPV 18.

[0108] In the present application, the HPV infection-related pathology includes, but is not limited to, skin warts, such as common warts, plantar warts, flat warts, Bowen's disease, butcher's warts, or condyloma acuminata; HPV-positive tumors such as HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), prostate cancer, or bladder cancer, etc.

[0109] In some preferred embodiments, the HPV infection-related pathology is a HPV-positive tumor such as HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), prostate cancer, or bladder cancer, etc.

[0110] In one embodiment, the lipid nanoparticle or the immunogenic or pharmaceutical composition is administered by injection, such as intramuscular injection, intravenous injection, intra-arterial injection, or intraperitoneal injection, preferably intramuscular injection.

[0111] In another aspect, the present application provides the lipid nanoparticle or the composition or the pharmaceutical composition or the immunogenic composition of the present application for use in delivery.

[0112] Actual dosage levels of the active ingredients in the present immunogenic compositions can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject. The selected dosage level will depend on a variety of pharmacokinetic factors, including the activity of the particular composition of the present application employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds, and / or materials used in combination with the particular composition employed, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors well known in the medical arts.

[0113] An "effective amount" of a nucleic acid molecule or a lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application preferably results in a decrease in severity of a disease symptom, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. For example, for the treatment of HPV-positive tumors, an "effective amount" of a nucleic acid molecule or a lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application preferably inhibits cell growth or tumor growth by at least about 10%, preferably by at least about 20%, more preferably by at least about 30%, more preferably by at least about 40%, more preferably by at least about 50%, more preferably by at least about 60%, more preferably by at least about 70%, more preferably by at least about 80%, relative to a subject who has not received treatment. The ability to inhibit tumor growth can be evaluated in an animal model system predictive of efficacy in human tumors. Alternatively, the ability to inhibit cell growth can also be evaluated, such inhibition can be determined in vitro by assays known to the skilled artisan. An effective amount of a nucleic acid molecule or a lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application is capable of reducing tumor size, or otherwise ameliorating a subject's symptoms, such as preventing and / or treating metastasis or recurrence. Such amounts can be determined by one of skill in the art based on factors such as the size of the subject, the severity of the subject's symptoms, and the particular composition chosen or the route of administration chosen.

[0114] A lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application can be administered using one or more methods known in the art by one or more routes of administration. It will be appreciated by one of skill in the art that the route and / or mode of administration will vary depending upon the desired results. Preferred routes of administration of a lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal or other parenteral routes, e.g., injection or infusion. As used herein, the phrase "parenteral administration" means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.

[0115] In another aspect, the application also provides a method of preventing and / or treating an HPV infection and / or an HPV infection-related pathology in a subject, the method comprising administering to the subject an effective amount of a lipid nanoparticle or a composition or a pharmaceutical composition or an immunogenic composition of the application.

[0116] In some embodiments, in particular for the prevention and / or treatment of HPV-positive tumors, the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the application or the method of the application can be combined with a chemotherapeutic agent, an immune checkpoint inhibitor, an antibody targeting a tumor-specific antigen or radiotherapy.

[0117] In some embodiments, the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the application can also be combined with radiotherapy, e.g. comprising the administration of ionizing radiation to the subject, earlier in the course of, during and / or later than the administration of the nucleic acid molecule, the lipid nanoparticle (LNP) or composition or pharmaceutical composition or immunogenic composition of the application.

[0118] In another aspect, the application also provides a kit for use in the methods of the application for the prevention and / or treatment of HPV infection and / or pathologies associated with HPV infection. In some embodiments, the kit comprises the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the application, and optionally a chemotherapeutic agent, an immune checkpoint inhibitor or an antibody targeting a tumor antigen.

[0119] In some embodiments, the immune checkpoint inhibitor in the kit of the application is a PD1 signaling pathway inhibitor; preferably, the PD1 signaling pathway inhibitor is selected from the group consisting of a PD1 antibody, a PDL1 antibody, a PDL2 antibody, or a combination thereof; preferably a PD1 antibody.

[0120] In another aspect, the application provides a combination product comprising:

[0121] (1) the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the application, and

[0122] (2) an immune checkpoint inhibitor; preferably, the immune checkpoint inhibitor is a PD1 signaling pathway inhibitor; preferably, the PD1 signaling pathway inhibitor is selected from the group consisting of a PD1 antibody, a PDL1 antibody, a PDL2 antibody, or a combination thereof; preferably a PD1 antibody.

[0123] In another aspect, the application also provides a method for the prevention and / or treatment of a tumor and / or cancer disease in a subject, the method comprising administering to the subject an effective amount of the above combination product; preferably, the tumor and / or cancer disease is a HPV-positive tumor and / or cancer disease; more preferably, the tumor and / or cancer disease is selected from the group consisting of a HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer.

[0124] Definitions

[0125] Chemical Definitions

[0126] The definitions of specific functional groups and chemical terms are more fully described below.

[0127] When a range of values is listed, it is intended to include each value and sub-range within the range. For example, "C 1-6 "alkyl" includes C1, C2, C3, C4, C5, C6, C 1-6 , C 1-5 , C 1-4 , C 1-3 , C 1-2 , C 2-6 , C 2-5 , C 2-4 , C 2-3 , C 3-6 , C 3-5 , C 3-4 , C 4-6 , C 4-5 , and C 5-6 alkyl groups.

[0128] The term "alkyl" refers to a straight-chain or branched-chain saturated hydrocarbon moiety. "C 1-20 "alkyl" refers to a straight-chain or branched-chain saturated hydrocarbon group having from 1 to 20 carbon atoms. In some embodiments, C 4-20 alkyl, C 8-20 alkyl, C 6-14 alkyl, C 7-12 alkyl, C 8-12 alkyl, C 12-20 alkyl, C 12-20 alkyl, C 4-10 alkyl, C 7-11 alkyl, C 8-11 alkyl, C 8-10 alkyl, C 9-10 alkyl, C 8-9 alkyl, C 4-9 alkyl, C 6-9 alkyl, C 7-9 alkyl, C9alkyl, C 2-8 alkyl, C 5-8 alkyl, C 7-8 alkyl, C 4-6 alkyl, C 1-20 alkyl, C 1-14 alkyl, C 2-14 alkyl, C 1-13 alkyl, C 1-12 alkyl, C 1-10 alkyl, C 1-9 alkyl, C 1-8 alkyl, C 1-7 alkyl, C 2-7 alkyl, C 1-6 alkyl, C2-6 alkyl, C 1-5 alkyl, C 1-4 alkyl, C 2-4 alkyl, C 1-3 alkyl, C 2-3 alkyl, C 1-2 alkyl and Me are preferred. C 1-6 Examples of alkyl groups include: methyl (Ci), ethyl (C2), n-propyl (C3), i-propyl (C3), n-butyl (C4), t-butyl (C4), sec-butyl (C4), i-butyl (C4), n-pentyl (C5), 3-pentyl (C5), amyl (C5), neopentyl (C5), 3-methyl-2-butyl (C5), t-amyl (C5), and n-hexyl (C6). The term "C 1-6 alkyl" also includes heteroalkyl groups, wherein one or more (e.g., 1, 2, 3, or 4) carbon atoms are replaced with a heteroatom (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus). An alkyl group can be optionally substituted with one or more substituents, for example, with 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. Conventional alkyl abbreviations include: Me (-CH3), Et (-CH2CH3), iPr (-CH(CH3)2), nPr (-CH2CH2CH3), n-Bu (-CH2CH2CH2CH3), or i-Bu (-CH2CH(CH3)2). In some embodiments, alkyl is preferably straight chain alkyl.

[0129] The term "alkenyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon double bonds. "C 4-20 alkenyl" refers to a straight-chain or branched hydrocarbon group having from 4 to 20 carbon atoms and at least one carbon-carbon double bond. In some embodiments, C 2-13 alkenyl, C 4-14 alkenyl, C 6-14 alkenyl, C 4-10 alkenyl, C 2-10 alkenyl, C 2-9 alkenyl, C 2-6 alkenyl and C 2-4 alkenyl is preferred. C 2-6 Examples of alkenyl groups include: ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. The term "C 2-6 alkenyl" also includes heteroalkenyl groups, wherein one or more (e.g., 1, 2, 3, or 4) carbon atoms are replaced with a heteroatom (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus). An alkenyl group can be optionally substituted with one or more substituents, for example, with 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0130] The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 4-20 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-13 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 4-14 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 6-14 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 4-10 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-10 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-9 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-6 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-4 The term "alkynyl" refers to a straight-chain or branched hydrocarbon moiety having one or more carbon-carbon triple bonds. "C 2-6 Examples of alkynyl groups include, but are not limited to: ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), 2-butynyl (C4), pentynyl (C5), hexynyl (C6), and the like. The term "C 2-6 The term "alkynyl" also includes heteroalkynyl groups in which one or more (e.g., 1, 2, 3, or 4) carbon atoms are replaced by a heteroatom (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus). An alkynyl group can be optionally substituted by one or more substituents, e.g., by 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0131] The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from an alkyl group, which can be substituted or unsubstituted. "C 1-20 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 1-20 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 4-20 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 6-14 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 7-12 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 8-12 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 4-10 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 7-11 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 8-11 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 8-10 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 9-10 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 8-9 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 4-9 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 6-9 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 7-9 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 2-8 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 5-8 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 7-8 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 4-6 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 1-20 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 1-14 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 2-14 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C 1-13 The term "alkylene" refers to a divalent radical resulting from the removal of two hydrogens from a C1-12 alkylene, C 1-10 alkylene, C 1-9 alkylene, C 1-8 alkylene, C 1-7 alkylene, C 2-7 alkylene, C 1-6 alkylene, C 2-6 alkylene, C 1-5 alkylene, C5alkylene, C 1-4 alkylene, C 2-4 alkylene, C 1-3 alkylene, C 2-3 alkylene, C 1-2 alkylene and methylene are preferred. Unsubstituted alkylene groups include, but are not limited to, methylene (-CH2-), ethylene (-CH2CH2-), propylene (-CH2CH2CH2-), butylene (-CH2CH2CH2CH2-), pentylene (-CH2CH2CH2CH2CH2-), hexylene (-CH2CH2CH2CH2CH2CH2-), and the like. Exemplary substituted alkylene groups, e.g., alkylene groups substituted with one or more alkyl (methyl) groups, include, but are not limited to, substituted methylene (-CH(CH3)-, -C(CH3)2-), substituted ethylene (-CH(CH3)CH2-, -CH2CH(CH3)-, -C(CH3)2CH2-, -CH2C(CH3)2-), substituted propylene (-CH(CH3)CH2CH2-, -CH2CH(CH3)CH2-, -CH2CH2CH(CH3)-, -C(CH3)2CH2CH2-, -CH2C(CH3)2CH2-, -CH2CH2C(CH3)2-), and the like. 2-

[0132] "C 0-6 alkylene" means a chemical bond and the above "C 1-6 alkylene" means a chemical bond and the above "C 0-4 alkylene" means a chemical bond and the above "C 1-4 alkylene".

[0133] The term "the total length of variable A and variable B is x carbon atoms" means the sum of the number of carbon atoms in the main chain of the group represented by variable A and the number of carbon atoms in the main chain of the group represented by variable B is x.

[0134] "Halo" or "halogen" means fluoro (F), chloro (Cl), bromo (Br), and iodo (I).

[0135] Thus, "C 1-10 haloalkyl" means the above "C 1-10 ​"alkyl" is substituted with one or more halogen groups. In some embodiments, C 1-8 Haloalkyl, C 1-6 Haloalkyl, C 1-4 Haloalkyl, C 1-3 Halogenated alkyl groups are particularly preferred, and C4 groups are more preferred. 1-2 Halogenated alkyl groups. Exemplary alkyl halogenated groups include, but are not limited to: -CF3, -CH2F, -CHF2, -CHFCH2F, -CH2CHF2, -CF2CF3, -CCl3, -CH2Cl, -CHCl2, 2,2,2-trifluoro-1,1-dimethyl-ethyl, etc. The alkyl halogenated group can be substituted at any available connection point, for example, 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0136] “C 3-14 "Cycloalkyl" or "3- to 14-membered cycloalkyl" refers to a non-aromatic cyclic hydrocarbon group having 3 to 14 ring carbon atoms and zero heteroatoms, optionally containing 1, 2, or 3 double or triple bonds. In some embodiments, 3- to 10-membered cycloalkyl, 5- to 10-membered cycloalkyl, 3- to 8-membered cycloalkyl, 3- to 7-membered cycloalkyl, and 3- to 6-membered cycloalkyl are particularly preferred, more preferably 5- to 7-membered cycloalkyl, 4- to 6-membered cycloalkyl, 3- to 5-membered cycloalkyl, 3- to 4-membered cycloalkyl, and 5- to 6-membered cycloalkyl, more preferably 5-membered cycloalkyl, more preferably 6-membered cycloalkyl, and more preferably cyclopropyl. Cycloalkyl also includes a cyclic system in which the aforementioned cycloalkyl ring is fused with one or more aryl or heteroaryl groups, wherein the bonding point is on the cycloalkyl ring, and in such cases, the number of carbons continues to indicate the number of carbons in the cycloalkyl system. Cycloalkyl also includes a cyclic system in which the aforementioned cycloalkyl ring, Substituents on any non-adjacent carbon atoms are linked together to form a bridged ring, forming a polycyclic alkane sharing two or more carbon atoms. Cycloalkyl groups also include the aforementioned cycloalkyl rings, where substituents on the same carbon atom are linked together to form a ring, forming a polycyclic alkane sharing one carbon atom. Exemplary cycloalkyl groups include, but are not limited to: cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cyclohepttrienyl (C7), etc. The cycloalkyl group may be optionally substituted with one or more substituents, for example, substituted with 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0137] “C 3-14 "Cycloalkylene" refers to the alkylene oxide that has had C removed. 3-14 The cycloalkyl group is a divalent group formed by another hydrogen atom, and can be substituted or unsubstituted. In some embodiments, C 3-10 Cycloalkylene, C3-7 cycloalkylene, C 3-6 cycloalkylene, C 3-5 cycloalkylene and C 3-4 Cycloalkylene is particularly preferred, especially cyclopropylene.

[0138] "3-14 membered heterocyclyl" or "3 to 14 membered heterocyclyl" refers to a saturated or unsaturated radical of a 3 to 14 membered non-aromatic ring system having ring carbon atoms and 1 to 5 ring heteroatoms, wherein each heteroatom is independently selected from the group consisting of nitrogen, oxygen, sulfur, boron, phosphorus, and silicon, wherein optionally containing 1, 2, or 3 double or triple bonds. In heterocyclyl groups containing one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valence permits. In some embodiments, 3 to 10 membered heterocyclyl is preferred, which is a 3 to 10 membered non-aromatic ring system having ring carbon atoms and 1 to 5 ring heteroatoms; in some embodiments, 5 to 10 membered heterocyclyl is preferred, which is a 5 to 10 membered non-aromatic ring system having ring carbon atoms and 1 to 5 ring heteroatoms; in some embodiments, 3 to 8 membered heterocyclyl is preferred, which is a 3 to 8 membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms; in some embodiments, 3 to 7 membered heterocyclyl is preferred, which is a 3 to 7 membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms; 5 to 7 membered heterocyclyl is preferred, which is a 5 to 7 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms; 3 to 6 membered heterocyclyl is preferred, which is a 3 to 6 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms; 4 to 6 membered heterocyclyl is preferred, which is a 4 to 6 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms; 5 to 6 membered heterocyclyl is more preferred, which is a 5 to 6 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms; 5 membered heterocyclyl is preferred, which is a 5 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms; 6 membered heterocyclyl is preferred, which is a 6 membered non-aromatic ring system having ring carbon atoms and 1 to 3 ring heteroatoms. Heterocyclyl also includes ring systems in which the above heterocyclyl ring is fused with one or more cycloalkyl rings, wherein the point of attachment is on the heterocyclyl ring, or with one or more aryl or heteroaryl rings, wherein the point of attachment is on the heterocyclyl ring; and in such cases the number of ring members continues to refer to the number of ring members in the heterocyclyl ring system. Heterocyclyl also includes ring systems in which the above heterocyclyl ring, wherein any non-adjacent carbon or nitrogen atoms on which substituents are attached form a bridge ring, together form a polycycloalkyl that shares two or more carbon or nitrogen atoms. Heterocyclyl also includes ring systems in which the above heterocyclyl ring, wherein substituents on the same carbon atom are connected to form a ring, together form a polycycloalkyl that shares one carbon atom. Exemplary 3 membered heterocyclyl groups containing one heteroatom include, but are not limited to: aziridinyl, oxiranyl, thiorenyl. Exemplary 4 membered heterocyclyl groups containing one heteroatom include, but are not limited to: azetidinyl, oxetanyl, and thietanyl. Exemplary 5 membered heterocyclyl groups containing one heteroatom include, but are not limited to: tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione.Exemplary 5-membered heterocyclic groups containing two heteroatoms include, but are not limited to: pyrazolyl, dioxasulfuranyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5-membered heterocyclic groups containing three heteroatoms include, but are not limited to: triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclic groups containing one heteroatom include, but are not limited to: piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6-membered heterocyclic groups containing two heteroatoms include, but are not limited to: piperazinyl, morpholinyl, disulfuranyl, and dioxalyl. Exemplary 6-membered heterocyclic groups containing three heteroatoms include, but are not limited to: triazinanyl. Exemplary 7-membered heterocyclic groups containing one heteroatom include, but are not limited to: azirheptanyl, oxasulfuranyl, and thioheptanyl. Exemplary 5-membered heterocyclic groups fused to a C6 aryl ring (also referred to herein as 5,6-bicyclic heterocyclic groups) include, but are not limited to: dihydroindolyl, isodihydroindolyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, benzoxazolinoneyl, etc. Exemplary 6-membered heterocyclic groups fused to a C6 aryl ring (also referred to herein as 6,6-bicyclic heterocyclic groups) include, but are not limited to: tetrahydroquinolinyl, tetrahydroisoquinolinyl, etc. Heterocyclic groups also include those that share one or two atoms with a cycloalkyl, heterocyclic, aryl, or heteroaryl group to form a bridged or spirocyclic ring, wherein the shared atom may be a carbon or nitrogen atom, provided that the valence allows. Heterocyclic groups also include those that can be optionally substituted with one or more substituents, for example, substituted with 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0139] “C 6-10 "Aryl" refers to a monocyclic or polycyclic (e.g., bicyclic) 4n+2 aromatic ring system (e.g., having 6 or 10 shared π electrons arranged in a ring) having 6-10 ring carbon atoms and zero heteroatoms. In some embodiments, the aryl group has six ring carbon atoms ("C6 aryl"; e.g., phenyl). In some embodiments, the aryl group has ten ring carbon atoms ("C6 aryl"). 10 "Aryl"; for example, naphthyl, such as 1-naphthyl and 2-naphthyl). Aryl also includes a ring system in which the above-mentioned aryl ring is fused with one or more cycloalkyl or heterocyclic groups, and the connection point is on the aryl ring, in which case the number of carbon atoms continues to represent the number of carbon atoms in the aryl ring system. The aryl group may be optionally substituted by one or more substituents, for example, by 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0140] "5-14 membered heteroaryl" or "5 to 14 membered heteroaryl" refers to a radical of a 5-14 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur. In heteroaryl groups containing one or more nitrogen atoms, the point of attachment can be a carbon or a nitrogen atom, as valence permits. Heteroaryl bicyclic systems can include one or more heteroatoms in one or both rings. Heteroaryl also includes ring systems wherein an above-described heteroaryl ring is fused with one or more cycloalkyl or heterocyclyl rings, and the point of attachment is on the heteroaryl ring, in which case the number of carbon atoms indicates the number of carbon atoms in the heteroaryl ring system. In some embodiments, 5-10 membered heteroaryl is preferred, which is a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms. In other embodiments, 5-6 membered heteroaryl is particularly preferred, which is a 5-6 membered monocyclic or bicyclic 4n+2 aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms. Exemplary 5-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl (e.g., 1,2,4-oxadiazolyl), and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl or pyridinonyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetrazinyl, respectively. Exemplary 7-membered heteroaryl groups containing one heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzoimidazolyl, benzoxazolyl, benzoisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. A heteroaryl group can be optionally substituted with one or more substituents, e.g., with 1 to 5 substituents, 1 to 3 substituents, or 1 substituent.

[0141] "Optionally substituted" means that the group can be substituted or unsubstituted.

[0142] The divalent radical formed by removing two hydrogens from the above-defined alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups is referred to as an "alkylene" group. The ring-forming groups cycloalkyl, heterocyclyl, aryl, and heteroaryl are collectively referred to as "ring groups."

[0143] The alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups defined herein are optionally substituted groups.

[0144] Exemplary substituents on carbon atoms include, but are not limited to: halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OR aa , -ON(R bb )2, -N(R bb )2, -N(R bb )3 + X - , -N(OR cc )R bb , -SH, -SR aa , -SSR cc , -C(=O)R aa , -CO2H, -CHO, -C(OR cc )2, -CO2R aa , -OC(=O)R aa , -OCO2R aa , -C(=O)N(R bb )2, -OC(=O)N(R bb )2, -NR bb C(=O)R aa , -NR bb CO2R aa , -NR bb C(=O)N(R bb )2, -C(=NR bb )R aa , -C(=NR bb )OR aa , -OC(=NR bb )R aa , -OC(=NR bb )OR aa , -C(=NR bb )N(R bb )2, -OC(=NR bb )N(R bb )2, -NR bb C(=NR bb )N(R bb )2, -C(=O)NR bb SO2R aa, -NR bb SO2R aa , -SO2N(R bb )2, -SO2R aa , -SO2OR aa , -OSO2R aa , -S(=O)R aa , -OS(=O)R aa , -Si(R aa )3, -OSi(R aa )3, -C(=S)N(R bb )2, -C(=O)SR aa , -C(=S)SR aa , -SC(=S)SR aa , -SC(=O)SR aa , -OC(=O)SR aa , -SC(=O)OR aa , -SC(=O)R aa , -P(=O)2R aa , -OP(=O)2R aa , -P(=O)(R aa )2, -OP(=O)(R aa )2, -OP(=O)(OR cc )2, -P(=O)2N(R bb )2, -OP(=O)2N(R bb )2, -P(=O)(NR bb )2, -OP(=O)(NR bb )2, -NR bb P(=O)(OR cc )2, -NR bb P(=O)(NR bb )2, -P(R cc )2, -P(R cc )3, -OP(R cc )2, -OP(R cc )3, -B(R aa )2, -B(OR cc )2, -BR aa (OR cc ), alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R dd groups;

[0145] or two geminal hydrogens on a carbon atom are replaced with a group =O, =S, =NN(Rbb )2, =NNR bb C(=O)R aa , =NNR bb C(=O)OR aa , =NNR bb S(=O)2R aa , =NR bb or =NOR cc substituted;

[0146] R aa each independently is selected from alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, or two R aa groups are joined to form a heterocyclyl or heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R dd groups;

[0147] R bb each independently is selected from: hydrogen, -OH, -OR aa , -N(R cc )2, -CN, -C(=O)R aa , -C(=O)N(R cc )2, -CO2R aa , -SO2R aa , -C(=NR cc )OR aa , -C(=NR cc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc , -SOR aa , -C(=S)N(R cc )2, -C(=O)SR cc , -C(=S)SR cc , -P(=O)2R aa , -P(=O)(R aa )2, -P(=O)2N(R cc )2, -P(=O)(NR cc )2, alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, or two R bb groups are joined to form a heterocyclyl or heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R dd groups;

[0148] Rcc Each is independently selected from hydrogen, alkyl, haloalkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, or two R cc Groups are combined to form heterocyclic or heteroaryl rings, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl group is independently bounded by 0, 1, 2, 3, 4, or 5 R groups. dd Group substitution;

[0149] R dd Each is independently selected from: halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OR ee -ON(R) ff )2、-N(R ff )2,、-N(R ff )3 + X - -N(OR) ee )R ff -SH, -SR ee -SSR ee -C(=O)R ee -CO2H, -CO2R ee -OC(=O)R ee -OCO2R ee -C(=O)N(R) ff )2、-OC(=O)N(R ff )2、-NR ff C(=O)R ee -NR ff CO2R ee -NR ff C(=O)N(R ff )2、-C(=NR ff OR ee -OC(=NR) ff )R ee -OC(=NR) ff OR ee -C(=NR) ff )N(R ff )2、-OC(=NR ff )N(R ff )2、-NR ff C(=NR ff )N(R ff )2、-NR ff SO2R ee -SO2N(R) ff )2、-SO2R ee -SO2OR ee -OSO2Ree -S(=O)R ee -Si(R ee )3, -OSi(R ee )3, -C(=S)N(R ff )2, -C(=O)SR ee , -C(=S)SR ee , -SC(=S)SR ee , -P(=O)2R ee , -P(=O)(R ee )2, -OP(=O)(R ee )2, -OP(=O)(OR ee )2, alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R gg groups, or two geminal R dd substituents can be combined to form =O or =S;

[0150] each R ee is independently selected from alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, aryl, heterocyclyl, and heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R gg groups;

[0151] each R ff is independently selected from hydrogen, alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, or two R ff groups combine to form a heterocyclyl or heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R gg groups;

[0152] each R gg is independently halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OC 1-6 alkyl, -ON(C 1-6 alkyl)2, -N(C 1-6 alkyl)2, -N(C 1-6 alkyl)3 + X - , -NH(C 1-6 alkyl)2 + X - , -NH2(C 1-6 alkyl) + X --NH3 + X - -N(OC 1-6 alkyl)(C 1-6 alkyl), -N(OH)(C 1-6 alkyl), -NH(OH), -SH, -SC 1-6 alkyl, -SS(C 1-6 alkyl), -C(=O)(C 1-6 alkyl), -CO2H, -CO2(C 1-6 alkyl), -OC(=O)(C 1-6 alkyl), -OCO2(C 1-6 alkyl), -C(=O)NH2, -C(=O)N(C 1-6 alkyl)2, -OC(=O)NH(C 1-6 alkyl), -NHC(=O)(C 1-6 alkyl), -N(C 1-6 alkyl)C(=O)(C 1-6 alkyl), -NHCO2(C 1-6 alkyl), -NHC(=O)N(C 1-6 alkyl)2, -NHC(=O)NH(C 1-6 alkyl), -NHC(=O)NH2, -C(=NH)O(C 1-6 alkyl), -OC(=NH)(C 1-6 alkyl), -OC(=NH)OC 1-6 alkyl, -C(=NH)N(C 1-6 alkyl)2, -C(=NH)NH(C 1-6 alkyl), -C(=NH)NH2, -OC(=NH)N(C 1-6 alkyl)2, -OC(NH)NH(C 1-6 alkyl), -OC(NH)NH2, -NHC(NH)N(C 1-6 alkyl)2, -NHC(=NH)NH2, -NHSO2(C 1-6 alkyl), -SO2N(C 1-6 alkyl)2, -SO2NH(C 1-6 alkyl), -SO2NH2, -SO2C 1-6 alkyl, -SO2OC 1-6 alkyl, -OSO2C 1-6 alkyl, -SOC 1-6 alkyl, -Si(C 1-6 alkyl)3, -OSi(C 1-6 alkyl)3, -C(=S)N(C 1-6 alkyl)2, C(=S)NH(C1-6 alkyl), -C(=S)NH2, -C(=O)S(C 1-6 alkyl), -C(=S)SC 1-6 alkyl, -SC(=S)SC 1-6 alkyl, -P(=O)2(C 1-6 alkyl), -P(=O)(C 1-6 alkyl)2, -OP(=O)(C 1-6 alkyl)2, -OP(=O)(OC 1-6 alkyl)2, C 1-6 alkyl, C 1-6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C6-C 10 aryl, 3-7 membered heterocyclyl, 5-10 membered heteroaryl; or two geminal R gg substituents can combine to form =O or =S; wherein X - is a counterion.

[0153] Exemplary substituents on a nitrogen atom include, but are not limited to: hydrogen, -OH, -OR aa , -N(R cc )2, -CN, -C(=O)R aa , -C(=O)N(R cc )2, -CO2R aa , -SO2R aa , -C(=NR bb )R aa , -C(=NR cc )OR aa , -C(=NR cc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc , -SOR aa , -C(=S)N(R cc )2, -C(=O)SR cc , -C(=S)SR cc , -P(=O)2R aa , -P(=O)(R aa )2, -P(=O)2N(R cc )2, -P(=O)(NR cc )2, alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, or two R ccgroups form a heterocyclyl or heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 R dd groups, and wherein R aa , R bb , R cc , and R dd are as described above.

[0154] “Nucleic acid” or “nucleic acid molecule” refers to a single- or double-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecule and hybrid molecules thereof. Examples of nucleic acid molecules include, but are not limited to, messenger RNA (mRNA), microRNA (miRNA), small interfering RNA (siRNA), self-amplifying RNA (saRNA), and antisense oligonucleotides (ASO), among others. The nucleic acid can be further chemically modified, the chemical modification being selected from one of pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-methylcytosine, or a combination thereof. The mRNA molecule contains a protein coding region, and can further contain expression regulatory sequences, typical expression regulatory sequences including, but not limited to, 5’ cap, 5’ untranslated region (5’ UTR), 3’ untranslated region (3’ UTR), polyadenylation sequence (Poly A), miRNA binding site.

[0155] “Ionizable lipid” refers to lipids that are ionizable, such that they can exist in a positively charged or neutral form depending on the pH. In some embodiments, the ionizable lipid is an amino lipid.

[0156] “Neutral lipid” refers to a lipid molecule that is not charged under certain pH conditions, such as physiological pH conditions. Examples of neutral lipids include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE).

[0157] "Structural lipid" refers to a lipid that enhances nanoparticle stability by filling the gaps between lipids, often seen with steroids. Steroids are compounds having a cyclopentanoperhydrophenanthrene carbon skeleton, in a preferred embodiment the steroid is selected from cholesterol, sitosterol, coprostanol, fecosterol, brassicasterol, ergosterol, tomatidine, ursolic acid, alpha-tocopherol, stigmasterol, avenasterol, ergocalciferol or campesterol.

[0158] "Polymeric lipid" refers to a molecule that contains both a polymeric moiety and a lipid moiety. In some embodiments, the polymeric lipid is a polyethylene glycol (PEG) lipid. Other lipids that can reduce aggregation, such as the product of coupling a compound having no charge, hydrophilic, steric hindering moiety to a lipid, can also be used.

[0159] "Lipid nanoparticle" refers to a particle that contains a lipid component, having a nanoscale size.

[0160] "Biodegradable group" refers to a functional group that contains a biodegradable bond, such as an ester, disulfide bond, and amide, among others. Biodegradation can affect the process of clearing a compound from the body. The direction of the biodegradable group of the present application is from the head to the tail of the ionizable lipid molecule.

[0161] Other definitions

[0162] As used herein, the term "and / or" encompasses all combinations of the items linked by the term "and / or". For example, "A and / or B" covers the cases where "A" is true, "B" is true, and "A and B" are true. For example, "A, B, and / or C" covers the cases where "A" is true, "B" is true, "C" is true, "A and B" are true, "A and C" are true, "B and C" are true, and "A and B and C" are true.

[0163] As used herein, the terms "comprising", "having", and "including" are open- ended, and mean that the specified element, component, step, etc. is included, but not that other elements, components, steps, etc. are excluded.

[0164] As used herein, the term "about" means approximately, roughly, or in the approximate range. When the term "about" is used in conjunction with a numerical value, it modifies that value by extending it by the margin of error associated with the measurement, typically +20%, preferably +10%, of the stated value, e.g., about 15 means any value in the range of 12-18.

[0165] As used herein, the terms "polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single- or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or altered nucleotide bases. Nucleotides are referred to by their single letter designation: "A" is adenine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" denotes cytosine or deoxycytosine, "G" denotes guanine or deoxyguanine, "U" denotes uridine, "T" denotes deoxythymidine, "R" denotes purine (A or G), "Y" denotes pyrimidine (C or T), "K" denotes G or T, "H" denotes A or C or T, "I" denotes inosine, and "N" denotes any nucleotide. Although nucleotide sequences herein can be represented in DNA sequence (containing T), the corresponding RNA sequence (i.e., with U in place of T) can be readily determined by one of skill in the art when RNA is referred to.

[0166] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" can also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0167] The word "comprising" when used in relation to a sequence of a protein or nucleic acid, means that the protein or nucleic acid can consist of the sequence, or can have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described herein.

[0168] "Sequence identity" between two polypeptide sequences or between two polynucleotide sequences refers to the percentage of identical amino acids or nucleotides between the sequences. Methods of assessing the level of sequence identity between polypeptide or polynucleotide sequences are known in the art. Sequence identity can be assessed using various sequence analysis software known. For example, sequence identity can be assessed by the online alignment tool of EMBL-EBI (https: / / www.ebi.ac.uk / Tools / psa / ). Sequence identity between two sequences can be assessed using the Needleman-Wunsch algorithm, using default parameters. Sequence identity can be over the full length of a given sequence.

[0169] “mRNA” or “messenger RNA” are used interchangeably herein to refer to a single-stranded ribonucleic acid molecule that carries genetic information capable of directing protein synthesis within a cell. An mRNA typically includes a 5’ UTR, a protein-coding sequence (CDS), and a “3’ UTR”. An mRNA can also include a poly(A) sequence at the 3’ end and a “5’ cap”. An mRNA is generally linear, however the term can also encompass covalently closed circular RNA molecules.

[0170] As used herein, “5’ UTR” generally refers to the sequence of an mRNA molecule between the 5’ end and the translation initiation codon, which is capable of recruiting ribosome complexes and initiating translation of the mRNA. The 5’ UTR regulates processes such as post-transcriptional modifications, formation and stability of translation initiation complexes, by interacting with transcription factors, ribosomes, and other transcriptional regulatory proteins. The term “5’ UTR” also encompasses ribosome entry site (IRES) sequences, particularly for circular RNA molecules.

[0171] As used herein, “3’ UTR” refers to the sequence of an mRNA between the stop codon of the polypeptide-coding sequence and the poly(A) sequence. The 3’ UTR can regulate translation of the mRNA by interacting with mRNA-binding proteins, miRNAs, and the like. Sequence and structural features of the 3’ UTR can affect the stability of the mRNA, scanning of the ribosome, and formation of the translation termination complex, thereby affecting the expression level of the protein.

[0172] A poly(A) sequence generally comprises a plurality of adenine nucleotides. Addition of a poly(A) sequence aids in the stability and transport of the mRNA, protecting it from degradation, and plays an important role in post-transcriptional modifications. A poly(A) sequence can be a continuous chain of pure adenine nucleotides, but can also be a variant comprising non-adenine nucleotides, as long as it is functionally equivalent to a conventional poly(A) sequence, i.e., capable of providing similar biological functions as a natural poly(A) sequence, such as affecting the stability, translation efficiency, or ribosome binding of the mRNA. Known poly(A) sequences are, for example, the human growth hormone (hGH) poly(A) sequence and the simian virus 40 (SV40) poly(A) sequence. These variants can differ in nucleotide composition, but are functionally recognized as equivalent to a conventional poly(A) sequence.

[0173] As used herein, a "5' cap" for an RNA includes the 5' cap structure present on natural mRNA as well as analogs thereof. The 5' cap structure on natural mRNA refers to a methylated guanylate linked via a pyrophosphate to the 5' terminal nucleotide of an RNA, forming a 5', 5'-triphosphate linkage. There are generally three types of 5' caps (m7G5'ppp5'Np, m7G5'ppp5'NmpNp, m7G5'ppp5'NmpNmpNp), referred to as Cap 0, Cap 1, and Cap 2, respectively. Cap 0 refers to the terminal nucleotide's ribose being unmethylated, Cap 1 refers to the terminal one nucleotide's ribose being methylated, and Cap 2 refers to both terminal nucleotides' riboses being methylated.

[0174] Methods for capping mRNA molecules are known in the art. The 5' cap structure of the mRNA molecule can be added using enzymatic reactions after the mRNA molecule is obtained by chemical synthesis or in vitro transcription (e.g., by using a commercial kit comprising vaccinia capping enzyme and mRNA cap structure 2'-0-methyltransferase). However, mRNA with a cap structure can also be produced by directly incorporating a nucleotide analog with a cap structure as the first nucleotide into the transcript during in vitro transcription.

[0175] As used herein, "antibody" refers to immunoglobulins and immunoglobulin fragments, whether naturally occurring or produced in whole or in part synthetically (e.g., recombinantly), including any fragment thereof that comprises at least a portion of the variable region of an immunoglobulin molecule that retains the ability to bind with the specificity of a full-length immunoglobulin. Thus, antibodies include any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin antigen binding domain (antibody binding site). Antibodies include antibody fragments, such as anti-tumor cell antibody fragments. As used herein, the term antibody thus includes synthetic antibodies, recombinantly produced antibodies, multispecific antibodies (e.g., bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, intrabodies, and antibody fragments, such as, but not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, disulfide-linked Fvs (dsFvs), Fd fragments, Fd' fragments, single-chain Fvs (scFv), single-chain Fabs (scFab), bispecific antibodies, anti-idiotypic (anti-Id) antibodies, or antigen-binding fragments of any of the above. Antibodies provided herein include members of any immunoglobulin type (e.g., IgG, IgM, IgD, IgE, IgA, and IgY), any class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2), or subclass (e.g., IgG2a and IgG2b).

[0176] The term "pharmaceutically acceptable salt" as used herein denotes those salts of the compounds of the present application which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients without an undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use, including the zwitterionic forms, where possible, of the compounds of the present application.

[0177] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals, hydrides or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine and procaine.

[0178] Base addition salts of acidic compounds can be prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt. The free acid form can be regenerated by contacting the salt form with a sufficient amount of an acid to produce the free acid form. The free acid and base forms can be regenerated by in vitro

[0179] Salts can be sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, chlorides, bromides, and iodides prepared from inorganic acids, such as hydrochloric acid, nitric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, and phosphoric acid. Representative salts include: hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthate, methanesulfonate, gluconate, lactobionate, laurylsulfonate, and hydroxyethanesulfonate. Salts can also be prepared from organic acids, such as aliphatic monocarboxylic and dicarboxylic acids, phenyl-substituted alkyl acids, hydroxyalkyl acids, alkyl diacids, aromatic acids, and aliphatic and aromatic sulfonic acids. Representative salts include acetates, propionates, octanoates, isobutyrates, oxalates, malonates, succinates, octanoates, sebacic acid salts, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, naphthates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, maleates, tartrates, and methanesulfonates. Pharmaceutically acceptable salts may include alkali metal and alkaline earth metal-based cations, such as sodium, lithium, potassium, calcium, and magnesium, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine. It also covers salts of amino acids, such as arginine salts, gluconates, galacturons, etc. (see, for example, Berge S. et al., "Pharmaceutical Salts", J. Pharm. Sci., 1977; 66: 1-19, which is incorporated herein by reference).

[0180] The term "subject" or "subject" includes, but is not limited to: humans (i.e., men or women of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or older adults)) and / or non-human animals, such as mammals, e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys), cattle, pigs, horses, sheep, goats, rodents, cats, and / or dogs. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human animal. The terms "human," "subject," "patient," and "subject" are used interchangeably herein.

[0181] The terms “disease,” “disorder,” and “symptom” are used interchangeably in this article.

[0182] As used herein, unless otherwise noted, the term "treatment" includes the intended action of an agent on a subject suffering from a particular disease, disorder, or condition, which reduces the severity of the disease, disorder, or condition, or retards or slows the progression of the disease, disorder, or condition ("therapeutic treatment"), and also includes the intended action of an agent on a subject prior to the onset of a particular disease, disorder, or condition ("prophylactic treatment").

[0183] In general, an "effective amount" of a pharmaceutical composition refers to a quantity sufficient to achieve a desired biological result. As will be appreciated by those of ordinary skill in the art, the effective amount of a pharmaceutical composition of the application can vary depending on such factors as the biological target, the pharmacokinetics of the pharmaceutical composition, the disease being treated, the mode of administration, and the age, health, and symptoms of the subject. An effective amount includes both a therapeutically effective amount and a prophylactically effective amount.

[0184] As used herein, unless otherwise noted, a "therapeutically effective amount" of a pharmaceutical composition is an amount that is sufficient to provide a therapeutic benefit in the treatment of a disease, disorder, or condition, or to delay or minimize one or more symptoms associated with a disease, disorder, or condition. A therapeutically effective amount of a pharmaceutical composition refers to the amount of therapeutic agent alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment of a disease, disorder, or condition. The term "therapeutically effective amount" can include an amount that improves overall prophylaxis, reduces or avoids symptoms or causes of a disease or condition, or enhances the therapeutic efficacy of another therapeutic agent.

[0185] As used herein, unless otherwise noted, a "prophylactically effective amount" of a pharmaceutical composition is an amount that is sufficient to prevent a disease, disorder, or condition, or to prevent one or more symptoms associated with a disease, disorder, or condition, or to prevent the recurrence of a disease, disorder, or condition. A prophylactically effective amount of a pharmaceutical composition refers to the amount of therapeutic agent alone, or in combination with other agents, that provides a prophylactic benefit in the prevention of a disease, disorder, or condition. The term "prophylactically effective amount" can include an amount that improves overall prophylaxis, or enhances the prophylactic efficacy of another prophylactic agent.

[0186] Pharmaceutically acceptable excipients for use in the application refer to non-toxic carriers, adjuvants or vehicles that do not destroy the pharmacological activity of the compound with which they are co-administered. Pharmaceutically acceptable carriers, adjuvants or vehicles that can be used in the compositions of this application include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphates), glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes (such as protamine sulfate), disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.

[0187] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or topical (e.g., by injection or infusion) administration.

[0188] "Combination" and related terms, such as "combined therapy," refer to the administration of the pharmaceutical composition of the application and the other therapeutic agent(s) simultaneously or sequentially. For example, the pharmaceutical composition of the application can be administered concurrently with the other therapeutic agent(s) in separate unit dosage forms, or concurrently in a single unit dosage form, or sequentially in any order.

[0189] DETAILED DESCRIPTION

[0190] One aspect of the application provides a lipid nanoparticle for delivery of an HPV nucleic acid vaccine, comprising an ionizable lipid, a structural lipid, a neutral lipid, and a polymeric lipid, wherein the ionizable lipid is a compound of Formula (II), or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof,

[0191] wherein,

[0192] a = 1, 2, 3, 4, 5, or 6;

[0193] b = 4, 5, 6, 7, 8, 9, or 10;

[0194] c = 1, 2, 3, 4, 5, or 6;

[0195] d = 0, 1, 2, 3, or 4;

[0196] c + d = 3, 4, 5, 6, 7, 8, or 9;

[0197] M1and M2are independently selected from the group consisting of -C(O)O-, -OC(O)-, -O-, -SC(O)O-, -OC(O)NR-, -NRC(O)NR-, -OC(O)S-, -OC(O)O-, -NRC(O)O-, -SC(O)-, -C(O)S-, -NR-, -C(O)NR-, -NRC(O)-, -NRC(O)S-, -SC(O)NR-, -C(O)-, -OC(S)-, -C(S)O-, -OC(S)NR-, -NRC(S)O-, -S-S-, and -S(O) 0-2 -;

[0198] R1and R2are independently selected from the group consisting of C 4-25 alkyl, C 4-25 alkenyl, and C 4-25 alkynyl, which is optionally substituted with one or more R 1s , and wherein one or more methylene units are optionally and independently replaced with -NR'-;

[0199] R 1s is independently selected from the group consisting of H, C 1-20 alkyl, -L c -OR c , -L c -SR c , and -L c -NR c R' c ;

[0200] R and R' are each independently selected from the group consisting of H and C 1-20 alkyl;

[0201] L c is independently selected from the group consisting of a bond and C 1-20 alkylene;

[0202] R c and R' c are independently selected from the group consisting of H, C 1-20 alkyl, C 3-14 cycloalkyl, and 3- to 14-membered heterocyclyl;

[0203] R4and R5are independently selected from the group consisting of C 1-8 alkyl, which is optionally substituted with one or more R 4s ;

[0204] or R4, R5, together with the carbon atom to which they are attached, form a C 3-14 cycloalkylene or 3- to 14-membered heterocyclylene, which is optionally substituted with one or more R 4s ;

[0205] R 4s is independently selected from the group consisting of H, halogen, cyano, C1-8 alkyl, C 1-8 haloalkyl, -L d -OR d , -L d -SR d and -L d -NR d R’ d ;

[0206] L d is independently selected from the group consisting of a bond and C 1-8 alkylene;

[0207] R d and R’ d are independently selected from the group consisting of H, C 1-8 alkyl, C 3-14 cycloalkyl and 3- to 14-membered heterocyclyl.

[0208] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein the ionizable lipid is a compound of Formula (II), or a pharmaceutically acceptable salt, isotopologue, tautomer, or stereoisomer thereof,

[0209] wherein,

[0210] a = 1, 2, 3, 4, 5, or 6;

[0211] b = 4, 5, 6, 7, 8, 9, or 10;

[0212] c = 1, 2, 3, 4, 5, or 6;

[0213] d = 0, 1, 2, 3, or 4;

[0214] c + d = 3, 4, 5, 6, 7, 8, or 9;

[0215] M1and M2are independently selected from the group consisting of -C(O)O-, -OC(O)-, -O-, -SC(O)O-, -OC(O)NR-, -NRC(O)NR-, -OC(O)S-, -OC(O)O-, -NRC(O)O-, -SC(O)-, -C(O)S-, -NR-, -C(O)NR-, -NRC(O)-, -NRC(O)S-, -SC(O)NR-, -C(O)-, -OC(S)-, -C(S)O-, -OC(S)NR-, -NRC(S)O-, -S-S-, and -S(O) 0-2 -;

[0216] R1and R2are independently selected from the group consisting of C 4-20 alkyl, C 4-20 alkenyl and C 4-20alkyl, -L 1s substituted, and wherein one or more methylene units are optionally and independently replaced with -NR'-;

[0217] R 1s is independently selected from the group consisting of H, C 1-20 alkyl, -L c -OR c , -L c -SR c and -L c -NR c R’ c ;

[0218] R and R’ are each independently selected from the group consisting of H and C 1-20 alkyl;

[0219] L c is independently selected from the group consisting of a bond and C 1-20 alkylene;

[0220] R c and R’ c are independently selected from the group consisting of H, C 1-20 alkyl, C 3-14 cycloalkyl, and 3- to 14-membered heterocyclyl;

[0221] R4and R5are independently selected from the group consisting of C 1-8 alkyl optionally substituted with one or more R 4s ;

[0222] or R4, R5, together with the carbon atom to which they are attached, form C 3-14 cycloalkylene or 3- to 14-membered heterocyclylene optionally substituted with one or more R 4s ;

[0223] R 4s is independently selected from the group consisting of H, halogen, cyano, C 1-8 alkyl, C 1-8 haloalkyl, -L d -OR d , -L d -SR d and -L d -NR d R’ d ;

[0224] L d is independently selected from the group consisting of a bond and C 1-8 alkylene;

[0225] R d and R’ d are independently selected from the group consisting of H, C 1-8 alkyl, C3-14 cycloalkyl and 3- to 14-membered heterocyclyl. In some specific embodiments, R1and R2are independently selected from the group consisting of -(CH2)5CH3, -(CH2)6CH3, -(CH2)7CH3, -(CH2)8CH3, -(CH2)9CH3, -(CH2) 10 CH3, -(CH2) 11 CH3, -CH2-C≡C-(CH2)5CH3, -CH2-C≡C-(CH2)6CH3, -(CH2)2-C≡C-(CH2)5CH3, -(CH2)4-C≡C-(CH2)3CH3, -CH2-CH=CH-(CH2)5CH3, -CH2-CH=CH-(CH2)6CH3, -(CH2)2-CH=CH-(CH2)5CH3, -(CH2)4-CH=CH-(CH2)3CH3, -(CH2)5-CH=CH-CH2CH3,

[0226] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein M1and M2are independently selected from -C(O)O- or -OC(O)-.

[0227] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R4and R5are independently C 1-8 alkyl, preferably, R4and R5are independently C 1-3 alkyl, more preferably, R4and R5are methyl.

[0228] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R1and R2are independently selected from C 4-20 alkyl, C 4-20 alkenyl, and C 4-20 alkynyl, and wherein one or more methylene units are optionally and independently replaced by -NR’-.

[0229] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R1and R2are independently selected from C 4-20 alkyl, and wherein one or more methylene units are optionally and independently replaced by -NR’-.

[0230] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein R1and R2are independently selected from C 4-20 alkyl, preferably, R1is C 6-14 alkyl and R2is C 8-20 alkyl, more preferably, R1is C 8-12linear alkyl and R2 is C 12-20 branched alkyl.

[0231] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein a is 2, b is 7, c is an integer from 2 to 5, e.g., 2, 3, 4, or 5, and d is an integer from 1 to 4, e.g., 1, 2, 3, or 4.

[0232] In a preferred embodiment, R1 is selected from C 8-11 linear alkyl, preferably C 9-10 linear alkyl, e.g., nonyl or decyl.

[0233] In a preferred embodiment, R2 is C 8-20 alkyl, preferably R2 is C 12-20 branched alkyl, more preferably R2 is C 16-20 branched alkyl.

[0234] In a preferred embodiment, R2 is selected from preferably

[0235] In another preferred embodiment,

[0236] R1 is selected from C 8-11 linear alkyl, preferably C 9-10 linear alkyl, e.g., nonyl or decyl;

[0237] R2 is C 12-20 branched alkyl, preferably R2 is C 16-20 branched alkyl, more preferably R2 is selected from preferably

[0238] M1 and M2 are independently selected from -C(O)O- or -OC(O)-;

[0239] R4 and R5 are independently C 1-8 alkyl, preferably C 1-3 alkyl, more preferably methyl; and

[0240] a is 2, b is 7, c is an integer from 2 to 5, e.g., 2, 3, 4, or 5, and d is an integer from 1 to 4, e.g., 1, 2, 3, or 4.

[0241] In some specific embodiments, the ionizable lipid is a compound of Formula (II-0), or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof:

[0242] wherein,

[0243] a = 2, 3 or 4;

[0244] c = 2, 3, 4 or 5;

[0245] d = 1, 2, 3 or 4;

[0246] c + d = 5, 6, 7 or 8, preferably 5 or 6, more preferably 6;

[0247] M1and M2are independently selected from -C(O)O- and -OC(O)-;

[0248] R1and R2are independently selected from C 4-20 alkyl, optionally substituted with one or more R 1s substituents, and wherein one or more methylene units are optionally and independently replaced with -NR'-;

[0249] R 1s is independently selected from H, C 1-20 alkyl, -L c -OR c , -L c -SR c , and -L c -NR c R’ c ;

[0250] R’ is independently selected from H and C 1-20 alkyl

[0251] R4and R5are independently C 1-3 alkyl.

[0252] In some specific embodiments, the ionizable lipid is a compound of Formula (II-1), or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof:

[0253] wherein,

[0254] c = 2, 3, 4 or 5;

[0255] d = 1, 2, 3 or 4;

[0256] c + d = 5, 6, 7 or 8, preferably 5 or 6, more preferably 6;

[0257] M1and M2are independently selected from -C(O)O- and -OC(O)-;

[0258] R1and R2are independently selected from C 4-20 alkyl, and wherein one or more methylene units are optionally and independently replaced with -NR'-;

[0259] R' is independently selected from H and C 1-20 alkyl;

[0260] R4and R5are independently C 1-3 alkyl.

[0261] R1is preferably selected from C 8-11 straight chain alkyl, preferably C 9-10 straight chain alkyl, preferably C9straight chain alkyl or C 10 straight chain alkyl;

[0262] R2is selected from C 7-12 alkyl, preferably C 8-12 alkyl, preferably C 9-10 alkyl, optionally substituted with 1 R 1s ; and

[0263] R 1s is selected from C 1-10 straight chain alkyl, preferably C 6-10 straight chain alkyl, more preferably C 7-9 straight chain alkyl.

[0264] R4and R5are preferably methyl.

[0265] In some embodiments, the ionizable lipid is a compound of Formula (II-2), or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof:

[0266] M1and M2are independently selected from -C(O)O- and -OC(O)-; preferably, M1is -OC(O)- and M2is -C(O)O-;

[0267] R1is selected from C 8-11 straight chain alkyl, preferably C 9-10 straight chain alkyl, more preferably nonyl or decyl;

[0268] R2is selected from C 8-12 straight chain alkyl, preferably C 9-10 straight chain alkyl, optionally substituted with 1 R 1s ; and

[0269] R 1s is selected from C 1-10 straight chain alkyl, preferably C 6-10 straight chain alkyl, more preferably C 7-9 straight chain alkyl.

[0270] In some embodiments, the present application provides a lipid nanoparticle as described above, wherein the compound of Formula (II) is selected from the following compounds, or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof:

[0271] In some embodiments, the ionizable lipid comprises about 35% to about 50%, preferably about 35% to about 45%, more preferably about 38% to about 45%, more preferably about 40% to about 42% by mole percent of the total lipids.

[0272] In some embodiments, the ionizable lipid comprises about 35%, about 35.5%, about 36%, about 36.5%, 37%, about 37.5%, about 38%, about 38.5%, about 39%, about 39.5%, about 40%, about 40.5%, about 41%, about 41.5%, about 42%, about 42.5%, about 43%, about 43.5%, about 44%, about 44.5%, about 45%, about 45.5%, about 46%, about 46.5%, about 47%, about 47.5%, about 48%, about 48.5%, about 49%, about 49.5%, or about 50% by mole percent of the total lipids.

[0273] In some embodiments, the structural lipid is a sterol; preferably, the sterol is selected from one or more of: cholesterol, sitosterol, chalinosterol, fecosterol, campesterol, ergosterol, tomatidine, ursolic acid, alpha-tocopherol, stigmasterol, avenasterol, ergocalciferol, and campesterol; preferably, the structural lipid is selected from cholesterol and / or beta-sitosterol; more preferably, the structural lipid is cholesterol.

[0274] In some embodiments, the structural lipid comprises about 30% to about 55%, preferably about 35% to about 45%, more preferably about 40% to about 45%, more preferably about 41% to about 44% by mole percent of the total lipids.

[0275] In a preferred embodiment, the structural lipid comprises about 30%, about 32.5%, about 35%, about 35.5%, about 36%, about 36.5%, about 37%, about 37.5%, about 38%, about 38.5%, about 39%, about 39.5%, about 40%, about 40.5%, about 41%, about 41.5%, about 42%, about 42.5%, about 43%, about 43.5%, about 44%, about 44.5%, about 45%, about 46%, about 47%, about 48%, about 49%, or about 50% by mole percent of the total lipids.

[0276] In some embodiments, the neutral lipid is selected from phosphatidylcholine and / or phosphatidylethanolamine.

[0277] Preferably, the phosphatidylcholine is selected from one or more of: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1.2-dioleoyl-sn-glycero-3-phosphocholine (DLPC), 1.2-ditridecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 2-((2,3-bis(oleoyloxy)propyl))dimethylammonio)ethyl hydrogen phosphate (DOCP), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), dimyristoyl phosphatidylethanolamine (DMPE), 1-palmitoyl-2-oleoyl phosphatidyl ethanolamine (POPE), and dipalmitoyl phosphatidyl ethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1.2-dioloyl-sn-glycero-3-phospho-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof, preferably DSPC and / or DOPE.

[0278] In some embodiments, the neutral lipid comprises about 5% to about 30%, preferably about 5% to about 20%, more preferably about 10% to about 20%, more preferably about 15% of the total lipid by molar percentage.

[0279] In some embodiments, the neutral lipid comprises about 5.0%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, about 10%, about 10.5%, about 11%, about 11.5%, about 12%, about 12.5%, about 13%, about 13.5%, about 14%, about 14.5%, about 15%, about 15.5%, about 16%, about 16.5%, about 17%, about 17.5%, about 18%, about 18.5%, about 19%, about 19.5%, about 20%, about 22.5%, about 25%, about 27.5%, or about 30% of the total lipid by molar percentage. In some embodiments, the polymeric lipid is a PEGylated lipid.

[0280] Preferably, the PEGylated lipid is selected from one or more of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol;

[0281] Preferably, the pegylated lipid comprises a PEG moiety of 1000 Da to 20 kDa, preferably a PEG moiety of about 1000 Da to about 5000 Da;

[0282] Preferably, the pegylated lipid is selected from one or more of the following: DMPE-PEG1000, DPPE-PEG1000, DSPE-PEG1000, DOPE-PEG1000, DMG-PEG2000, Ceramide-PEG2000, DMPE-PEG2000, DPPE-PEG2000, DSPE-PEG2000, Azido-PEG2000, DSPE-PEG2000, DSPE-PEG2000-Mannose, DSPE-PEG2000 amine, DSPE-PEG3350, DSPE-PEG3500, DMG-PEG3500, DPPE-PEG3500, DSPE-PEG4000, DMG-PEG4000, Ceramide-PEG5000, DSPE-PEG5000, DMG-PEG5000, and ALC-0159, preferably DMG-PEG2000, DSPE-PEG2000, DMG-PEG3500, DMG-PEG4000, and / or DMG-PEG5000, more preferably DMG-PEG2000.

[0283] In some embodiments, the pegylated lipid is present in a molar percentage of about 0.5% to about 3.5% of the total lipid, preferably about 1% to about 3%, more preferably about 1% to about 2%, more preferably about 1.5% to about 2%.

[0284] In some embodiments, the pegylated lipid is present in a molar percentage of about 0.5%, about 0.75%, about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, about 2%, about 2.2%, about 2.4%, about 2.6%, about 2.8%, about 3%, about 3.25%, or about 3.5% of the total lipid.

[0285] In some embodiments, the present application provides a lipid nanoparticle as described above comprising the following molar percentages of components:

[0286] ionizable lipid: about 35% to about 50%, preferably about 35% to about 45%, more preferably about 38% to about 45%, more preferably about 40% to about 42%;

[0287] Structural lipid: about 30% to about 55%, preferably about 35% to about 45%, more preferably about 40% to about 45%, more preferably about 41% to about 44%;

[0288] Neutral lipid: about 5% to about 30%, preferably about 5% to about 20%, more preferably about 10% to about 20%, more preferably about 15%;

[0289] Polymer lipid: about 0.5% to about 3.5%, preferably about 1% to about 3%, more preferably about 1% to about 2%, more preferably about 1.5 to about 2%.

[0290] In a particular embodiment, the lipid nanoparticle comprises the following molar percentages of components:

[0291] Ionizable lipid: about 35% to about 50%;

[0292] Structural lipid: about 30% to about 55%;

[0293] Neutral lipid: about 5% to 30%;

[0294] Polymer lipid: about 0.5% to about 3.5%.

[0295] In a particular embodiment, the lipid nanoparticle comprises the following molar percentages of components:

[0296] Ionizable lipid: about 35% to about 45%;

[0297] Structural lipid: about 35% to about 45%;

[0298] Neutral lipid: about 5% to about 20%;

[0299] Polymer lipid: about 1% to about 3%.

[0300] In a more particular embodiment, the lipid nanoparticle comprises the following molar percentages of components:

[0301] Ionizable lipid: about 38% to about 45%;

[0302] Structural lipid: about 40% to about 45%;

[0303] Neutral lipid: about 10% to about 20%;

[0304] Polymer lipid: about 1% to about 2%.

[0305] In a more particular embodiment, the lipid nanoparticle comprises the following molar percentages of components:

[0306] Ionizable lipid: about 40% to about 42%;

[0307] Structural lipid: about 41% to about 44%;

[0308] Neutral lipid: about 15%;

[0309] Polymer lipid: about 1.5% to about 2%.

[0310] In some embodiments, the lipid nanoparticle contains about 35-45 mol% of an ionizable lipid compound provided herein, about 35-45 mol% cholesterol, about 5-20 mol% DOPE, and about 1-3 mol% DMG-PEG2000.

[0311] In some embodiments, the lipid nanoparticle contains about 38-45 mol% of an ionizable lipid compound provided herein, about 40-45 mol% cholesterol, about 10-20 mol% DOPE, and about 1-2 mol% DMG-PEG2000.

[0312] In some embodiments, the lipid nanoparticle contains 40-42 mol% of an ionizable lipid compound provided herein, about 41-44 mol% cholesterol, about 15 mol% DOPE, and about 1.5 mol% DMG-PEG2000.

[0313] In some embodiments, the lipid nanoparticle contains about 40 mol% of an ionizable lipid compound provided herein, about 43.5 mol% cholesterol, about 15 mol% DOPE, and about 1.5 mol% DMG-PEG2000.

[0314] In some embodiments, the lipid nanoparticle contains about 42 mol% of an ionizable lipid compound provided herein, about 41.5 mol% cholesterol, about 15 mol% DOPE, and about 1.5 mol% DMG-PEG2000.

[0315] In some embodiments, the lipid nanoparticle contains about 35-45 mol% of compound MTS001 or MTS002, about 35-45 mol% cholesterol, about 5-20 mol% DOPE, and about 1-3 mol% DMG-PEG2000.

[0316] In some embodiments, the lipid nanoparticle contains about 38-45 mol% of compound MTS001 or MTS002, about 40-45 mol% cholesterol, about 10-20 mol% DOPE, and about 1-2 mol% DMG-PEG2000.

[0317] In some embodiments, the lipid nanoparticle contains 40-42 mol% of compound MTS001 or MTS002, about 41-44 mol% of cholesterol, about 15 mol% of DOPE, and about 1.5 mol% of DMG-PEG2000.

[0318] In some embodiments, the lipid nanoparticle contains about 40 mol% of compound MTS001 or MTS002, about 43.5 mol% of cholesterol, about 15 mol% of DOPE, and about 1.5 mol% of DMG-PEG2000.

[0319] In some embodiments, the lipid nanoparticle contains about 42 mol% of compound MTS001 or MTS002, about 41.5 mol% of cholesterol, about 15 mol% of DOPE, and about 1.5 mol% of DMG-PEG2000.

[0320] In some embodiments, the above-mentioned lipid nanoparticle further comprises at least one load selected from a therapeutic agent and / or a prophylactic agent; in some embodiments, the load is a nucleic acid molecule for use as an HPV vaccine.

[0321] In some embodiments, the nucleic acid molecule for use as an HPV vaccine comprises an open reading frame (ORF) comprising: a nucleotide sequence encoding an HPV antigen; and a nucleotide sequence encoding an immune costimulatory factor.

[0322] In some embodiments, the HPV antigen comprises at least one HPV immunogenic polypeptide from at least one HPV serotype. The HPV antigen can comprise any HPV immunogenic polypeptide from any HPV serotype or a combination thereof.

[0323] In the present application, the HPV can be any serotype HPV. In some embodiments, the HPV is a low-risk HPV, such as type 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, etc. In some embodiments, the HPV is a high-risk HPV, such as type 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39, etc. In some preferred embodiments, the HPV is HPV of serotype 16 and / or serotype 18.

[0324] In the present application, the HPV immunogenic polypeptide can be selected from an E1, E2, E3, E4, E5, E6, E7, LI, or L2 polypeptide of HPV or an immunogenic variant thereof. In some preferred embodiments, the HPV immunogenic polypeptide is selected from an E6, E7, L2 polypeptide or an immunogenic variant thereof. In some more preferred embodiments, the HPV immunogenic polypeptide is selected from an E6, E7 polypeptide or an immunogenic variant thereof.

[0325] In some embodiments, the HPV antigen can comprise one, two, three, four or more HPV immunogenic polypeptides from one, two, three, four or more HPV serotypes. In some embodiments, the HPV antigen can comprise one HPV immunogenic polypeptide from one HPV serotype. In some embodiments, the HPV antigen can comprise two HPV immunogenic polypeptides from one HPV serotype. In some embodiments, the HPV antigen can comprise two HPV immunogenic polypeptides from two HPV serotypes.

[0326] In some embodiments, the HPV antigen comprises an E6 polypeptide and an E7 polypeptide from HPV serotype 16. In some embodiments, the HPV antigen comprises an E6 polypeptide and an E7 polypeptide from HPV serotype 18. In some embodiments, the HPV antigen comprises an E6 polypeptide and an E7 polypeptide from HPV serotype 16, and an E6 polypeptide and an E7 polypeptide from HPV serotype 18.

[0327] In some embodiments, the E6 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 41 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 41.

[0328] In some embodiments, the E6 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 67 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 67.

[0329] In some embodiments, the E7 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 42 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 42. In some embodiments, the E7 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 43 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 43.

[0330] In some embodiments, the E7 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 68 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 68.

[0331] In some embodiments, the E6 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 43 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 43.

[0332] In some embodiments, the E6 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 69 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 69.

[0333] In some embodiments, the E7 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 44 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 44.

[0334] In some embodiments, the E7 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 70 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 70.

[0335] In some embodiments, the HPV antigen can further comprise one or more epitope peptides derived from an L2 polypeptide. For example, an epitope peptide derived from an L2 polypeptide from HPV serotype 16 can comprise the amino acid sequence of SEQ ID NO: 45 or 46.

[0336] In some embodiments, the HPV antigen can further comprise a signal peptide, thereby resulting in secreted expression of the HPV immunogenic polypeptide. An exemplary signal peptide can comprise the amino acid sequence of SEQ ID NO: 48.

[0337] In some embodiments, the HPV antigen can further comprise an amino acid sequence that disrupts host immune tolerance and / or an amino acid sequence that enhances antigen processing and / or presentation. The amino acid sequence that disrupts host immune tolerance is, for example, P2P16 from tetanus endotoxin, the amino acid sequence of which is set forth in SEQ ID NO: 56. The amino acid sequence that enhances antigen processing and / or presentation is, for example, the transmembrane and cytoplasmic domain of MHC class I molecule (MITD), the amino acid sequence of which is set forth in SEQ ID NO: 55. However, in some preferred embodiments, the HPV antigen does not comprise an amino acid sequence that disrupts host immune tolerance and / or an amino acid sequence that enhances antigen processing and / or presentation.

[0338] In some embodiments, the different elements / polypeptides, amino acid sequences comprised in the HPV antigen are fused directly or via a peptide linker. The peptide linker can be a flexible peptide linker or a rigid peptide linker, preferably a flexible peptide linker. An exemplary peptide linker comprises the sequence GnS, n being an integer from 1 to 5, for example n being 1 or 3.

[0339] As used herein, "immune co-stimulatory factor" refers to a molecule that, when co-expressed with an antigen, enhances the immune response of the host to the antigen. Exemplary immune co-stimulatory factors include, but are not limited to, Flt3Lecd, GM-CSF, OX40L, HMGB1, or HSP70p.

[0340] In some embodiments, the Flt3Lecd comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 49. In some embodiments, the HMGB1 comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 53. In some embodiments, the HSP70p comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 54. In some embodiments, the OX40L comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 52. In some embodiments, the GM-CSF comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 50. In some embodiments, the GM-CSF comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to the amino acid sequence of SEQ ID NO: 51.

[0341] In some preferred embodiments of the application, the immune co-stimulatory factor is OX40L or GM-CSF, most preferably GM-CSF.

[0342] In some embodiments, the immune co-stimulatory factor can further comprise a signal peptide, thereby resulting in secreted expression of the immune co-stimulatory factor. An exemplary signal peptide can comprise the amino acid sequence of SEQ ID NO: 48.

[0343] In some preferred embodiments, the ORF further comprises a nucleotide sequence encoding a self-cleaving peptide located between the nucleotide sequence encoding the HPV antigen and the nucleotide sequence encoding the immune co-stimulatory factor.

[0344] As used herein, "self-cleaving peptide" means a peptide that can achieve self-cleavage within a cell. The presence of the self-cleaving peptide can allow the HPV antigen and the immune co-stimulatory molecule to be translated to form separate polypeptides rather than a fusion protein.

[0345] For example, the self-cleaving peptide can comprise a protease recognition site, so as to be recognized and specifically cleaved by a protease within the cell. Alternatively and preferably, the self-cleaving peptide can be a 2A polypeptide. 2A polypeptides are a class of short peptides from viruses, whose self-cleavage occurs during translation. Commonly used 2A polypeptides can be P2A from porcine techovirus-1, T2A from Thosea asigna virus, E2A from equine rhinitis A virus, and F2A from foot-and-mouth disease virus. A variety of functional variants of these 2A polypeptides are also known in the art, which can also be used in the present application. In some preferred embodiments, the 2A polypeptide is a T2A polypeptide. An exemplary T2A polypeptide amino acid sequence is set forth in SEQ ID NO: 64. In some preferred embodiments, the 2A polypeptide is a P2A polypeptide. An exemplary P2A polypeptide amino acid sequence is set forth in SEQ ID NO: 65.

[0346] In some embodiments, the ORF comprises, in the 5' to 3' direction:

[0347] i) the nucleotide sequence encoding the HPV antigen and the nucleotide sequence encoding the immune co-stimulatory factor; or

[0348] ii) the nucleotide sequence encoding the HPV antigen, the nucleotide sequence encoding the self-cleaving peptide, and the nucleotide sequence encoding the immune co-stimulatory factor.

[0349] In some embodiments, the ORF encodes an amino acid sequence comprising one of SEQ ID NOs: 3-6 and 8-18, or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 3-6 and 8-18.

[0350] In some embodiments, the ORF encodes an amino acid sequence comprising the following structure: SP-E6 16 -E7 16 -E6 18 -E7 18 -2A-GMCSF, wherein SP is a signal peptide, E6 16 and E716 E6 and E7 polypeptides from HPV serotype 16, respectively, E6 18 and E7 18 E6 and E7 polypeptides from HPV serotype 18, respectively, 2A is a 2A polypeptide such as T2A, GMCSF is human or murine GM-CSF. In some preferred embodiments, the ORF encodes an amino acid sequence set forth in SEQ ID NO: 11 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 11.

[0351] In some embodiments, the ORF encodes an amino acid sequence comprising one of SEQ ID NOs: 23-26 and 28-38 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 23-26 and 28-38. In some preferred embodiments, the ORF comprises a nucleotide sequence set forth in SEQ ID NO: 31 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 31.

[0352] In some embodiments, the nucleic acid molecule is an mRNA molecule. In some embodiments, the mRNA molecule further comprises a 5’ UTR and / or a 3’ UTR.

[0353] A variety of useful 5’ UTRs and / or 3’ UTRs are known in the art. One of skill in the art is capable of determining a 5’ UTR and / or 3’ UTR suitable for use in the present application.

[0354] In some embodiments, the 5’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 57 or 59. In some embodiments, the 3’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 58 or 60. In some embodiments, the 5’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 57 and the 3’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 58. In some embodiments, the 5’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 59 and the 3’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 60.

[0355] In some embodiments, the mRNA molecule further comprises a poly(A) sequence.

[0356] In some embodiments of the application, the poly(A) sequence comprises about 20 to about 500 (e.g., contiguous) adenine nucleotides (A), for example, about 25, about 50, about 100, about 150, about 175, about 200, about 300, about 400, about 500 (e.g., contiguous) adenine nucleotides (A). In some preferred embodiments, the poly(A) sequence comprises 120 (e.g., contiguous) adenine nucleotides (A). The addition of a poly(A) sequence aids in the stability and transport of the mRNA, preventing its degradation, and plays an important role in the post-transcriptional modification process. The poly(A) sequence can be a continuous chain of pure adenine nucleotides, but can also be a variant comprising nucleotides other than adenine, as long as it is functionally equivalent to a conventional poly(A) sequence, i.e., is capable of providing similar biological functions as a natural poly(A) sequence, such as affecting the stability, translation efficiency or ribosome binding of the mRNA. Known poly(A) sequences are, for example, the human growth hormone (hGH) poly(A) sequence and the monkey virus 40 (SV40) poly(A) sequence. These variants can differ in the nucleotide composition, but are functionally recognized as equivalent to the traditional poly(A) sequence. In some particular embodiments, the poly(A) sequence comprises the nucleotide sequence set forth in SEQ ID NO: 61.

[0357] In some particularly preferred embodiments, the mRNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 66 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 66.

[0358] In some embodiments, the mRNA molecule further comprises a 5’ cap structure. In some embodiments of the application, the 5’ cap structure is a Capl cap structure.

[0359] In some embodiments, the mRNA molecule of the application can further comprise at least one nucleotide modification. The at least one nucleotide modification includes, but is not limited to, a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, the at least one nucleotide modification includes, but is not limited to, 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU).

[0360] In some embodiments, the mRNA is chemically synthesized. In some embodiments, the mRNA molecule is obtained by in vitro transcription.

[0361] Additionally, the mRNA molecules involved in the present application have a certain stability, which can tolerate the insertion of certain additional sequences, such as microRNA binding sites, without affecting the ability to translate and without affecting the stability of the mRNA molecule. In some embodiments, additional sequences, such as microRNA binding sites, can be inserted into the 3’ UTR. The microRNA binding sites include the full-length reverse complement of a microRNA (exemplary length can be 19-25 nt) or the reverse complement of the seed sequence thereof (exemplary length can be 7-8 nt).

[0362] In one aspect, the present application provides a nucleic acid vector comprising a coding sequence of a nucleic acid molecule, such as an mRNA molecule, of the present application. In some embodiments, the nucleic acid vector is used to generate a nucleic acid molecule, such as an mRNA molecule, of the present application.

[0363] As used herein, “vector” refers to a piece of DNA extracted from a virus, plasmid, or cell of a higher organism into which a foreign DNA segment can be or has been inserted for cloning and / or expression purposes. In certain embodiments, a vector can be stably maintained in an organism. A vector can comprise, for example, an origin of replication, a selectable marker or reporter gene, such as antibiotic resistance or GFP, and / or a multiple cloning site (MCS). The term includes linear DNA fragments (e.g., PCR products, linear plasmid fragments), plasmid vectors, viral vectors, cosmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and the like.

[0364] In some embodiments, the nucleic acid vector further comprises an RNA polymerase promoter sequence operably linked to the coding sequence of the nucleic acid molecule, such as an mRNA molecule. The operably linked promoter allows for the in vivo and / or in vitro transcription of the RNA molecule. The promoter is, for example, a T7 RNA polymerase promoter, a T6 viral RNA polymerase promoter, a SP6 viral RNA polymerase promoter, a T3 viral RNA polymerase promoter, or a T4 viral RNA polymerase promoter.

[0365] In some embodiments, the nucleic acid vector is a plasmid vector. In some embodiments, the nucleic acid vector comprises a restriction endonuclease site, such as a type IIS restriction endonuclease site, flanking the 3’ of the coding sequence of the nucleic acid molecule, such as an mRNA molecule. Suitable restriction endonucleases include, but are not limited to, BsmBI, BsaI, SapI, and the like. The restriction endonuclease site can be used to linearize the nucleic acid vector for in vitro transcription.

[0366] Methods for obtaining mRNA molecules from nucleic acid vectors in vitro are known in the art, for example, in vitro transcription can be performed using commercial kits.

[0367] The present application provides the lipid nanoparticle as described above, wherein the N:P molar ratio of the N atoms in the ionizable lipid to the P atoms in the payload molecule is about 1-15: 1, preferably about 2-12: 1, preferably 2-9: 1.

[0368] In some embodiments, the N:P molar ratio of the N atoms in the ionizable lipid to the P atoms in the payload molecule is about 2-15: 1, preferably about 2-10: 1, more preferably about 4-6: 1.

[0369] In some embodiments, the N:P molar ratio of the N atoms in the ionizable lipid to the P atoms in the payload molecule is about 2-12: 1, preferably about 2-8: 1, more preferably about 4.5-6: 1.

[0370] In some embodiments, the present application provides the lipid nanoparticle as described above, wherein the particle size of the particle is about 40-500 nm, preferably about 50-250 nm, preferably about 50-200 nm, more preferably about 50-150 nm.

[0371] In some embodiments, the particle size of the particle is about 50-300 nm, preferably about 50-180 nm, preferably about 50-150 nm, more preferably about 50-120 nm.

[0372] In some embodiments, the particle size of the particle is about 50-200 nm, preferably about 50-160 nm, preferably about 60-120 nm.

[0373] In some embodiments, the particle size of the particle is about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, about 100 nm, about 105 nm, about 110 nm, about 115 nm, about 120 nm, about 125 nm, about 130 nm, about 135 nm, about 140 nm, about 145 nm, about 150 nm, about 160 nm.

[0374] In another aspect, the present application provides a method of preparing the lipid nanoparticle, comprising: mixing the lipid components in the lipid nanoparticle, and mixing with the payload to obtain the lipid nanoparticle.

[0375] In another aspect, the present application provides a composition comprising the lipid nanoparticle of the present application.

[0376] In another aspect, the present application provides a pharmaceutical composition comprising the lipid nanoparticle as described above and optionally a pharmaceutically acceptable excipient, such as a carrier, adjuvant or vehicle.

[0377] In another aspect, the present application provides an immunogenic composition comprising the lipid nanoparticle as described above and optionally a pharmaceutically acceptable carrier.

[0378] In another aspect, the present application provides the use of the lipid nanoparticle or the composition or the pharmaceutical composition or the immunogenic composition as described above for the manufacture of a medicament or a vaccine for the prevention and / or treatment of an HPV infection and / or an HPV infection related pathology;

[0379] i. Preferably, wherein the HPV infection is an HPV infection selected from the group consisting of serotypes 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39;

[0380] More preferably, wherein the HPV infection is an infection of a single HPV serotype or the HPV infection is a mixed infection of two or more different HPV serotypes;

[0381] More preferably, wherein the HPV infection is an infection of HPV 16 and / or HPV 18; or

[0382] ii. Preferably, wherein the HPV infection related pathology is selected from the group consisting of cutaneous warts, such as common warts, plantar warts, flat warts, Bowen’s disease, butcher’s warts or condyloma acuminata; HPV-positive tumors such as HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer.

[0383] In another aspect, the present application provides a method for the prevention and / or treatment of an HPV infection and / or an HPV infection related pathology in a subject, comprising administering to said subject an effective amount of the lipid nanoparticle or the composition or the pharmaceutical composition or the immunogenic composition as described above;

[0384] i. Preferably, wherein the HPV infection is an HPV infection selected from the group consisting of serotypes 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39;

[0385] More preferably, wherein the HPV infection is an infection of a single HPV serotype or the HPV infection is a mixed infection of two or more different HPV serotypes;

[0386] More preferably, wherein the HPV infection is an infection with HPV 16 and / or HPV 18; or

[0387] ii. Preferably, wherein the HPV infection related pathology is selected from the group consisting of skin warts, such as common warts, plantar warts, flat warts, Bowen's disease, butcher's warts or condyloma acuminata; HPV positive tumors such as HPV positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer.

[0388] In some embodiments, the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition is administered by injection, such as intramuscular injection, intravenous injection, intra-arterial injection or intraperitoneal injection, preferably intramuscular injection.

[0389] In another aspect, the present application provides a lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition as described above for use in the prophylaxis and / or treatment of an HPV infection and / or an HPV infection related pathology;

[0390] i. Preferably, wherein the HPV infection is an HPV infection with a serotype selected from the group consisting of serotypes 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39;

[0391] More preferably, wherein the HPV infection is an infection with a single HPV serotype or the HPV infection is a mixed infection with two or more different HPV serotypes;

[0392] More preferably, wherein the HPV infection is an infection with HPV 16 and / or HPV 18; or

[0393] ii. Preferably, wherein the HPV infection related pathology is selected from the group consisting of skin warts, such as common warts, plantar warts, flat warts, Bowen's disease, butcher's warts or condyloma acuminata; HPV positive tumors such as HPV positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer.

[0394] In some specific embodiments of each of the above aspects, the payload is as defined above.

[0395] It will be understood by a person of ordinary skill in the art that the actual dose levels of the active ingredients in the pharmaceutical or immunogenic compositions of the present application can be varied to obtain an amount of the active ingredients that is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject. The selected dose level will depend on a variety of pharmacokinetic factors, including the activity of the particular compositions of the present application applied, the route of administration, the time of administration, the rate of excretion of the particular compounds being applied, the duration of the treatment, other drugs, compounds, and / or materials used in combination with the particular compositions applied, the age, sex, weight, condition, general health, and medical history of the subject being treated, and like factors known in the medical arts.

[0396] The lipid nanoparticles or pharmaceutical or immunogenic compositions of the present application can be administered by one or more routes of administration using one or more methods known in the art. It will be understood by a person of ordinary skill in the art that the route and / or mode of administration will vary depending upon the desired results. Preferred routes of administration of the lipid nanoparticles or pharmaceutical or immunogenic compositions of the present application include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal, or other parenteral routes of administration, such as by injection or infusion. The phrase “parenteral administration” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection and infusion.

[0397] In some embodiments, the LNP, compositions or pharmaceutical or immunogenic compositions thereof, or methods of the present application can be used in combination with a chemotherapeutic agent, an immune checkpoint inhibitor, an antibody targeting other tumor-specific antigens, or radiotherapy.

[0398] In some embodiments, the present application also provides a kit for use in the methods of the present application for preventing and / or treating HPV infection and / or HPV infection-associated pathologies. In some embodiments, the kit comprises a lipid nanoparticle or composition or pharmaceutical or immunogenic composition of the present application, and optionally a chemotherapeutic agent, an immune checkpoint inhibitor, or an antibody targeting a tumor antigen.

[0399] In a preferred embodiment, the immune checkpoint inhibitor is a PD1 signaling pathway inhibitor; preferably, the PD1 signaling pathway inhibitor is selected from a PD1 antibody, a PDL1 antibody, a PDL2 antibody, or a combination thereof; more preferably, it is a PD1 antibody.

[0400] The chemotherapeutic agent, immune checkpoint inhibitor, or antibody targeting other tumor antigens that can be used in combination with the LNP, pharmaceutical composition, or immunogenic composition of the present application is not particularly limited. Examples of the chemotherapeutic agent, immune checkpoint inhibitor, and antibody targeting other tumor antigens include, but are not limited to, isophosphamide, cyclophosphamide, dacarbazine, temozolomide, nimustine, busulfan, melphalan, enocitabine, capecitabine, carmofur, cladrabine, gemcitabine, cytarabine, tegafur, tegafur-uracil, TS-1, doxifluridine, nelarabine, hydroxyurea, fluorouracil, fludarabine, pemetrexed, pentostatin, mercaptopurine, methotrexate, irinotecan, etoposide, eribulin, sobuzoxane, docetaxel, paclitaxel, vinorelbine, vincristine, vindesine, vinblastine, actinomycin D, aclarubicin, amrubicin, idarubicin, epirubicin, zinostatin stimalamer, daunorubicin, doxorubicin, pirarubicin, bleomycin, peplomycin, mitomycin C, mitoxantrone, oxaliplatin, carboplatin, cisplatin, nedaplatin, anastrozole, exemestane, ethinyl estradiol, chlormadinone, goserelin, tamoxifen, dexamethasone, bicalutamide, toremifene, flutamide, prednisolone, fosfestrol, mitotane, methyltestosterone, leuprolide, letrozole, megestrol, ibritumomab, imatinib, everolimus, erlotinib, gefitinib, sunitinib, cetuximab, sorafenib, dasatinib, tamibarotene, trastuzumab, tretinoin, panitumumab, bevacizumab, bortezomib, lapatinib, atezolizumab, pembrolizumab, tislelizumab, camrelizumab, sugemalimab, and nivolumab, and the like.

[0401] The lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the present application and the chemotherapeutic agent, immune checkpoint inhibitor, or antibody targeting other tumor antigens can be all administered at once or separately. When administered separately (in the case of different administration schedules from each other), they can be administered consecutively without interruption or at predetermined intervals.

[0402] The dose of the lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the present application and the chemotherapeutic agent, immune checkpoint inhibitor, or antibody targeting other tumor antigens in the combination of the present application is not particularly limited. As described above, the dose of the lipid nanoparticle or pharmaceutical composition or immunogenic composition of the present application can be determined by referring to the dose when the antibody is used alone. The chemotherapeutic agent, immune checkpoint inhibitor, and antibody targeting other tumor antigens can be used according to the dose indicated for each drug or can be reduced (in consideration of the combined effect with the antibody of the present application).

[0403] The lipid nanoparticle or composition or pharmaceutical composition or immunogenic composition of the present application can also be combined with radiotherapy, for example, including administration of ionizing radiation to the subject, which is earlier than, during, and / or later than the administration of the lipid nanoparticle or pharmaceutical composition or immunogenic composition of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0404] Figure 1 shows that the mRNA of the design of Example 1d is well expressed in cells;

[0405] Figure 2 shows the ELISpot results of HPV16 E7 polypeptide groups;

[0406] Figure 3 shows the results of the pharmacodynamic screening of mRNA vaccines (TGI, tumor growth inhibition rate; CR, complete remission rate; n = 5, mean ± SD, n.s: no significance, *P < 0.05, **P < 0.01;

[0407] Figure 4 shows the results of Western blot detection of HPV vaccine mRNA expression in HEK293T cells.

[0408] Figure 5 shows the results of Western blot experiments for detecting HPV antigen content in DC2.4 cells;

[0409] Figure 6 shows the results of ELISA detection of human or murine GM-CSF content in cell supernatants;

[0410] Figure 7 shows the results of the pharmacodynamic screening of mRNA vaccines (TGI, tumor growth inhibition rate; CR, complete remission rate; n = 5, mean ± SD, **P < 0.01);

[0411] Figure 8 shows the results of the pharmacodynamic screening of M21-2 mRNA molecules (TGI, tumor growth inhibition rate; n = 3, mean ± SD, **P < 0.01);

[0412] Figure 9 shows the results of ELISpot detection of the immune response of splenocytes to M21-2 (SPF, spot forming units; n = 3, mean ± SD, **P < 0.01);

[0413] Figure 10 shows the results of detection of HPV-specific CTL content in splenocytes and tumor tissue cells (n = 3, mean ± SD, **P < 0.01);

[0414] Figure 11 shows the results of detection of HPV-specific CTL content in splenocytes and tumor tissue cells (n = 3, mean ± SD, **P < 0.01);

[0415] Figure 12 shows the effect of tumor inhibition when the LNP administration dose in Example 9 is 0.5 μg / 50 μL / mouse / time.

[0416] Figure 13 shows the effect of tumor inhibition in each group of LNP administration dose of 0.15 pg / 50 pL / mouse / time in Example 10;

[0417] Figure 14 shows the effect of tumor inhibition in each group of LNP administration dose of 0.5 pg / 50 pL / mouse / time in Example 10, each line represents one mouse;

[0418] Figure 15 shows the results of the evaluation of the pharmacodynamic activity of M21-2 molecules in the HPV16+ large tumor model (TGI, tumor growth inhibition rate; n=5, mean±SD, *P<0.05, **P<0.01);

[0419] Figure 16 shows the results of the comparison of the pharmacodynamic activity of M21-2, M21-2-Neg and BMK in the HPV16 + large tumor model (TGI, tumor growth inhibition rate; n=5, mean±SD, *P<0.05, **P<0.01);

[0420] Figure 17 shows the pharmacodynamic activity of M21-2 and M20-2 molecules in the HPV18 + large tumor MC38 (HPV18-E6&E7)-100mm 3 grafted tumor model (TGI, tumor growth inhibition rate; n=5, mean±SD, *P<0.05, **P<0.01);

[0421] Figure 18 shows the pharmacodynamic activity of M21-2 molecules in the HPV18 + large tumor MC38 (HPV18-E6&E7)-200mm 3 grafted tumor model (TGI, tumor growth inhibition rate; n=5, mean±SD, *P<0.05, **P<0.01);

[0422] Figure 19 shows the results of qPCR detection in Example 15, indicating that the tool cell can stably express HPV18 E6E7;

[0423] Figure 20 shows the results of flow cytometry detection of PD-L1 expression in tool cell MC38 (HPV18 E6E7) in Example 15, indicating that MC38 (HPV18 E6E7) cells positively express PD-L1;

[0424] Figure 21 shows the body weight data of each group of MTS002-23-M21-2 and aPD-1 respectively administered alone and in combination in Example 15;

[0425] Figure 22 shows the tumor inhibition effect of each group of MTS002-23-M21-2 and aPD-1 alone and in combination in Example 15. DETAILED DESCRIPTION

[0426] EMBODIMENTS

[0427] In order to make the technical solutions of the present application clearer and more explicit, the present application is further described in detail through the following examples. The following examples are only used to illustrate the specific embodiments of the present application, so that those skilled in the art can understand the present application, but are not used to limit the protection scope of the present application. In the specific embodiments of the present application, the technical means or methods not specifically described are conventional technical means or methods in the art. The materials, reagents, etc. used in the examples, if not specifically described, can be obtained from commercial channels.

[0428] Example 1a: Synthesis of a lipid compound

[0429] Synthesis of compound MTS001

[0430] Into a 100 mL three-necked round-bottom flask, compound 1 (3.0 g), 1-nonanol (2.1 g), DMAP (0.3 g, 2.4 mmol, 0.2 eq.), EDCI (3.45 g) were added at room temperature, and then 50 mL of dichloromethane was added. The reaction solution was stirred at room temperature until the reaction was complete, as monitored by TLC. The reaction solution was then poured into 100 mL of saturated aqueous ammonium chloride solution, and the organic phase was extracted with dichloromethane three times. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to dryness to obtain a crude product. The crude product was purified by silica gel column chromatography to obtain 3.94 g of compound 2 as a yellow oil.

[0431] Into a 100 mL three-necked round-bottom flask, compound 2 (3.0 g) and 2-aminoethanol (9.8 g) were added and dissolved in 40 mL of ethanol. The reaction was stirred at 60°C for 18 hours, and then the reaction solvent was removed by concentration. Saturated aqueous ammonium chloride solution and ethyl acetate were then added, and the layers were separated. The organic phase was combined and dried over anhydrous sodium sulfate. The filtrate was filtered and concentrated to dryness to obtain a crude product. The crude product was purified by silica gel column chromatography to obtain 1.26 g of compound 3 as a yellow oil.

[0432] Into a 100 mL three-necked round-bottom flask, compound 4 (700 mg), 8-bromooctanoic acid (780 mg), DMAP (71 mg), EDCI (834 mg) were added at room temperature, and then 30 mL of dichloromethane was added. The reaction solution was stirred at room temperature until the reaction was complete, as monitored by TLC. The reaction solution was then poured into 100 mL of saturated aqueous ammonium chloride solution, and the organic phase was extracted with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to dryness to obtain a crude product. The crude product was purified by silica gel column chromatography to obtain 800 mg of compound 5 as a yellow oil.

[0433] Compound 5 (560 mg) and compound 3 (357 mg) were added to a mixture of cyclopentyl methyl ether (3 mL) and acetonitrile (1 mL) under nitrogen protection, potassium carbonate (414 mg, 3.0 mmol, 3.0 eq.) and potassium iodide (199 mg) were added, the reaction was stirred at 80 °C, after the reaction was completed, it was cooled to room temperature, diluted with saturated sodium chloride solution, then extracted with dichloromethane, the organic phases were combined, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, filtered to collect the organic phase, and the organic solvent was removed by rotary evaporator to obtain a crude product. Purification by high performance liquid chromatography (column: Xselect CSH F-Phenyl OBD column 19x250 mm, 5 μm; A phase: acetonitrile / water (10 mmol / L ammonium bicarbonate + 0.05% ammonia water), B phase: isopropanol / acetonitrile; flow rate: 20 mL / min; gradient: 75% B to 95% B, 9 min) to obtain 163.4 mg of compound MTS001 as yellow oil; 1H NMR (300 MHz, CDCl3) δ: 4.06 (t, J = 6.6 Hz, 2H), 3.96 (d, J = 5.7 Hz, 2H), 3.55 (t, J = 5.4 Hz, 2H), 2.61 (t, J = 5.4 Hz, 2H), 2.52-2.45 (m, 4H), 2.30 (dt, J = 7.2 Hz, 2.4 Hz, 4H), 1.64-1.18 (m, 58H), 0.94-0.88 (m, 15H); ESI-MS m / z: 724.60 [M+H]+.

[0434] Synthesis of compound MTS002:

[0435] To a stirred solution of methyl isobutyrate (4.4 g) in tetrahydrofuran (100.0 mL) was added lithium diisopropylamide (43.0 mL) at 0 °C. The resulting mixture was stirred at 0 °C for 30 minutes, 1,5-dibromo-pentane (20.0 g) was added to the above solution, the resulting mixture was stirred at room temperature for 5 hours, the reaction was quenched with saturated ammonium chloride solution (1.0 mL), the reaction solution was diluted with water, extracted with dichloromethane, the organic layers were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure, the residue was purified by silica gel column chromatography to obtain 10 g (46%) of 1-4 as a light yellow oil;

[0436] To a stirred solution of 1-4 (10.0 g) in tetrahydrofuran (20.0 mL) was added borane-tetrahydrofuran complex solution (100.0 mL) at 0 °C, the resulting solution was stirred at 75 °C for 3 h, the mixture was cooled to room temperature, diluted with water and extracted with dichloromethane, the combined organic phase was washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 8 g (90%) of 1-5 as a colorless oil;

[0437] To a stirred solution of 1-4 (10.0 g) in tetrahydrofuran (20.0 mL) was added borane-tetrahydrofuran complex solution (100.0 mL) at 0 °C, the resulting solution was stirred at 75 °C for 3 h, the mixture was cooled to room temperature, diluted with water and extracted with dichloromethane, the combined organic phase was washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 8 g (90%) of 1-5 as a colorless oil;

[0438] To a stirred solution of 1-4 (10.0 g) in tetrahydrofuran (20.0 mL) was added borane-tetrahydrofuran complex solution (100.0 mL) at 0 °C, the resulting solution was stirred at 75 °C for 3 h, the mixture was cooled to room temperature, diluted with water and extracted with dichloromethane, the combined organic phase was washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 8 g (90%) of 1-5 as a colorless oil;

[0439] To a stirred solution of 1-4 (10.0 g) in tetrahydrofuran (20.0 mL) was added borane-tetrahydrofuran complex solution (100.0 mL) at 0 °C, the resulting solution was stirred at 75 °C for 3 h, the mixture was cooled to room temperature, diluted with water and extracted with dichloromethane, the combined organic phase was washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 8 g (90%) of 1-5 as a colorless oil;

[0440] To a solution of 2-3 (150 mg) and 2-1 (234.2 mg) in N,N-dimethylformamide (2 mL) was added potassium carbonate (165.6 mg) and sodium iodide (150.0 mg) under nitrogen protection, and the reaction was stirred at 70 °C. After the reaction was completed, it was cooled to room temperature, diluted with water, then extracted with dichloromethane, the organic phases were combined, washed with saturated aqueous sodium chloride solution, dried over anhydrous sodium sulfate, the organic phase was collected by filtration, and the organic solvent was removed to obtain a crude product, which was purified by high performance liquid chromatography (column: Xselect CSH F-Phenyl OBD column 19x250 mm, 5 μm; A phase: acetonitrile / water (10 mmol / L ammonium bicarbonate + 0.05% ammonia water), B phase: isopropanol / acetonitrile; flow rate: 20 mL / min; gradient: 75% B to 95% B, 9 min) to obtain compound MTS002 (99 mg, 31%) as a yellow oil; 1H NMR (300 MHz, CD3OD) δ: 0.80-0.90 (m, 15H), 1.29-1.34 (m, 54H), 1.52-1.64 (m, 12H), 2.28-2.35 (m, 4H), 2.52-2.57 (m, 4H), 2.63-2.68 (m, 2H), 3.60-3.64 (m, 2H), 3.80 (s, 2H), 4.87-4.89 (m, 1H); MS m / z [M+H]+(ESI): 780.80.

[0441] The following table compounds were synthesized using the methods of the above examples, or using analogous methods using the corresponding intermediates.

[0442] Example 1b: Preparation of lipid nanoparticles (LNP)

[0443] Materials for lipid nanoparticle assembly: (1) ionizable lipid compounds: ionizable lipids designed and synthesized in this application (MTS001 to MTS008, only MTS001 or MTS002 as an example in Table A-1 below) or SM102 (purchased from Sinopeg), ALC0315 (purchased from AVT); (2) structural lipids: Cholesterol (purchased from Sigma-Aldrich); (3) neutral lipids (phospholipids): DSPC as 1,2-distearoyl-sn-glycero-3-phosphocholine (purchased from AVT), DOPE as Dioleoyl Phosphoethanolamine (purchased from AVT); (4) polymer lipids: DMG-PEG2000 as 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (purchased from AVT); (5) see Table A-1 for relevant information of nucleic acid sequences. See Table A-1 for structural formulas of lipid nanoparticle assembly materials:

[0444] Table A-1

[0445] Method for preparing lipid nanoparticles: (1) ionizable lipid compounds, structural lipids, neutral lipids, and polymer lipids were dissolved and mixed in ethanol according to the formula; (2) mRNA active ingredients were dissolved in 25 mM sodium acetate solution (pH = 4.0); (3) the organic phase dissolved with lipid mixture and the aqueous phase dissolved with mRNA ingredients were mixed at a flow rate ratio of 1:1 to 1:4 using an automated high-throughput microfluidic system, and the mixing speed was at 10 mL / min to 18 mL / min; (4) the prepared lipid nanoparticles were diluted with phosphate buffered saline solution, and the nanoparticle solution was ultrafiltrated to the original preparation volume using an ultrafiltration tube with a molecular weight cutoff of 30 kDa (purchased from Millipore); (5) the obtained nanoparticles were filtered and sterilized through a 0.22 μm sterile filter membrane, and stored in a sealed glass bottle at low temperature.

[0446] The preparation method of lipid nanoparticles includes a microfluidic mixing system, but is not limited to this method, and also includes a T-type mixer and an ethanol injection method, etc.

[0447] Example 1c: Physical property characterization of lipid nanoparticles

[0448] The particle size and polydispersity index (PDI) of the prepared lipid nanoparticles were measured using Zetasizer Pro (purchased from Malvern Instruments Ltd) and DynaPro NanoStar (purchased from Wyatt). The encapsulation efficiency of the lipid nanoparticles for RNA was characterized by the encapsulation efficiency % which reflects the degree of combination of the lipid nanoparticles with the RNA fragments. The coefficient was measured by the method of Quant-it™ RiboGreen RNA Assay (purchased from Invitrogen). The lipid nanoparticle sample was diluted in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH = 7.5), and a portion of the sample solution was added with 0.5% Triton X-100 and incubated at 37°C for 30 minutes. The fluorescence value was read immediately after adding the reaction solution in the Varioskan LUX multifunctional enzyme label (purchased from Thermofisher) at the absorption light wavelength of 485 nm and the emission light wavelength of 528 nm to obtain the encapsulation efficiency value. The fluorescence value was read immediately after adding the reaction solution in the Varioskan LUX multifunctional enzyme label (purchased from Thermofisher) at the absorption light wavelength of 485 nm and the emission light wavelength of 528 nm to obtain the encapsulation efficiency value.

[0449] Example 1d: Preparation and expression detection of HPV mRNA vaccine

[0450] Flt3Lecd, GMCSF, OX40L, HMGB1 and HSP70p were selected as co-stimulatory factors for HPV mRNA vaccines. Using the artificial intelligence driven RNA design platform (AiRNA) built by the applicant, mRNA sequences were designed for different structures of HPV mRNA vaccines. The specific structure information of the vaccine mRNA sequence is shown in Tables 1-3. The nucleic acid fragments containing T7 promoter, 5'UTR, vaccine ORF coding sequence, 3'UTR, polyA (SEQ ID NO: 61) and IIS type restriction endonuclease cleavage site were synthesized in vitro and cloned into the in vitro transcription vector (pIVTRup, Addgene). The 5'UTR and 3'UTR of M20 1-4 and M21 1-4 were selected from SEQ ID NO. 57 and SEQ ID NO. 58, respectively; the 5'UTR and 3'UTR of P007, P008, P014, M20, M21, P019, P022, P025, P029 and P030 were selected from SEQ ID NO. 59 and SEQ ID NO. 60, respectively. The obtained vectors were linearized and used for in vitro transcription to produce mRNA molecules using T7-RNA polymerase, and 5'-cap structure was added by co-transcription capping to produce mRNA molecules with Cap1 structure. The obtained mRNA molecules were purified and resuspended in water, and stored at -80°C after determination of the concentration.

[0451] The mouse dendritic cell DC2.4 cells were plated at 2.5 x 10 5 The 6-well plate was plated at a high density, and after overnight culture, each group of vaccine mRNA (2 μg) was transfected into cells per well using Lipofectamine MessengerMAX (Thermofisher). Continue to culture for 24 h, lyse the cells, and perform Western blotting experiment to detect the expression of different HPV mRNA sequences using HPV16 E7 antibody (Cell Signaling Technology). BNT113E7 is the positive control group (Benchmark, BMK, the sequence is from WO2022 / 008519, the antigen structure is HPV16 SP-E7-Tetanus P2P16-MITD, and the nucleotide sequence of the mRNA is shown in SEQ ID NO: 40).

[0452] The results showed that the mRNA of each vaccine group and the mRNA of the positive control group were well expressed in the cells (Figure 1).

[0453] Table 1

[0454] Example 2: In vivo immunogenicity detection of HPV mRNA vaccine

[0455] HPV mRNA vaccine in the form of LNP is delivered into the animal body by intramuscular injection, which can significantly increase the number of HPV antigen-specific CD4+ and / or CD8+ T lymphocytes in the animal body. The in vivo immunogenicity of the mRNA drug is evaluated by detecting the number of T cells that respond to the HPV mRNA vaccine and specifically secrete IFNγ.

[0456] In this experiment, LNP-mRNA preparation was prepared using ionizable lipid SM102 (Xiamen Senobangge) classic formula (SM102:DSPC:cholesterol:DMG-PEG2000=50:10:38.5:1.5). 6-8 week old C57BL / 6N female mice were selected for grouping, and different HPV mRNA vaccine groups were set up, and empty LNP (i.e. lipid nanoparticles without encapsulating mRNA) was set up as a negative control group. The mice were immunized by intramuscular injection (i.m.) of 1 μg / mouse of mRNA drug at a dose of QWx2 (once a week for a total of 2 times) interval and frequency in the right tibialis anterior muscle. Seven days after the second immunization, the mouse spleen was taken, ground, red blood cells were lysed, and a single cell suspension of the spleen was obtained after filtration.

[0457] The mouse spleen single cell suspension was plated at a density of 0.5x10 5 The ELISpot 96-well plate was plated at a density of 0.5x10 After 18h incubation in the incubator, the cells and culture medium in the wells were discarded. Add 200 μl / well of deionized water and place in the refrigerator at 4°C for 10 minutes. Discard the liquid and rinse the wells 6 times with the Wash buffer in the kit, then pat dry. Add 100 μl of biotin-labeled detection antibody to each well and incubate at 37°C for 1h. Discard the liquid and rinse the wells 6 times with the Wash buffer, then pat dry. Add 100 μl of diluted enzyme-linked avidin to each well and incubate at 37°C for 1h. Discard the liquid and rinse the wells 6 times with the Wash buffer, then wash the membrane bottom and base with deionized water and pat dry. Add 100 μl of freshly prepared AEC developing solution to each well, and incubate at room temperature in the dark for 15 min. Stop the reaction, discard the liquid in the wells, and wash the PVDF membrane on both sides with water, then air dry at room temperature. Use the enzyme-linked spot analyzer (AID) to count the spots.

[0458] The results show (Figure 2) that almost no IFNy+T cells were detected in the empty LNP group, a strong T cell immune response was detected in the PMA+Ionomycin positive control group, and the P014 (GMCSF) and P022 (OX40L) groups had a stronger T cell immune response, indicating that GMCSF and OX40L as costimulatory factors can significantly improve the immunogenicity of the HPV mRNA vaccine.

[0459] After the HPV mRNA vaccine is delivered to the animal in the form of LNP by intramuscular injection, the HPV antigen-specific CD4+and / or CD8+T lymphocytes in the animal are significantly increased, and the in vivo immunogenicity of the mRNA drug is evaluated by detecting the number of T cells that respond to the HPV mRNA vaccine and specifically secrete IFNy.

[0460] Example 3: Evaluation of the tumor inhibition synergistic activity of costimulatory factors

[0461] This example uses a subcutaneous transplanted tumor mouse model of HPV16 positive mouse lung cancer cell line TC-1 to evaluate mRNA vaccines corresponding to different protein structures. The administration scheme is: the administration dose is 0.05, 0.15, 0.5 pg / mouse; the administration method is i.m; the administration window is ~ 6 mm 3 The drug is administered on the day of small tumor implantation; the administration interval and frequency are Q5Dx2 (administration once every 5 days, a total of 2 times). The specific experimental operation is as follows:

[0462] 3.1 Experimental materials

[0463] 3.1.1 TC-1 mouse tumor model

[0464] The subcutaneous transplanted tumor model was modeled by tumor transmission, and a large tumor mass taken from the passaged mouse was cut into small round pieces with a particle size of about 2 mm using a scalpel, and the small tumor mass was implanted in the right dorsal axillary of the mouse using a push needle.

[0465] 3.1.2 Drug

[0466] LNP formula: SM102:DSPC:cholesterol:DMG-PEG2000=50:10:38.5:1.5

[0467] mRNA: The specific structure information of the experimental group is shown in Table 2; the mRNA nucleotide sequence is shown in SEQ ID NO:40; the Benchmark is the positive control.

[0468] Table 2

[0469] Solvent: Tris + 10% sucrose

[0470] 3.1.3 Experimental animals

[0471] Animal species: C57BL / 6N mice

[0472] Animal gender: Female

[0473] Animal source: Vantianlihua

[0474] Weeks of age: 6 weeks of age

[0475] 3.2 Experimental method

[0476] 3.2.1 Drug administration

[0477] Drug administration time point: administration on the day of tumor implantation, tumor volume ~ 6 mm 3

[0478] Drug administration method: intramuscular injection, right hind limb rectus femoris

[0479] Drug administration dose: 0.05, 0.15, 0.5 μg / 50 μL / mouse / time

[0480] Drug administration frequency: Q5D x 2

[0481] 3.2.2 Experimental grouping

[0482] Blank control group: solvent group (Neg)

[0483] Negative control group: SM102-Empty (same lipid molecule content as high dose group)

[0484] Positive control group: Benchmark drug group (BMK)

[0485] Experimental group: 6 kinds of mRNA are set to high, medium and low 3 doses (0.05, 0.15 and 0.5 μg / 50 μL / mouse / time)

[0486] 5 mice in each group

[0487] 3.2.3 Evaluation index

[0488] Body weight (2-3 times a week after initial administration); tumor volume (2-3 times a week after initial administration); experimental endpoint: significant difference can be seen between groups or the experiment reaches the humane endpoint (mouse weight reduction of more than 20% or / and implanted tumor volume more than 2000 mm 3 )

[0489] 3.3 Experimental results

[0490] There was no difference in the weight of mice among groups. Tumor volume data showed that only the high dose of positive control drug significantly inhibited tumor growth, while the medium and low dose groups did not show obvious efficacy; the high and medium doses of the 5 METiS-mRNAs showed significant pharmacodynamic activity. In the low dose group, all mice models were completely remission (CR) after P014 administration, P022 showed no pharmacodynamic activity, and P019, P007 and P025 showed moderate antitumor activity (Figure 3).

[0491] 3.4 Experimental summary

[0492] The ranking of the 6 mRNAs tested according to the pharmacodynamic data in this round of experiments was: P014 > P019 > P025 ≈ P022 ≈ P007 > positive drug. This indicates that the GM-CSF element has the most optimal pharmacodynamic enhancement activity for the HPV mRNA vaccine.

[0493] Example 4: Preparation and expression detection of HPV mRNA vaccine containing co-stimulatory factor GM-CSF

[0494] The HPV mRNA vaccine containing co-stimulatory factor GM-CSF was prepared according to the method of Example 2, and the specific structure information of the vaccine mRNA sequence is shown in Table 3, and the ORF coding sequence is SEQ ID NO: 29-38.

[0495] Table 3

[0496] HPV antigen expression detection: HEK293T cells and DC2.4 cells were plated at a density of 8x105 and 5x105, respectively, in 6-well plates, and cultured overnight. Then 2 μg mRNA was transfected into each well of cells using Lipofectamine MessengerMAX (Thermofisher), and the cells were cultured for another 24 h. The cells were lysed and Western blotting was performed to detect the expression of different HPV mRNA sequences using HPV18 E7 antibody (NOVUS). Solvent blank and GFP were used as negative control groups.

[0497] Co-stimulatory factor (GM-CSF) expression detection: HEK293T cells were plated at a density of 8x105 in 6-well plates and cultured overnight. Then 2 μg mRNA was transfected into each well of cells using Lipofectamine MessengerMAX (Thermofisher), and the cells were cultured for another 24 h. The cell culture supernatant was collected and the content of GM-CSF in the supernatant was detected using ELISA (Abeam). 5

[0498] Results summary:

[0499] ​1. Western blotting results showed that HPV18 E7 expression was detected in HEK293T and DC2.4 cells transfected with different HPV mRNA vaccines, and the expression level of HPV antigen located upstream of T2A was higher (Figures 4 and 5).

[0500] 2. ELISA results showed that the hGM-CSF content in the supernatant of MTS-M20, MTS-M20-1 and MTS-M20-3 groups was significantly higher than that of MTS-M20-2 and MTS-M20-4 groups; the mGM-CSF content in the supernatant of MTS-M21, MTS-M21-1 and MTS-M21-3 groups was significantly higher than that of MTS-M21-2 and MTS-M21-4 groups (Figure 6), indicating that the expression level of GM-CSF located upstream of T2A was higher.

[0501] Example 5: Evaluation of the tumor inhibition activity of HPV mRNA vaccine containing co-stimulatory factor GM-CSF

[0502] This example uses a subcutaneous transplanted tumor mouse model of HPV16 positive mouse lung cancer cell line TC-1 to evaluate different structures of HPV mRNA vaccine containing co-stimulatory factor GM-CSF. The administration scheme is: the administration dose is set to 0.05, 0.15, 0.5 μg / 50 μL / mouse / time; the administration mode is intramuscular injection; the administration window is ~ 6 mm 3 The administration was performed on the day of small tumor implantation; the administration interval and frequency were Q5Dx2 (administration once every 5 days, a total of 2 times).

[0503] 5.1 Experimental materials

[0504] 5.1.1 TC-1 mouse tumor model

[0505] The subcutaneous transplanted tumor model was modeled by tumor transmission, and the large tumor mass taken from the passaged mouse was cut into small pieces with a particle size of about 2 mm, and the small tumor mass was implanted in the right dorsal axillary of the mouse using a push needle.

[0506] 5.1.2 Drug

[0507] LNP formula: MTS002-23 (MTS002: DOPE: cholesterol: DMG-PEG2000 = 40: 15: 43.5: 1.5)

[0508] mRNA: see Table 4 for specific structural information

[0509] Table 4

[0510] Solvent: Tris + 10% sucrose

[0511] 5.1.3 Experimental animals

[0512] Animal species: C57BL / 6N mice

[0513] Animal gender: Female

[0514] Animal source: Vantianlihua

[0515] Weeks of age: 6 weeks of age

[0516] 5.2 Experimental method

[0517] 5.2.1 Drug administration

[0518] Drug administration time point: Drug administration on the day of tumor implantation, and the volume of the implanted tumor was ~6mm3

[0519] Drug administration method: Intramuscular injection (i.m.), right hind limb rectus femoris

[0520] Drug administration dose: 0.02, 0.1, 0.5 μg / 50 μL / mouse / time

[0521] Drug administration frequency: Q5D x 2

[0522] 5.2.2 Experimental grouping

[0523] Blank control group: Solvent group

[0524] Negative control group (Empty): MTS002-23-Empty (lipid molecule content is the same as the high-dose group)

[0525] Positive control: Benchmark (BMK)

[0526] Experimental group: 5 kinds of mRNA were set up with high, medium and low 3 doses

[0527] 5 mice in each group

[0528] 5.2.3 Evaluation index

[0529] Body weight (2-3 times per week after initial drug administration); tumor volume (2-3 times per week after initial drug administration)

[0530] 5.3 Experimental results

[0531] There was no difference in the body weight of mice among groups. M21-2 performed best at high dose, and all mice achieved complete remission (CR) (Figure 7, each line in the figure represents one mouse).

[0532] 5.4 Experimental summary

[0533] M21-2 and M21-4 are more effective than M21-1 and M21-3, respectively, indicating that the HPV mRNA vaccine exhibits more optimal activity when the GM-CSF coding sequence is at the 3' end; M21-2 and M21-1 are more effective than M21-4 and M21-3, respectively, indicating that the HPV mRNA vaccine without the MITD coding sequence has more optimal pharmacodynamic activity.

[0534] Example 6: Vaccine molecules produce pharmacodynamic activity by activating HPV-specific CTLs

[0535] This example uses a subcutaneous transplanted tumor mouse model of HPV16-positive mouse lung cancer cell line TC-1 to analyze the pharmacological mechanism of the mRNA vaccine molecule, and the administration scheme is as follows: the administration dose is set to 0.05, 0.15, and 0.5 μg per mouse; the administration mode is i.m. (intramuscular injection); and the administration window is ~ 6 mm 3 The small tumor pieces were administered on the day of implantation; the administration interval and frequency were Q5Dx2. The specific experimental operation is as follows:

[0536] 6.1 Experimental materials

[0537] 6.1.1 Homologous mouse transplantation model

[0538] The subcutaneous transplanted tumor model was modeled using tumor transmission, and a large tumor piece taken from the passaged mouse was cut into nearly circular small pieces with a particle size of about 2 mm using a scalpel, and the small tumor pieces were implanted in the right dorsal axillary region of the mouse using a push needle.

[0539] 6.1.2 Drug

[0540] Lipid molecules: MTS002

[0541] LNP formulation: MTS002-23 (MTS002: DOPE: cholesterol: DMG-PEG2000 = 40: 15: 43.5: 1.5)

[0542] mRNA: M21-2 (HPV 16-18SP-E6-E7-E6-E7-2A-mGMCSF)

[0543] Solvent: Tris + 10% sucrose

[0544] 6.1.3 Experimental animals

[0545] Animal species: C57BL / 6N mice

[0546] Animal gender: female

[0547] Animal source: Vivotec Laboratories

[0548] Weeks of age: 6 weeks of age

[0549] 6.2 Experimental method

[0550] 6.2.1 Administration

[0551] Administration time point: administration on the day of tumor implantation, tumor volume ~ 6mm 3

[0552] Administration method: i.m., right hind limb rectus femoris

[0553] Administration dose: 0.05, 0.15, 0.5 μg / 50 μL / mouse / time

[0554] Administration frequency: Q5D x 2

[0555] 6.2.2 Experimental grouping

[0556] Blank control group: solvent group Tris

[0557] Negative control group (Empty): MTS002-23-Empty (lipid molecule content is the same as the high dose group)

[0558] Experimental group: high, medium and low three doses

[0559] Three mice were set in each group

[0560] 6.2.3 Evaluation index

[0561] Body weight (2-3 times a week after the first administration); tumor volume (2-3 times a week after the first administration); experimental endpoint: one week after the second administration, i.e. day 12 (D12).

[0562] 6.3 Experimental results

[0563] There was no difference in the body weight of mice between groups. The tumor volume data showed that M21-2 molecules exhibited significant dose-dependent pharmacodynamic activity on D12 (Figure 8).

[0564] The immune response to HPV16 E7 was detected by ELISpot method for the spleen cells of each group, and the results showed that with the increase of the administration dose of M21-2, the number of IFN-γ secretion positive points responding to HPV16 E7 also showed a dose-dependent increase, and there was a significant difference (Figure 9).

[0565] Further, the spleen cells and tumor tissue cells of each group were stained with Tetramer of HPV16 E7, and specific killer T cells (CTL) were identified by flow cytometry. The results showed that after administration of M21-2, the content of HPV E7 specific CTL was significantly up-regulated, and had a dose-dependent effect (Figure 10).

[0566] 6.4 Experimental summary

[0567] Ex vivo ELISpot and flow cytometry results were consistent and demonstrated that mRNA vaccine M21-2 successfully activated HPV-specific CTLs, and the specific CTLs had a significant positive correlation with efficacy (Figure 11). Therefore, the pharmacological mechanism of M21-2 is to activate the production of HPV-specific CTLs, thereby exerting specific killing activity.

[0568] Example 7: Lipid nanoparticle freeze-thaw stability experiment

[0569] The lipid nanoparticle preparation method is described in Example 1b, and the physical property characterization method is described in Example 1c. The nucleic acid fragment is Benchmark (BMK) (see Table A-1), and the lipid nanoparticle formulation design is described in detail in Table A-2.

[0570] The physical property characterization of the lipid nanoparticle was performed as follows: three batches of lipid nanoparticles were frozen at -20°C, and after 48 hours, they were thawed at room temperature. The physical properties of the thawed lipid nanoparticles were characterized, and the remaining lipid nanoparticles were returned to -20°C for freezing. After 48 hours, they were taken out and thawed at room temperature. The physical properties of the thawed lipid nanoparticles were characterized, and the remaining lipid nanoparticles were returned to -20°C for freezing. After 48 hours, they were taken out and thawed at room temperature. The physical properties of the thawed lipid nanoparticles were characterized. The characterization data of the freshly prepared LNP and the LNP after three freeze-thaw cycles are shown in Table A-3.

[0571] Table A-2

[0572] Table A-3

[0573] Example 8: Mouse immunization effect test of the lipid nanoparticle of the present application

[0574] The preparation and physical property characterization of the lipid nanoparticle were performed according to Example 1b and Example 1c. The LNP formulation and physical characterization data are shown in Table A-4:

[0575] Table A-4

[0576] MTS002 lipid nanoparticle formulation was screened by evaluating the adaptive immune effect produced by the mRNA encoding viral antigen protein-loaded lipid nanoparticles in mice. The test mice were SPF BALB / c mice, female, 6-8 weeks old, weighing 18-22 g, purchased from Beijing Sbiopharm Co., Ltd. All animals were adaptively fed for more than 7 days before the test, and were free to eat and drink during the test, with 12 / 12h light and dark alternation, indoor temperature of 20-26℃, and humidity of 40-70%. The mice were randomly divided into immune and negative control groups (DPBS, pH = 7.4), with 5 mice in each group. The prepared mRNA encoding viral antigen protein-loaded lipid nanoparticles were injected into the immune group of mice by intramuscular administration at the immunization dose of Table A-5. Two immunizations were performed, with an interval of several days between the two immunizations.

[0577] Table A-5

[0578] Evaluation of humoral immune effect

[0579] On the 10th day after the booster immunization, the mice were taken blood from the eye orbit to obtain a sufficient amount of serum, and the humoral immune response produced by the mRNA encoding viral antigen protein-loaded lipid nanoparticles in mice was evaluated.

[0580] 8.1 Novel coronavirus specific binding antibody detection

[0581] The novel coronavirus spike protein (purchased from Yiqiao God State) was diluted with carbonate buffer (50 mM, pH 9.6, 0.22 μm filter) to 2 ng / μl to form a protein coating solution, and was added to a 96-well plate, sealed, and incubated at 4℃ overnight; after overnight coating, the 96-well plate was poured to remove the protein coating solution, and wash buffer (1xTBS containing 0.2% Tween-20, purchased from Solabio) was added to each well for plate washing, which was repeated 6 times. After repeated plate washing, blocking solution (1xTBS containing 2% BSA, purchased from Solabio) was added to each well for blocking in a 37℃ incubator; after 2h of blocking, the plate washing operation was repeated; the immune mouse serum was diluted 10-fold with antibody diluent (wash buffer containing 0.5% BSA) to obtain serum with different dilutions of 10-1 to 10-6, which was added to the plate for incubation in a 37℃ incubator; after 2h of incubation, the plate washing operation was repeated; the horseradish peroxidase-labeled goat anti-mouse IgG (purchased from Biyun Tian) was diluted 250-fold with antibody diluent (wash buffer containing 0.5% BSA) to obtain a secondary antibody diluent, which was added to the plate for incubation in a 37℃ incubator; after 1h of incubation, the plate washing operation was repeated; TMB substrate was added, incubated at room temperature, protected from light, for 20 min for color development; finally, stop solution (purchased from Solabio) was added to terminate the reaction, and the OD value of A450 was detected on a microplate reader.

[0582] Serum binding antibody IgG titer determination: OD of a certain dilution serum / OD of negative control ≥2.1, OD of the next dilution / OD of negative control <2.1, and the dilution factor is the antibody titer corresponding to the serum sample (if the OD of the negative control is <0.05, it is calculated as 0.05). The SARS-CoV-2 spike protein binding antibody titers of the sera of mice immunized with lipid nanoparticles encapsulating SARS-CoV-2 spike protein mRNA are shown in Table A-6.

[0583] As can be seen from the data in Table A-6, the humoral immune effect of the lipid nanoparticles MTS002-31, MTS002-45, MTS002-0-35 of the present application is significantly better than that of the control group ALC0315. The humoral immune serum IgG titer of MTS002-37 is comparable to that of ALC0315. The humoral immune serum IgG titers of MTS002-23, MTS002-39 and MTS002-43 are slightly lower than that of ALC0315. Considering that the dosage of ALC0315 lipid nanoparticles encapsulating SARS-CoV-2 spike protein mRNA is twice that of the lipid nanoparticles encapsulating SARS-CoV-2 spike protein mRNA of MTS002, it is believed that the humoral immune effect of MTS002-23, MTS002-31, MTS002-37, MTS002-39, MTS002-43, MTS002-45 is better than that of the control group ALC0315.

[0584] Table A-6

[0585] 8.2 Cellular immune effect evaluation

[0586] On day 10 after the booster immunization, the spleens of the immunized mice and the negative control mice were dissected, and the spleen cells were isolated to prepare a single cell suspension. The mouse spleen cells were added with SARS-CoV-2 spike protein peptides (purchased from Jinserui, 2 μg / ml / peptide) and specifically stimulated at 37°C, 5% CO2 cell culture conditions. After 18 h of stimulation, the secretion of cytokines IFN-γ and IL-2 was detected using an enzyme-linked immunospot (ELISpot) assay kit (purchased from MABTECH). After the experiment, the plate was naturally air-dried for color development, and the spots were counted using a full-automatic AID iSpot ELISPOT plate reader, and various parameters of the spots were recorded. The secretion of SARS-CoV-2 spike protein specific IFN-γ and IL-2 is shown in Table A-7.

[0587] As can be seen from the data in Table A-7, the antigen-specific cytokine IFN-γ secretion of the spleen cells of the mice immunized with the MTS002 lipid nanoparticle formulations MTS002-37 and MTS002-0-35 of the present application was higher than that of the ALC0315 control group, and the antigen-specific cytokine IL-2 secretion of the spleen cells of the mice immunized with MTS002-23, MTS002-37, MTS002-39, MTS002-45 and MTS002-0-35 was higher than that of the ALC0315 control group. Taking into account that the immunization dose of the ALC0315 group was twice that of each of the MTS002 formulations, it was found that the cell immunity of MTS002-23, MTS002-37, MTS002-39 and MTS002-45 was superior to or equivalent to that of the ALC0315 control.

[0588] Table A-7

[0589] Example 9: Tumor inhibition effect test of the lipid nanoparticle provided in the present application

[0590] C57BL / 6N mice (Vivantgene), female, 6 weeks old. The TC-1 cell line was used for subcutaneous inoculation to form tumors, and the tumor transplantation model was established by tumor transmission, and the tumor block size was ~ 6 mm 3 , and the drug was administered on the day of tumor block implantation; the administration method was intramuscular injection in the right hind limb rectus femoris muscle, the administration dose was 0.5 μg / 50 μL / mouse / time, and the administration frequency was Q5Dx2. Each group had 5 mice: model group: injection of solvent Tris; negative control group: each LNP-Empty (i.e. lipid nanoparticle loaded with nucleic acid, the lipid content was the same as that of the experimental group); experimental group: each LNP-BMK group. The tumor volume measurement method was: the length and short diameter of the tumor were measured using a vernier caliper, and the calculation formula of the tumor volume was: V = 0.5a x b 2 , where a and b represent the length and short diameter of the tumor, respectively.

[0591] The specific formulations of the LNP are shown in Table A-8, the mRNA sequence is Benchmark (BMK) (see Table A-1), and the physical property characterization data are shown in Table A-9.

[0592] Table A-8

[0593] Table A-9

[0594] The tumor inhibition effects of the three LNP groups are shown in Figure 12, and the tumor volume data show that the three LNP compositions can all exert dose-dependent pharmacological activity, and each group of drugs can basically completely inhibit the tumor at a dose of 0.5 μg / 50 μL / mouse / time, and the pharmacological activity of the MTS001-0-35 group and the MTS002-0-35 group is superior to that of the SM102 group.

[0595] Example 10: Inhibition effect of LNP of the application on tumor

[0596] The specific formulation of LNP is shown in Table A-10, the method for preparing LNP is the same as that in Example 1b, and the method for animal experiment is the same as that in Example 9.

[0597] Table A-10

[0598] The inhibition effect of LNP in group 5 on tumor is shown in Figures 13 and 14, and the tumor volume data shows that the LNP compositions in group 5 can all exert dose-dependent pharmacodynamic activity. In the low-dose group (0.15 μg / 50 μL / mouse / time), the pharmacodynamic activity of MTS002-23, MTS002-37, MTS002-45 and MTS001-24 is better than that of MTS002-0-35, and the drug administration dose of each group is 0.5 μg / 50 μL / mouse / time, which basically completely inhibits the tumor.

[0599] Example 11: Pharmacodynamic evaluation of HPV16+ large tumor model

[0600] This example uses a subcutaneous transplanted tumor mouse model of HPV16-positive mouse lung cancer cell line TC-1 to evaluate the pharmacodynamic activity of the LNP-loaded mRNA molecules provided by the application. The administration scheme is as follows: the administration dose is set to 0.1, 1 and 10 μg / 50 μL / mouse / time; the administration mode is intramuscular injection; the administration window is when the transplanted tumor volume is 100 mm 3 and 500 mm 3 , respectively; the administration interval and frequency are QWx3 (once a week for a total of 3 times). The specific experimental operation is as follows:

[0601] 11.1 Experimental materials

[0602] 11.1.1 Homologous mouse transplantation model

[0603] The subcutaneous transplanted tumor model is modeled by tumor transmission, a large tumor mass taken from a passaged mouse is cut into small pieces with a diameter of about 2 mm using a scalpel, and the small tumor pieces are buried in the right dorsal axillary region of the mouse using a push needle.

[0604] 11.1.2 Drug

[0605] Lipid molecules: MTS002

[0606] LNP formulation: MTS002-23 (MTS002:DOPE:cholesterol:DMG-PEG2000 = 40:15:43.5:1.5)

[0607] mRNA: BMK (Benchmark), M21-2-Neg (without GM-CSF, encoding amino acid sequence see SEQ ID NO: 19), M21-2

[0608] Solvent: Tris + 10% sucrose

[0609] 11.1.3 Experimental animals

[0610] Animal species: C57BL / 6N mice

[0611] Animal gender: female

[0612] Animal source: Vantianlihua

[0613] Weeks of age: 6 weeks of age

[0614] 11.2 Experimental methods

[0615] 11.2.1 Administration

[0616] Administration time point: tumor volume ~100mm 3 and ~500mm 3

[0617] Administration method: intramuscular injection, right hind limb rectus femoris

[0618] Administration dose: 0.1, 1, 10 μg / 50 μL / mouse / time

[0619] Administration frequency: QWx3

[0620] 11.2.2 Experimental grouping

[0621] Negative control group (Empty): MTS002-23-Empty (lipid molecule content is the same as the high dose group)

[0622] Experimental group: three kinds of mRNA are set to high, medium and low three doses

[0623] 5 mice in each group

[0624] 11.2.3 Evaluation index

[0625] Body weight (measured 2-3 times per week after the first administration); tumor volume (measured 2-3 times per week after the first administration)

[0626] 11.3 Experimental results

[0627] There was no difference in the body weight of mice between groups. The tumor volume data showed that M21-2 began to give the first needle when the tumor volume was ~100mm 3 , and accumulated 3 injections, and the high, medium and low doses all had significant tumor inhibition activity. When the tumor volume was ~500mm3 When the first dose was given and the cumulative dose was 2 doses, M21-2 showed significant dose-dependent anti-tumor efficacy (Figure 15).

[0628] Meanwhile, in the large tumor efficacy model with a tumor volume of about 500mm 3 , the two control mRNA M21-2-Neg and BMK were given for 2 doses, and the efficacy of M21-2 was compared. The results showed that the anti-tumor efficacy of M21-2 was better than that of the other two mRNA vaccines at high, medium and low doses, and the anti-tumor efficacy of M21-2 at high dose was significantly different from that of M21-2-Neg and BMK (Figure 16).

[0629] 11.4 Experimental summary

[0630] In this round of experiments, M21-2 showed significant dose-dependent anti-tumor activity in a large tumor model; at the same time, compared with M21-2-Neg (without mGM-CSF) and BMK, M21-2 showed better efficacy. This indicates that the LNP loaded with M21-2 of the present application has good anti-tumor activity in large tumors, and GM-CSF has an efficacy boosting effect. +

[0631] Example 12: Efficacy evaluation of MC38 (HPV18-E6&E7) transplanted tumor model

[0632] This example uses a subcutaneous transplanted tumor mouse model of colon cancer cells MC38 (HPV18-E6&E7) stably expressing HPV18 E6 and E7 (item number KC-3790, purchased from KYINNO) to evaluate the efficacy of the mRNA molecule. When the tumor volume is about 100mm 3 and about 200mm 3 , the administration is started, i.e. the anti-tumor effect of the mRNA molecule on HPV18 + large tumor is evaluated at the same time. The administration scheme is: the administration dose is set to 0.05, 0.5, 5 μg / 50 μL / mouse / time; the administration mode is intramuscular injection (i.m.); the administration window is about 100mm 3 and about 200mm 3 ; the administration interval and frequency are QWx3 (once a week for a total of 3 times) or Q5Dx3 (once every 5 days for a total of 3 times). The specific experimental operation is as follows:

[0633] 12.1 Experimental materials

[0634] 12.1.1 Homologous mouse transplanted model

[0635] ​Subcutaneous tumor model adopts subcutaneous inoculation of MC38 (HPV18-E6&E7) tumor cells to form tumors, 0.1 mL of cell suspension with a concentration of 2x10 7 cells / mL is inoculated on the right dorsal side of the mouse near the axilla.

[0636] 12.1.2 Drug

[0637] Lipid molecules: MTS002

[0638] LNP formulation: MTS002-23 (MTS002: DOPE: cholesterol: DMG-PEG2000 = 40: 15: 43.5: 1.5)

[0639] mRNA:

[0640] Solvent: Tris + 10% sucrose

[0641] 12.1.3 Experimental animals

[0642] Animal species: C57BL / 6J mice

[0643] Animal gender: female

[0644] Animal source: Beijing Yakang Biology

[0645] Weeks of age: 6 weeks of age

[0646] 12.2 Experimental methods

[0647] 12.2.1 Administration

[0648] Administration time point: tumor volume ~100mm 3 or ~200mm 3

[0649] Administration method: intramuscular injection, right hind limb rectus femoris

[0650] Administration dose: 0.05, 0.5, 5 μg / 50 μL / mouse / time

[0651] Administration frequency: Q5Dx3 or QWx3

[0652] 12.2.2 Experimental grouping

[0653] Negative control group (Empty): MTS002-23-Empty (lipid molecule content is the same as the high dose group)

[0654] Experimental group: M21-2 sets high, medium and low three doses, M20-2 sets high and medium two doses

[0655] 5 mice in each group

[0656] 12.2.3 Evaluation Indicators

[0657] Body weight (measured 2-3 times per week after initial administration); tumor volume (measured 2-3 times per week after initial administration).

[0658] 12.3 Experimental Results

[0659] 12.3.1 mRNA molecules in tumors with a volume of ~100 mm 3 Time-based drug efficacy

[0660] There was no difference in body weight among the groups. Tumor volume data showed that M21-2 was present in a 100mm tumor. 3 The xenografts exhibited dose-dependent pharmacological activity, with significant differences in activity between the medium and high doses compared to the control group. At the high dose, both M21-2 and M20-2 showed good tumor inhibition rates (Figure 17).

[0661] 12.3.2 mRNA molecules in tumors with a volume of ~200 mm 3 Time-based drug efficacy

[0662] There was no difference in body weight among the groups. Tumor volume data showed that M21-2 was located at 200 mm. 3 The xenograft model exhibited dose-dependent pharmacological activity, and the pharmacological activity at the medium and high doses was significantly different from that of the control group (Figure 18).

[0663] 12.4 Experiment Summary

[0664] The LNP package provided in this application includes M21-2 and M20-2 in HPV18 type 100mm. 3 and 200mm 3 The drug exhibited good efficacy in the xenograft model, indicating that it has a good tumor-suppressing effect on large HPV18+ tumors.

[0665] Example 13: Freeze-thaw stability test of M20-2 mRNA encapsulated in lipid nanoparticles provided in this application

[0666] The lipid nanoparticles were prepared according to Example 1b, and their physical properties were characterized according to Example 1c. The assembly materials and proportions of each component of the lipid nanoparticles are shown in Table A-12. The encapsulated nucleic acid fragment was M20-2 mRNA (see the sequence list below), with an N / P ratio of 4.5.

[0667] Table A-12

[0668] The prepared lipid nanoparticles were divided into three batches, and the physical property characterization detection was carried out for 1-time freeze-thaw, 2-time repeated freeze-thaw and 3-time repeated freeze-thaw. The three batches of lipid nanoparticles were frozen at-20℃, and after 48h, they were taken out and thawed at room temperature. The thawed 1-time freeze-thaw batch of lipid nanoparticles was subjected to physical property characterization, and the rest of the lipid nanoparticles was returned to-20℃ for freezing, and after 48h, they were taken out and thawed at room temperature. The thawed 2-time repeated freeze-thaw batch of lipid nanoparticles was subjected to physical property characterization, and the rest of the lipid nanoparticles was returned to-20℃ for freezing, and after 48h, they were taken out and thawed at room temperature. The thawed 3-time repeated freeze-thaw batch of lipid nanoparticles was subjected to physical property characterization, and the freeze-thaw preparation characterization data are shown in Table A-13. The repeated freeze-thaw stability test showed that the freeze-thaw stability of the MTS002-23 formulation lipid nanoparticle loaded with M20-2 mRNA was good.

[0669] Table A-13

[0670] Example 14: Delivery effect of the lipid nanoparticles prepared from the ionizable lipid compounds of the application in mice

[0671] The preparation of the lipid nanoparticles refers to Example 1b, and the physical property characterization refers to Example 1c. The specific formulation (molar percentage) of the lipid nanoparticles is: ionizable lipid compound (MTS001-MTS008): cholesterol: DSPC: DMG-PEG2000 = 50:38.5:10:1.5, N / P = 6, and luciferase mRNA (purchased from Trilink, L-7202) is loaded. The ionizable lipid compounds used as controls are MC3 and SM102, and the LNP formulations thereof are the same as those of MTS001-MTS008. The delivery effect of the nanoparticles loaded with luciferase mRNA (Trilink, L-7202) in mice and the safety thereof are evaluated. The test mice are SPF C57BL / 6 mice, female, 6-8 weeks old, and weighing 18-22 g, which are purchased from Beijing Sbielof Biotechnology Co., Ltd. All animals are adaptively fed for more than 7 days before the test, and are free to eat and drink during the test, with 12 / 12 h light-dark alternation, and the indoor temperature is 20-26℃, and the humidity is 40-70%. The mice are randomly divided into groups. The above-prepared lipid nanoparticles loaded with luciferase mRNA are injected into the mice at a single dose of 0.5 mg / kg mRNA by intravenous administration, and the mice are subjected to in vivo bioluminescence detection by a small animal in vivo imaging system (IVIS LUMINA III, purchased from PerkinElmer) at 6 hours after administration. The specific operation steps of the detection are as follows: a D-luciferin solution with a concentration of 15 mg / mL is prepared with normal saline, and each mouse is given the substrate by intraperitoneal injection. After 10 minutes of substrate administration, the mice are placed in a narcotizing box for narcotization with a concentration of 2.5% isoflurane. The narcotized mice are placed in the IVIS for fluorescence imaging, and the data of the fluorescence concentrated distribution are collected and analyzed. The in vivo delivery efficiency of the lipid nanoparticles is represented by the average value of the fluorescence intensity and the total photon number of the same test group of animals, as shown in Table A-14.

[0672] Table A-14

[0673] DLin-MC3-DMA (MC3, commercially available):

[0674] Example 15: Tumor inhibition effect of the nucleic acid vaccine LNP of the present application in combination with an immune checkpoint inhibitor

[0675] A subcutaneous transplant tumor mouse model using MC38 (HPV18 E6E7) was used to test the pharmacodynamic synergy of mRNA vaccine drug LNP in combination with immune checkpoint inhibitors (ICIs), such as anti-PD-1 antibody (aPD-1). The vaccine drug LNP was MTS002-23-M21-2, and aPD-1 (a PD-1 antibody) was purchased from BioXcell (Cat No.: BP0146; Clone: RMP1-14). The specific experimental operation was as follows:

[0676] 15.1 Experimental materials

[0677] 15.1.1 Cell lines

[0678] MC38 (HPV18 E6E7), inoculation dose: 1x10 6 cells / 100 μL / point.

[0679] The inoculation position was the right side of the back near the axilla.

[0680] 15.1.2 Drugs

[0681] Ionizable lipid molecules: MTS002

[0682] LNP formulation: MTS002-23 (MTS002: DOPE: cholesterol: DMG-PEG2000 = 40: 15: 43.5: 1.5)

[0683] mRNA: M21-2

[0684] ICIs: aPD-1 (BP0146, BioXcell)

[0685] Solvent: vaccine: Tris + 10% sucrose; ICIs: PBS

[0686] Preparation concentration: vaccine: 0.01 mg / mL; ICIs: 2 mg / mL

[0687] 15.1.3 Experimental animals

[0688] Animal species: C57BL / 6N mice

[0689] Animal gender: female

[0690] Animal source: Vivotec Laboratories

[0691] Weeks of age: 6-8 weeks of age

[0692] 15.2 Experimental methods

[0693] 15.2.1 Administration

[0694] Dosing time point: when tumor volume is 70-100 mm 3 3 Dosing time point: when tumor volume is 70-100 mm

[0695] Dosing method: vaccine: i.m., right hind limb rectus femoris; ICIs: i.p., intraperitoneal injection

[0696] Dosing dose: vaccine: 0.5 μg / 50 μL / mouse / time; ICIs: 200 μg / 100 μL / mouse / time

[0697] Dosing frequency: vaccine: Q5Dx3; ICIs: Q3Dx6

[0698] 15.2.2 Experimental grouping

[0699] Negative control group: MTS002-23-Empty (lipid molecule content is the same as M21-2-0.5 μg group)

[0700] Vaccine single-drug group: M21-2-0.5 μg

[0701] ICIs single-drug group: αPD-1 10mpk

[0702] Combination group: M21-2-0.5 μg+αPD-1 10mpk

[0703] 6 mice in each group

[0704] 15.2.3 Evaluation index

[0705] Body weight (2-3 times per week after initial administration); tumor volume (2-3 times per week from when the tumor mass can be touched); with more than 20% body weight reduction or / and tumor volume reaching 2000 mm 3 as the humane endpoint

[0706] 15.3 Experimental results and analysis

[0707] 15.3.1 Tool cell MC38 (HPV18E6E7)

[0708] MC38 (HPV18 E6E7) cells are monoclonal tool cells prepared by stably transfecting HPV18-E6E7 into MC38 cells using lentivirus. After construction, the E6E7 gene of HPV18 in the genome of the tool cells was detected by qPCR, and the primer sequence information used is as follows: E6-Forward, TAATAAGGTGCCTGCGGTGC; E6-Reverse, GTTGGAGTCGTTCCTGTCGT; E7-Forward, ACATTTACCAGCCCGACGAG; E7-Reverse, GGTCGTCTGCTGAGCTTTCT. The qPCR detection results show that the tool cells can stably express HPV18 E6E7 (Figure 19).

[0709] At the same time, the expression of PD-L1 in the tool cells was detected by flow cytometry, and the detection results showed that MC38 (HPV18 E6E7) cells positively expressed PD-L1 (Figure 20), wherein only the fluorescence secondary antibody group (PE-anti-human Fc) was the negative control group, and the fluorescence secondary antibody was Goat F(ab')2 Anti-Human IgG-Fc (PE) purchased from Abeam, the item number is ab98596. Therefore, in the mouse xenograft model of the cells, the administration of aPD-1 can target the PD-1 protein on the membrane of T cells, so that the PD-L1 on the surface of tumor cells cannot effectively bind to the PD-1 of T cells, thereby relieving immune suppression, and thus can effectively immunokill the transplanted tumor under the mediation of the tumor vaccine.

[0710] 15.3.2 Pharmacodynamic experiment of combination

[0711] From the body weight data, there was no obvious difference between the groups (Figure 21). In terms of tumor inhibition effect, the single drug administration group had significant pharmacodynamic activity relative to the control group, the combination group had significantly enhanced pharmacodynamic activity relative to the single drug administration group, and basically caused the tumor to regress (Figure 22).

[0712] 15.4 Research summary

[0713] This study shows that the nucleic acid vaccine LNP of the present application has synergistic pharmacodynamic activity when combined with aPD-1, and can significantly enhance the tumor inhibition effect.

[0714] Obviously, the above examples are only examples for the purpose of clarity, and are not a limitation on the embodiments. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, it is not necessary and impossible to exhaust all embodiments. The changes or variations derived therefrom are still within the protection scope of the present application.

[0715] Sequence information

Claims

1. A lipid nanoparticle for delivering an HPV nucleic acid vaccine, comprising an ionizable lipid, a structural lipid, a neutral lipid, and a polymeric lipid, wherein the ionizable lipid is a compound of Formula (II), or a pharmaceutically acceptable salt, isotopologues, tautomer, or stereoisomer thereof, wherein a = 1, 2, 3, 4, 5 or 6; b = 4, 5, 6, 7, 8, 9 or 10; c = 1, 2, 3, 4, 5 or 6; d = 0, 1, 2, 3 or 4; c + d = 3, 4, 5, 6, 7, 8 or 9; M1and M2are independently selected from the group consisting of -C(O)O-, -OC(O)-, -O-, -SC(O)O-, -OC(O)NR-, -NRC(O)NR-, -OC(O)S-, -OC(O)O-, -NRC(O)O-, -SC(O)-, -C(O)S-, -NR-, -C(O)NR-, -NRC(O)-, -NRC(O)S-, -SC(O)NR-, -C(O)-, -OC(S)-, -C(S)O-, -OC(S)NR-, -NRC(S)O-, -S-S-, and -S(O) 0-2 -; R1and R2are independently selected from C 4-25 alkyl, C 4-25 alkenyl and C 4-25 alkynyl, optionally substituted with one or more R 1s and wherein one or more methylene units are optionally and independently replaced with -NR'-; R 1s independently selected from H, C 1-20 alkyl, -L c -OR c , -L c -SR c and -L c -NR c R’ c ; R and R' are each independently selected from H and C 1-20 alkyl; L c independently selected from a chemical bond and C 1-20 alkylene; R c and R' c are independently selected from H, C 1-20 alkyl, C 3-14 cycloalkyl and 3- to 14-membered heterocyclyl; R4and R5are independently selected from C 1-8 alkyl, optionally substituted with one or more R 4s substituents; or R4, R5 together with the carbon atom to which they are attached form C 3-14 cycloalkylene or 3- to 14-membered heterocyclylene, which is optionally substituted by one or more R 4s substituents; R 4s independently selected from H, halogen, cyano, C 1-8 alkyl, C 1-8 haloalkyl, -L d -OR d , -L d -SR d and -L d -NR d R’ d ; L d independently selected from a chemical bond and C 1-8 alkylene; R d and R' d are independently selected from H, C 1-8 alkyl, C 3-14 cycloalkyl and 3- to 14-membered heterocyclyl; R1and R2are independently selected from C 4-20 alkyl, C 4-20 alkenyl and C 4-20 alkynyl, optionally substituted with one or more R 1s , and wherein one or more methylene units are optionally and independently replaced with -NR'-, and wherein R 1s , R' are as defined above.

2. The lipid nanoparticle of claim 1, wherein M1and M2are independently selected from -C(O)O- or -OC(O)-.

3. The lipid nanoparticle of any one of claims 1-2, wherein R4and R5are independently C 1-8 alkyl, preferably C 1-3 alkyl, more preferably methyl.

4. The lipid nanoparticle of any one of claims 1-3, wherein R1and R2are independently selected from C 4-20 alkyl, preferably R1is C 6-14 alkyl and R2is C 8-20 alkyl, more preferably R1is C 8-12 straight chain alkyl and R2is C 12-20 branched chain alkyl.

5. The lipid nanoparticle of any one of claims 1-4, wherein a is 2, b is 7, c is an integer from 2-5, such as 2, 3, 4, or 5, and d is an integer from 1-4, such as 1, 2, 3, or 4.

6. The lipid nanoparticle of any one of claims 1-5, wherein the compound of Formula (II) is selected from the following compounds, or a pharmaceutically acceptable salt, isotopically enriched variant, tautomer, or stereoisomer thereof:

7. The lipid nanoparticle of claim 1, wherein the structural lipid is a sterol; preferably, the sterol is selected from one or more of: cholesterol, sitosterol, coprostanol, desmosterol, brassicasterol, ergosterol, tomatidine, ursolic acid, alpha-tocopherol, stigmasterol, avenasterol, ergocalciferol, and campesterol; preferably, the structural lipid is selected from cholesterol and / or beta-sitosterol; more preferably, the structural lipid is cholesterol.

8. The lipid nanoparticle of claim 1, wherein the neutral lipid is selected from a phosphatidylcholine and / or a phosphatidylethanolamine; preferably, the phosphatidylcholine is selected from one or more of: DSPC, DLPC, DUPC, POPC, DPPC, DMPC, POPC, DOCP, DOPE, DMPE, POPE, DPPE, DOPC, DOPG, sphingomyelin, and mixtures thereof, more preferably DSPC and / or DOPE.

9. The lipid nanoparticle of claim 1, wherein the polymeric lipid is a PEGylated lipid; preferably, the PEGylated lipid is selected from one or more of: a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, and a PEG-modified dialkylglycerol; preferably, the PEGylated lipid comprises a PEG moiety of 1000 Da to 20 kDa, preferably a PEG moiety of about 1000 Da to about 5000 Da; Preferably, the pegylated lipid is selected from one or more of: DMPE-PEG1000, DPPE-PEG1000, DSPE-PEG1000, DOPE-PEG1000, DMG-PEG2000, Ceramide-PEG2000, DMPE-PEG2000, DPPE-PEG2000, DSPE-PEG2000, Azido-PEG2000, DSPE-PEG2000, DSPE-PEG2000-Mannose, DSPE-PEG2000 amine, DSPE-PEG3350, DSPE-PEG3500, DMG-PEG3500, DPPE-PEG3500, DSPE-PEG4000, DMG-PEG4000, Ceramide-PEG5000, DSPE-PEG5000, DMG-PEG5000, and ALC-0159, preferably DMG-PEG2000, DSPE-PEG2000, DMG-PEG3500, DMG-PEG4000, and / or DMG-PEG5000, more preferably DMG-PEG2000.

10. The lipid nanoparticle of any one of claims 1-9, comprising the following molar percentages of components: ionizable lipid: about 35-50%, preferably about 35-45%, more preferably about 38-45%, more preferably about 40-42%; structural lipid: about 30-55%, preferably about 35-45%, more preferably about 40-45%, more preferably about 41-44%; neutral lipid: about 5-30%, preferably about 5-20%, more preferably about 10-20%, more preferably about 15%; polymer lipid: about 0.5-3.5%, preferably about 1-3%, more preferably about 1-2%, more preferably about 1.5-2%.

11. The lipid nanoparticle of any one of claims 1-10, further comprising at least one cargo, the cargo selected from a therapeutic agent and / or a prophylactic agent; preferably, the cargo is a nucleic acid molecule for use as an HPV vaccine.

12. The lipid nanoparticle of claim 11, wherein the nucleic acid molecule comprises an open reading frame (ORF) comprising: - a nucleotide sequence encoding an HPV antigen; - a nucleotide sequence encoding an immune costimulatory factor; and - a nucleotide sequence encoding a self-cleaving peptide located between the nucleotide sequence encoding an HPV antigen and the nucleotide sequence encoding an immune costimulatory factor.

13. The lipid nanoparticle of claim 12, wherein the HPV antigen comprises at least one HPV immunogenic polypeptide from at least one HPV serotype.

14. The lipid nanoparticle of claim 13, wherein the at least one HPV serotype is selected from the group consisting of serotypes 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39, preferably, the at least one HPV serotype is serotype 16 and / or serotype 18.

15. The lipid nanoparticle of claim 13 or 14, wherein the HPV immunogenic polypeptide is selected from the group consisting of an El, E2, E3, E4, E5, E6, E7, LI, or L2 polypeptide of HPV or an immunogenic variant thereof, preferably, the HPV immunogenic polypeptide is selected from the group consisting of an E6, E7, L2 polypeptide or an immunogenic variant thereof, more preferably, the HPV immunogenic polypeptide is selected from the group consisting of an E6, E7 polypeptide or an immunogenic variant thereof.

16. The lipid nanoparticle of any one of claims 13-15, wherein the HPV antigen comprises two HPV immunogenic polypeptides from one HPV serotype, or, the HPV antigen comprises two HPV immunogenic polypeptides from two HPV serotypes.

17. The lipid nanoparticle of any one of claims 13-16, wherein the HPV antigen comprises i) an E6 polypeptide and an E7 polypeptide from HPV serotype 16; ii) an E6 polypeptide and an E7 polypeptide from HPV serotype 18; or iii) an E6 polypeptide and an E7 polypeptide from HPV serotype 16 and an E6 polypeptide and an E7 polypeptide from HPV serotype 18.

18. The lipid nanoparticle of claim 17, wherein - the E6 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 41 or SEQ ID NO: 67 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 41 or SEQ ID NO: 67; - the E7 polypeptide from HPV serotype 16 comprises the amino acid sequence set forth in SEQ ID NO: 42 or SEQ ID NO: 68 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 42 or SEQ ID NO: 68; - the E6 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 43 or SEQ ID NO: 69 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 43 or SEQ ID NO: 69; ​ ​ ​ ​ ​ ​ - the E7 polypeptide from HPV serotype 18 comprises the amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 70 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO: 44 or SEQ ID NO:

70.

19. The lipid nanoparticle of any one of claims 13-18, wherein the HPV antigen further comprises a signal peptide, whereby secretion expression of the HPV immunogenic polypeptide is induced, for example, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO:

48.

20. The lipid nanoparticle of any one of claims 13-19, wherein the different polypeptides comprised in the HPV antigen are directly linked or linked via a peptide linker, for example, the peptide linker comprises the sequence GnS, n being an integer from 1 to 5, for example n is 1 or 3.

21. The lipid nanoparticle of any one of claims 12-20, wherein the immune co-stimulatory factor is selected from Flt3Lecd, GM-CSF, OX40L, HMGB1 or HSP70p, preferably GM-CSF and OX40L, more preferably GM-CSF.

22. The lipid nanoparticle of claim 21, wherein the GM-CSF comprises the amino acid sequence set forth in SEQ ID NO:

50.

23. The lipid nanoparticle of any one of claims 12-22, wherein the self-cleaving peptide is a 2A polypeptide, preferably a T2A polypeptide or a P2A polypeptide, more preferably a T2A polypeptide.

24. The lipid nanoparticle of claim 23, wherein the T2A polypeptide amino acid sequence is set forth in SEQ ID NO:

64.

25. The lipid nanoparticle of any one of claims 12-24, wherein the ORF comprises, in the 5’ to 3’ direction, the nucleotide sequence encoding the HPV antigen, the nucleotide sequence encoding the self-cleaving peptide and the nucleotide sequence encoding the immune co-stimulatory factor.

26. The lipid nanoparticle of any one of claims 12-25, wherein the ORF encodes an amino acid sequence comprising the structure: SP-HPV immunogenic polypeptide-2A-GMCSF, wherein SP is a signal peptide, 2A is a 2A polypeptide, and GMCSF is human or murine GM-CSF; preferably, the ORF encodes an amino acid sequence comprising the structure: SP-E6 16 -E7 16 -E6 18 -E7 18 -2A-GMCSF, wherein SP is a signal peptide, E6 16 and E7 16 are E6 and E7 polypeptides from HPV serotype 16, respectively, E6 18 and E7 18 are E6 and E7 polypeptides from HPV serotype 18, respectively, 2A is a 2A polypeptide, and GMCSF is human or murine GM-CSF.

27. The lipid nanoparticle of any one of claims 12-26, wherein the ORF encodes the amino acid sequence set forth in one of SEQ ID NOs: 3-6 and 8-18 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 3-6 and 8-18, preferably the ORF encodes the amino acid sequence set forth in SEQ ID NO: 11 or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO:

11.

28. The lipid nanoparticle of any one of claims 12-27, wherein the ORF comprises a nucleotide sequence set forth in one of SEQ ID NOs: 23-26 and 28-38 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to one of SEQ ID NOs: 23-26 and 28-38. Preferably, the ORF comprises a nucleotide sequence set forth in SEQ ID NO: 31 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO:

31.

29. The lipid nanoparticle of any one of claims 12-28, wherein the nucleic acid molecule is an mRNA molecule.

30. The lipid nanoparticle of claim 29, wherein the mRNA molecule further comprises a 5’ UTR and / or a 3’ UTR.

31. The lipid nanoparticle of claim 30, wherein the 5’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 57 and the 3’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 58; or the 5’ UTR comprises a nucleotide sequence set forth in SEQ ID NO: 59 and the 3’ UTR comprises a nucleotide sequence set forth in SEQ ID NO:

60.

32. The lipid nanoparticle of any one of claims 29-31, wherein the mRNA molecule further comprises a poly(A) sequence.

33. The lipid nanoparticle of claim 32, wherein the poly(A) sequence comprises about 20 to about 500 adenine nucleotides (A), preferably the poly(A) sequence comprises 120 adenine nucleotides (A).

34. The lipid nanoparticle of any one of claims 29-33, wherein the mRNA molecule comprises a nucleotide sequence set forth in SEQ ID NO: 66 or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity to SEQ ID NO:

66.

35. The lipid nanoparticle of any one of claims 29-34, wherein the mRNA molecule further comprises a 5’ cap structure, for example, the 5’ cap structure is a Capl cap structure.

36. The lipid nanoparticle of any one of claims 29-35, wherein the mRNA molecule further comprises at least one modified nucleotide, preferably the modified nucleotide is selected from pseudouridine, N1-methyl-pseudouridine, 5-methylcytidine, or a combination thereof.

37. A method of making the lipid nanoparticle of any one of claims 1-36, comprising: mixing the lipid components in the lipid nanoparticle, and mixing with the cargo to obtain the lipid nanoparticle.

38. A composition comprising the lipid nanoparticle of any one of claims 1-36.

39. A pharmaceutical composition comprising the lipid nanoparticle of any one of claims 1-36 and optionally a pharmaceutically acceptable excipient, e.g., a carrier, adjuvant, or vehicle.

40. An immunogenic composition comprising the lipid nanoparticle of any one of claims 1-36 and optionally a pharmaceutically acceptable carrier.

41. Use of the lipid nanoparticle of any one of claims 1-36 or the composition of claim 38 or the pharmaceutical composition of claim 39 or the immunogenic composition of claim 40 in the manufacture of a medicament or vaccine for the prevention and / or treatment of an HPV infection and / or an HPV infection-related pathology; i. Preferably, wherein the HPV infection is an HPV infection of a serotype selected from the group consisting of: 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39; More preferably, wherein the HPV infection is an infection of a single HPV serotype or the HPV infection is a mixed infection of two or more different HPV serotypes; More preferably, wherein the HPV infection is an infection of HPV 16 and / or HPV 18; or ii. Preferably, wherein the HPV infection-related pathology is selected from the group consisting of cutaneous warts, e.g., common warts, plantar warts, flat warts, Bowen’s disease, butcher’s warts, or condyloma acuminata; HPV-positive tumors, e.g., HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), prostate cancer, or bladder cancer.

42. A method of preventing and / or treating an HPV infection and / or an HPV infection-related pathology in a subject, comprising administering to the subject an effective amount of the lipid nanoparticle of any one of claims 1-36 or the composition of claim 38 or the pharmaceutical composition of claim 39 or the immunogenic composition of claim 40; i. Preferably, wherein the HPV infection is an HPV infection of a serotype selected from the group consisting of: 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39; More preferably, wherein the HPV infection is an infection of a single HPV serotype or the HPV infection is a mixed infection of two or more different HPV serotypes; More preferably, wherein the HPV infection is an infection of HPV 16 and / or HPV 18; or ii. Preferably, wherein the HPV infection-related pathology is selected from the group consisting of cutaneous warts, e.g., common warts, plantar warts, flat warts, Bowen’s disease, butcher’s warts, or condyloma acuminata; HPV-positive tumors, e.g., HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), prostate cancer, or bladder cancer. ii. Preferably, wherein the HPV infection related pathology is selected from skin warts, such as common warts, plantar warts, flat warts, Bowen's disease, butcher's warts or condyloma acuminata; HPV positive tumors such as HPV positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer; and / or iii. Preferably, wherein the lipid nanoparticle or composition is administered by injection, such as intramuscular injection, intravenous injection, intra-arterial injection or intraperitoneal injection, preferably intramuscular injection.

43. The lipid nanoparticle of any one of claims 1-36 or the composition of claim 38 or the pharmaceutical composition of claim 39 or the immunogenic composition of claim 40 for use in the prevention and / or treatment of an HPV infection and / or an HPV infection related pathology; i. Preferably, wherein the HPV infection is an HPV infection of a serotype selected from the group consisting of: HPV 1, 2, 3, 4, 7, 10, 12, 15, 6, 11, 13, 32, 34, 40, 42, 43, 44, 53, 54, 5, 8, 14, 17, 20, 36, 38, 16, 18, 30, 31, 33, 35, 39; More preferably, wherein the HPV infection is an infection of a single HPV serotype or the HPV infection is a mixed infection of two or more different HPV serotypes; More preferably, wherein the HPV infection is an infection of HPV 16 and / or HPV 18; or ii. Preferably, wherein the HPV infection related pathology is selected from skin warts, such as common warts, plantar warts, flat warts, Bowen's disease, butcher's warts or condyloma acuminata; HPV positive tumors such as HPV positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer or bladder cancer.

44. A kit comprising the lipid nanoparticle of any one of claims 1-36 or the composition of claim 38 or the pharmaceutical composition of claim 39 or the immunogenic composition of claim 40, and optionally a chemotherapeutic agent, an immune checkpoint inhibitor or an antibody targeting a tumor antigen.

45. The kit of claim 44, wherein the immune checkpoint inhibitor is a PD1 signaling pathway inhibitor; preferably the PD1 signaling pathway inhibitor is selected from the group consisting of a PD1 antibody, a PDL1 antibody, a PDL2 antibody, or a combination thereof; preferably a PD1 antibody.

46. A combination product comprising: (1) the lipid nanoparticle of any one of claims 1-36 or the composition of claim 38 or the pharmaceutical composition of claim 39 or the immunogenic composition of claim 40, and (2) an immune checkpoint inhibitor; preferably, the immune checkpoint inhibitor is a PD1 signaling pathway inhibitor; preferably, the PD1 signaling pathway inhibitor is selected from a PD1 antibody, a PDL1 antibody, a PDL2 antibody, or a combination thereof; preferably a PD1 antibody.

47. A method for preventing and / or treating a neoplastic and / or cancer disease in a subject, said method comprising administering to said subject an effective amount of the combination product of claim 46; preferably, the neoplastic and / or cancer disease is a HPV-positive neoplastic and / or cancer disease; more preferably, the neoplastic and / or cancer disease is selected from a HPV-positive cervical cancer, vulvar cancer, penile cancer, anal cancer, vaginal cancer, rectal cancer, bladder cancer, endometrial cancer, oropharyngeal cancer, head and neck cancer (e.g. head and neck squamous cell carcinoma), prostate cancer, or bladder cancer.

Citation Information

Patent Citations

  • Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids

    CN108368028A

  • Messenger ribonucleic acids for enhancing immune responses and methods of use thereof

    CN110402145A

  • Lipid nanoparticles

    CN115887674A

  • Novel ionizable lipid for nucleic acid delivery and LNP composition and vaccine thereof

    CN116514671A

  • Therapeutic HPV mRNA vaccine and application thereof

    CN117624381A