Composition for producing cardiac organoid, and method for producing cardiac organoid by using same
A composition of heart-associated long non-coding RNA and extracellular matrix fibers differentiates and matures cardiac cells, creating a multi-chamber cardiac organoid capable of spontaneous contraction, addressing the limitations of existing organoids in drug development and heart disease research.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-12-11
- Publication Date
- 2026-03-19
AI Technical Summary
Existing cardiac organoids exhibit limitations in morphological and functional similarity to adult cardiomyocytes, with challenges in achieving cell maturation through self-organization and reproducing diastolic and systolic movements, which hinders their application in studying heart diseases and drug development.
A composition comprising heart-associated long non-coding RNA and extracellular matrix fibers is used to differentiate and mature cardiac cells, enabling the formation of a multi-chamber cardiac organoid with ventricles, valves, and lumens, capable of spontaneous contraction.
The method produces cardiac organoids that are morphologically and functionally similar to a living heart, facilitating accurate drug efficacy and toxicity testing, and potentially contributing to cardiac regeneration and recovery treatments.
Smart Images

Figure KR2024096729_19032026_PF_FP_ABST
Abstract
Description
Composition for manufacturing cardiac organoids and method for manufacturing cardiac organoids using the same
[0001] The present invention relates to a composition for manufacturing cardiac organoids, a cardiac organoid using the same, a method for manufacturing the same, and an advanced cardiac organoid.
[0002] Organoids are formed by growing stem cells into specific cell types to create three-dimensional structures resembling organs. Unlike two-dimensional cell-based models, organoids are cultured in a three-dimensional environment, allowing for longer-term cultivation. Furthermore, while organoids are small in size, their constituent cells and structures closely resemble actual organs. Consequently, organoids are considered optimal experimental subjects for evaluating drug efficacy and safety during the new drug development process. Moreover, the field of organoids holds high potential for applications not only in evaluating drug toxicity and efficacy in new drug development but also in disease models, cancer research, personalized medicine, and regenerative therapies.
[0003] Meanwhile, cardiac organoids developed to date exhibit electrophysiological characteristics and other traits of immature cardiomyocytes. Furthermore, they have limitations in that they are not morphologically similar to a living heart. Since most cardiovascular diseases develop after adulthood or the progression of aging, there is a need to develop cardiac organoids containing mature cardiomyocytes that are morphologically and functionally similar to adult cardiomyocytes.
[0004] The background description of the invention is provided to facilitate a better understanding of the present invention. The matters described in the background description should not be construed as an acknowledgment that they exist as prior art.
[0005] As a solution to the aforementioned problem, an artificial heart tissue was proposed by utilizing differentiated cardiomyocytes to produce various heart cells (cardiomyocytes, vascular endothelial cells, smooth muscle cells, and fibroblasts), and through this, the structure and function of the heart were reproduced.
[0006] However, in the case of artificial heart tissue, it exhibits a shape completely different from that of the heart, which significantly influences cardiac function, and since it is functionally unable to perform relaxation and contraction movements, there may be limitations in replacing cardiac organoids.
[0007] To address the problems of previously proposed cardiac organoids, a chamber-structure tissue-based cardiac organoid using cardiac constituent cells was developed.
[0008] However, newly developed cardiac organoids have difficulty achieving cell maturation through self-organization and morphologically possess a tubular form characteristic of the very early stages of cardiac development; functionally, while pulsation is possible due to the chamber structure, the reproduction of diastolic and systolic movements may be impossible.
[0009] Consequently, there may still be limitations in the study of heart disease, new drug development, and furthermore, the evaluation of drug cardiotoxicity using the relevant cardiac organoids.
[0010] The inventors of the present invention intended to develop an advanced cardiac organoid having a multi-chamber with distinct cavities, and at the same time, to resolve the complexity of the cardiac organoid fabrication method.
[0011] More specifically, the inventors of the present invention sought to overcome the limitations of conventional cardiac organoid production methods, which involve complex manufacturing processes and low organization efficiency, making it impossible to produce advanced cardiac organoids, as each cardiac cell is differentiated and produced, and then aggregated and fused in a different batch.
[0012] The inventors of the present invention sought to develop a method for producing a functionally superior cardiac organoid by optimizing the interaction between each cell, particularly by simultaneously differentiating cardiac constituent cells and inducing cell maturation through self-organization.
[0013] At this time, the inventors of the present invention focused on functional RNA molecules of non-coding RNA present in the heart.
[0014] In particular, the inventors of the present invention recognized that long non-coding RNA reflecting species-specific characteristics can not only induce cardiac differentiation but also promote maturation, thereby enhancing the differentiation and functionality of each cardiac cell.
[0015] The inventors of the present invention aimed to lay the foundation for contributing to research on heart diseases and the development of treatment methods by producing organoids possessing actual cardiac functions using long non-coding RNA present in the heart.
[0016] Furthermore, the inventors of the present invention recognized that by using a composition for manufacturing cardiac organoids containing long non-coding RNA present in the heart as an active ingredient, a cardiac organoid can be obtained directly through the differentiation of stem cells without additional processing such as differentiation, aggregation, and fusion of each cardiac cell as the two-dimensional cells are converted into three dimensions.
[0017] As a result, the inventors of the present invention have developed a composition and a method for manufacturing a cardiac organoid that is morphologically and functionally similar to a living heart, composed of mature cells, while simplifying the manufacturing process.
[0018] Accordingly, the problem that the present invention aims to solve is to provide a composition for manufacturing a cardiac organoid comprising a long non-coding RNA associated with the heart.
[0019] Another problem that the present invention aims to solve is to provide a method for manufacturing a mature cardiac organoid and an advanced cardiac organoid, which has structures such as ventricles, valves, and lumen similar to a living heart and possesses the function of self-contraction, by means of a composition for manufacturing cardiac organoids.
[0020] The problems of the present invention are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below.
[0021] In order to solve the problem described above, a composition for manufacturing a cardiac organoid according to one embodiment of the present invention is provided.
[0022] The above composition is a composition for manufacturing advanced cardiac organoids and comprises heart-associated long noncoding RNA and extracellular matrix (ECM) fibers as active ingredients.
[0023] As used herein, the term "organoid" refers to a small culture that reproduces both the form and function of a tissue or organ. More specifically, an organoid must contain one or more types of cells among the various types of cells that constitute an organ or tissue, be able to reproduce the specific functions of each organ, and be organized spatially in a form similar to an organ by clustering the cells together. Such organoids differ from spheroids in that they form a lineage rather than being a simple aggregate of cells, and can be used for new drug development, artificial organs, disease treatments, and patient-specific models for disease treatment.
[0024] As used in this specification, the term “cardiac organoid” refers to a three-dimensional cellular structure composed of heart cells, including various types of heart cells such as myocardial cells, vascular endothelial cells, smooth muscle cells, and fibroblasts, which can mimic the complex physiological characteristics of heart tissue.
[0025] In this case, the term "composition for manufacturing cardiac organoids" as used in the present specification refers to a mixture specifically designed for producing cardiac organoids and includes components that support the differentiation and self-organization of cardiac cells.
[0026] As used in this specification, the term "cardiac-associated long non-coding RNA" refers to RNA that plays an important role in cardiac development and function and regulates gene expression without encoding proteins.
[0027] At this time, the sequence of the heart-associated long non-coding RNA has significant interspecies differences and is associated with the maturation of heart cells, so it can be provided as an active ingredient in the composition for manufacturing heart organoids provided in various embodiments of the present invention.
[0028] Preferably, the heart-associated long non-coding RNA may be human heart-associated long non-coding RNA, but is not limited thereto.
[0029] In various embodiments of the present invention, the heart-associated long non-coding RNA may be provided in the composition in a form that is inserted into a vector such as an adenovirus and overexpressed. However, it is not limited thereto.
[0030] In one embodiment of the present invention, the heart-associated long non-coding RNA may be at least one of TERMINATOR, CARMEN, Braveheart, FENDRR, ALIEN, FENDRR, SENCR, mm85, mm77, mm130, MYHEART, and SMAD7-IncRNA.
[0031] In another embodiment of the present invention, the heart-associated long non-coding RNA may have at least one sequence of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3.
[0032] 서열번호 1ctggagctgg gacaggtcag catccatctt cttcttctgg ttgatgaggc tgctgctcac ctgggaatgc agcagctgca cccgctcact agtctcaatc agctcctgct ccgccagcttccgggaccgc tctgtctgct ccaccacggc acgcaactcc tccagctcag cctgcagcaggttgttgcgc cgctccacga tggcgatgtt ctccttcagg tcgtcgttgg cacggactgcatcgtccagc tgaatctggg ttaccttcaa caagctctgg aggctcttga cttgcttctgggcctcggcg gccatgcggt tggcgtggct gagctggatc tccatctcat tgaggtctccttccatcttc ttcttcaccc tcagggcctc gttgcggctg cgtgtctctg cgtccagggaggtctgcagc gagtccacca cccgcaggtg gttgcgcttg gcctgttcca tctcctcgtccttctctgcc agcttccgct cgatctctgc cttgatctgg ttgaactcca gctgggcccggaggatcttg ccctcctcct gctttcggac cttctccagc tcatggatag tctttccgctggaacccaac tgctcagtca agtcggagat ctcctctgtg tggggaacac ggcgttcttgagtttgaaga gctctgtgct gagggagcga gcctccttct gcgaggactc cagctccgactgcgactcct catacttctg cttccactcg gccaggatct gcccggggac aaggctcactcttcagcccc ccagcctcag ccccatgtcc aggggctgca gcagcagcat tggagcgctctacgtccacc atcaagtcct cgatctcatt ctgtag서열번호 2gtgcgtagag tttaagcagt gtggagatatttcttcactt ttccttaggg tgtccacatcaagaccctga ggccatctta ccacccttct ggatcagaag aggccttcag agccctccgctgccgagacg cggcagactc ccagagcggc tcacccactc atcgaagcgg attctgggcggtttcgggct gacccgcgct gtcagggcgc ggactccatt ccgggcgcat tgttaggagaaggggcccct cggggcggcg cgcctcgacc ctgggctccc ggtgcccgca gagggcggagatccgcggcg ccctaggcca cctatccgca tcttctcgag ccaaaccccc agcgcttacccggacccgac ggcccaagca ctgactccca ggcaagagtc gcccttcctg gtccccagggaactgacact accgcgggac gttccctcta ggacagtcag caggtcccag gagcgcagcacgcaacagcg cagagcagac ccagactttt cccggggtga gacccggagg cccgcgctctggaccgtcct ccctacccag cctggaggcc ggcgttcccc ggcccaaccc ggagacctccccgcctccct cctgggccgc cgcgcgcccc agttggagca gcctcgaggg gctgggccctttcggccgga ctcccttctc ccggacatcc aaaacaggtt accttgtcca cgctctccggaccacgcttt ggacttgctc acttttattt aagagtccga cgggggaaag agggaaaaaaaatccagagg agatccaagt caattggaag aaaaaatttc aaaagggtgt ccacagaggcgaaaaaagcc caggctctac cgaccttcaa actacaacag agctttcagg agaatgcggagagacggctt cccacccgga cctcaccaga aacccgcaca ccccagccacattgctcctcattcagccag aaaggactcc aactccacca ccaggaggcc ccccttcctg gtgctggccagttgcagagg ctgttcatgg catcccacag gtggcgactg ccccccaccc tcctcctagcactttagagg gtccctctgt ggcagacacc atggctctctctctctt gtgacagatc atcttcacta cattaatcag tagtcacccg aacattcctatactgtcccc caattccttt cagcaccagc tgcctccccc actggaatta ttcaatatggaactagatta aattgaagac ttgcccttta gtttttaaaa aaaaaaaaa aaaa 3gtgcagaccc gcgtgtggcg caggcaagga ccctcaaaat aaacagcctc taccttggagccgtcttc ccaggcctgc gtccgagtct ccgccgctgc gggcccgctc cgacgcggaagatctcgactg cagccatgag cagcaatgagtcagatcg tgc tggccactgggcccgggaat gtcctactgg tggaggccgt ggtcgtggaa tgagaagccg tggcagaggtggttttacct cggatagagg tttccagttt gtttcctcgt ctcttccaga catttgttatcgctgtggtg agtctggtca tcttgccaag ttgtgattgttgtc gcggtagagg tggccacatt gccaaggact gcaaggagcc caagagagagcgagagcaat gctgctacaa ctgtggcaaa ccaggccatc tggctcgtga ctgcgaccatgcagatgagc agaaatgcta ttcttgtgga gaattcggac acattcaaaa agactgcagcaaatgctataggtg tggtgaact ggtcatgtag ccatcaactg cagcaagacaagtgaagtca actgttaccg ctgtggcgag tcagggcacc tgcacggga atgcacaatgaggtacag cctattatt ttccttgtc gccctaccttgtttttgttgatttttgactt cactggccaa aggttggcag atagaggcaa ctcccaggccagtgagctt acttgccgtg taaaaggagg aaaggggtgg aaaaaaaccg actttctgcatttaactaca aaaaaagttt cacttttagtt cactgactgact gttatgtata atgggctcctcttagaagagtta tagggattga tgaatgggaa gagttgagtcagaccagtaa gcccgtcctg ggttccttga acatgttccc atgtaggagg taaaaccaattctggaagtg tctatgaact tccataata actttaattt tagtataatg atgtcttgtgtgac tagtaactag atcataagtac atcatagtac ggccctacatagaacataca gttgagtggg agtaaacaaa agataaaca tgcgtgttaa tggctgttcgagagaatcg gataaaagc ctaaacagga acaacttcat cacagttg atgttggacacataggt gatggcaag gttgagactagaaacaacattacattacatta tcaatgctca gagttagcat aatttggagc tattcaggaa ttgcagagaaatgcattttc acagaaatca agatgttatt tttgtatact attackcactta vakaactgtgttcattgc tgtaatcagt ttttaaagtcagatggaaa gagcaactga agtcctagaaatagaaatg taattttaaa ctattccaat aaagctggag gaggaagggg agtttgactaaagttctttt tgtttgtttc aaatttcat taatgtatat agtgcaaaat accatattaaagaggggaat gtggaggact gaaagctgac agttggatttg tacttaagtcatgtcttcaa taatgaaaat tgctgttaaa aggatgtatg ggatttagat acttttgcaaagctatagaa aattcacttt gtaatctgtt ataataatgc ccttgagttc tgtgttcagtctgaacaggt tttttggtgg tggtggtttt gttttgttg ggagacacctcctcgtcgt ctggagtgca ggcttggctc actgcaacct ccacctcccg ggttcaagcaattctcctgc ctcagcctc tgagtagctg ggattacagg cacccgccac cacccccgctaatttttg tatttttatt tttattttat ttttttgaga cagagtgtcgctgctgctgctgtg tg cgatctcggc tcactgcaag ctccgcctcctgggttcgtg ccattctcct gcctcagcct cctgagtagc tggggctaca ggtacccgccaccgcgccca gctaattttt ttttttgta tttttagtaa agacggggtt tcacggtgttagccaggatg gtctctcctcctcgcgcgc gccttggcct cccaaagtgctgggatcaca ggcgtgagcc accgcgccg gcctattttt tgtattttta gtagagactgggtttcatca tgttggtcgg gctggtctcc aactcctgac ctcaggtgatccacctgccccgccccccaa agtgctagtg ttacaggtgc gagccaccgt gtctggccga ttctgaacagttttaatacc attgctattt ttgtgttttt cctgggcctt tttttttttt ttttttttttttgagacagt ctcgctctgt tgcccaggct agagtgcaat ggtgcaatct cagctcactgcaacctccac cccccacccc cacaccccgt tcaagtaatt ctcctgcctc agcctcccaaatagctggga ttacaggtgt ccgccaccac acccagctaa tttttgttat ttttagtagagatggggttt cactgtgttg gtcaggctgg tctccaactg ttgccctcag gtgagccactgtgccccacc ttttcctggg tttcataagg atctgaagtg gtggattcct tgtttttgctagtgtctcat ttagagttga gatggacctt aaaactcatc tgttttaact cactttttaatagatgagtt aaacttaatt tacttaagga tgtacagtta gagcctggaa cttcaaccattattcactcc ccatgccctg tttcccccca cttcgaaatt aaatgcggtt agcatcatatagttcatttt ccccctccat gctgctgtgt gattcttgac tttgggtatg agtttttcatccttcatgca gggttctgtc agttcatggt atagtgattc agtgttaaaa tggtggtgtctcagctgtgc tgtgcacatt ccaaccttgt caaattaata gtcctgagca agcaagaaaaagaggtaata acatacccat ttctttatga atataagctt ataatatttt ttcatgtgctatttttactg agcaaattgt atgtctcaca tgttaacaca ataaatatct tgacaatttta
[0033] Preferably, the heart-associated long non-coding RNA may have SEQ ID NO. 1, but is not limited thereto.
[0034] In this specification, the term "extracellular matrix (ECM)" refers to a three-dimensional structure that can serve as a support for the development of tissues, playing an important role in providing signals that influence various cellular metabolic pathways, such as cell proliferation, differentiation, and apoptosis. The extracellular matrix can store and supply biochemical factors necessary for cell growth and differentiation, while simultaneously providing a physical environment that cells can recognize. The extracellular matrix is a product created by the cells constituting each tissue as needed, and may include structural proteins such as collagen and elastin, polysaccharides such as glycosaminoglycans (GAGs), adhesive proteins that aid in cell attachment, and growth factors. Such extracellular matrix is composed of different components depending on the tissue and cell from which it originates and possesses specific physical properties.
[0035] In one embodiment of the present invention, the extracellular matrix may be obtained from fibroblasts, preferably from fibroblasts derived from heart tissue.
[0036] More preferably, in another embodiment of the present invention, the extracellular matrix may be an extracellular matrix fiber in which a fibroblast-derived extracellular matrix is homogenized through DMEM (Dulbecco's Modified Eagle's Medium).
[0037] In another embodiment of the present invention, the composition for manufacturing a cardiac organoid may further include at least one Wnt inhibitor selected from IWR-1 endo, XAV-939, JW74, SEN461, ICG-001, LGK-974, IWP-2, IWP-4, Wnt-C59, and WIKI4.
[0038] At this time, Wnt inhibitors are substances that inhibit Wnt proteins, which contribute to intracellular signaling systems, and can differentiate mesenchymal cells into cardiac progenitor cells by activating GSK-3β. Through treatment with such Wnt inhibitors, mesenchymal cells can be differentiated into high-purity cardiac progenitor cells with a positive rate of 80 to 98% for cTnT (cardiac troponin T), one of the constituent proteins of cardiomyocytes.
[0039] Meanwhile, Wnt inhibitors may also be included as components in the culture medium.
[0040] In this case, "medium" refers to a mixture for the growth and proliferation of cells, such as stem cells, in vitro, containing elements essential for the growth and proliferation of cells, such as sugars, amino acids, various nutrients, serum, growth factors, and minerals.
[0041] At this time, the medium may be a natural or artificial serum-free medium that does not contain insulin, used to maintain and grow animal cells. More specifically, the medium may intentionally exclude insulin to inhibit the formation of the mesoderm, which is a pre-cardiac muscle formation process in the formation of pluripotent stem cell-derived cardiomyocytes, and may contain antioxidants to inhibit cell damage caused by reactive oxygen species. Furthermore, the medium may include various serum-free media and variants thereof, such as insulin-free Minimal Essential Medium (MEM), Eagle's Minimal Essential Medium (Eagle's MEM), Dulbecco's Modified Eagle's Medium (DMEM), Ham's F 12, SF 12, and RPMI 1640, and preferably may be insulin-free RPMI 1640, but is not limited thereto.
[0042] In this regard, under culture conditions, the temperature may be 36°C to 38°C, preferably 36.5°C to 37.5°C, the supply oxygen (O2) may be 1% to 25%, and the supply carbon dioxide (CO2) may be 1% to 15%, but is not limited thereto.
[0043] To solve the problem described above, a method for manufacturing a heart organoid according to another embodiment of the present invention is provided.
[0044] At this time, the above manufacturing method may include the step of culturing pluripotent stem cells to differentiate into cardiac cells composed of cardiomyocytes, vascular endothelial cells, smooth muscle cells, and fibroblasts, and to self-organize the differentiated cells, the step of culturing stem cells in a cardiac induction medium treated with a composition for manufacturing cardiac organoids according to various embodiments of the present invention, and the step of recovering a three-dimensional tissue of the differentiated cells suspended from the cardiac induction medium to obtain a cardiac organoid.
[0045] In this specification, the term "pluripotent stem cell" may refer to a cell capable of differentiating into all cells that make up the body, and may include induced pluripotent stem cells (iPSCs) and embryonic stem cells (ES cells) that share the common characteristic of differentiating pluripotently. More specifically, embryonic stem cells may be induced from the inner cell mass of a blastocyst at the pre-implantation stage. The induced cells are maintained in a specific environment and allow for unlimited culture and pluripotent differentiation. Furthermore, induced pluripotent stem cells may refer to pluripotent differentiated cells created by dedifferentiation from somatic cells, and may be formed by making somatic cells very similar to embryonic stem cells through reprogramming processes such as cell fusion, nuclear transfer, or the overexpression of pluripotency regulatory factors. Furthermore, pluripotent stem cells are not limited to embryonic stem cells and induced pluripotent stem cells, but may include all cells possessing both differentiation pluripotency and self-replicating ability. Preferably, the pluripotent stem cells may be mammalian cells, and more preferably, human-derived pluripotent stem cells.
[0046] In various embodiments of the present invention, pluripotent stem cells may be cells treated such that cell adhesion and extension are promoted as they are cultured on a plate containing a coating film, thereby increasing the differentiation efficiency of mesodermal lineage cells.
[0047] In more diverse embodiments of the present invention, for the production of cardiac organoids, pluripotent stem cells may be cultured and differentiated by being initiated while attached to a plate in which a culture medium has been dispensed, after being adapted and stabilized.
[0048] As used herein, the term "cardiac induction medium" may refer to a culture medium containing a component that induces pluripotent stem cells to differentiate into heart-related cells. In one embodiment of the present invention, the cardiac induction medium may refer to a medium treated with a composition for manufacturing cardiac organoids according to various embodiments of the present invention.
[0049] As used herein, the term "self-organization" may refer to the process in which heart cells organize themselves to form a structured tissue.
[0050] As used herein, the term “three-dimensional tissue” may refer to a tissue in which heart cells are arranged in a three-dimensional structure rather than a flat one. Such a three-dimensional tissue may correspond to a cardiac organoid having a multi-chamber with separated cavities and an atrioventricular canal.
[0051] That is, the three-dimensional tissue can be separated from the cardiac induction medium and float without a separate cutting procedure, as it is capable of spontaneous relaxation and contraction.
[0052] According to one embodiment of the present invention, a step of suspending and culturing the three-dimensional tissue recovered from suspension may be further performed to obtain a mature cardiac organoid.
[0053] In this specification, the term "suspend culture" refers to a three-dimensional cell culture in which cells are grown suspended in a liquid phase so as not to adhere to the bottom by using a stirrer, such as a spinner or a rotational chamber, to continuously move the cells. Suspension culture is characterized by the fact that as cells float and move in the culture medium, they adhere to each other through intercellular interactions and form a structure that reflects the original tissue structure.
[0054] In this specification, the term "mature cardiac organoid" as used herein refers to a cardiac-like tissue that is a more advanced state than an early cardiac organoid, possesses functional and morphological characteristics similar to heart tissue, and forms an organized three-dimensional structure through the interaction of mature myocardial cells, vascular endothelial cells, smooth muscle cells, and fibroblasts. That is, in this specification, "mature cardiac organoid" may be used interchangeably with "advanced cardiac organoid."
[0055] In one embodiment of the present invention, the mature cardiac organoid has an ejection fraction of 50% or more or a fractional shortening of 20% or more, which may mean that it is functionally similar to a normal human heart.
[0056] According to another embodiment of the present invention, the culturing step may include a first culture step of inoculating and culturing stem cells in a medium treated with a Wnt agent, and a second culture step of culturing the first cultured cells in a cardiac induction medium treated with a composition for producing cardiac organoids according to various embodiments of the present invention.
[0057] According to another embodiment of the present invention, the first culture step may include the step of culturing stem cells in a medium treated with a Wnt agent for at least one period of 1 to 3 days.
[0058] According to another embodiment of the present invention, the second culture step may include the step of culturing the first cultured cells in a cardiac induction medium treated with a composition for producing a cardiac organoid on the 3rd to 5th day from the start date of the first culture, and culturing for at least one period of 4 to 22 days.
[0059] Here, "first culture" may refer to the culture stage in which pluripotent stem cells differentiate into mesodermal cells.
[0060] At this time, pluripotent stem cells are inoculated and cultured on a medium containing a Wnt agent such as CHIRR99021 for the first culture. In various embodiments of the present invention, the content of CHIRR99021 in the medium may be 0.5 to 8 μM, but preferably, the content of CHIRR99021 that can enhance the survival and proliferation of pluripotent stem cells on the culture start day (D0) may be 5 to 7 μM.
[0061] For example, pluripotent stem cells attached to a plate can be cultured for 3 days in a medium containing 5 to 7 μM of the Wnt agent of CHIRR99021 on the culture start date (D0) in the first culture step.
[0062] At this time, CHIRR99021 is a substance that inhibits the activity of GSK (Glycogen synthase kinase)-3β. More specifically, as GSK-3β is inhibited, β-catenin of the signaling pathway involved in cell proliferation is not degraded by GSK-3β, so the expression level of genes involved in cell proliferation increases, and thus cell survival and proliferation can be improved.
[0063] Optionally, Activin A and / or BMP4 may be additionally treated during the first culture step.
[0064] Here, Activin A and BMP4 are growth and differentiation factors belonging to the TGF-β group, and by activating BMP and Activin / Nodal signals, which are important cell signaling systems during embryonic development, they can inhibit differentiation into the ectodermal nervous system and promote differentiation into the mesodermal lineage.
[0065] Next, "second culture" may refer to a culture stage in which mesenchymal cells from the first culture are differentiated into cardiac progenitor cells, cardiac progenitor cells are differentiated into cardiac cells, and cardiac organoids are produced through maturation and self-organization.
[0066] At this time, the content of Wnt inhibitor in the medium during the second culture may be 0.01 to 3 μM.
[0067] For example, the first cultured cells, i.e., mesenchymal cells, may be cultured in the second culture step by replacing the medium containing 0.01 to 3 μM of a Wnt inhibitor on the third day (D3) of the first culture. At the same time, a composition for preparing a cardiac organoid, consisting of a cardiac-associated long non-coding RNA (or a cardiac-associated long non-coding RNA overexpression vector) and extracellular matrix fibers according to various embodiments of the present invention, may be treated on the medium containing the Wnt inhibitor.
[0068] That is, mesenchymal cells can be induced to differentiate into cardiac progenitor cells on day 7 (D7) of culture after being cultured for an additional 4 days on cardiac induction medium containing a Wnt inhibitor, cardiac-associated long non-coding RNA, and extracellular matrix fibers.
[0069] Next, on day 7 (D7) to day 25 (D25) of culture, the cardiac progenitor cells differentiate into mature cardiac cells, vascular endothelial cells, smooth muscle cells, and fibroblasts, and these self-organize to form a cardiac organoid with a three-dimensional structure.
[0070] In this case, the cardiac organoid may contain a high proportion of mature myocardial cells undergoing spontaneous contraction.
[0071] Optionally, the heart induction medium may be replaced with a new heart induction medium during the second culture step.
[0072] The three-dimensional tissue formed through the second culture step has the structural characteristics of a heart as described above, and since it is capable of spontaneous relaxation and contraction, it can be separated from the heart induction medium and float without a separate cutting procedure.
[0073] Through the manufacturing method according to the various embodiments of the present invention above, pluripotent stem cells differentiate into mature cardiomyocytes, cardiomyocytes, vascular endothelial cells, smooth muscle cells, and fibroblasts capable of self-contracting, and these cardiac cells self-organize to form a three-dimensional structure, making it possible to obtain a cardiac organoid that is morphologically and functionally similar to a living heart.
[0074] These cardiac organoids may be provided as therapeutic agents for the heart (e.g., regenerative cell therapy for the recovery of heart function or treatment of heart disease) and may also be used in experiments to determine the safety and efficacy of candidate substances regarding cardiotoxicity during the new drug development process.
[0075] Accordingly, according to another embodiment of the present invention, the steps of treating a target drug on a cardiac organoid obtained in the above manufacturing method, washing the cardiac organoid after the drug reaction is complete, culturing and treating the washed cardiac organoid, obtaining an image of each cardiac organoid corresponding to the washing and culturing steps, and evaluating the toxicity of the target drug based on the obtained image of each may be further performed.
[0076] According to another embodiment of the present invention, the step of evaluating the toxicity of a drug may include: dividing an image for each acquired case so that the image has pixels of a predetermined size; estimating a signal for each of the divided images; quantifying based on the estimated signal; removing outliers from the quantified signal; clustering the remaining signal from which outliers have been removed; and determining muscle contractility based on the clustering result.
[0077] In this specification, the term "drug" may include any substance used to alter or examine a physiological system or disease state for the benefit of an organism. More specifically, it may include, but is not limited to, at least one of the group consisting of vitamins, hormones, metal salts, vaccines, antiserums, antibiotics, chemotherapy agents, cardiac stimulants, antihypertensive agents, antihistamines, steroids, antidotes, and contrast agents.
[0078] Specific details of other embodiments are included in the detailed description and drawings.
[0079] The present invention provides a composition capable of producing a cardiac organoid that is morphologically and functionally similar to a living heart, and a method for producing such a composition, thereby overcoming the limitations of conventional cardiac organoids and the complexity of their production methods.
[0080] More specifically, unlike conventional organoids that had a structure different from a living heart, the present invention provides a cardiac organoid having a plurality of chambers with a structure similar to a ventricle and valve, a valve, and a lumen separating each chamber, capable of performing voluntary contractile movements, and thereby capable of valve action such as valve movement and circulating fluid inside and outside.
[0081] In particular, the present invention provides a composition for preparing cardiac organoids comprising a long non-coding RNA associated with the heart as an active ingredient, thereby enabling the simultaneous differentiation of cardiac cells such as nerve cells, myocardial cells, vascular endothelial cells, and fibroblasts, and inducing self-organization, which can promote functional connectivity and tissue formation of cardiac cells.
[0082] Through this, the present invention can obtain a cardiac organoid in a more simplified manner while enhancing the structural stability and similarity of the cardiac organoid, thereby enabling it to perform relaxation and contraction functions in a manner similar to actual heart tissue.
[0083] Accordingly, the present invention provides an advanced cardiac organoid, which enables the derivation of more accurate and effective results in drug efficacy evaluation and toxicity testing, and ultimately has the potential to contribute to cardiac regeneration and recovery treatment.
[0084] In particular, the present invention provides a cardiac organoid with excellent function, which can drastically reduce the cost and time required for screening drug candidates in new drug development, and can be utilized in physiological research and clinical trials of heart cancer.
[0085] The effects according to the present invention are not limited to those exemplified above, and various other effects are included in this specification.
[0086] FIGS. 1a to 1f illustrate, exemplarily, the procedure of a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to one embodiment of the present invention.
[0087] Figures 2a and 2b illustrate the degree of expression of cardiac cell-specific markers following treatment with a composition for manufacturing cardiac organoids according to one embodiment of the present invention.
[0088] FIGS. 3a to 3f illustrate the morphological characteristics and functional evaluation results of a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0089] FIGS. 4a to 4c illustrate the results of an evaluation of the cardiotoxicity of Nifedipine using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0090] FIGS. 5a to 5c illustrate the results of an evaluation of the cardiotoxicity of Verapamil using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0091] Figures 6a and 6b illustrate the results of an efficacy evaluation of Nifedipine using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0092] Figures 7a and 7b illustrate the results of an efficacy evaluation of Verapamil using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0093] The advantages of the invention and the methods for achieving them will become clear by referring to the embodiments described below in detail together with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below but may be implemented in various different forms. These embodiments are provided merely to ensure that the disclosure of the present invention is complete and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined only by the scope of the claims.
[0094] The shapes, sizes, ratios, angles, numbers, etc. disclosed in the drawings for explaining embodiments of the present invention are exemplary, and therefore the present invention is not limited to the depicted details. Furthermore, in describing the present invention, if it is determined that a detailed description of related known technology may unnecessarily obscure the essence of the present invention, such detailed description is omitted. Where terms such as "comprising," "having," or "consisting of" are used in this specification, other parts may be added unless "only" is used. Where a component is expressed in the singular, it includes cases where it includes the plural unless specifically stated otherwise.
[0095] In interpreting the components, they are interpreted to include a margin of error even in the absence of a separate explicit description.
[0096] The features of each of the various embodiments of the present invention may be combined or combined with one another, either partially or wholly, and as will be fully understood by those skilled in the art, various technical interlocking and operation are possible, and each embodiment may be implemented independently of one another or together in an interlocking relationship.
[0097]
[0098] Hereinafter, with reference to FIGS. 1a to 1f, a procedure for a method of manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention will be described.
[0099] FIGS. 1a to 1f illustrate, exemplarily, the procedure of a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to one embodiment of the present invention.
[0100] First, referring to FIG. 1a, in a method for manufacturing a cardiac organoid according to one embodiment of the present invention, in order to obtain a cardiac organoid, stem cells are cultured in a cardiac induction medium treated with a composition for manufacturing a cardiac organoid (S110), and a three-dimensional tissue suspended from the cardiac induction medium is recovered (S120).
[0101] That is, referring together with FIG. 1b, in the method for manufacturing a cardiac organoid according to one embodiment of the present invention, pluripotent stem cells can be obtained directly as a cardiac organoid without additional processing such as differentiation, aggregation, and fusion of each cardiac cell as the two-dimensional cells are converted into three dimensions through the differentiation process.
[0102] According to a feature of the present invention, in the culturing step (S110), a first culture step of inoculating and culturing stem cells in a medium treated with a Wnt agent and a second culture step of culturing the first cultured stem cells in a heart induction medium treated with a composition for producing a heart organoid may be performed.
[0103] At this time, the first culture step may be performed by culturing the stem cells in a medium treated with a Wnt agent for at least one period of 1 to 3 days, and the second culture step may be performed by culturing the first cultured stem cells in a cardiac induction medium treated with a composition for producing cardiac organoids for at least one period of 4 to 22 days on the 3rd to 5th day from the start date of the first culture.
[0104] More specifically, referring to FIGS. 1c and 1d together, pluripotent stem cells attached to a plate in the first culture step can be cultured for 3 days in a medium containing 5 to 7 μM of the Wnt agent of CHIRR99021 on the culture start date (D0).
[0105] At this time, the pluripotent stem cells may be cells treated to promote cell adhesion and extension as they are cultured on a plate containing a coating film, thereby increasing the differentiation efficiency of mesodermal lineage cells.
[0106] Preferably, for the production of cardiac organoids, pluripotent stem cells can be cultured and differentiated by starting the culture in a state where they have adapted, stabilized, and attached to a plate dispensed with culture medium.
[0107] Through the first culture, pluripotent stem cells can be induced to differentiate into mesodermal cells.
[0108] Next, in the second culture step, the first cultured cells, i.e., mesenchymal cells, may be replaced with a medium containing 0.01 to 3 μM of a Wnt inhibitor on the third day (D3) of the first culture and cultured. At the same time, a composition for preparing a cardiac organoid, consisting of a heart-associated long non-coding RNA and / or extracellular matrix fibers according to various embodiments of the present invention, may be applied to the medium containing the Wnt inhibitor.
[0109] That is, mesenchymal cells are cultured for an additional 4 days on cardiac induction medium containing a Wnt inhibitor, cardiac-associated long non-coding RNA and / or extracellular matrix fibers, and can be induced to differentiate into cardiac progenitor cells on day 7 of culture (D7) (not shown).
[0110] Then, on day 7 to day 25 of culture (D25), cardiac progenitor cells differentiate into mature cardiac cells, vascular endothelial cells, smooth muscle cells, and fibroblasts, which can self-organize to develop into cardiac organoids, which are cardiac-like tissues forming a three-dimensional structure.
[0111] More specifically, referring to FIG. 1f, a self-organized three-dimensional tissue can be formed through a second culture step.
[0112] Referring further to Fig. 1e, the cardiac organoid may contain a high proportion of mature myocardial cells (relatively large and elongated in shape) that undergo spontaneous contraction.
[0113] At this time, the three-dimensional tissue formed through the second culture step has the structural characteristics of a heart as described above, and since it is capable of spontaneous relaxation and contraction, it can be separated from the heart induction medium and float without a separate cutting procedure.
[0114] Returning to Fig. 1a, in the recovery step (S120), it may be possible to obtain a cardiac organoid while recovering the three-dimensional tissue suspended from the cardiac induction medium.
[0115] These cardiac organoids have a multi-chamber with separated cavities and may have an atrioventricular canal.
[0116] In various embodiments of the present invention, after the recovery step (S120), a step of suspending and culturing the three-dimensional tissue may be further performed to obtain a mature cardiac organoid.
[0117] At this stage, the mature cardiac organoid is in a more advanced state than the early cardiac organoid and can possess functional and morphological characteristics similar to heart tissue.
[0118] For example, mature cardiac organoids have an ejection fraction of 50% or more or a fractional shortening of 20% or more, which may mean that they are functionally similar to a normal human heart.
[0119] That is, according to the method for manufacturing a cardiac organoid based on a composition for manufacturing a cardiac organoid according to various embodiments of the present invention, it may be possible to provide an advanced cardiac organoid.
[0120] Experimental Example 1: Performance evaluation of a composition for manufacturing cardiac organoids according to various embodiments of the present invention
[0121] Hereinafter, with reference to FIGS. 2a and 2b, the evaluation results of compositions for manufacturing cardiac organoids according to various embodiments of the present invention will be described.
[0122] Figures 2a and 2b illustrate the degree of expression of cardiac cell-specific markers following treatment with a composition for manufacturing cardiac organoids according to one embodiment of the present invention.
[0123] In this evaluation, for the advanced cardiac organoids obtained at one month of suspension culture, the levels of cardiac cell-specific markers of myocardial cells, neurons, fibroblasts, smooth muscle cells, and vascular endothelial cells were measured using a flow cytometer.
[0124] More specifically, referring to FIGS. 2a and 2b, the cardiac organoid expresses all cardiac cell-specific markers of myocardial cells, neurons, fibroblasts, smooth muscle cells, and vascular endothelial cells, which may mean that these cardiac cells are included as constituent cells in the cardiac organoid according to various embodiments of the present invention.
[0125] Experimental Example 2: Morphological and functional characteristics of cardiac organoids according to various embodiments of the present invention
[0126] Hereinafter, the morphological and functional characteristics of cardiac organoids according to various embodiments of the present invention will be described with reference to FIGS. 3a to 3f.
[0127] FIGS. 3a to 3f illustrate the morphological characteristics and functional evaluation results of a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0128] First, referring to Figure 3a, a mature cardiac organoid at one month of suspension culture is shown to have an atrioventricular canal (AV canal), similar to a living heart structure. This atrioventricular canal can form a vascular network within the cardiac organoid to provide structural support to the tissue.
[0129] Referring further to Fig. 3b, the mature cardiac organoid at 3 months of suspension culture takes on a more mature form and exhibits structural features similar to a real living heart. In particular, it appears that a vascular network including folded tissue and coronary arteries has formed, which can provide functional connectivity and stability to the tissue.
[0130] Referring to Figure 3c, the looping process plays an important role in heart development, which leads to the formation of a multichambered heart. In mature heart organoids, it is shown that a multichambered heart is formed or the loop is unraveled during the opening and closing of the coronary artery ducts.
[0131] These results may imply that cardiac organoids can mimic actual heart function, as they demonstrate that spontaneous contraction and relaxation movements occur in advanced cardiac organoids and that coronary arteries open and close through this process.
[0132] Furthermore, referring to Fig. 3d, it is shown that in a mature cardiac organoid, multi-chambers are separated, each having its own cavity, and referring to Fig. 3e, it is shown that in a mature cardiac organoid, a valve connecting the outside and inside is formed, allowing fluid to flow through the opening and closing of the valve.
[0133] Next, referring to Figure 3f, actual cardiac function can be measured for the cardiac organoid, and as a result, the mature cardiac organoid is shown to have a function corresponding to a normal human heart with an ejection fraction of 57% and fractional shortening of 24.5%.
[0134] These results may imply that mature organoids according to various embodiments of the present invention can effectively mimic the function of an actual human heart. This suggests that cardiac organoids can be used as a useful platform for research on heart failure and other heart diseases, and also presents potential applications in fields such as heart transplantation and drug testing. Furthermore, as the maturity and function of the cardiac organoids become more closely aligned with human physiological conditions, the advanced cardiac organoids according to various embodiments of the present invention may open up the possibility of clinical application.
[0135] Experimental Example 3: Drug evaluation using cardiac organoids according to various embodiments of the present invention
[0136] Hereinafter, with reference to FIGS. 4a to 4c, FIGS. 5a to 5c, FIGS. 6a and 6b, and further FIGS. 7a and 7b, the results of analyzing changes in muscle contractility based on segmentation of cardiac organoid images, estimation of heartbeats, and clustering using pulse video, an image analysis program for drug treatment, will be described.
[0137] FIGS. 4a to 4c illustrate the results of a cardiotoxicity evaluation of Nifedipine using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention. FIGS. 5a to 5c illustrate the results of a cardiotoxicity evaluation of Verapamil using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention. FIGS. 6a and 6b illustrate the results of an efficacy evaluation of Nifedipine using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention. FIGS. 7a and 7b illustrate the results of an efficacy evaluation of Verapamil using a cardiac organoid according to a method for manufacturing a cardiac organoid using a composition for manufacturing a cardiac organoid according to various embodiments of the present invention.
[0138] First, referring to (a), (b), and (c) of Figure 4a, the results of clustering each cardiac organoid by dividing it into zones before drug treatment with Nifedipine, 30 minutes after drug treatment, and 1 hour after drug washing are shown.
[0139] Referring to Figures 4b (a), (b), and (c), in the beating velocity heatmap, considering that red and yellow correspond to areas where the beating is strong, it appears that the beating velocity generally decreases and becomes irregular after drug treatment.
[0140] Referring to Figures 4c (a), (b), and (c), in the contractility measurement, a regular and strong beat and normal contraction were observed before drug treatment (Figure 4c (a)), and abnormal beats with abnormally irregular beats and low contractility were observed 30 minutes after drug treatment (Figure 4c (b)). This may indicate that Nifedipine affected cardiac function. Subsequently, it was shown that the heart returned to normal beats 1 hour after rinsing (Figure 4c (a)).
[0141] This may mean that the drug Nifedipine is somewhat less likely to cause cardiotoxicity.
[0142] Next, referring to (a), (b), and (c) of 5a, the results of clustering each cardiac organoid by dividing it into zones before drug treatment with Verapamil, 30 minutes after drug treatment, and 1 hour after drug washing are shown.
[0143] Referring to (a), (b), and (c) of Figure 5b, the heart rate heatmap shows that the heart rate generally decreases and becomes irregular after drug treatment.
[0144] Referring to Figures 5c (a), (b), and (c), in the measurement of muscle contractility, regular and strong beats and normal contractions were observed before drug treatment (Figure 5c (a)), but an arrhythmia with abnormally irregular beats appeared 30 minutes after drug treatment (Figure 5c (b)). This may indicate that Verapamil affected cardiac function. Since the arrhythmia still appeared 1 hour after rinsing (Figure 5c (a)), this may imply that there is a possibility that the drug Verapamil could cause cardiotoxicity.
[0145] Next, referring to (a) and (b) of 6a, the results of clustering the regions of each cardiac organoid based on an arrhythmia disease model before drug treatment with Nifedipine and 1 hour after drug washing are shown.
[0146] Referring to Figures 6b (a) and (b), in the measurement of muscle contractility, an arrhythmia with abnormally irregular beats appears before drug treatment with Nifedipine (Figure 6b (a)), but regular and strong beats and normal contractions appear 1 hour after drug treatment with Nifedipine (Figure 6b (b)). This may mean that Nifedipine has the efficacy to restore arrhythmia to normal.
[0147] Referring to (a) and (b) of 7a, the results of clustering the regions of each cardiac organoid based on an arrhythmia disease model before drug treatment with Verapamil and 1 hour after drug washing are shown.
[0148] Referring to Figures 7b (a) and (b), in the measurement of muscle contractility, an arrhythmia with abnormally irregular beats appears before drug treatment with Verapamil (Figure 7b (a)), but regular and strong beats and normal contraction appear 1 hour after drug treatment with Verapamil (Figure 7b (b)). This may mean that Verapamil has the efficacy to restore the arrhythmia to normal.
[0149] That is, functional changes in cardiac organoids resulting from drug treatment can be visually confirmed using cardiac organoids according to various embodiments of the present invention, and the present invention can be provided as a useful platform for quantitatively evaluating the effect of drugs on heartbeats.
[0150] Therefore, the present invention serves as an important tool in heart disease research and drug testing, and has the effect of enabling more accurate and quantitative evaluation of the effects of drugs on heart function through cardiac organoids.
[0151] In addition, the present invention can predict and evaluate various heart-related side effects, including arrhythmia, in advance, and can be utilized as a very useful platform for new drug development and verifying the efficacy of heart disease treatments.
[0152] Although embodiments of the present invention have been described in more detail with reference to the attached drawings, the present invention is not necessarily limited to these embodiments and may be modified in various ways within the scope of the technical spirit of the present invention. Accordingly, the embodiments disclosed in the present invention are intended to explain, not limit, the technical spirit of the present invention, and the scope of the technical spirit of the present invention is not limited by these embodiments. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of protection of the present invention shall be interpreted by the claims below, and all technical spirits within an equivalent scope shall be interpreted as being included within the scope of rights of the present invention.
[0153] Project ID: 00508925
[0154] Project No.: RS-2024-00508925
[0155] Ministry Name: Ministry of SMEs and Startups
[0156] Specialized research management agency: Korea Technology Information Promotion Agency for SMEs
[0157] Research Project Name: Technology Innovation Program for Startups (TIPS)
[0158] Research Project Title: Development of Advanced Human Heart and Skin Organoids and Development of Translational Drug Evaluation Test Methods Using Them
[0159] Project Executing Organization Name: ORG Co., Ltd.
[0160] 연구기간: 2024.09.01 ~ 2027.08.31
[0161] <210> 1
[0162] <211> 876
[0163] <212> RNA
[0164] <213> Artificial Sequence
[0165] <220>
[0166] <223> Noncoing RNA
[0167] <400> 1
[0168] ctggagctgg gacaggtcag catccatctt cttcttctgg ttgatgaggc tgctgctcac 60
[0169] ctgggaatgc agcagctgca cccgctcact agtctcaatc agctcctgct ccgccagctt 120
[0170] ccgggaccgc tctgtctgct ccaccacggc acgcaactcc tccagctcag cctgcagcag 180
[0171] gttgttgcgc cgctccacga tggcgatgtt ctccttcagg tcgtcgttgg cacggactgc 240
[0172] atcgtccagc tgaatctggg ttaccttcaa caagctctgg aggctcttga cttgcttctg 300
[0173] ggcctcggcg gccatgcggt tggcgtggct gagctggatc tccatctcat tgaggtctcc 360
[0174] ttccatcttc ttcttcaccc tcagggcctc gttgcggctg cgtgtctctg cgtccaggga 420
[0175] ggtctgcagc gagtccacca cccgcaggtg gttgcgcttg gcctgttcca tctcctcgtc 480
[0176] cttctctgcc agcttccgct cgatctctgc cttgatctgg ttgaactcca gctgggcccg 540
[0177] gaggatcttg ccctcctcct gctttcggac cttctccagc tcatggatag tctttccgct 600
[0178] ggaacccaac tgctcagtca agtcggagat ctcctctgtg tggggaacac ggcgttcttg 660
[0179] agtttgaaga gctctgtgct gagggagcga gcctccttct gcgaggactc cagctccgac 720
[0180] tgcgactcct catacttctg cttccactcg gccaggatct gcccggggac aaggctcact 780
[0181] cttcagcccc ccagcctcag ccccatgtcc aggggctgca gcagcagcat tggagcgctc 840
[0182] tacgtccacc atcaagtcct cgatctcatt ctgtag 876
[0183]
[0184] <210> 2
[0185] <211> 1319
[0186] <212> RNA
[0187] <213> Artificial Sequence
[0188] <220>
[0189] <223> Noncoing RNA
[0190] <400> 2
[0191] gtgcgtagag tttaagcagt gtggagatat ttcttcactt ttccttaggg tgtccacatc 60
[0192] aagaccctga ggccatctta ccacccttct ggatcagaag aggccttcag agccctccgc 120
[0193] tgccgagacg cggcagactc ccagagcggc tcacccactc atcgaagcgg attctgggcg 180
[0194] gtttcgggct gacccgcgct gtcagggcgc ggactccatt ccgggcgcat tgttaggaga 240
[0195] aggggcccct cggggcggcg cgcctcgacc ctgggctccc ggtgcccgca gagggcggag 300
[0196] atccgcggcg ccctaggcca cctatccgca tcttctcgag ccaaaccccc agcgcttacc 360
[0197] cggacccgac ggcccaagca ctgactccca ggcaagagtc gcccttcctg gtccccaggg 420
[0198] aactgacact accgcgggac gttccctcta ggacagtcag caggtcccag gagcgcagca 480
[0199] cgcaacagcg cagagcagac ccagactttt cccggggtga gacccggagg cccgcgctct 540
[0200] ggaccgtcct ccctacccag cctggaggcc ggcgttcccc ggcccaaccc ggagacctcc 600
[0201] ccgcctccct cctgggccgc cgcgcgcccc agttggagca gcctcgaggg gctgggccct 660
[0202] ttcggccgga ctcccttctc ccggacatcc aaaacaggtt accttgtcca cgctctccgg 720
[0203] accacgcttt ggacttgctc acttttattt aagagtccga cgggggaaag agggaaaaaa 780
[0204] aatccagagg agatccaagt caattggaag aaaaaatttc aaaagggtgt ccacagaggc 840
[0205] gaaaaaagcc caggctctac cgaccttcaa actacaacag agctttcagg agaatgcgga 900
[0206] gagacggctt cccacccgga cctcaccaga aacccgcaca ccccagccac attgctcctc 960
[0207] attcagccag aaaggactcc aactccacca ccaggaggcc ccccttcctg gtgctggcca 1020
[0208] gttgcagagg ctgttcatgg catcccacag gtggcgactg ccccccaccc tcctcctagc 1080
[0209] actttagagg gtccctctgt ggcagacacc atggctaggt ttctctttcc aactcctgtt 1140
[0210] ggtctggcaa gtgacagatc atcttcacta cattaatcag tagtcacccg aacattccta 1200
[0211] tactgtcccc caattccttt cagcaccagc tgcctccccc actggaatta ttcaatatgg 1260
[0212] aactagatta aattgaagac ttgcccttta gttttaaaa aaaaaaaaa aaaaaaaaa 1319
[0213] <210> 3
[0214] <211> 3301
[0215] <212> RNA
[0216] <213> Artificial Sequence
[0217] <220>
[0218] <223> Noncoing RNA
[0219] <400> 3
[0220] gtgcagaccc gcgtgtggcg caggcaagga ccctcaaaat aaacagcctc taccttgcga 60
[0221] gccgtcttcc ccaggcctgc gtccgagtct ccgccgctgc gggcccgctc cgacgcggaa 120
[0222] gatctgactg cagccatgag cagcaatgag tgcttcaagt gtggacgatc tggccactgg 180
[0223] gcccggggaat gtcctactgg tggaggccgt ggtcgtggaa tgagaagccg tggcagaggt 240
[0224] ggtttacct cggatagagg tttccagttt gtttcctcgt ctcttccaga catttgttat 300
[0225] cgctgtggtg agtctggtca tcttgccaag gattgtgatc ttcaggagga tgttgaagcc 360
[0226] tgctataact gcggtagagg tggccacatt gccaaggact gcaaggagcc caagagagag 420
[0227] cgagagcaat gctgctacaa ctgtggcaaa ccaggccatc tggctcgtga ctgcgaccat 480
[0228] gcagatgagc agaaatgcta ttcttgtgga gaattcggac acattcaaaa agactgcacc 540
[0229] aaagtgaagt gctataggtg tggtgaaact ggtcatgtag ccatcaactg cagcaagaca 600
[0230] agtgaagtca actgttaccg ctgtggcgag tcagggcacc ttgcacggga atgcacaatt 660
[0231] gaggctacag cctaattatt ttcctttgtc gcccctcctt tttctgattg atggttgtat 720
[0232] tatttctct gaatcctctt cactggccaa aggttggcag atagaggcaa ctcccaggcc 780
[0233] agtgagcttt acttgccgtg taaaaggagg aaaggggtgg aaaaaaccg actttctgca 840
[0234] tttaactaca aaaaaagttt atgtttagtt tggtagaggt gttatgtata atgctttgtt 900
[0235] aaagaacccc ctttccgtgc cactggtgaa tagggattga tgaatgggaa gagttgagtc 960
[0236] agaccagtaa gcccgtcctg ggttccttga acatgttccc atgtaggagg taaaaccaat 1020
[0237] tctggaagtg tctatgaact tccataata actttaattt tagtataatg atggtcttgg 1080
[0238] attgtctgac ctcagtagct attaaatac atcaagtac atctgtatca ggcctacat 1140
[0239] agaacataca gttgagtggg agtaaaaaaaaaaca tgcgtgttaa tggctgttcg 1200
[0240] agagaaatcg gataaaagc ctaaaacagga acacttcat cacagtgttg atgttggaca 1260
[0241] catagatggt gatggcaag gtttagaaca cattatttc aaagactaaa tctaaaaccc 1320
[0242] agagtaaca tcaatgctca gagttagcat aatttggagc tattcaggaa ttgcagagaaa 1380
[0243] atgcattttc acagaaatca agatgttatt tttgtatact atatcactta uqaactgtg 1440
[0244] tttcattgc tgtaatcagt tttcaaagt cagatggaaa gagcaactga agtcctagaa 1500
[0245] atagaatg taatttttaa ctattccaat aaagctggag gaggagggg agtttgacta 1560
[0246] aagttctttt tgtttgtttc aaatttcat taatgtatat agtgcaaaat accatattaa
[0247] agggggat gtggaggact gaaagctgac agtttggact tttctttttg tacttaagtc
[0248] atgtcttcaa taatgaaaat tgctgttaaa aggatgtatg ggatttagat acttttgcaa
[0249] agctatagaa aattcacttt gtaatctgtt fathergc ccttgagttc tgtgttcagt
[0250] ctgaacaggt tttttggtgg tggtggtttt gttttgtttt ggagacggag tctcactctt
[0251] gtcgcccagg ctggagtgca ggcttggctc actgcaacct ccacctcccg ggttcaagca
[0252] attctcctgc ctcagcctcc tgagtagctg ggattacagg cacccgccac caccccccgc 1980.
[0253] 2040. 2040. 2040. 2040. 2040. 2040. 2040. 2040. 2040
[0254] ctctgttgcc caggctggag tgtagtggtg cgatctcggc tcactgcaag ctccgcctcc
[0255] tgggttcgtg ccattctcct gcctcagcct cctgagtagc tggggctaca ggtacccgcc 2160.
[0256] accgcgccca gctaattttt tttttttgta tttttagtaa agacggggtt tcacggtgtt 2220
[0257] agccaggatg gtctcaatct cctgacctcg tgatccgccc gccttggcct cccaaagtgc 2280
[0258] tgggatcaca ggcgtgagcc accgcgcccg gcctattttt tgtattttta gtagagactg 2340
[0259] ggtttcatca tgttggtcgg gctggtctcc aactcctgac ctcaggtgat ccacctgccc 2400
[0260] cgccccccaa agtgctagtg ttacaggtgc gagccaccgt gtctggccga ttctgaacag 2460
[0261] ttttaatacc attgctattt ttgtgttttt cctgggcctt tttttttttt tttttttttt 2520
[0262] ttgagacagt ctcgctctgt tgcccaggct agagtgcaat ggtgcaatct cagctcactg 2580
[0263] caacctccac cccccacccc cacaccccgt tcaagtaatt ctcctgcctc agcctcccaa 2640
[0264] atagctggga ttacaggtgt ccgccaccac acccagctaa tttttgttat ttttagtaga 2700
[0265] gatggggttt cactgtgttg gtcaggctgg tctccaactg ttgccctcag gtgagccact 2760
[0266] gtgccccacc ttttcctggg tttcataagg atctgaagtg gtggattcct tgtttttgct 2820
[0267] agtgtctcat ttagagttga gatggacctt aaaactcatc tgttttaact cactttttaa 2880
[0268] tagatgagtt aaacttaatt tacttaagga tgtacagtta gagcctggaa cttcaaccat 2940
[0269] tattcactcc ccatgccctg tttcccccca cttcgaaatt aaatgcggtt agcatcatat 3000
[0270] agttcatttt ccccctccat gctgctgtgt gattcttgac tttgggtatg agttttcat 3060
[0271] ccttcatgca gggttctgtc agttcatggt atagtgattc agtgttaaaa tggtggtgtc 3120
[0272] tcagctgtgc tgtgcacatt ccaaccttgt caaattaata gtcctgagca agcaagaaaa 3180
[0273] agaggtaata acatacccat ttctttatga atataagctt ataatatttt ttcatgtgct 3240
[0274] atttttactg agcaaattgt atgtctcaca tgttaacaca ataaatatct tgacaattttt 3300
[0275] at 3301
Claims
1. A composition for preparing cardiac organoids, comprising cardiac-associated long noncoding RNA and extracellular matrix (ECM) fibers as active ingredients.
2. In Paragraph 1, The above-mentioned cardiac-associated long non-coding RNA is at least one of TERMINATOR, CARMEN, Braveheart, FENDRR, ALIEN, FENDRR, SENCR, mm85, mm77, mm130, MYHEART, and SMAD7-IncRNA, a composition for preparing cardiac organoids.
3. In Paragraph 1, The above cardiac-associated long non-coding RNA is a composition for preparing cardiac organoids having at least one sequence of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO.
3.
4. In Paragraph 1, The above-mentioned composition for manufacturing a cardiac organoid further comprises at least one of IWR-1 endo, XAV-939, JW74, SEN461, ICG-001, LGK-974, IWP-2, IWP-4, Wnt-C59, and WIKI4.
5. The above extracellular matrix fibers are, Composition for preparing cardiac organoids obtained from fibroblasts.
6. A step in which pluripotent stem cells differentiate into cardiac cells composed of cardiomyocytes, vascular endothelial cells, smooth muscle cells, and fibroblasts, and the differentiated cells are cultured to self-organize, The step of culturing the stem cells in a cardiac induction medium treated with the composition for producing a cardiac organoid described in any one of claims 1 to 5, and A method for manufacturing a cardiac organoid, comprising the step of recovering a three-dimensional tissue organized with differentiated cells suspended from the cardiac induction medium to obtain a cardiac organoid.
7. In Paragraph 6, The method further includes the step of suspending the recovered three-dimensional tissue to obtain a mature cardiac organoid, A method for preparing a cardiac organoid, wherein the mature cardiac organoid has an ejection fraction of 50% or more or a fractional shortening rate of 20% or more.
8. In Paragraph 6, The above-mentioned culturing step is, A first culture step of inoculating and culturing the above stem cells in a medium treated with a Wnt agent; A method for manufacturing a heart organoid, comprising a second culture step of culturing a first cultured cell in a heart induction medium treated with the above-mentioned composition for manufacturing a heart organoid.
9. In Paragraph 8, The above first culture step is, A method for preparing a cardiac organoid, comprising the step of culturing the stem cells in a medium treated with the Wnt agonist for at least one period of 1 to 3 days.
10. In Paragraph 8, The above second culture step is, A method for producing a cardiac organoid, comprising the step of culturing the first cultured cells in a cardiac induction medium treated with the cardiac organoid production composition on the 3rd to 5th day from the start date of the first culture, and culturing for at least one period of 4 to 22 days.
11. In Paragraph 6, The above cardiac organoid is a method for manufacturing a cardiac organoid having a multi-chamber with separated cavities.
12. In Paragraph 6, The above cardiac organoid is a method for manufacturing a cardiac organoid having an atrioventricular canal.
13. In Paragraph 6, A method for preparing a cardiac organoid, wherein the above-mentioned pluripotent stem cells are induced pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs).
14. In Paragraph 6, A step of treating the above cardiac organoid with a target drug; A step of washing the cardiac organoid after the drug response is complete; A step of culturing the washed cardiac organoid; A step of acquiring images for each cardiac organoid corresponding to the processing step, the washing step, and the culture step, and A method for manufacturing a cardiac organoid, further comprising the step of evaluating the toxicity of the target drug based on images obtained for each of the above.
15. In Paragraph 14, The step of evaluating the toxicity of the above-mentioned target drug is, A step of dividing the image for each of the above-mentioned obtained images so that they have pixels of a predetermined size; A step of estimating a signal for each segmented image; A step of quantifying based on the estimated signal; A step of removing signals having outliers from a quantified signal; A step of clustering residual signals from which signals having outliers have been removed, and A method for manufacturing a cardiac organoid, comprising the step of determining muscle contractility based on clustering results.
16. Multiple chambers for storing fluid; A plurality of cavities separating the above plurality of chambers; Atrioventricular canals connecting the ventricles and atria in multiple chambers, and A cardiac organoid containing a valve for fluid flow.
17. In Paragraph 16, The above cardiac organoid is a cardiac organoid that undergoes spontaneous contraction and has an ejection fraction of 50% or more or a fractional shortening of 20% or more.
Citation Information
Patent Citations
Composition comprising 15-keto prostaglandin e2 for Anti-oxidation
KR1020190117394A
Punching device for corrugate tube
KR1020260005459A
Cardiac organoids, method for preparing the same and method for evaluating drug toxicity using the same
KR102291271B1
Process for producing cardiac organoids
WO2019174879A1