Compositions and methods for targeting a tissue specific protein expression
Modified siRNAs with specific linkages and a multivalent linker target ANGPTL4 in adipose and liver tissues, overcoming delivery challenges and enhancing therapeutic efficacy for conditions like obesity and dyslipidemias.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2026-03-19
AI Technical Summary
Current RNA therapeutics face challenges in targeted delivery to tissues other than the liver, with issues including poor distribution, minimal immune response, off-target effects, inefficient cellular uptake, and rapid degradation, limiting their effectiveness in treating conditions like dyslipidemias and obesity.
Compositions comprising modified siRNAs with specific linkages and a multivalent linker that target angiopoietin-like protein 4 (ANGPTL4) are developed, allowing selective delivery to adipose and liver tissues, enhancing stability and bioavailability while minimizing immune response and off-target effects.
The modified siRNAs effectively reduce ANGPTL4 expression, leading to reduced body weight and fat, improved therapeutic efficacy, and prolonged tissue residence time, addressing the limitations of existing RNA therapeutics.
Smart Images

Figure IMGF000003_0001 
Figure IMGF000003_0002 
Figure IMGF000004_0001
Abstract
Description
Attorney Docket No. 229670-701601COMPOSITIONS AND METHODS FOR TARGETING A TISSUE SPECIFIC PROTEIN EXPRESSIONRELATED APPLICATIONS
[0001] This patent application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 692,808, filed on September 10, 2024; which is incorporated herein by reference in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 10, 2025, is named 229670-701601_PCT_SL. xml and is 9,866,811 bytes in size.BACKGROUND
[0003] RNA therapeutics are promising alternative to other small molecules for the treatment of many diseases but are currently not offered to treat dyslipidemias, obesity, and related medical conditions. Currently, small therapeutic RNAs can only be delivered effectively to the liver due to poor distribution to in other tissue types. There remains a need for targeted siRNA delivery, and therapeutic polynucleotides in general, that exhibit minimal immune response and off-target effects, efficient cellular uptake without formulation, and efficient and specific tissue distribution.SUMMARY
[0004] Provided herein are compositions comprising (a) at least two small interfering ribonucleic acids (siRNAs) that when administered to a cell decrease expression of a gene, wherein each of the at least two siRNAs comprises a sense strand and an antisense strand, wherein at least one of the at least two siRNAs comprises at least one modified inter-nucleoside linkage, at least one modified nucleoside, or a combination thereof, and wherein at least one of the at least two siRNAs comprises a guide strand (an antisense strand) that hybridizes to an mRNA encoding angiopoietin- like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and (b) a multivalent linker that directs the composition to a target site, wherein the target site is an adipose tissue, a liver tissue or a combination thereof. In some embodiments, the composition is selectively directed to adipose tissues associated with one or more of liver, intestine, kidney and peritoneum. In some embodiments, at least one siRNA of the at least two siRNAs comprises a length in a range of from 21 nucleotides to 23 nucleotides. In some embodiments, the sense strand and the antisenseAttorney Docket No. 229670-701601 strand independently have a length in a range of from 21 nucleotides to 23 nucleotides. In some embodiments, the antisense strand of at least one of the at least two siRNAs comprises a 3' overhang relative to the sense strand of the siRNA. In some embodiments, the sense strand of at least one of the at least two siRNAs comprises a 3' overhang relative to the antisense strand of the siRNA. In some embodiments, the antisense strand and the sense strand of at least one of the at least two siRNAs have different lengths relative to each other. In some embodiments, the antisense strand and the sense strand of at least one of the at least two siRNAs have the same lengths relative to each other. In some embodiments, at least one of the at least two siRNAs comprises an antisense strand that hybridizes to an mRNA encoding angiopoietin-like proteins or variants thereof. In some embodiments, at least one of the at least two siRNAs comprise one or more xeno nucleic acid (XNA) modifications. In some embodiments, the modified inter-nucleoside linkage comprises:Formula XIX; Formula XX; Formula XXI; or a combination thereof. In some embodiments, the modified inter-nucleoside linkage comprises:Formula XXVI; Formula XXVII; Formula XXVIII; or a combination thereof, wherein each Base is, independently, a base pairing moiety; each X is, independently, selected from the group consisting of halo, hydroxy, and C1-C6 alkoxy. In some embodiments, the modified inter-nucleoside linkage comprises:Attorney Docket No. 229670-701601(Formula IV); (Formula V); (Formula VI);(Formula VII); wherein each B is, independently, a base pairing moiety; W is selected from the group consisting of O, OCH2, OCH, CH2, and CH; each X is, independently, selected from the group consisting of halo, hydroxy, and C1-C6 alkoxy; Y is selected from the group consisting of O-, OH, OR, NH-,NH2, S-, and SH; Z is selected from the group consisting of O and CH2; when Y is O- or S-, either Z or W is not O; R is a protecting group; and is an optional double bond. In someAttorney Docket No. 229670-701601 embodiments, the base pairing moiety B is selected from the group consisting of adenine (A), guanine (G), cytosine (C), and uracil (U). In some embodiments, the R is a protecting group selected from the group consisting of: dimethoxytrityl (DMTr), succinate, tert-butyl dimethylsilyl (TBDMS), benzoyl (Bz), benzyl (Bn), methoxyethoxymethyl ether (MOM), methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuranyl (THF), trityl (Trt), triisopropyl silyl (TIPS), tert-butyldiphenylsilyl (TBDPS), and acetate. In some embodiments, at least one of the at least two siRNAs comprises one or more extended-Nucleic Acid (exNA) modifications. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 18- 160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-2664. In some embodiments, at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711. In some embodiments, the multivalent linker comprises a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof. In some embodiments, the multivalent linker is a divalent linker. In some embodiments, the compositions provided herein further comprise at least one moiety, wherein the at least one moiety is selected from a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof. In some embodiments, the sugar comprises an N- acetylgalactosamine (GalNAc) amino sugar or a derivative thereof. In some embodiments, the moiety is an adipose tissue targeting moiety. In some embodiments, the moiety is a liver targeting moiety. In some embodiments, the composition is hydrophobic. In some embodiments, the composition has in vivo half-life that is at least 10% longer than a half-life of a corresponding composition that does not comprise modifies siRNAs. In some embodiments, the composition has at least 10% more in vivo bioavailability in liver or adipose tissue than bioavailability in brain, intestine, thyroid, kidney, and heart combined together. In some embodiments, the compositions provided herein further comprise a pharmaceutically acceptable carrier or excipient.Attorney Docket No. 229670-701601
[0005] Also provided herein are compositions comprising (a) at least two siRNAs, wherein at least one siRNA of the at least two siRNA hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof or a fragment thereof in a cell or a tissue, wherein at least one of the at least two siRNAs comprises at least one modified inter-nucleoside linkage selected from:Formula IV; Formula V; Formula VI; orFormula VII; wherein: each B is, independently, a base pairing moiety; W is selected from the group consisting of O, OCH2, OCH, CH2, and CH; each X is, independently, selected from the group consisting of halo, hydroxy, and C1-6 alkoxy; Y is selected from the group consisting of O , OH, OR, NH , NH2,Attomey Docket No. 229670-701601S , and SH; Z is selected from the group consisting of O and CH2; when Y is O or S , either Z or W is not O;R is a protecting group; and is an optional double bond; and (b) a multivalent linker that connects the at least two siRNAs to each other, wherein the multivalent linker selectively directs the composition to an adipose tissue. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 18- 160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-2664. In some embodiments, at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711
[0006] Also provided herein are compositions comprising (a) at least two double stranded polynucleotides, wherein at least one of the at least two double stranded polynucleotides comprises: a guide strand (an antisense strand) that hybridizes to an mRNA encoding angiopoietin- like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and an oligonucleotide interlinkage modification; (b) a multivalent linker that connects the at least two siRNAs to each other, wherein the multivalent linker directs the composition to an adipose tissue; and (c) a liver targeting moiety. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 18- 160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-2664. In some embodiments, at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs:Attomey Docket No. 229670-701601508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711
[0007] Also provided herein are methods of reducing expression of angiopoi etin-like protein 4 (ANGPTL4) in adipose tissues, the method comprising administering to the subject any one of the compositions provided herein. Also provided herein are methods of treating a disease or a condition in a subject, the method comprising administering to the subject any one of the compositions provided herein, thereby treating the disease or the condition. Also provided herein are methods of reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in a subject, the method comprising administering to the subject any one of the compositions provided herein, thereby reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in the subject. In some embodiments, the administering is local or systemic. In some embodiments, the administering is by subcutaneous, intravenous, intradermal, intramuscular, intraadipose, inhalation, intravenous, intraperitoneal, intraocular, intravitreal, intratumoral, intracranial, sublingual, oral, or intrathecal administration. In some embodiments, methods provided herein further comprising administering to the subject an additional therapeutic agent. In some embodiments, the additional therapeutic agent comprises: a glucagon-like peptide- 1 (GLP- 1) receptor agonist, a dipeptidyl peptidase 4 (DPP -4) inhibitor, a sodium-glucose cotransporter-2 (SGLT2) inhibitor, metformin, insulin, an angiotensin II receptor antagonist, an angiotensin converting enzyme (ACE) inhibitor, a beta-blocker, a calcium channel blocker, a thrombocyte aggregation inhibitor, salts, or derivatives thereof. In some embodiments, the GLP-1 receptor agonist is selected from the group consisting of exenatide, exenatide LAR, liraglutide, taspoglutide, semaglutide, albiglutide, lixisenatide and dulaglutide. In some embodiments, the DPP -4 inhibitor is selected from the group consisting of sitagliptin, saxagliptin, linagliptin, and alogliptin. In some embodiments, the SLGT2 inhibitor is selected from the group consisting of canagliflozin, dapagliflozin, empagliflozin, and ertugliflozin. In some embodiments, the condition comprises CVD risk, diabetes mellitus, hypertension, obesity, metabolic syndrome, dyslipidemia, or combinations thereof. In some embodiments, the disease or condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associatedAttomey Docket No. 229670-701601 disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, and eating disorders. In some embodiments, the methods decrease food intake, increases energy expenditure, reduces body weight, regulates appetite, induces satiety, or prevents weight regain after successful weight loss relative to the subject before administration.
[0008] Also provided herein are compositions, the compositions comprise (a) two small interfering ribonucleic acids (siRNAs) that when administered to a cell decreases expression of a gene, wherein at least one of the two siRNAs comprises one or more xeno nucleic acid (XNA) modifications, and wherein at least one of the at least two siRNAs comprises a guide strand (an antisense strand) that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and (b) a multivalent linker that directs the composition to an adipose tissue, a liver tissue or a combination thereof. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7. In some embodiments, at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 18-160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566- 2664. In some embodiments, at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711. Also, provided herein are methods of treating a disease or a condition in a subject, wherein the methods comprise administering to the subject the composition provided herein, thereby treating the disease or the condition, wherein the disease or the condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, nonalcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), muscular dystrophy (MD), dyslipidemias, epileptic seizures, Alzheimer's disease,Attomey Docket No. 229670-701601Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
[0009] Also provided herein are compositions, the compositions comprise (a) a small interfering ribonucleic acid (siRNA) that when administered to a cell decreases expression of a gene, wherein the siRNA comprises one or more xeno nucleic acid (XNA) modifications, and wherein the siRNA comprises a guide strand (an antisense strand) that hybridizes to an mRNA encoding angiopoietin- like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and (b) a linker comprising a sugar or a peptide, wherein the linker directs the composition to an adipose tissue. Also, provided herein are methods of treating a disease or a condition in a subject, wherein the methods comprise administering to the subject the composition provided herein, thereby treating the disease or the condition, wherein the disease or the condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof. In some embodiments, provided herein are methods for treating diabetes in a subject, the method comprising administering to the subject an effective amount of composition provided herein, wherein the administering of the composition increases insulin sensitivity and reduces blood glucose and A1C level in the subject as compared their level prior to the administration. In some embodiments, method of treating obesity in a subject, the method comprising administering to the subject an effective amount of composition provided herein, wherein the administering of the composition reduces adipose tissue deposition and / or ectopic fat in the subject as compared to the adipose tissue deposition and / or ectopic fat prior to the administration. In some embodiments, provided herein are methods for treating hypertriglyceridemia in a subject, the method comprising administering to the subject an effective amount of composition provided herein, wherein the administering of the composition reduces the level of triglycerides, cholesterol, and / or LDL- cholesterol in the subject as compared the triglycerides, cholesterol, and / or LDL-cholesterol level prior to the administration.Attomey Docket No. 229670-701601INCORPORATION BY REFERENCE
[0010] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0012] FIGURE 1 shows a schematic of exemplary compositions provided herein.
[0013] FIGURE 2 shows the synthesis of interlinkage RNA modifications. Phosphoramidites (7a and 7b). Reagent and conditions: (i) TBDMSC1, Imidazole / DMF, rt, overnight; (ii) 3% DCA / CH2CI2, triethylsilane, rt, 1 h, 2a: 88 % (2 steps), 2b: 84 % (2 steps); (iii) IBX / CH3CN, 85°C, 1.5 h; (iv) CH3PPh3Br, ‘BuOK, THF, 0°C then rt, overnight, 4a: 75% (2 steps), 4b: 67% (2 steps); (v) 9-BBN, THF, 0°C, overnight; (vi) NaBCh ■ 4H2O, MeOH, THF, H2O, 0°C then rt, overnight, 5a: 62% (2 steps), 5b: ND; (vii) DMTr-Cl, pyridine, rt, 2 h; (viii) 0.1 M TBAF, THF, rt, 1 h, 6a:93% (2 steps), 6b: 12% (3 steps); (ix) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, DIPEA / CH2CI2, 0°C then rt, 0.5 h, 7a: 86%, b: 81%.
[0014] FIGURE 3 shows additional compositions comprising any one of modified siRNA structural modifications of the siRNAs, any one of multivalent linkers, and any one of moieties in Table 1
[0015] FIGURE 4 shows locations for moieties conjugation to siRNA molecules. Dark gray: sense strand; Dark: antisense strand; Light gray line with attachment points for siRNA conjugates.
[0016] FIGURE 5 shows a schematic of a protected phosphoramidite nucleotide.
[0017] FIGURE 6 shows a schematic of a protected C12 linker.
[0018] FIGURE 7 shows a schematic of the polynucleotide synthesis cycle.
[0019] FIGURE 8 shows a deprotected 5’ amino modifier.
[0020] FIGURE 9 shows a divalent siRNA construct comprising two ANGPTL4 siRNAs linked to each other by a C 12 linker.
[0021] FIGURE 10 shows a graph demonstrating potent ANGPTL4 gene knockdown of divalent ANGPTL4 siRNA construct in Huh7 Cells.
[0022] FIGURE 11 shows a graph demonstrating potent ANGPTL4 gene knockdown of divalent ANGPTL4 siRNA constructs in Hep3B cells.Attomey Docket No. 229670-701601DETAILED DESCRIPTION OF THE INVENTION
[0023] For many diseases and targets where small interfering RNA (siRNA) could be employed as a modality to silence disease-causing genes. However, systemic or local administration, short half-life, rapid clearance rates, nonspecific binding, cell membrane penetration inability, and endonuclease degradation remain major challenges. Accordingly, specific tissue delivery to prosecute the target of interest (TOI) is often lacking. Similarly, specific and long-lasting delivery of siRNA to non-liver tissues has not been established as a therapeutic, largely due to limited biodistribution, instability and degradation.
[0024] Provided herein are compositions comprising modified siRNA that targets a nucleic acid encoding an angiopoietin like protein, a portion thereof, or a fragment thereof. Accordingly, the compositions provided herein can overcome challenges related to systemic or local administration, short half-life, rapid clearance rates, nonspecific binding, cell membrane penetration inability, and endonuclease degradation. Further provided herein are chemical modifications that advantageously improve stability of siRNA when combined with the standard phosphonothioate of enhanced stabilization chemistry (ESC) of contemporary siRNA constructs. The chemical modifications provided herein generate higher concentrations and longer tissue residence time of the siRNA construct by providing 3 ’-exonuclease resistance of the modification.Definitions
[0025] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0026] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0027] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.Attomey Docket No. 229670-701601
[0028] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term, “or,” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0029] As used herein, the term, “optional” or “optionally,” means that the subsequently described circumstance may or may not occur, so that the description includes instances where the circumstance occurs and instances where it does not.
[0030] As used herein, the term, “about” or “approximately,” means a range of up to ± 20 % of a given value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.
[0031] The term, “effective amount” or “therapeutically effective amount,” refers to an amount that is sufficient to achieve the desired effect.
[0032] As used herein, the terms, “silence” and “knockdown,” are used interchangeably to refer to a reduction in gene expression levels.Polynucleotides
[0033] Provided herein are polynucleotides for treating a condition. In some embodiments, a polynucleotide is a single-stranded polynucleotide or a double-stranded polynucleotide. In some embodiments, a polynucleotide described herein comprises a gene-silencing activity.
[0034] In some embodiments, a double-stranded polynucleotide described herein comprises a small interfering RNA (siRNA). A double-stranded polynucleotide of an siRNA comprises a sense strand and an antisense strand. An siRNA can induce a post transcriptional gene silencing of a target gene. An siRNA, as provided herein, can bind to one or more proteins, and forms an RNA- Induced Silencing Complex (RISC). Once an siRNA is part of an RISC complex, two strands of siRNA are separated to leave a single stranded siRNA bound to RISC. Of the two strands of an siRNA, a strand that is thermodynamically less stable due to its base pairing at the 5' end is chosen to remain part of an RISC-complex (a guide strand (an antisense strand)). A single stranded siRNA, which is part of the RISC complex, can scan and find a complementary mRNA. Once a singleAttomey Docket No. 229670-701601 stranded siRNA (part of an RISC complex) binds to its target mRNA, it can induce mRNA cleavage. Cleaved mRNA is degraded by cellular machinery and, subsequently, translation of the mRNA into amino acids is inhibited, thereby reducing protein expression. In some embodiments, an antisense strand of an siRNA provided herein has complementarity to a target nucleic acid. In some embodiments, a sense strand and an antisense strand of an siRNA provided herein have a different number of nucleotides. In some embodiments, a sense strand and an antisense strand of an siRNA provided herein have the same number of nucleotides. In some embodiments, at least one end of the double strand siRNA comprises a 5’ and / or 3’ overhang. In some embodiments, both ends of the double strand siRNA comprises overhangs. Accordingly, in some embodiments, of the two strands of siRNA, one strand comprises a 5’ overhang and / or the other strand comprises a 3’ overhang. In some embodiments, the 5’ and / or 3’ overhang comprise at least one nucleotide, such as one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, and ten nucleotides.
[0035] In some embodiments, an siRNA provided herein comprises at least ten nucleotide base pairs, at least eleven nucleotide base pairs, at least twelve nucleotide base pairs, at least thirteen nucleotide base pairs, at least fourteen nucleotide base pairs, at least fifteen nucleotide base pairs, at least sixteen nucleotide base pairs, at least seventeen nucleotide base pairs, at least eighteen nucleotide base pairs, at least nineteen nucleotide base pairs, at least twenty nucleotide base pairs, at least twenty-one nucleotide base pairs, at least twenty -two nucleotide base pairs, at least twenty- three nucleotide base pairs, at least twenty-four nucleotide base pairs, or at least twenty-five nucleotide base pairs. In some embodiments, an siRNA provided herein comprises ten to twenty- five nucleotide base pairs, eleven to twenty-five nucleotide base pairs, twelve to twenty-five nucleotide base pairs, thirteen to twenty-five nucleotide base pairs, fourteen to twenty-five nucleotide base pairs, fifteen to twenty -five nucleotide base pairs, sixteen to twenty-five nucleotide base pairs, seventeen to twenty-five nucleotide base pairs, eighteen to twenty-five nucleotide base pairs, nineteen to twenty-five nucleotide base pairs, twenty to twenty-five nucleotide base pairs, twenty-one to twenty-five nucleotide base pairs, twenty-two to twenty-five nucleotide base pairs, fifteen to twenty -two nucleotide base pairs, sixteen to twenty -two nucleotide base pairs, seventeen to twenty-two nucleotide base pairs, eighteen to twenty-two nucleotide base pairs, nineteen to twenty-two nucleotide base pairs, twenty to twenty-two nucleotide base pairs, twenty-one to twenty-two nucleotide base pairs, fifteen to twenty-one nucleotide base pairs, sixteen to twenty- one nucleotide base pairs, seventeen to twenty-one nucleotide base pairs, eighteen to twenty-one nucleotide base pairs, nineteen to twenty-one nucleotide base pairs, or twenty to twenty-one nucleotide base pairs. In some embodiments, an siRNA provided herein comprises about ten nucleotide base pairs, about eleven nucleotide base pairs, about twelve nucleotide base pairs, aboutAttomey Docket No. 229670-701601 thirteen nucleotide base pairs, about fourteen nucleotide base pairs, about fifteen nucleotide base pairs, about sixteen nucleotide base pairs, about seventeen nucleotide base pairs, about eighteen nucleotide base pairs, about nineteen nucleotide base pairs, about twenty nucleotide base pairs, about twenty-one nucleotide base pairs, about twenty-two nucleotide base pairs, about twenty- three nucleotide base pairs, about twenty-four nucleotide base pairs, or about twenty-five nucleotide base pairs.
[0036] In some embodiments, an siRNA provided herein comprises a modified siRNA. In some embodiments, a modified siRNA has improved stability, targeting efficiency, or combinations thereof relative to a corresponding unmodified siRNA. In some embodiments, a modified siRNA comprises a modified sense strand, a modified antisense strand, or a combination thereof. In some embodiments, an antisense strand of a modified siRNA comprises a 3' overhang relative to a sense strand of the modified siRNA. In some embodiments, at least one of a sense stand and an antisense strand of an siRNA has an overhang. For example, in some embodiments, at least one of a sense stand and an antisense strand of an siRNA has an overhang, wherein the overhang comprises one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides or ten nucleotides. In some embodiments, a sense strand of a modified siRNA comprises a 3' overhang relative to an antisense strand of the modified siRNA. In some embodiments, an antisense strand of a modified siRNA comprises a 5' overhang relative to a sense strand of the modified siRNA. In some embodiments, a sense strand of a modified siRNA comprises a 5' overhang relative to an antisense strand of the modified siRNA.
[0037] In some embodiments, a sense strand of an siRNA provided herein comprises at least ten nucleotide base pairs, at least eleven nucleotide base pairs, at least twelve nucleotide base pairs, at least thirteen nucleotide base pairs, at least fourteen nucleotide base pairs, at least fifteen nucleotides, at least sixteen nucleotides, at least seventeen nucleotides, at least eighteen nucleotides, at least nineteen nucleotides, at least twenty nucleotides, at least twenty-one nucleotides, at least twenty -two nucleotides, at least twenty -three nucleotides, at least twenty -four nucleotides, or at least twenty-five nucleotides. In some embodiments, a sense strand of an siRNA provided herein comprises ten to twenty-five nucleotide base pairs, eleven to twenty-five nucleotide base pairs, twelve to twenty-five nucleotide base pairs, thirteen to twenty-five nucleotide base pairs, fourteen to twenty-five nucleotide base pairs, fifteen to twenty-five nucleotides, sixteen to twenty-five nucleotides, seventeen to twenty-five nucleotides, eighteen to twenty-five nucleotides, nineteen to twenty-five nucleotides, twenty to twenty-five nucleotides, twenty-one to twenty-five nucleotides, twenty-two to twenty-five nucleotides, fifteen to twenty- two nucleotides, sixteen to twenty -two nucleotides, seventeen to twenty -two nucleotides, eighteenAttomey Docket No. 229670-701601 to twenty-two nucleotides, nineteen to twenty-two nucleotides, twenty to twenty-two nucleotides, twenty-one to twenty-two nucleotides, fifteen to twenty-one nucleotides, sixteen to twenty-one nucleotides, seventeen to twenty-one nucleotides, eighteen to twenty-one nucleotides, nineteen to twenty-one nucleotides, or twenty to twenty-one nucleotides. In some embodiments, a sense strand of an siRNA provided herein comprises about ten nucleotide base pairs, about eleven nucleotide base pairs, about twelve nucleotide base pairs, about thirteen nucleotide base pairs, about fourteen nucleotide base pairs, about fifteen nucleotides, about sixteen nucleotides, about seventeen nucleotides, about eighteen nucleotides, about nineteen nucleotides, about twenty nucleotides, about twenty-one nucleotides, about twenty -two nucleotides, about twenty -three nucleotides, about twenty-four nucleotides, or about twenty-five nucleotides.
[0038] In some embodiments, an antisense strand of an siRNA provided herein comprises at least ten nucleotide base pairs, at least eleven nucleotide base pairs, at least twelve nucleotide base pairs, at least thirteen nucleotide base pairs, at least fourteen nucleotide base pairs, at least fifteen nucleotides, at least sixteen nucleotides, at least seventeen nucleotides, at least eighteen nucleotides, at least nineteen nucleotides, at least twenty nucleotides, at least twenty-one nucleotides, at least twenty -two nucleotides, at least twenty -three nucleotides, at least twenty -four nucleotides, or at least twenty-five nucleotides. In some embodiments, an antisense strand of an siRNA provided herein comprises ten to twenty-five nucleotide base pairs, eleven to twenty-five nucleotide base pairs, twelve to twenty-five nucleotide base pairs, thirteen to twenty-five nucleotide base pairs, fourteen to twenty-five nucleotide base pairs, fifteen to twenty-five nucleotides, sixteen to twenty-five nucleotides, seventeen to twenty-five nucleotides, eighteen to twenty-five nucleotides, nineteen to twenty-five nucleotides, twenty to twenty-five nucleotides, twenty-one to twenty-five nucleotides, twenty-two to twenty-five nucleotides, fifteen to twenty- two nucleotides, sixteen to twenty -two nucleotides, seventeen to twenty -two nucleotides, eighteen to twenty-two nucleotides, nineteen to twenty-two nucleotides, twenty to twenty-two nucleotides, twenty-one to twenty-two nucleotides, fifteen to twenty-one nucleotides, sixteen to twenty-one nucleotides, seventeen to twenty-one nucleotides, eighteen to twenty-one nucleotides, nineteen to twenty-one nucleotides, or twenty to twenty-one nucleotides. In some embodiments, an antisense strand of an siRNA provided herein comprises about ten nucleotide base pairs, about eleven nucleotide base pairs, about twelve nucleotide base pairs, about thirteen nucleotide base pairs, about fourteen nucleotide base pairs, about fifteen nucleotides, about sixteen nucleotides, about seventeen nucleotides, about eighteen nucleotides, about nineteen nucleotides, about twenty nucleotides, about twenty-one nucleotides, about twenty-two nucleotides, about twenty-three nucleotides, about twenty -four nucleotides, or about twenty -five nucleotides.Attomey Docket No. 229670-701601
[0039] In some embodiments, an siRNA described herein comprises an antisense strand having minimal self-fold ability, such as less than -6 kal / mole. In some embodiments, an siRNA described herein comprises an antisense strand that binds a target nucleotide having weak self-folding ability (e.g., less than -13 kal / mole and at least -26 kcal / mole of net binding free energy between the antisense strand and its target). Accordingly, in some embodiments, secondary structures of an antisense strand described herein and / or a target nucleotide described herein have low stability.
[0040] In some embodiments, a modified siRNA comprises one or more modifications. In some embodiments, one or more modifications increase in vivo stability of an siRNA relative to that of the corresponding unmodified siRNA. Accordingly, in some embodiments, the one or more modifications increase in vivo half-life of the siRNA by about 5%, about 10%, about 15%, about 20%, about 50%, about 80%, about 100% or more relative to that of the corresponding unmodified siRNA. In some embodiments, one or more modifications increase bioavailability of an siRNA at a target site relative to relative to that of the corresponding unmodified siRNA. Accordingly, in some embodiments, the one or more modifications increase bioavailability of an siRNA at a target site by about 5%, about 10%, about 15%, about 20%, about 50%, about 80%, about 100% or more relative to that of the corresponding unmodified siRNA.
[0041] In some embodiments, an siRNA comprises one or more modifications selected from sugar modifications, backbone modifications, terminal modifications and conjugate-based modifications. In some embodiments, the sugar modifications comprise 2'-O-methyl (2'-OMe), 2'- fluoro (2'-F), 2'-O-methoxyethyl (2'-M0E), locked nucleic acid (LNA) or LNA constrained analogs, glycol nucleic acid (GNA), unlocked nucleic acid (UNA), or combinations thereof. In some embodiments, the siRNA comprises a backbone modification that advantageously improves the durability, stability, and / or potency of the siRNA relative to the unmodified siRNA. In some embodiments, the backbone modifications comprise extended-Nucleic Acid (exNA) modifications, phosphorothioate (PS) modifications, phosphorodithioate modifications, boranophosphate linkage modifications or combinations thereof. In some embodiments, the phosphodiester modifications, phosphorothioate modifications, and / or phosphorodithioate modifications protect or stabilize the polynucleotides against nucleases. In some embodiments, the exNA modifications comprise 3’-O-CH2-exNA modification, 3’-CH2-O-exNA modification, 2’- exNA modification 3 ’-exNA modification. In some embodiments, the base modifications comprise 5-methylcytidine, N6-methyladenosine, pseudouridine, 2-thiouridine, universal bases (e.g., 5- nitroindole) and combinations thereof. In some embodiments, the terminal modifications comprise 3’ and / or 5’ overhangs, cholesterol conjugation, PEG, lipids, peptides and combinations thereof. In some embodiments, the siRNA disclosed herein is conjugated with GalNAc, cell penetrating peptides, aptamers, antibodies or combinations thereof. In some embodiments, the siRNAAttomey Docket No. 229670-701601 modifications comprise 5’-(E)-vinylphosphonate (5’-(E)-VP), PMO, pseudouridine, 2’ -thiouridine (s2U), or combinations thereof.
[0042] In some embodiments, one or more exNA backbone modifications described herein enhance siRNA stability by about 20-fold to about 1000-fold relative to that of the corresponding siRNA without any backbone modifications. For instance, in some embodiments, one or more exNA backbone modifications enhance siRNA stability by about 15-fold, about 20 fold, about 25 fold about 30 fold, about 35 fold, about 40 fold, about 45 fold, about 50 fold, about 55 fold, about 60 fold, about 65 fold, about 70 fold, about 80 fold, about 90 fold, about 100 fold, about 150 fold, about 200 fold, about 250 fold, about 300 fold, about 350 fold, about 400 fold, about 450 fold, about 500 fold, about 550 fold, about 600 fold, about 650 fold, about 700 fold, about 750 fold, about 800 fold, about 850 fold, about 900 fold, about 950 fold, or about 1000-fold relative to that of the corresponding siRNA without any backbone modifications. In some embodiments, one or more exNA backbone modifications enhance siRNA stability by more than 1000-fold relative to that of the corresponding siRNA with natural phosphodiester backbone. In some embodiments, one or more exNA modifications, one or more PS modifications, or combinations thereof of siRNAs enhance tissue exposure by about 2-fold to about 10-fold relative to that of the corresponding unmodified siRNA. In some embodiments, one or more exNA modifications, one or more PS modifications, or combinations thereof of siRNAs enhance tissue accumulation by about 2-fold to about 20-fold relative to that of the corresponding unmodified siRNA. In some embodiments, one or more exNA modifications of siRNAs increase adipose tissue and liver accumulation by about 5-fold, about 8 fold, about 10 fold, about 12 fold, to about 15-fold as relative to that of the corresponding unmodified siRNA.
[0043] In some embodiments, an siRNA disclosed herein comprises one or more modifications that enhance delivery of the siRNA to a specific targeting site (e.g., adipose tissues and / or liver tissues) relative to that of the corresponding siRNA without any modifications. In some embodiments, an siRNA disclosed herein comprises a moiety (e.g., GalNAc) conjugated to 3’ or 5’ end of a sense strand of the siRNA. In some embodiments, an siRNA disclosed herein comprises a moiety (e.g., GalNAc) conjugated to 3’ or 5’ end of an antisense strand of the siRNA. In some embodiments, an siRNA disclosed herein comprises an exNA modification at 3’ or 5’ end of a sense strand of the siRNA. In some embodiments, an siRNA disclosed herein comprises an exNA modification at 3’ or 5’ end of an antisense strand of the siRNA. In some embodiments, an exNA modification at 3’ end of the siRNA enhances interactions with RISC. In some embodiments, an siRNA comprises an exNA modification, a PS modification, or a combination thereof at 3' or 5' end of a sense strand of the siRNA. In some embodiments, an siRNA comprises an exNAAttomey Docket No. 229670-701601 modification, a PS modification, or a combination thereof at 3' or 5' end of an antisense strand of the siRNA.
[0044] In some embodiments, a modified siRNA comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least nineteen, at least twenty, at least twenty-one, at least twenty -two, at least twenty- three, at least twenty -four, or at least twenty-five modifications. In some embodiments, a modified siRNA comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% internucleoside linkage bonds, nucleotides, nucleosides, or combinations thereof that are modified.
[0045] In some embodiments, at least one strand of a modified siRNA provided herein comprises one or more modifications, wherein the modified siRNA comprises at least ten nucleotide base pairs, at least eleven nucleotide base pairs, at least twelve nucleotide base pairs, at least thirteen nucleotide base pairs, at least fourteen nucleotide base pairs, at least fifteen modified nucleotides, at least sixteen modified nucleotides, at least seventeen modified nucleotides, at least eighteen modified nucleotides, at least nineteen modified nucleotides, at least twenty modified nucleotides, at least twenty-one modified nucleotides, at least twenty -two modified nucleotides, at least twenty- three modified nucleotides, at least twenty-four modified nucleotides, or at least twenty-five modified nucleotides. In some embodiments, at least one strand of a modified siRNA provided herein comprises one or more modifications, wherein the modified siRNA comprises ten to twenty- five nucleotide base pairs, eleven to twenty-five nucleotide base pairs, twelve to twenty-five nucleotide base pairs, thirteen to twenty-five nucleotide base pairs, fourteen to twenty-five nucleotide base pairs, fifteen to twenty-five modified nucleotides, sixteen to twenty-five modified nucleotides, seventeen to twenty-five modified nucleotides, eighteen to twenty-five modified nucleotides, nineteen to twenty-five modified nucleotides, twenty to twenty-five modified nucleotides, twenty-one to twenty-five modified nucleotides, twenty-two to twenty-five modified nucleotides, fifteen to twenty-two modified nucleotides, sixteen to twenty-two modified nucleotides, seventeen to twenty-two modified nucleotides, eighteen to twenty-two modified nucleotides, nineteen to twenty-two modified nucleotides, twenty to twenty-two modified nucleotides, twenty-one to twenty-two modified nucleotides, fifteen to twenty-one modified nucleotides, sixteen to twenty-one modified nucleotides, seventeen to twenty-one modified nucleotides, eighteen to twenty-one modified nucleotides, nineteen to twenty-one modified nucleotides, or twenty to twenty-one modified nucleotides. In some embodiments, at least one strand of a modified siRNA provided herein comprises one or more modifications, wherein theAttomey Docket No. 229670-701601 modified siRNA comprises about ten nucleotide base pairs, about eleven nucleotide base pairs, about twelve nucleotide base pairs, about thirteen nucleotide base pairs, about fourteen nucleotide base pairs, about fifteen modified nucleotides, about sixteen modified nucleotides, about seventeen modified nucleotides, about eighteen modified nucleotides, about nineteen modified nucleotides, about twenty modified nucleotides, about twenty-one modified nucleotides, about twenty-two modified nucleotides, about twenty-three modified nucleotides, about twenty-four modified nucleotides, or about twenty -five modified nucleotides.
[0046] In some embodiments, at least one of two strands (sense strand and anti-sense strand) of a modified siRNA provided herein comprises one or more xeno nucleic acid (XNA) modifications. In some embodiments, both strands (sense strand and anti-sense strand) of a modified siRNA provided herein independently comprise one or more XNA modifications. In some embodiments, one or more XNA modifications advantageously improve the stability, potency, targeting specificity, immunogenicity, and pharmacokinetics of the siRNA relative to that of the corresponding siRNA without any modifications. In some embodiments, XNA modifications comprise locked nucleic acid modification (LNA), 2'-Fluoro-arabino nucleic acid (FANA), hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), or combinations thereof. In some embodiments, the siRNA described herein comprises one or more XNA modifications in the sense strand, the antisense strand, seed region, termini, or backbone region. In some embodiments, the 3’ and / or 5’ end of the sense strand comprises one or more XNA modifications. In some embodiments, the 3’ end of the antisense strand comprises one or more XNA modifications. In some embodiments, the seed region of the siRNA comprises one or more XNA modifications. In some embodiments, one or more XNA modifications increase knockdown efficiency of siRNAs by about 0.5 fold, about 1 fold, about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold relative to that of the corresponding siRNA without any modifications. In some embodiments, one or more XNA modifications increase knockdown efficiency of siRNAs by more than 10 fold relative to that of the corresponding siRNA without any modifications.
[0047] In some embodiments, at least one of two strands (sense strand and anti-sense strand) of a modified siRNA provided herein comprises one or more modified nucleosides. In some embodiments, a modified nucleoside comprises a locked nucleic acid (LNA), hexitol nucleic acid (HLA), cyclohexene nucleic acid (CeNA), a 2’, 4’ constrained ethyl, 2’- methoxyethyl, 2’-O-alkyl, 2’-O-allyl, 2’-O-allyl, 2’-fluoro, 2’-deoxy, a 2’-O-methyl nucleoside, 2’-deoxyfluoro nucleoside, 2’-O-N-methylacetamido (2’-0-NMA) nucleoside, a 2’-O- dimethylaminoethoxyethyl (2’-O- DMAEOE) nucleoside, 2’-O-aminopropyl (2’-O-AP) nucleoside, 2’-ara-F, 2'-fluoro 3'- phosphorothioate, 2'-OMe, 2'-OMe 3'-phosphorothioate, 2'-OMe-A, 2'-OMe-U 3'-Attomey Docket No. 229670-701601 phosphorothioate, 5'-vinyl-phosphonate, 4'-alkylated nucleoside (e.g., 4'-methyl nucleoside), 4'- O-alkylated nucleoside (e.g., 4'-O-methyl nucleoside), 5 '-alkylated nucleoside (e.g., 5 '-methyl nucleoside) or a combination thereof. In some embodiments, an alkyl group of the 4'-alkylated nucleoside, 4'-O-alkylated nucleoside, and / or 5'-alkylated nucleoside comprise racemic or chirally pure R or S isomer. In some embodiments, a modified nucleoside comprises a 2’-fluoro modified nucleoside. In some embodiments, a modified nucleoside comprises a 2’-O-methyl modified nucleoside. In some embodiments, a modified siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 modified nucleosides. In some embodiments, a modified siRNA comprises 2 or more modified nucleosides, 3 or more modified nucleosides, 4 or more modified nucleosides, 5 or more modified nucleosides, 6 or more modified nucleosides, 7 or more modified nucleosides, 8 or more modified nucleosides, 9 or more modified nucleosides, 10 or more modified nucleosides, 11 or more modified nucleosides, 12 or more modified nucleosides, 13 or more modified nucleosides, 14 or more modified nucleosides, 15 or more modified nucleosides, 16 or more modified nucleosides, 17 or more modified nucleosides, 18 or more modified nucleosides, 19 or more modified nucleosides, 20 or more modified nucleosides, 21 or more modified nucleosides, 22 or more modified nucleosides, 23 or more modified nucleosides, or 24 or more modified nucleosides.
[0048] In some embodiments, the modifications of the siRNA are located at positions selected from a group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 from the 5’ end of the siRNA. In some embodiments, the siRNA provided herein has a modification pattern comprising: NxNxNxNNxNNxNxNxNxNxNxNxNxNNxNxNN, NNxNxNxNNxNxNxNNxNNxNxNxNNNxNNxN, NxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNx, NxNNxNxNxNxNNNxNxNNxNNxNNxNxNNxNNxN, NNxNxNNxNNxNNxNxNxNxNNNxNxNxNxNxNx, NxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNxNx, wherein N represents a nucleotide, and x presents any one or more modifications disclosed herein.
[0049] In some embodiments, the siRNA comprises a 21 nt sense strand and a 23 nt antisense strand, wherein each nucleotide comprises a 2’-O-methyl (OMe) sugar modification except at positions 7 and 9-11 from the 5’ end comprising a 2’-fluoro sugar modification. In some embodiments, the siRNA comprises two phosphorothioate (PS) linkage modifications at each end of each oligo. In some embodiments, the siRNA comprises a 2’-O-methyl A residue substituted at the 3’ end of the molecule regardless of the original sequence at that position. In some embodiments, each nucleotide of the siRNA comprises a 2’-O-methyl (OMe) sugar modification except at positions 2, 6, 14 & 16 counting at the 5’ end comprise a 2’ -fluoro sugar modification.Attorney Docket No. 229670-701601
[0050] In some embodiments, each strand (sense strand and anti-sense strand) of a modified siRNA provided herein independently comprises one or more modified inter-nucleoside linkages. In some embodiments, a modified siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 modified inter-nucleoside linkages. In some embodiments, a modified siRNA comprises 2 or more modified inter-nucleoside linkages, 3 or more modified inter-nucleoside linkages, 4 or more modified inter-nucleoside linkages, 5 or more modified internucleoside linkages, 6 or more modified inter-nucleoside linkages, 7 or more modified inter- nucleoside linkages, 8 or more modified inter-nucleoside linkages, 9 or more modified inter- nucleoside linkages, 10 or more modified inter-nucleoside linkages, 11 or more modified inter- nucleoside linkages, 12 or more modified inter-nucleoside linkages, 13 or more modified inter- nucleoside linkages, 14 or more modified inter-nucleoside linkages, 15 or more modified inter- nucleoside linkages, 16 or more modified inter-nucleoside linkages, 17 or more modified inter- nucleoside linkages, 18 or more modified inter-nucleoside linkages, 19 or more modified inter- nucleoside linkages, 20 or more modified inter-nucleoside linkages, 21 or more modified inter- nucleoside linkages, 22 or more modified inter-nucleoside linkages, 23 or more modified inter- nucleoside linkages, or 24 or more modified inter-nucleoside linkages. In some embodiments, a modified inter-nucleoside linkage comprises alkylphosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or a combination thereof. In some embodiments, a modified inter-nucleoside linkage comprises a phosphorothioate linkage.
[0051] In some embodiments, the siRNAs described herein comprise modification occurring on alternating nucleotides of a sense strand and / or antisense strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. The type of modifications contained in the alternating motif may be the same or different.
[0052] In some embodiments, the siRNAs described herein comprise the modification pattern for the alternating region on the sense strand relative to the modification pattern for the alternating region on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa.
[0053] In some embodiments, the siRNAs described herein comprise mismatch(es) with the target, within the duplex region, the overhang region, or a combination thereof. The base pair can be ranked on the basis of their preference for promoting dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).Attomey Docket No. 229670-701601
[0054] In some embodiments, the siRNAs described herein comprise at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'-end of the antisense strand comprises a base pair that promote the dissociation of the antisense strand at the 5 '-end of the duplex. In some embodiments, the base pair promoting the dissociation is selected from the group consisting of A:U, G:U, I:C, and mismatched pairs. In some embodiments, the nucleotide at position 1 within the duplex region from the 5 '-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 nucleotides within the duplex region from the 5 '-end of the antisense strand is selected from the group consisting of A and U. In some embodiments, the base pairs promoting the dissociation comprise non-canonical base pairs.
[0055] In some embodiments, the siRNAs described herein comprise 4'-modified nucleoside (e.g., 4'-alkylated nucleoside, 4'-O-alkylated nucleoside) and / or 5 '-modified nucleoside (5 '-alkylated nucleoside). In some embodiments, the siRNAs described herein comprise 4'-modified nucleoside (e.g., 4'-alkylated nucleoside, 4'-O-alkylated nucleoside) and / or 5 '-modified nucleoside (5'- alkylated nucleoside) at the 3'-end. In some embodiments, 4'-modified nucleoside and / or 5'- modified nucleoside maintains or improves potency of the siRNA.
[0056] In some embodiments, the siRNA described herein comprise one or more modifications that promote nuclease resistance at the 3' end, inhibit binding of the sense to the antisense strand and / or prevent sense strand activation by RISC at the 5' end. In such embodiments, the one or modifications comprise 2'-5 ' linkage (with 2'-H, 2'-OH and 2'-OMe and with P=O or P=S) and / or L sugars (e.g., L ribose, L-arabinose with 2'-H, 2'-OH and 2'-OMe).
[0057] In some embodiments, a modified inter-nucleoside linkage comprises: Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII, wherein: each B is, independently, a base pairing moiety; W is selected from the group consisting of O, OCH2, OCH, CH2, and CH; each X is, independently, selected from the group consisting of halo, hydroxy, and C1-C6 alkoxy; Y is selected from the group consisting of O-, OH, OR, NH-, NH2, S-, and SH; Z is selected from the group consisting of O and CH2; when Y is O- or S-, either Z or W is not O; R is a protecting group; and is an optional double bond. In some embodiments, the base pairing moiety B is selected from the group consisting of adenine, guanine, cytosine, and uracil. In some embodiments, the R is a protecting group selected from the group consisting of: dimethoxytrityl (DMTr), succinate, tert-butyl dimethylsilyl (TBDMS), benzoyl (Bz), benzyl (Bn), methoxyethoxymethyl ether (MOM), methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuranyl (THF), trityl (Trt), triisopropyl silyl (TIPS), tert-butyldiphenylsilyl (TBDPS), and acetate.Atorney Docket No. 229670-701601(Formula IV) (Formula V) (Formula VI)Attorney Docket No. 229670-701601(Formula VII)
[0058] In some embodiments, a modified siRNAs comprises Formula VIII, wherein D is selected from the group consisting of OCH2 and OCH; C is selected from the group consisting of O-, OH, OR1, NH-, NH2, S-, and SH, optionally wherein C is selected from the group consisting of O-, OH, and OR1; A is selected from the group consisting of O and CH2; R1is a protecting group;=-= is an optional double bond; and the inter-nucleoside is bridging two optionally modified nucleosides.(Formula VIII)
[0059] In some embodiments, D is CH2. In some embodiments, a modified inter-nucleoside linkage of Formula VIII is a modified inter-nucleoside linkage of Formula IX.(Formula IX)
[0060] In some embodiments, D is 0. In some embodiments, a modified inter-nucleoside linkage of Formula VIII is a modified inter-nucleoside linkage of Formula X.(Formula X)Attorney Docket No. 229670-701601
[0061] In some embodiments, D is CH2. In some embodiments, a modified inter-nucleoside linkage of Formula VIII is a modified inter-nucleoside linkage of Formula XI.(Formula XI)
[0062] In another embodiment, a modified inter-nucleoside linkage of Formula VII is a modified inter-nucleoside linkage of Formula XII.(Formula XII)
[0063] In some embodiments, D is OCH2. In some embodiments, the modified inter-nucleoside linkage of Formula VII is a modified inter-nucleoside linkage of Formula XIII.(Formula XIII)
[0064] In another embodiment, a modified inter-nucleoside linkage of Formula VII is a modified inter-nucleoside linkage of Formula XIV.(Formula XIV)
[0065] In some embodiments, a modified siRNA provided herein comprises one or more modifications listed in Table 1.Attorney Docket No. 229670-701601Table 1. Polynucleotide Modifications.Attorney Docket No. 229670-701601*R= halo, hydroxy, and Ci-6 alkoxy; Base = a base pairing moiety
[0066] In some embodiments, a modified siRNA provided herein comprises one or more modified inter-nucleoside linkages selected from Formula XIX; Formula XX; Formula XXI; or any combination thereofAttorney Docket No. 229670-701601Formula XIX Formula XX Formula XXI
[0067] In some embodiments, a modified siRNA provided herein comprises one or more modified inter-nucleoside linkages selected from Formula XXVI; Formula XXVII; Formula XXVIII; or any combination thereofFormula XXVI Formula XXVII Formula XXVIII wherein each B is, independently, a base pairing moiety; and each X is, independently, selected from the group consisting of halo, hydroxy, and C1-C6 alkoxy.
[0068] In some embodiments, a modified siRNA comprising one or more modified inter- nucleoside linkages can be synthesized as shown in FIG. 2.
[0069] In some embodiments, the modifications advantageously reduce immunogenicity by avoiding toll-like receptor activation. In some embodiments, the modifications reduce renal toxicity by increasing plasma protein binding, reducing off-target tissue distribution, slowing clearance. For instance, in some embodiments, the modification increases the siRNA plasma halflife, increases cellular uptake and endosomal escape, thereby increasing the retention time of the siRNA by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold. In some embodiments, the modification increases the siRNA retention time by more than 10-fold.
[0070] In some embodiments, the siRNA is synthesized with solid phase phosphate triester methods. In some embodiments, protecting groups are added to the siRNA during synthesis to increase the stability and potency of the siRNA. In some embodiments, the protecting groupsAttomey Docket No. 229670-701601 comprising a protected phosphoramidite polynucleotides or a protected phosphoramidite carbon chain linker.
[0071] In some embodiments, the siRNA provided herein binds with at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, or at least twenty consecutive nucleotides of a human ANGPTL4 mRNA. In some embodiments, the siRNA binds with at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, or at least twenty consecutive nucleotides of a non-human primate ANGPTL4 mRNA. In some embodiments, the siRNA binds with at least 19 consecutive nucleotides of a human ANGPTL4 mRNA. In some embodiments, the siRNA binds with a human ANGPTL4 mRNA and less than or equal to 20 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, siRNA binds with a human ANGPTL4 mRNA target site that does not harbor an SNP, with a minor allele frequency (MAF) greater or equal to 1% (pos.2-18).Linkers
[0072] Provided herein are linkers. In some embodiments, a linker is coupled, directly or indirectly, to at least one polynucleotide provided herein. In some embodiments, a linker provided herein does not compromise RISC loading of the at least one polynucleotide. In some embodiments, a linker provided herein alters distribution of at least one polynucleotide connected to the linker. In some embodiments, a linker provided herein increases bioavailability of at least one polynucleotide connected to the linker at a target site. In some embodiments, a linker provided herein increases half-life of at least one polynucleotide connected to the linker at a target site. In some embodiments, a target site comprises a molecule, a cell or a cell type, a compartment (e.g., a cellular or organ compartment), a tissue, an organ or a region of the body. In some embodiments, a linker provided herein is hydrophobic. In some embodiments, a linker comprises a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof. In some embodiments, the linker is a peptide (e.g., CKGGRAKDC peptide (SEQ ID NO: 8164)). In some embodiments, a linker comprises a polymer, wherein the polymer is a tetra-ethylene glycol. In some embodiments, a linker comprises a polynucleotide, wherein the polynucleotide comprises one or more XNA modifications.
[0073] In some embodiments, the linkers described herein comprise multivalent linkers. In some embodiments, a multivalent linker connects at least one polynucleotide to at least one moiety. In some embodiments, a multivalent linker connects at least two polynucleotides by covalentAttomey Docket No. 229670-701601 linkages. In some embodiments, a multivalent linker is coupled, directly or indirectly, to at least one polynucleotide provided herein and at least one moiety provided herein. In some embodiments, a multivalent linker connects at least one polynucleotide with at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten moieties. In some embodiments, a multivalent linker connects at least one polynucleotide to one, two, three, four, five, six, seven, eight, nine or ten moieties. In some embodiments, a multivalent linker connects at least one moiety with at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten polynucleotides. In some embodiments, a multivalent linker connects at least one moiety with one, two, three, four, five, six, seven, eight, nine or ten polynucleotides. In some embodiments, multivalent linkers provided herein does not compromise RISC loading of the at least one polynucleotide that is connected to at least one moiety by the multivalent linker.
[0074] In some embodiments, a multivalent linker connects at least two polynucleotides to each other. In some embodiments, a multivalent linker connects at least two polynucleotides by covalent linkages. In some embodiments, a multivalent linker is coupled, directly or indirectly, to at least two polynucleotides provided herein. In some embodiments, a multivalent linker connects at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten polynucleotides. In some embodiments, a multivalent linker connects two, three, four, five, six, seven, eight, nine or ten polynucleotides. In some embodiments, a multivalent linker connects two polynucleotides. In some embodiments, a multivalent linker connects three polynucleotides. In some embodiments, a multivalent linker connects four polynucleotides. In some embodiments, a multivalent linker connects at least two polynucleotides, wherein at least two polynucleotides are different relative to each other. In some embodiments, a multivalent linker connects at least two polynucleotides, wherein at least two polynucleotides are identical relative to each other. In some embodiments, multivalent linkers provided herein do not compromise RISC loading of the at least two polynucleotides that are connected to each other by the multivalent linker.
[0075] In some embodiments, a multivalent linker comprises a divalent linker, a trivalent linker, a tetravalent linker, a pentavalent linker, a hexavalent linker, a heptavalent linker, an octavalent linker, a nonavalent linker, and a decavalent linker. In some embodiments, a multivalent linker is a divalent linker. Accordingly, in some embodiments, a divalent linker connects two polynucleotides. In some embodiments, a divalent linker connects two non-identical polynucleotides. In some embodiments, a divalent linker connects two identical polynucleotides. Alternatively, in some embodiments, a divalent linker connects a polynucleotide to a moiety.Attomey Docket No. 229670-701601
[0076] In some embodiments, the multivalent linker described herein connects two siRNAs to each other, wherein the multivalent linker is further linked to one or more moieties. In some embodiments, the siRNAs in the compositions and systems described herein are connect via at least one multivalent linker.
[0077] In some embodiments, the multivalent linker described herein connects two siRNAs to each other. In some embodiments, the multivalent linker is further linked to one or more moieties. In some embodiments, at least one of the two siRNAs are further conjugated to one or more moieties directly or by a multivalent linker. Accordingly, in some embodiments, compositions described herein comprise two multivalent linkers, wherein one multivalent linker connects the two siRNAs to each other, and the other multivalent linker connects one of the two siRNAs to one or more moieties. In some embodiments, compositions described herein comprise three multivalent linkers, wherein a first multivalent linker connects the first siRNA and a second siRNA to each other, a second multivalent linker connects the first siRNA to one or more moieties, and a third multivalent linker connects the second siRNA to one or more moieties.
[0078] In some embodiments, a multivalent linker provided herein alters pharmacokinetic properties of one or more polynucleotides. For example, in some embodiments, a multivalent linker provided herein alters distribution of at least two polynucleotides connected to each other by the multivalent linker. In some embodiments, a multivalent linker provided herein transports at least two polynucleotides connected to each other by the multivalent linker to a target site. In some embodiments, a multivalent linker provided herein increases bioavailability of at least two polynucleotides connected to each other by the multivalent linker at a target site. In some embodiments, a multivalent linker provided herein increases half-life of at least two polynucleotides connected to each other by the multivalent linker at a target site. Alternatively, in some embodiments, a multivalent linker provided herein alters distribution of at least one polynucleotide connected to at least one moiety by the multivalent linker. In some embodiments, a multivalent linker provided herein increases bioavailability of at least one polynucleotide connected to at least one moiety by the multivalent linker at a target site. In some embodiments, a multivalent linker provided herein increases half-life of at least one polynucleotide connected to at least one moiety by the multivalent linker at a target site. In some embodiments, a target site comprises a molecule, a cell or a cell type, a compartment (e.g., a cellular or organ compartment), a tissue, an organ or a region of the body. In some embodiments, a multivalent linker provided herein is hydrophobic.
[0079] In some embodiments, a multivalent linker directs the compositions provided herein to a target site, wherein the target site is a liver. In some embodiments, a multivalent linker directs the compositions provided herein to a target site, wherein the target site is an adipose tissue orAttomey Docket No. 229670-701601 adipocytes (adipose cells). In some embodiments, the adipose tissue comprises a population of white adipocytes, a population of brown adipocytes, or a population of marrow adipocytes. White adipocytes and adipose tissue are most abundant in mammals and its distribution greatly varies among different species. White adipose is generally found in subcutaneous adipose tissue that is directly underneath the skin or in the intra-abdominal adipose tissue that surrounds the organs inside the abdomen such as intestine and kidneys. Brown adipocytes are dispersed within the white adipose tissue. The role of white adipose tissue is to store lipids, and it is associated with obesity. Brown adipose tissue is involved in the maintenance of body temperature, energy balance and glucose metabolism. In some embodiments, a multivalent linker provided herein targets white adipose cells or tissues, brown adipose cells or tissues, marrow adipose cells or tissues, or any combination thereof. In some embodiments, a multivalent linker provided herein directs a composition provided herein to subcutaneous fat cells or tissue. In some embodiments, the multivalent linker improves the binding specificity of the siRNA to a target tissue by about 0.5 fold to about 10 fold, such as about 0.3 fold, about 0.8 fold, about 1 fold, about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, and about 10 fold as compared to the siRNA without the multivalent linker.
[0080] In some embodiments, the multivalent linker provided herein selectively targets sitespecific adipose tissue. In some embodiments, the multivalent linker provided herein specifically directs to visceral adipose tissue. In some embodiments, the multivalent linker provided herein specifically directs to subcutaneous adipose tissue. In some embodiments, the multivalent linker provided herein specifically directs to ectopic fat deposits that are outside normal adipose depots, such as intramuscular fat, hepatic fat, myocardial fat, pancreatic fat. In some embodiments, the multivalent linker provided herein specifically directs to adipose tissue or preadipocyte associated with pathogenesis of a disease or condition. In some embodiments, the multivalent linker provided herein does not direct to brown adipose tissue. In some embodiments, the multivalent linker provided herein specifically directs to preadipocyte or beige fat and favors the differentiation of the preadipocyte to brown adipose tissue, thereby shifting the population of adipocyte and favoring brown fat depot. In some embodiments, a multivalent linker provided herein directs a composition provided herein to cell that expresses leptin, Hoxc8, Hoxc9, adiponectin, serpina3k, Wdnml-like, ASCI ANGPLT4, or any combination thereof.
[0081] In some embodiments, a multivalent linker described herein has a size in a range of from 100 Da to 20,000 Da, from 1,000 Da to 20,000 Da, from 2,000 Da to 15,000 Da, from 2,000 Da to 12,000 Da, from 2,000 Da to 10,000 Da, from 2,000 Da to 8,000 Da, from 2,000 Da to 5,000 Da, from 5,000 Da to 20,000 Da, from 5,000 Da to 15,000 Da, from 5,000 Da to 12,000 Da, from 5,000 Da to 10,000 Da, from 5,000 Da to 8,000 Da, from 8,000 Da to 20,000 Da, from 8,000 Da to 15,000Attomey Docket No. 229670-701601Da, from 8,000 Da to 12,000 Da, from 8,000 Da to 10,000 Da, from 10,000 Da to 20,000 Da, from 10,000 Da to 15,000 Da, from 10,000 Da to 12,000 Da, from 12,000 Da to 20,000 Da, from 12,000 Da to 15,000 Da, or from 15,000 Da to 20,000 Da.
[0082] In some embodiments, a multivalent linker comprises a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof. In some embodiments, a multivalent linker comprises a polymer, wherein the polymer is a tetra-ethylene glycol. In some embodiments, a multivalent linker comprises a polynucleotide, wherein the polynucleotide comprises one or more modifications. In some embodiments, a multivalent linker comprises a polynucleotide, wherein the polynucleotide comprises one or more XNA modifications.
[0083] GalNAc binds to Ashwell-Morell receptor (ASGPR) occurs at the sinusoidal surface of the hepatocyte and thereby, initiates endocytosis of GalNAc conjugated polynucleotides. Example 4 of US20210170034A1 is incorporated herein by reference which clearly shows that GalNAc conjugated miR-122 inhibitor treatment significantly reduced HCV viral titer in human chimeric liver mouse model of HCV infection. Accordingly, in some embodiments, GalNAc can be used as a multivalent linker for directing the multivalent polynucleotide constructs to hepatocytes. In some embodiments, the multivalent linker comprises a GalNAc linker at the 3’ end of the sense strand. In some embodiments, the siRNA comprises a GalNAc linker at the 5’ end of the sense strand. In some embodiments, the siRNA comprises a GalNAc linker at the 3’ end of the antisense strand. In some embodiments, the siRNA comprises an internal GalNAc linker at either the sense strand or the antisense strand. In some embodiments, the GalNAc linker links the polynucleotides together. In some embodiments, the GalNAc linker links the moieties with the polynucleotides. In some embodiments, the GalNAc linker increases the delivery efficiency of the polynucleotides to liver. In some embodiments, the GalNAc linker is further conjugated to one or more moieties described herein.
[0084] Cyclic peptide CKGGRAKDC (SEQ ID NO: 8164), which is a ligand for prohibitin, selectively selective accumulation in subcutaneous fat tissue (e.g., adipose tissue). Accordingly, in some embodiments, cyclic peptide CKGGRAKDC (SEQ ID NO: 8164)can be used as the multivalent linker for directing the multivalent polynucleotide constructs to adipose tissues. In some embodiments, the multivalent linker comprises the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164)linker at the 3’ end of the sense strand. In some embodiments, the siRNA comprises the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker at the 5’ end of the sense strand. In some embodiments, the siRNA comprises the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker at the 3’ end of the antisense strand. In some embodiments, the siRNA comprises an internal the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker at either the sense strand or the antisenseAttomey Docket No. 229670-701601 strand. In some embodiments, the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker links the polynucleotides together. In some embodiments, the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164)linker links the moieties with the polynucleotides. In some embodiments, the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker increases the delivery efficiency of the polynucleotides to adipose tissues. In some embodiments, the cyclic peptide CKGGRAKDC (SEQ ID NO: 8164) linker is further conjugated to one or more moieties described herein.
[0085] Exemplary multivalent linkers that facilitate delivery to adipocytes are described in TABLE 1 (structure no. 1-1 to 1-41), TABLE 2 (structure no. 11-1 to 1-34), TABLE 3 (structure no. Ill- 1 to 1-49), TABLE 4 (structure no. IV-1 to IV-3), TABLE 5 (structure no. VI-1 to VI-17), TABLE 6 (structure no. VIL1 to VIL17), and TABLE 7 (structure no. VIII-1 to VIII-20) of WO2018191719A1, and are incorporated by reference herein. Example 4 specifically discloses use of nanoparticles containing compound 1-6 for targeted delivery of oligonucleotide to adipocytes. Accordingly, multivalent linkers comprising any one of the structures described in TABLE 1 (structure no. 1-1 to 1-41), TABLE 2 (structure no. 11-1 to 1-34), TABLE 3 (structure no. III-l to 1-49), TABLE 4 (structure no. IV-1 to IV-3), TABLE 5 (structure no. VI- 1 to VI- 17), TABLE 6 (structure no. VII- 1 to VIL17), and TABLE 7 (structure no. VIILl to VIII-20) of WO2018191719A1 can be used for targeted delivery of multivalent polynucleotide constricts to adipocytes.
[0086] In some embodiments, the multivalent linker comprises a carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl 1, C12, C13, C14, C15, C16, C17, C18, C19 and C20). In some embodiments, the multivalent linker comprises a carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) at the 3’ end of the sense strand. In some embodiments, the siRNA comprises a carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) at the 5’ end of the sense strand. In some embodiments, the siRNA comprises a carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) at the 3’ end of the antisense strand. In some embodiments, the siRNA comprises an internal carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) attached to either the sense strand or the antisense strand. In some embodiments, the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) comprises an amino modifier and an amino modifier spacer. In some embodiments, the amino modifier spacer is coupled to the 5’ end of the siRNA. In some embodiments, the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) links the polynucleotides together. In some embodiments, the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, Cl 6, Cl 7, Cl 8, C19 and C20) links the moieties with the polynucleotides. In some embodiments,Attomey Docket No. 229670-701601 the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) links the GalNAc moi eties to the polynucleotides to increase the delivery efficiency of the polynucleotides. In some embodiments, the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) is further conjugated to one or more moi eties described herein. In some embodiments, the carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) is further conjugated to DCA. In some embodiments, the carbon chain linker (e.g, C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20) is further conjugated to cholesterol.
[0087] In some embodiments, the multivalent linker comprises a C12 linker at the 3’ end of the sense strand. In some embodiments, the siRNA comprises a C12 linker at the 5’ end of the sense strand. In some embodiments, the siRNA comprises a C12 linker at the 3’ end of the antisense strand. In some embodiments, the siRNA comprises an internal C12 linker at either the sense strand or the antisense strand. In some embodiments, the C12 linker comprises an amino modifier and an amino modifier spacer. In some embodiments, the amino modifier spacer is coupled to the 5’ end of the siRNA. In some embodiments, the C12 linker links the polynucleotides together. In some embodiments, the C12 linker links the moieties with the polynucleotides. In some embodiments, the C12 linker links the GalNAc moieties to the polynucleotides. In some embodiments, the C12 linker is further conjugated to one or more moieties described herein. In some embodiments, the C12 linker is further conjugated to DCA. In some embodiments, the C12 linker is further conjugated to GalNAc. In some embodiments, the C12 linker is further conjugated to cholesterol.
[0088] In some embodiments, the multivalent linker comprises a hexamethylene succinimide (HMS) linker. In some embodiments the HMS linker is modified. In some embodiments, the modified HMS is Choi- HMS. In some embodiments, the HMS linker links the polynucleotides together. In some embodiments, the HMS linker links the moieties with the polynucleotides. In some embodiments, the HMS linker links the cholesterol moieties to the polynucleotides. In some embodiments, the HMS linker links the GalNAc moieties to the polynucleotides.
[0089] In some embodiments, the multivalent linker comprises a triethylene glycol (TEG) linker. In some embodiments the TEG linker is modified. In some embodiments, the modified TEG is Chol-TEG. In some embodiments, the TEG linker links the polynucleotides together. In some embodiments, the TEG linker links the moieties with the polynucleotides. In some embodiments, the TEG linker links the cholesterol moieties to the polynucleotides. In some embodiments, the TEG linker links the GalNAc moieties to the polynucleotides.
[0090] In some embodiments, a multivalent linker comprises a polynucleotide, wherein the polynucleotide comprises one or more modifications. In some embodiments, a modification is an XNA modification.Attomey Docket No. 229670-701601
[0091] In some embodiments, the multivalent linkers described herein are cleavable linkers. In some embodiments, the cleavable linkers are stable outside the target cells. In some embodiments, the cleavable linkers undergo cleavage reaction upon entry into the target cells. In some embodiments, linkers described herein comprise an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. In such embodiments, liver specificity can be further enhanced by conjugating the multivalent siRNAs described herein with liver targeting moieties (e.g, cationic lipids). In some embodiments, the cleavable linkers comprise enzymatically cleavable linkers (e.g., peptide linkers). In some embodiments, the cleavable linkers comprise linkers that undergo cleavage reaction under reducing conditions (e.g., disulfide linkers). In some embodiments, the cleavable linkers comprise linkers that undergo cleavage reaction under acidic conditions (e.g., hydrazones and carbonates). In some embodiments, the cleavable linkers comprise phosphatase cleavable linkers, wherein the cleavable linkers comprise phosphate-based cleavable linking groups (e.g, - O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, - S-P(O)(OH)-S-, -O-P(S)(OH) -S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S- P(O)(H)-O-, -S-P(S)(H)-O-, -S-P(O)(H)-S-, -O-P(S)(H)-S-.Moieties
[0092] Provided herein are compositions and systems comprising at least two polynucleotides provided herein that are connected to each other by a multivalent linker provided herein, and at least one moiety. In some embodiments, a moiety comprises a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof. In some embodiments, a moiety can improve transport to a target site, hybridization to a target nucleotide, specificity to a target site, resistance to nuclease, or combinations thereof. Accordingly, in some embodiments, a moiety provided herein facilitates transport of compositions or systems provided herein to a target site. In some embodiments, a moiety provided herein protects compositions and systems provided herein from degradation. For example, in some embodiments, a moiety protects a polynucleotide of compositions and systems described herein from degradation by exonuclease.
[0093] In some embodiments, a moiety is attached to a 3’ or 5’ end of a polynucleotide provided herein. In some embodiments, a moiety is directly attached to a 3’ or 5’ end of a polynucleotide provided herein. In some embodiments, a moiety is indirectly attached to a 3’ or 5’ end of a polynucleotide provided herein. In some embodiments, a moiety is directly attached to a multivalent linker, wherein the multivalent linker directly or indirectly connects two polynucleotides as provided herein. In some embodiments, a moiety is indirectly attached to aAttomey Docket No. 229670-701601 multivalent linker, wherein the multivalent linker directly or indirectly connects two polynucleotides as provided herein. In some embodiments, a moiety comprises a nucleic acid, an siRNA, a lipid, a polypeptide, a sugar or an antibody.
[0094] In some embodiments, a moiety comprises a lipid, wherein the lipid comprises cholesterol, myristoyl, palmitoyl, stearoyl, lithocholoyl, docosanoyl, docosahexaenoyl, myristyl, palmityl stearyl, or a-tocopherol, or a combination thereof. In some embodiments, a lipid comprises a fatty acid. Altering fatty acid valency can impact the hydrophobicity of the composition provided herein, resulting in different clearance profiles. For example, lipid-conjugated siRNAs selectively accumulate more in one or more of liver and adipose tissue relative to lung, heart, or fat. In some embodiments, a lipid can also include a naturally occurring substance (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); amino acid, or a lipid. A tissue targeting moiety that comprises a lipid may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L- glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. In some embodiments, a moiety comprises a sugar, wherein the sugar comprises an N-acetylgalactosamine (GalNAc) amino sugar or a derivative thereof. In some embodiments, a moiety described herein comprises a hydrophobic acid, such as a docosanoic acid (DCA), unsaturated fatty acids docosahexaenoic acid (DHA, 22:6 n-3) and eicosapentaenoic acid (EP A, 20:5 n-3); the saturated fatty acid docosanoic acid (DCA, 22:0); the sterols cholesterol (Choi) and lithocholic acid (LA); and the vitamins retinoic acid (RA) and a-tocopheryl succinate (TS). In some embodiments, a moiety described herein comprises a phosphocholine (PC)-lipid, such as a PC- DCA, a PC-DHA, a PC-EPA, a PC-Chol, a PC-LA, a PC-RA, a PC-TS. In some embodiments, the PC lipids increase liver and / or adipose tissue targeting by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%. In some embodiments, a moiety described herein is a naturally occurring lipid. In some embodiments, a moiety described herein is a synthetic lipid.
[0095] In some embodiments, a moiety comprises a ligand. Ligands, in general, can include therapeutic modifiers (e.g., for enhancing uptake); diagnostic compounds or reporter groups (e.g., for monitoring distribution); cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophiles, lipids, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes (e.g., sarsasapogenin, Friedelin, epifriedelanolAttomey Docket No. 229670-701601 derivatized lithocholic acid)), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics. Examples of polyamines include but are not limited to: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. In some embodiments, a peptide or a protein is modified, including a peptidylmimetic, invertomers, nonpeptide or pseudo-peptide linkages, and use of D-amino acids. In some embodiments, a moiety comprises a tat or antennopedia.
[0096] In some embodiments, a moiety comprises a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, glycosylated polyarninoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of moieties include dyes, intercalating agents (e.g. acridines and substituted acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrenes), lys-tyr-lys tripeptide, aminoglycosides, guanidium aminoglycodies, artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, cholesterol (and thio analogs thereof), cholic acid, cholanic acid, lithocholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, e.g., CIO, Cu, Cl 2, Cn, Cl 4, Cis, Cl 6, C17, Cis, Cl 8, Cl 9, C20, or C22 fatty acids) and ethers thereof, e.g., CIO, Cu, C12, Cn, C14, Cis, C16, C17, Cis, C18 C19, C20, or C22 alkyl; e.g., 1,3-bis- O(hexadecyl)glycerol, l,3-bis-O(octadecyl)glycerol), geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), triethyl glycol (TEG), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridineimidazole conjugates, EuH complexes of tetraazamacrocycles), dinitrophenyl, HRP or AP.
[0097] In some embodiments, a moiety provided herein comprises a hydrophobic fatty acid that enhance the interaction between polynucleotides and cell membranes, promoting direct transmembrane transport. In some embodiments, the moiety provided herein comprises a long-Attomey Docket No. 229670-701601 chain fatty acids that can interact with intracellular proteins, such as serum albumin or lipoproteins, or oligopeptides to extend the half-life of the siRNA in plasma by about several days to several weeks, e.g. 1 day, 2 days, 4 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, or 10 weeks, thereby reducing renal clearance. In some embodiments, the moiety provided herein comprises a long-chain fatty acids that increase the delivery efficiency of siRNA to various tissues, e.g. adipose tissue, liver, muscle, heart, brain, kidney, skin, connective tissue, by about 5% to about 500%, e.g. about 20%, about 50%, about 90%, about 150%, about 200%, about 300%, about 400%, and about 500%.
[0098] In some embodiments, a moiety provided herein comprises ionizable cationic lipid. In some embodiments, systems and compositions described herein comprise lipid nanoparticles comprising ionizable lipid, phospholipid, cholesterol, and PEGylated lipid.
[0099] A moiety provided herein can comprise a protein or a peptide. In some embodiments, the protein comprises a glycoprotein. For example, molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as an adipose cell. A moiety can also include hormones and hormone receptors. In some embodiments, a moiety comprises non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl- galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. A moiety can comprise, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF -KB. In some embodiments, a moiety comprises a peptidomimetic. A peptidomimetic (also referred to as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and / or peptidomimetics to the RNA polynucleotide provided herein can affect pharmacokinetic distribution of the RNA polynucleotide, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. The peptide moiety can be an L-peptide or D- peptide. In some embodiments, the peptide moiety comprises a hydrophobic membrane translocation sequence (MTS). A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead- one-compound (OBOC) combinatorial library. In some embodiments, the peptide or peptidomimetic is tethered to the RNA polynucleotide provided herein via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 aminoAttomey Docket No. 229670-701601 acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties.
[0100] A moiety provided herein can comprise a drug, such as a small molecule, which can increase the uptake of the RNA polynucleotide into a cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. In some embodiments, a moiety comprises a cell-permeation agent, for example, a helical cell-permeation agent.
[0101] In some embodiments, a moiety provided herein comprises a tissue targeting moiety. In some embodiments, a tissue targeting moiety comprises a liver targeting moiety, an adipose tissue targeting moiety, a muscle tissue targeting moiety or a combination thereof. In some embodiments, a tissue targeting moiety comprises a liver targeting moiety, an adipose tissue targeting moiety, or a combination thereof. In some embodiments, a tissue targeting moiety comprises a liver targeting moiety. In some embodiments, a tissue targeting moiety comprises an adipose tissue targeting moiety. In some embodiments, a tissue targeting moiety comprises an adipose tissue targeting moiety, wherein the adipose tissue is associated with one or more of liver, intestine, kidney and peritoneum. In some embodiments, a tissue targeting moiety comprises a muscle tissue targeting moiety. In some embodiments, a tissue targeting moiety comprises an adipose tissue targeting moiety associated with a muscle tissue. In some embodiments, an adipose tissue targeting moiety provided herein target a white adipose tissue, a brown adipose tissue, or combination thereof.
[0102] In some embodiments, a liver targeting moiety comprises a cationic lipid. In some embodiments, a liver targeting moiety is connected to an siRNA or a multivalent linker via an ester group. Accordingly, in some embodiments, a liver targeting moiety comprises a cationic lipid that is connected to an siRNA or a multivalent linker via an ester group. In some embodiments, a cationoic lipid is selected from N,N-dioleyl-N,N-dimethylammonium chloride (DODAC); N,N- distearyl-N,N-dimethylammonium bromide (DDAB); N-(I-(2,3-dioleoyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTAP); N-(I-(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA); N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA); l,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA); 1,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLenDMA); l,2-Dilinoleylcarbamoyloxy-3 -dimethylaminopropane(DLin-C-DAP); 1,2-Dilinoley oxy-3- (dimethylamino)acetoxypropane (DLin-DAC); 1,2- Dilinoley oxy-3 -morpholinopropane (DLin-MA); l,2-Dilinoleoyl-3 -dimethylaminopropane(DLinDAP); l,2-Dilinoleylthio-3 -dimethylaminopropane (DLin-S-DMA); l-Linoleoyl-2- linoleyloxy-3 -dimethylaminopropane (DLin-2-DMAP); 1, 2-Dilinoleyl oxy-3 -Attomey Docket No. 229670-701601 trimethylaminopropane chloride salt (DLin-TMA.Cl); l,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl); l,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ); or 3-(N,N-Dilinoleylamino)-l,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-l,2-propanedio (DOAP); l,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA); 1,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA); 2,2- Dilinoleyl-4- dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA) or derivative thereof; (3aR,5s,6aS)-N,N- dimethyl-2,2-di((9Z, 12Z)-octadeca-9, 12-dienyl)tetrahydro-3aH- cyclopenta[d][l,3]dioxol-5- amine (ALNI 00); (6Z,9Z,28Z,3 lZ)-heptatriaconta-6,9,28,31-tetraen- 19-yl 4-(dimethylamino)butanoate (MC3); l,l'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2- hydroxydodecyl)amino)ethyl)piperazin-l-yl)ethylazanediyl)didodecan-2-ol (Tech Gl); or a combination thereof.
[0103] In some embodiments, the moieties provided herein linked to the siRNA at positions comprise 3’ end of the sense strand, 5’ end of the senses strand, 3’ end of the antisense strand, or internal of the sense strand or antisense strand. In some embodiments, the moieties comprise modifications that allows the incorporation of other therapeutic compounds or proteins.
[0104] In some embodiments, a moiety provided herein is linked to the sense strand at either end is equally effective and advantageous in removing the conjugated moiety when the sense strand is separated during RISC loading. In some embodiments, conjugation of a moiety described herein to the 3’ end of the antisense strand is less favored due to concerns that such an attachment may interfere with gene silencing activity. In some embodiments, conjugation of a moiety described herein to the 5’ end of the antisense strand is avoided due to its involvement in gene silencing activity. In some embodiments, DCA is linked to the sense strand at either end is equally effective and advantageous in removing the DCA when the sense strand is separated during RISC loading. In some embodiments, DCA conjugate at the 3’ end of the antisense strand is less favored due to concerns that such an attachment may interfere with gene silencing activity. In some embodiments, DCA conjugate at the 5’ end of the antisense strand is avoided due to its involvement in gene silencing activity.Target site
[0105] Provided herein are compositions and systems that are directed to a target site. In some embodiments, a target site is a liver. In some embodiments, a target site is an adipose tissue or adipocytes (adipose cells). In some embodiments, the adipose tissue comprises a population of white adipocytes, a population of brown adipocytes, or a population of marrow adipocytes. White adipocytes and adipose tissue is most abundant in mammals and its distribution greatly varies among different species. White adipose is generally found in subcutaneous adipose tissue that isAtorney Docket No. 229670-701601 directly underneath the skin or in the intra-abdominal adipose tissue that surrounds the organs inside the abdomen such as intestine and kidneys. Brown adipocytes are dispersed within the white adipose tissue. The role of white adipose tissue is to store lipids, and it is associated with obesity. Brown adipose tissue is involved in the maintenance of body temperature, energy balance and glucose metabolism. In some embodiments, compositions and systems provided herein target white adipose cells or tissues, brown adipose cells or tissues, marrow adipose cells or tissues, or any combination thereof. In some embodiments, compositions and systems provided herein target adipose tissues associated with liver. In some embodiments, compositions and systems provided herein target muscle tissues. In some embodiments, compositions and systems provided herein target muscle tissues associated with liver. In some embodiments, compositions and systems provided herein target adipose tissues associated with muscle tissues. In some embodiments, compositions and systems provided herein target subcutaneous fat cells or tissue. In some embodiments, compositions and systems provided herein target cells that express leptin, Hoxc8, Hoxc9, adiponectin, serpina3k, Wdnml-like, ASCI ANGPLT4, or any combination thereof.Target nucleotide
[0106] Provided herein are compositions and systems for silencing expression of a target nucleotide. In some embodiments, a target nucleotide comprises leptin, Hoxc8, Hoxc9, adiponectin, serpina3k, Wdnml-like, ASCI Angiopoi etin-like proteins (ANGPTLs), or any combination thereof.
[0107] Angiopoietin-like proteins (ANGPTLs) are a family of proteins structurally similar to the angiopoietins that regulate numerous physiological and pathophysiological processes, such as lipid and glucose metabolism, inflammation, hematopoiesis, and cancer. Eight ANGPTLs have been identified, namely ANGPTL1 to ANGPTL8. ANGPTL1-ANGTPL7 contain an amino-terminal coiled-coil domain, a linker region, and a carboxy -terminal fibrinogen-like domain. Angiopoietin- like protein 4 or ANGPTL4 is expressed in the liver, adipose tissue, brain, intestine, thyroid, kidney, and heart.
[0108] TABLE 2 provides an amino acid sequence of ANGPTL4.Table 2. Amino acid sequence of ANGPTL4Atorney Docket No. 229670-701601
[0109] In some embodiments, a target nucleotide comprises a nucleotide sequence, a portion thereof, or a fragment thereof, wherein the nucleotide sequence encodes an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1. Accordingly, in an siRNA provided herein hybridizes to at least a portion of a nucleotide sequence that encodes an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1.
[0110] ANGPTL4 is involved in a variety of functions, including lipoprotein metabolism and angiogenesis. ANGPTL4 serves as a potent inhibitor of the LPL enzyme, which hydrolyzes triglycerides from the apolipoprotein B - containing lipoproteins chylomicrons and VLDL. Through means of such a mechanism, ANGPTL4 suppresses the release of non-esterified fatty acids (NEFAs) and their subsequent uptake by underlying tissues, including adipose tissue, skeletal and cardiac muscle. Moreover, ANGPTL4 increases the intracellular lipolysis of triglycerides within adipocytes, thereby raising plasma NEFA concentrations. Genome wide studies in humans have shown that reduced expression of ANGPTL4 correlates with improvements across the metabolic spectrum and in diet induced obese mice results in reduced VLDL (“remnant cholesterol”), reduced plasma triglycerides, reduced ectopic lipid deposition and improved glucose tolerance. Knock out of ANGPTL4 was also shown to reduce waist:hip ratio in a genetic clinical model while sparing lean mass.[OHl] In some embodiments, provided herein is a 17 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is an 18 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 19 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 20 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 21 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 22 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 23 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 24 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, providedAttorney Docket No. 229670-701601 herein is a 25 mer siRNA that binds / hybridizes to a human ANGPTL4 mRNA. In some embodiments, provided herein is a 17 mer siRNA that binds to a non-human primate ANGPTL4 mRNA. In some embodiments, the siRNA binds with a human ANGPTL4 mRNA and has less than or equal to 20 human off-targets, with no more than 2 mismatches in the antisense strand. In some embodiments, siRNA binds with a human ANGPTL4 mRNA target site that does not harbor an SNP, with a minor allele frequency (MAF) greater or equal to 1% (pos.2-18).
[0112] Table 3 provides exemplary mRNA sequences that encodes angiopoi etin-like protein 4 (ANGPTL4) and variants thereof.Table 3. Exemplary mRNA sequences encoding ANGPTL4Atorney Docket No. 229670-701601Atorney Docket No. 229670-701601Atorney Docket No. 229670-701601Atorney Docket No. 229670-701601Atorney Docket No. 229670-701601Attorney Docket No. 229670-701601
[0113] In some embodiments, siRNAs provided herein targets a polynucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the mRNA sequences provided in Table 3. In some embodiments, siRNAs provided herein targets any one of the mRNA sequences provided in Table 3. Accordingly, in some embodiments, an siRNA provided herein hybridizes to at least a portion of a nucleotide sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the mRNA sequences provided in Table 3. In some embodiments, siRNAs described herein can bind / hybridize to at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides of any one of the sequences provided in Table 3.
[0114] Exemplary sense strands of siRNA sequences are provided in Table 4.Table 4. Exemplary sense strands of siRNA sequencesAtorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No.229670-701601Attorney Docket No. 229670-701601
[0115] In some embodiments, siRNAs provided herein comprises a sense strand, wherein the sense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 4. In some embodiments, siRNAs comprising any one of the sense strands targets an mRNA sequence that encodes an amino acid sequence of SEQ ID NO: 1. Accordingly, in some embodiments, an siRNA comprising a sense strand that is identical to at least a portion of a nucleotide sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the mRNA sequences provided in Table 3, wherein the sense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 4. In some embodiments, the sense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the SEQ ID NOs: 18-160, 304- 405, 712-2565, and 4420-6291.
[0116] Exemplary antisense strands of siRNA sequences are provided in Table 5.Table 5. Exemplary antisense strands of siRNA sequencesAtorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No.229670-701601Atorney Docket No. 229670-701601
[0117] In some embodiments, siRNAs provided herein comprises an antisense strand, wherein the antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 5. In some embodiments, siRNAs comprising any one of the antisense strands targets an mRNA sequence that encodes an amino acid sequence of SEQ ID NO: 1. Accordingly, in some embodiments, an siRNA comprising an antisense strand that hybridizes to at least a portion of a nucleotide sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the mRNA sequences provided in TableAttorney Docket No. 229670-7016013, wherein the antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 5. In some embodiments, the antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the SEQ ID NOs: 161-303, 406-507, 2566-4419, and 6292-8163
[0118] Further provided here are compositions comprising at least two modified siRNAs and a multivalent linker that directs the siRNAs to a target site, wherein the at least two modified siRNAs comprising a modified antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1) or a portion thereof. In some embodiments, the modification patterns of the sense strand of the siRNA comprises: mmMMMMFMFFFMMMMMMMmm2, wherein m refers to 2'-0Me 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and 2 refers to 2'-0Me-A. In some embodiments, the modification patterns of the sense strand of the siRNA comprises: fmFMFMFFFMFMFMFMFMfmM, mmMMFMFFFMMMMMMMMMmmM, mmMMFMFMFMMMMMMMMMmmM, fmFMFMFFFMFMFMFMFMfmM, mmMMFMFFFMMMMMMMMMmmM, or fmFMFMFMFMFMFMFMFMfmM , wherein m refers to 2'-0Me 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and f refers to 2'- fluoro 3'-phosphorothioate. In some embodiments, the modification patterns of the sense strand of the siRNA comprises: MMMMFFMFFMMMMMMMMMmmM,MMMMFFMFFMFMMMMMMMmmM, MMMMMMFMFMMMMMMMMMmmM,MMMMMFFMFMFMMMMMMMmmM, or MMMMMFFFFMMMMMMMMMmmM, wherein m refers to 2'-0Me 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and f refers to 2'-fluoro 3'-phosphorothioate. In some embodiments, the modification patterns of the antisense strand of the siRNA comprises 5fMMMFMMMMMMMFMFMMMMmmM, wherein 5 refers to 2'-0Me-U 3'-phosphorothioate, f refers to 2'-fluoro 3'-phosphorothioate, M refers to 2'- Ome, F refers to 2'-fluoro, m refers to 2'-0Me 3'-phosphorothioate. In some embodiments, the modification patterns of the antisense strand of the siRNA comprises mfMFMFMFMFMMMFMFMFmmM, mfMMMFMFFMMMMFMFMMmmM, mfMMMFMMMMMMMFMFMMmmM, mfMFMFMMMMMMMFMFMMmmM, mfMMMFMFMMMMMFMFMMmmM, mfMFMFMFMFMFMFMFMFmmM, mfMFMFMFMMMMMFMFMMmmM, mfMMMMMMMMMMMFMMMmmM, mfMMMFMMMMMMMFMFMFmmM, wherein m refers to 2'-0Me 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and f refers to 2'-fluoro 3'-phosphorothioate. In some embodiments, the modification patterns of the antisense strand of the siRNA comprisesAttomey Docket No. 229670-701601 mfMMMFMFMFMFMFMFMFmmM, mfmFMFMFMFMFMFMFMFmmM, mfMFMFMMMFMFMFMFMFmmM, or mfMFMFMMMMMFMFMFMFmmM, wherein m refers to 2'-OMe 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and f refers to 2'- fluoro 3'-phosphorothioate. In some embodiments, the modifications to the siRNA comprise a 2’- fluoro (F) modification, a 2'-fluoro 3'-phosphorothioate (f) modification, a 2'-OMe (M) modification, a 2'-OMe 3'-phosphorothioate (m) modification, a 2'-OMe-A (2) modification, a 2'- OMe-U 3'-phosphorothioate (5) modification, a 5'-vinyl-phosphonate ({vinP}) modification, a phosphorothioate linkage (s) modification, or a combination thereof.
[0119] In some embodiments, the modifications to the ANGPTL4 siRNA increase the ANGPTL4 knockdown efficiency by about 0.5 fold, about 1 fold, about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold as compared to the ANGPTL4 siRNA without modifications. In some embodiments, the modifications to the ANGPTL4 siRNA increase the ANGPTL4 knockdown efficiency by more than 10 fold as compared to the ANGPTL4 siRNA without modifications.
[0120] In some embodiments, the siRNAs described herein comprise one or more modification in sense strands and / or antisense strands. In some embodiments, the sense strands described herein comprise 21 nucleotides, wherein at least three of the positions selected from the group consisting of 7, 9, 10, and 11 (counting from the 5' end) comprise 2'-fluoro modifications. In some embodiments, the sense strands described herein comprise 21 nucleotides, wherein at least one of the internucleotide linkages between the positions 1 and 2, and positions 2 and 3 (counting from the 5' end) comprise phosphorothioate linkage. In some embodiments, the sense strands described herein comprise 21 nucleotides, wherein the sense strands comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more LNA modifications. In some embodiments, the sense strands described herein comprise 21 nucleotides, wherein at least one of the positions selected from the group consisting of 1, 2, and 3 (counting from the 5' end) comprise LNA modifications. In some embodiments, the antisense strands described herein comprise 23 nucleotides, wherein at least three of the positions selected from the group consisting of 2, 6, 8, 9, 14, and 16 (counting from the 5' end) comprise 2'- fluoro modifications. In some embodiments, the antisense strands described herein comprise 23 nucleotides, wherein at least one of the internucleotide linkages between the positions 1 and 2, and positions 2 and 3, positions 21 and 22, and positions 22 and 23 (counting from the 5' end) comprise phosphorothioate linkage. In some embodiments, the siRNAs described herein comprise at least one of the positions selected from the group consisting of 5, 6 or 7 of the duplex (counting from the 5' end) thermally destabilizing modification. In some embodiments, the siRNAs describedAttomey Docket No. 229670-701601 herein comprise two nucleotide overhang at the 3 '-end of the antisense strand, and a blunt end at the 5 '-end of the antisense strand.
[0121] In some embodiments, the siRNAs described herein comprise modified siRNAs. Accordingly, in some embodiments, a sense strand of the siRNA described herein comprise a modified sense strand. In some embodiments, the sense strand of the ANGPTL4 siRNA is modified and comprises a modifications pattern of “mmMMMMFMFFFMMMMMMMmm2” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'-phosphorothioate modification, and 2 refers to a 2'-OMe-A modification. For example, in some embodiments, the ANGPTL4 siRNA comprises a sense sequence of cacggcGaGUUcuggcuggga (SEQ ID NO 304), which can be modified according to the modifications pattern of “mmMMMMFMFFFMMMMMMMmm2” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'- phosphorothioate modification, and 2 refers to a 2'-OMe-A modification. In such embodiments, the modified sense sequence is csascggcGfaGfUfUfcuggcuggsgsa (SEQ ID NO: 508), wherein f refers to 2'-fluoro 3'-phosphorothioate modification; s refers to a phosphorothioate linkage modification. Another exemplary sense strand of the ANGPTL4 siRNA comprise a sequence of GAUCCUCACACGACUGUGAUC (SEQ ID NO: 8165), which can be modified according to the modifications pattern of “mmMMMMFMFFFMMMMMMMmm2” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, M refers to a 2'-OMe modification, m refers to a 2'-0Me 3'- phosphorothioate modification, and 2 refers to a 2'-OMe-A modification. In such embodiments, the modified sense sequence is gsasuccuCfaCfAfCfgacugugasusa (SEQ ID NO: 8166), wherein f refers to 2'-fluoro 3 '-phosphorothioate modification; s refers to a phosphorothioate linkage modification. Similarly, in some embodiments, any one of the sense strands of TABLE 3 can be modified according to the modifications pattern of “mmMMMMFMFFFMMMMMMMmm2” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, M refers to a 2'-0Me modification, m refers to a 2'-0Me 3 '-phosphorothioate modification, and 2 refers to a 2'-0Me-A modification. In some embodiments, any one of the sense strands of SEQ ID NOs: 18-160, 304-405, 712-2565, and 4420-6291 can be modified according to the modifications pattern of “m m M MM MF MF FF MM MM MM Mm m2” from the 5’ to 3’, wherein F refers to a 2' -fluoro modification, M refers to a 2'-0Me modification, m refers to a 2'-0Me 3 '-phosphorothioate modification, and 2 refers to a 2'-0Me-A modification. Additional exemplary modified sense strands of siRNA sequences are provided in Table 6.Atorney Docket No. 229670-701601Attorney Docket No. 229670-701601* a, c, g, and u represent 2'-0-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; f represents 2'-fluoro 3'-phosphorothioate modification; s represents a phosphorothioate linkage modification
[0122] In some embodiments, siRNAs provided herein comprises a modified sense strand, wherein the modified sense strand comprises a nucleotide sequence that is at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 6. In some embodiments, siRNAs comprising any one of the modified sense strands targets an mRNA sequence that encodes an amino acid sequence of SEQ ID NO: 1. In some embodiments, the modified sense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the SEQ ID NOs: 508-609.Attorney Docket No. 229670-701601
[0123] In some embodiments, the siRNAs described herein comprise modified siRNAs. Accordingly, in some embodiments, an antisense strand of the siRNA described herein comprises a modified antisense strand. In some embodiments, the antisense strand of the ANGPTL4 siRNA is modified and comprises a modifications pattern of “5fMMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3'-phosphorothioate modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'-phosphorothioate modification, and 5 refers to a 2'-OMe-U 3'-phosphorothioate modification. For example, in some embodiments, the ANGPTL4 siRNA comprises an antisense sequence of uCccaGccagaacUcGccguggg (SEQ ID NO: 406), which can be modified according to the modifications pattern of “5f\FMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3'-phosphorothioate modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'-phosphorothioate modification, and 5 refers to a 2'-OMe-U 3'-phosphorothioate modification. In such embodiments, the modified antisense sequence is {vinPJusCfsccaGfccagaacUfcGfccgugsgsg (SEQ ID NO: 610), wherein {vinP} refers to a 5'- vinyl-phosphonate modification, f refers to 2'-fluoro 3'-phosphorothioate modification, and s refers to a phosphorothioate linkage modification. Another exemplary antisense strand of the ANGPTL4 siRNA comprise a sequence of GAUCACAGUCGUGUGAGGAUCCG (SEQ ID NO: 8167), which can be modified according to the modifications pattern of “5f\FMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3 '-phosphorothioate modification, M refers to a 2'-0Me modification, m refers to a 2'-0Me 3 '-phosphorothioate modification, and 5 refers to a 2'-0Me-U 3 '-phosphorothioate modification. In such embodiments, the modified antisense sequence is {vinPJusAfsucaCfagucgugUfgAfggaucscsg (SEQ ID NO: 8168), wherein {vinP} refers to a 5'- vinyl-phosphonate modification, f refers to 2'-fluoro 3 '-phosphorothioate modification, and s refers to a phosphorothioate linkage modification. Similarly, in some embodiments, any one of the antisense strands of TABLE 5 can be modified according to modifications pattern of “5f\FMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3 '-phosphorothioate modification, M refers to a 2'-0Me modification, m refers to a 2'-0Me 3 '-phosphorothioate modification, and 5 refers to a 2'-0Me-U 3 '-phosphorothioate modification. In some embodiments, any one of the antisense strands of SEQ ID NOs: 161-303, 406-507, 2566-4419, and 6292-8163 can be modified according to modifications pattern of “51MMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3 '-phosphorothioate modification, M refers to a 2'-0Me modification, m refers to a 2'-0Me 3'-phosphorothioate modification, and 5Attorney Docket No. 229670-701601 refers to a 2'-0Me-U 3'-phosphorothioate modification. Additional exemplary modified antisense strands of siRNA sequences are provided in Table 7.Table 7. Exemplary modified antisense strands of siRNA sequencesAtorney Docket No.229670-701601Atorney Docket No. 229670-701601* a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; {vinP} represents a 5'-vinyl-phosphonate modification; f represents 2'-fluoro 3'-phosphorothioate modification; s represents a phosphorothioate linkage modification
[0124] In some embodiments, siRNAs provided herein comprises a modified antisense strand, wherein the modified antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 7. In some embodiments, siRNAs comprising any one of the modified antisense strands targets an mRNA sequence that encodes an amino acid sequence of SEQ ID NO: 1. Accordingly, in some embodiments, an siRNA comprising a modified antisense strand that hybridizes to at least a portion of a nucleotide sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the mRNA sequences provided in Table 3, wherein the modified antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the sequences provided in Table 7. In some embodiments, the modified antisense strand comprises a nucleotide sequence that is at least at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of SEQ ID NOs: 610-711.
[0125] In some embodiments, the siRNAs in Tables 4-7 comprise at least one, such as one, two, three, four, five, six, seven, eight, nine or ten mismatches without affecting the activity or efficacy of the siRNA. In some embodiments, the at least one mismatch is at the 3’ end, 5’ end, or both. In some embodiments, the at least one mismatch in between the 3’ end and 5’ end.Compositions and Systems
[0126] Provided herein are compositions and systems comprising at least two polynucleotides provided herein that are connected to each other by a multivalent linker provided herein. Accordingly, in some embodiments, compositions and systems provided herein comprises at least two siRNAs connected to each other by a multivalent linker. Alternatively, in some embodiments, compositions and systems provided herein comprises at least two siRNAs connected to each otherAttomey Docket No. 229670-701601 by a multivalent linker, wherein at least one of the at least two siRNAs is a modified siRNA. In some embodiments, the compositions and systems comprise a bivalent siRNA conjugate. In some embodiments, the compositions and systems comprise a trivalent siRNA conjugate. In some embodiments, the compositions and systems comprise a siRNA conjugate. In some embodiments, the compositions and systems comprise a siRNA and an antisense polynucleotide (ASO) conjugate. In some embodiments, the compositions and systems comprise a siRNA and ASO conjugate, wherein the siRNAs and the ASOs are connected through a multivalent linker.
[0127] In some embodiments, provided herein are siRNA compositions and systems comprising novel backbone chemistry for enhanced durability and potency, cleavable lipophilic engineered tether for selective delivery and multiplexing, and glycosylated peptide conjugation assisting adipose tissue delivery. In some embodiments, the composition and systems comprise multivalent linkers comprising a carbon chain linker (e.g., C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19 and C20).
[0128] In some embodiments, a modified siRNA advantageously increases in vivo stability of compositions and systems provided herein relative to a corresponding composition or system comprising unmodified siRNAs. In some embodiments, a modified siRNA advantageously increases in vivo half-life of compositions and systems provided herein by about 5%, about 10%, about 15%, about 20%, about 50%, about 80%, about 100% or more relative to a corresponding composition or system comprising unmodified siRNAs. In some embodiments, a modified siRNA provided herein comprises one or more modified inter-nucleoside linkages. In some embodiments, a modified inter-nucleoside linkage is according to Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII as provided herein. In some embodiments, compositions and systems provided herein advantageously reduce adverse reaction relative to a corresponding composition or system comprising unmodified siRNAs.
[0129] In some embodiments, provided herein are compositions and systems provided herein comprises at least two siRNAs connected to each other by a multivalent linker, wherein the at least two siRNAs are the same siRNA targeting the same gene expressed in different tissue. In some embodiments, the at least two siRNAs target two different genes from the same tissue. In some embodiments, the at least two siRNAs target two different genes from different tissues, including adipose tissue, liver tissue, muscle, kidney, lung, spleen, heart, skin, connective tissue, and brain In some embodiments, the compositions or systems with at least two siRNAs surprisingly achieve better multiplex silencing effects, such as about 1 fold, about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold increase in target gene knockdown, as compared to the composition or system with a single siRNA or with two combined corresponding siRNAs.Attomey Docket No. 229670-701601
[0130] In some embodiments, the at least one of the at least two siRNAs comprises an ANGPTL4 siRNA. In some embodiments, the ANGPTL4 siRNA comprises an unmodified sense strand in Table 4, unmodified antisense strand in Table 5, a modified sense strand in Table 6, or a modified antisense strand in Table 7. In some embodiments, the at least one of the at least two siRNAs comprise at least 85% sequence identify to an unmodified sense strand in Table 4, unmodified antisense strand in Table 5, a modified sense strand in Table 6, or a modified antisense strand in Table 7. In some embodiments, the at least one of the at least two siRNAs comprise 90% sequence identify to an unmodified sense strand in Table 4, unmodified antisense strand in Table 5, a modified sense strand in Table 6, or a modified antisense strand in Table 7. In some embodiments, the at least one of the at least two siRNAs comprises 95% sequence identify to an unmodified sense strand in Table 4, unmodified antisense strand in Table 5, a modified sense strand in Table 6, or a modified antisense strand in Table 7. In some embodiments, the at least one of the at least two siRNAs comprises 98% sequence identify to a unmodified sense strand in Table 4, unmodified antisense strand in Table 5, a modified sense strand in Table 6, or a modified antisense strand in Table 7
[0131] In some embodiments, the ANGPTL4 siRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise a 17mer, a 18mer, a 19mer, a 20mer, a 21mer, a 22mer, a 23mer, a 24mer, a 25mer sequence. In some embodiments, the ANGPTL4 siRNA sense strand comprises 0, 1, 2, or 3 nucleotide substitutions, additions, or deletions relative to any one of SEQ ID NOs: 18-160, 304-405, 712-2565, and 4420-6291. In some embodiments, the ANGPTL4 siRNA antisense strand comprises 0, 1, 2, or 3 nucleotide substitutions, additions, or deletions relative to any one of SEQ ID NOs: 161-303, 406-507, 2566- 4419, and 6292-8163. In some embodiments, the modified ANGPTL4 siRNA sense strand comprises 0, 1, 2, or 3 nucleotide substitutions, additions, or deletions relative to any one of SEQ ID NOs: 508-609. In some embodiments, the modified ANGPTL4 siRNA antisense strand comprises 0, 1, 2, or 3 nucleotide substitutions, additions, or deletions relative to any one of SEQ ID NOs: 610-711. In some embodiments, the ANGPTL4 siRNA provided herein comprises species cross-reactivity for human, monkey, mouse, rat, and other subject provided herein.
[0132] In some embodiments, the sense strand of the ANGPTL4 siRNA comprises sequence that is 21mer in length. In some embodiments, the sense strand of the ANGPTL4 siRNA is modified and comprises a modifications pattern of “mmMMMMFMFFFMMMMMMMmm2” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'-phosphorothioate modification, and 2 refers to a 2'-OMe-A modification. In some embodiments, the antisense strand of the ANGPTL4 siRNA comprises sequence that is 23mer in length. In some embodiments, the antisense strand of the ANGPTL4 siRNA is modified andAttomey Docket No. 229670-701601 comprises a modifications pattern of “5fMMMFMMMMMMMFMFMMMMmmM” from the 5’ to 3’, wherein F refers to a 2'-fluoro modification, f refers to a 2'-fluoro 3'-phosphorothioate modification, M refers to a 2'-OMe modification, m refers to a 2'-OMe 3'-phosphorothioate modification, and 5 refers to a 2'-OMe-U 3'-phosphorothioate modification.
[0133] In some embodiments, the modification increases ANGPTL4 siRNA gene silencing or knockdown efficiency. In some embodiments, the ANGPTL4 siRNA exhibits a median effective dose (EDso) level of about 0.2 mg / kg, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8 about 0.9, about 1, about 1.5, about 2 mg / kg following a single dose of injection.
[0134] In some embodiments, the antisense and the sense strand have the same length. In some embodiments, the antisense and the sense strand have different length. In some embodiments, both the antisense and the sense strand are 19mer in length. In some embodiments, the sense strand of the 19mer siRNA have a sequence set forth in SEQ ID NO: 712 to SEQ ID NO: 2565. In some embodiments, the antisense strand of the 19mer siRNA have a sequence set forth in SEQ ID NO: 2566 to SEQ ID NO: 4419 In some embodiments, the sense strand of the 19mer siRNA have a replacement of position 19 to “A” at the 3’ end of any one of the sequences set forth in SEQ ID NO: 712 to SEQ ID NO: 2565. In some embodiments, the antisense strand of the 19mer siRNA have a replacement of position 1 to “U” at the 5’ end of any one of the sequences set forth in SEQ ID NO: 2566 to SEQ ID NO: 4419 In some embodiments, sense strand is 19mer in length and the antisense strand is 23mer in length. In some embodiments, the ANGPTL4 siRNA matches the target ANGPTL4 mRNA by 100% to about 85%. In some embodiments, the ANGPTL4 siRNA completely matches the target sequence. In some embodiments the ANGPTL4 siRNA has a 95% match of the target sequence. In some embodiments the ANGPTL4 siRNA has a 90% match of the target sequence. In some embodiments the ANGPTL4 siRNA has an 85% match of the target sequence. In some embodiments, the 5’ end of the antisense strand of the ANGPTL4 siRNA comprise a mismatch to the target sequence. In some embodiments, the sense strand of the ANGPTL4 siRNA is about 85% to 100% complementary to the antisense strand of the ANGPTL4 siRNA, e.g. about 85%, about 90%, about 95%, about 98%, and 100%. In some embodiments, the ANGPTL4 siRNA binds to a region of mRNA of ANGPTL4 comprising an SNP. In some embodiments, the SNP is located at the exon, intron, or other non-coding region of the ANGPTL4 gene.
[0135] In some embodiments, the at least one of the at least two siRNAs is directed to mRNA of genes comprising PCSK9, LPA, APOC3, HAO1, ALAS1, SERPINA1, DGAT2, fatty acid synthase (FASN), osteopontin (OPN), N0X4, nuclear receptor interacting protein 1 (Nripl), RIP 140, and HSD17B13. In some embodiments, at least one of the at least two siRNAs targets Dgat2 and inhibits the expression of Dgat2 in both adipose tissue and liver tissue. In someAttomey Docket No. 229670-701601 embodiments, at least one of the at least two siRNAs targets RIP 140 and inhibits the expression of Dgat2 in adipose tissue, resulting in increased energy expenditure by lowering body weight and adiposity, reducing liver steatosis, and improving glucose metabolism. In some embodiments, the divalent siRNAs with linkers provided herein and / or additional moieties provided herein achieve superior gene silencing potency across various fat depositions, such as subcutaneous fat, perigonadal fat, perirenal fat, abdominal fat, ectopic fat but not in other tissues as compared to the monovalent siRNA with or without moieties. In some embodiments, provided herein are compositions and systems comprising dual ANGPTL4 siRNAs that achieve advantageous triglycerides reduction.
[0136] Provided herein are compositions and systems comprising at least two polynucleotides connected to each other by a multivalent linker, wherein the compositions and systems further comprise a moiety provided herein that is directly or indirectly linked to at least one of the at least two polynucleotides, the multivalent linker, or combinations thereof. Accordingly, provided herein are compositions and systems comprising at least two siRNAs connected to each other by a multivalent linker, wherein the compositions and systems further comprise a moiety provided herein that is directly or indirectly linked to at least one of the at least two siRNAs, the multivalent linker, or combinations thereof. In some embodiments, provided herein are compositions and systems comprising at least two siRNAs connected to each other by a multivalent linker, wherein the compositions and systems further comprise a moiety provided herein that is directly or indirectly linked to at least one of the at least two siRNAs, the multivalent linker, or combinations thereof, and wherein at least one of the at least two siRNAs is a modified siRNA. In some embodiments, compositions and systems comprising a modified siRNA can have a longer in vivo half-life that can improve bioavailability of the composition at a target site. Accordingly, in some embodiments, compositions and systems comprising at least one modified siRNA can have improved bioavailability at a target site relative to a corresponding composition comprising unmodified siRNAs, wherein the improved bioavailability refers to an improvement of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 100% or more. In some embodiments, compositions and systems provided herein advantageously reduces adverse reaction relative to a corresponding composition or system comprising unmodified siRNAs. In some embodiments, compositions and systems comprising at least one modified siRNA provided herein comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 100% or higher bioavailability in liver relative to brain, intestine, thyroid, kidney, or heart. In some embodiments, compositions and systems comprising at least one modified siRNA provided herein comprises at least 5%, at least 10%, at least 15%, at least 20%,Attomey Docket No. 229670-701601 at least 25%, at least 50%, at least 75%, at least 100% or higher bioavailability in adipose tissues relative to brain, intestine, thyroid, kidney, or heart.
[0137] Provided herein are compositions and systems comprising a first siRNA, a second siRNA linked, and a multivalent linker. In some embodiments, a multivalent linker provided herein links 3’ end of an antisense strand of a first siRNA to 5’ end of an antisense strand of a second siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a first antisense strand of an siRNA to 3’ end of a second antisense strand of a different siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of an antisense strand of a first siRNA to 5’ end of an sense strand of a second siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a first antisense strand of an siRNA to 3’ end of a second sense strand of a different siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 5’ end of an antisense strand of a second different siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 3’ end of an antisense strand of a second siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 5’ end of a sense strand of a second different siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 3 ’ end of a sense strand of a second siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 5’ end of an antisense strand of a second siRNA. In some embodiments, a multivalent linker provided herein links 3’ end of a sense strand of a first siRNA to 3’ end of an antisense strand of a second siRNA. In some embodiments, the first and the second siRNA are at least 50%, at least 55%, at least 60%, at 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical. In some embodiments, the first siRNA and the second siRNA are non-identical. In some embodiments, the first siRNA and the second siRNA target the same targeting site. In some embodiments, the first siRNA and the second siRNA target different targeting sites, such as adipose tissue, liver tissue, muscle, brain, heart, kidney, skin, connective tissue, or a combination thereof.
[0138] In some embodiments, the compositions provided herein comprises modified siRNAs and a multivalent linker that significantly increases knockdown of target genes in metabolically active tissues, such as adipose tissue, muscle, and liver, than other tissues such as kidney, brain, and heart, thereby achieving greater selectivity and gene silencing effects. In some embodiments, the compositions provided herein comprise lipophilic moieties that achieve more selective and durable gene silencing or knockdown as compared to a system comprising single siRNA or composition. In some embodiments, the compositions and systems provided herein have about 50 to about 90% knockdown of at least two genes in the metabolic tissue. For instance, the compositions andAttomey Docket No. 229670-701601 systems provided herein have about 48%, about 52%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% knockdown of at least two genes in the metabolic tissue. In some embodiments, the compositions and systems provided herein have most effective knockdown in the adipose tissue, particularly the subcutaneous adipose tissue. In some embodiments, the compositions and systems provided herein have most effective knockdown in the visceral adipose tissue. In some embodiments, the compositions and systems provided herein have most effective knockdown in the ectopic adipose tissue. In some embodiments, the compositions and systems provided herein have about 80%, about 85%, about 90%, and about 95% gene knockdown efficiency in the visceral adipose tissue, ectopic adipose tissue, or combinations thereof. In some embodiments, the compositions and systems provided herein have less than 20% knockdown of targeted genes, such as ANGPTL4 in non-fat tissue.
[0139] In some embodiments, provided herein are compositions or systems comprise at least two siRNAs connected by at least one multivalent linker. In some embodiments, the multivalent linkers are non-cleavable linkers, such as GalNAc, which stabilize the siRNA. In some embodiments, the multivalent linkers are cleavable linkers that are cleaved in acidic environments such as tumors, on in reducing environment, by specific enzymes, such as proteases, esterases, or reductases, or light exposure. In some embodiments, the multivalent linker connecting the at least two siRNAs comprises a cleavage biotin linker (BSS-siRNA), peptide linkers, phosphodiester linkers, or a disulfide linker that is cleaved upon entering the reducing environment of a target cell, releasing the siRNA for processing or function.
[0140] In some embodiment, the compositions or systems comprise HMS linker that promotes efficient siRNA loading by forming lipid bilayer geometry. In some embodiments, the HMS linker increases siRNA delivery efficiency by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, to about 95%. In some embodiments, the compositions or systems comprise cholesteryl HMS linker that enhance broad distribution of siRNA to the target sites.
[0141] In some embodiment, the compositions or systems comprise TEG linker that promotes efficient siRNA loading by forming lipid bilayer geometry. In some embodiments, the TEG linker increases siRNA delivery efficiency by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, to about 95% relative to corresponding compositions that lack TEG linker. In some embodiments, the compositions or systems comprise cholesterol TEG linker.
[0142] Compositions or systems provided herein comprise two ANGPTL4 siRNA connected to each other by a linker provided herein. In some embodiments, the linker improves efficiency of selectively knocking down ANGPTL4 in the adipose tissue, liver, or muscle. For example, in someAttomey Docket No. 229670-701601 embodiments, the compositions or systems comprising linkers show about 30% to about 95% (e.g, about 30%, about 40%, about 50%, about 55%, about 60% about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%) gene silencing efficiency in the adipose tissue. In some embodiments, the compositions or systems comprising linkers show about 30% to about 95% (e.g., about 30%, about 40%, about 50%, about 55%, about 60% about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%) gene silencing efficiency in the liver. In some embodiments, the compositions or systems comprising linkers show about 30% to about 95% (e.g., about 30%, about 40%, about 50%, about 55%, about 60% about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%) gene silencing efficiency in the muscle. In some embodiments, the compositions or systems comprising linkers show about <30% (e.g., <25%, <20%, <15%, <10%, or <5%) gene silencing efficiency in the non-metabolic tissue.
[0143] In some embodiments, the composition comprises a linker described herein that facilitates delivery of the composition to adipose tissue or preadipocyte. In some embodiments, the composition comprises a linker described herein that facilitates delivery of the composition to adipocyte or preadipocyte, immune cells, hepatic cell, myocytes, or combinations thereof. In some embodiments, the composition comprises a linker described herein that facilitates delivery of the composition to hepatocytes. In some embodiments, the composition comprises a linker described herein that facilitates delivery of the composition to myocytes.
[0144] Compositions provided herein comprise at least two polynucleotides connected to each other by a multivalent linker, wherein the polynucleotides and / or the multivalent linker are conjugated to one or more moieties described herein. In some embodiments, the composition comprises siRNAs comprising same type of moieties discussed above. In some embodiments, the composition comprises siRNAs comprising different types of moieties discussed above. For example, the composition comprises dual siRNAs with one siRNA is linked to a polypeptide and the other siRNA is linked to a lipid. In some embodiments, the composition comprises multiple moieties targeting the same type of tissue. In some embodiments, the composition comprises multiple moieties targeting different types of tissue. In some embodiments, the composition comprises a DHA moiety that facilitates delivery of the composition to blood-brain barrier or neurons.
[0145] Provided herein are compositions and systems comprising at least two polynucleotides connected to each other by a multivalent linker, wherein the compositions and systems further comprise a moiety that is directly or indirectly linked to at least one of the at least two polynucleotides, the multivalent linker, or combinations thereof, and wherein the moiety is a GalNAc ligand. Accordingly, provided herein are compositions and systems comprising at least two siRNAs connected to each other by a multivalent linker, wherein the compositions and systems-n-Attomey Docket No. 229670-701601 further comprise a moiety that is directly or indirectly linked to at least one of the at least two siRNAs, the multivalent linker, or combinations thereof, wherein the moiety is a GalNAc ligand. In some embodiments, provided herein are compositions and systems comprising at least two siRNAs connected to each other by a multivalent linker, wherein the compositions and systems further comprise a moiety that is directly or indirectly linked to at least one of the at least two siRNAs, the multivalent linker, or combinations thereof, wherein at least one of the at least two siRNAs is a modified siRNA, and wherein the moiety is a GalNAc ligand.
[0146] In some embodiments, compositions and systems provided herein comprise an ANGPTL4 siRNA and an additional siRNA connected to each other by a monovalent, bivalent, or trivalent N-acetylgalactosamine (GalNAc) linker or GalNAc derivative linker for liver specific siRNA delivery. In some embodiments, the siRNAs of the present invention comprise at least one, at least two, at least three, at least four, at least 5, at least 6 GalNAc or a GalNAc derivatives, each independently attached to a plurality of nucleotides of the siRNA. In some embodiments, the GalNAc derivatives comprise GalNAc monosaccharide, GalNAc-p / a-OH, GalNAc-amine, GalNAc-azide, GalNAc-thiol, and GalNAc clusters.
[0147] In some embodiments, compositions and systems comprising a modified siRNA conjugated to a GalNAc ligand is selectively directed to liver. Accordingly, in some embodiments, compositions and systems comprising at least one modified siRNA that is conjugated to a GalNAc ligand comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 100% or higher bioavailability in liver relative to brain, intestine, thyroid, kidney, or heart. In some embodiments, compositions and systems provided herein advantageously reduces systemic adverse reaction relative to a corresponding composition or system lacking GalNAc ligand. In some embodiments, a GalNAc ligand is attached to a 3' end of a sense strand of at least one siRNA of the at least two siRNAs of the compositions and systems provided herein. In some embodiments, a GalNAc ligand is attached to a 5' end of a sense strand of at least one siRNA of the at least two siRNAs of the compositions and systems provided herein.
[0148] In some embodiments, the compositions and systems provided herein comprise at least one siRNA directed to ANGPTL4. In some embodiments, the compositions and systems comprise dual anti-ANGPTL4 siRNAs achieves synergistic effects in reducing triglyceride and cholesterol associated with metabolic disorders. In some embodiments, the compositions and systems provided herein comprise at least one siRNA directed to ANGPTL4 and at least one siRNA direct to another ANGPTLs. In some embodiments, the compositions and systems provided herein further comprise an antisense polynucleotide (ASO). In some embodiments, the ASOs are modified ASOs comprising backbone modifications, sugar modifications, base modifications. In some embodiments, the modifications to the ASOs increase target-specific delivery. In someAttomey Docket No. 229670-701601 embodiments, the modifications to the ASOs improves the potency of the ASO, e.g. by modulating the expression of target genes. In some embodiments, the ASO is directed to any one of the ANGPTL4 mRNA in Table 3, thereby inhibiting the expression of ANGPTL4 in a targeted tissue. In some embodiments, the ASO is directed to another ANGPTLs mRNA. In some embodiments, the ASOs comprise similar modifications as the siRNAs. In some embodiments the ASOs comprises different modifications as compared to the siRNAs. In some embodiments, the ASOs are linked to the antisense strand of the siRNA. In some embodiments, the ASOs are linked to the sense strand of the siRNA. In some embodiments, the ASOs are linked to the multivalent linker that connected to the siRNA. In some embodiments, the ASO are connected to the moieties of the siRNA.
[0149] Compositions and systems comprise an siRNA that hybridizes to an mRNA encoding ANGPTL4, a portion thereof, or a fragment thereof. In some embodiments, an siRNA hybridizes at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four, or at least twenty-five consecutive nucleotides of mRNA encoding ANGPTL4. In some embodiments, an siRNA hybridizes at least a portion of mRNA encoding ANGPTL4, wherein a sequence of the siRNA is at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a corresponding portion of the mRNA that the siRNA hybridizes to. In some embodiments, composition and systems comprising an siRNA that inhibits and / or reduces expression of ANGPTL4, wherein the siRNA comprises a sense strand and an antisense strand; the siRNA hybridizes to an mRNA encoding ANGPTL4, a portion thereof, or a fragment thereof; siRNA hybridizes less than or equal to 100 off-targets, less than or equal to 90 off-targets, less than or equal to 80 off-targets, less than or equal to 70 off-targets, less than or equal to 60 off-targets, less than or equal to 50 off-targets, less than or equal to 30 off-targets, less than or equal to 20 off- targets, less than or equal to 10 off-targets, or less than or equal to 5 off-targets; and siRNA has no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, or no more than 10 mismatches in the antisense strand.
[0150] Compositions and systems comprising an siRNA that targets ANGPTL4 can be useful in treating a disease or a condition associated with a metabolic or cardiovascular disorder in a subject in need thereof. In some embodiments, a disease or a condition comprises hyperlipidemia, hypertriglyceridemia, pancreatitis, familial chylomicronemia syndrome, diabetes, type 2 diabetes, heart disease, a myocardial infarction, angina pectoris, or atherosclerosis.
[0151] Compositions and systems comprising an siRNA that targets ANGPTL4 can be useful in treating various metabolic disorders and dyslipidemias, as well as a reduction of body weight byAttomey Docket No. 229670-701601 having long-term stability and specific targeting to adipose tissue. Accordingly, provided herein are compositions and systems comprising polynucleotides described herein that target a nucleic acid encoding ANGPTL4, a portion thereof, or a fragment thereof. In some embodiments, compositions and systems target an mRNA encoding ANGPTL4, a portion thereof, or a fragment thereof. In some embodiments, an siRNA as provided herein comprises: an antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4), a portion thereof, or a fragment thereof. In some embodiments, compositions and systems provided herein target to a particular tissue to reduce levels of ANGPTL4 mRNA and protein in the cell or tissue or interest (e.g., adipose tissue).
[0152] Further provided herein are compositions or systems comprising multivalent polynucleotides construct, wherein the multivalent polynucleotides construct comprising at least polynucleotides connected with each other with as least one multivalent linker. In some embodiments, the polynucleotides comprise an siRNA, an ASO, a double strand RNA, or a single strand RNA. In some embodiments, the siRNA is an ANGPTL4 siRNA. In some embodiments, the siRNA hybridizes to an mRNA sequence of any one of the ANGTPLs provided herein or any one of their variants. In some embodiments, the multivalent ANGPTL4 siRNA construct comprises at least two ANGPTL4 siRNAs, such as, two, three, or four ANGPTL4 siRNAs connected with each other via at least one multivalent linker. In some embodiments, the at least two ANGPTL4 siRNAs comprise the same sequences or different sequences. In some embodiments, the at least two ANGPTL4 siRNAs target the same tissue or different tissues. In some embodiments, the multivalent ANGPTL4 siRNA construct possesses silencing effects that are proportional to the number of ANGPTL4 siRNAs made up of the multivalent ANGPTL4 siRNA construct. In some embodiments, the multivalent ANGPTL4 siRNA construct comprises modificationsthat increase ANGPTL4 knockdown efficiency than the one without modifications.
[0153] In some embodiments, provided herein are dual siRNA constructs comprising a first ANGPTL4 siRNA and a second siRNA that hybridizes to an mRNA of any one of the angiopoietin- like proteins or variants thereof. In some embodiments, the angiopoietin-like proteins comprise ANGPTL 1 -ANGTPL7.
[0154] In some embodiments, the compositions provided herein comprise an IC20 ranging from about 0.0001 nm, about 0.0005 nm, about 0.001 nm, about 0.005 nm, about 0.01 nM, about 0.05 nM, to about 0.1 nM. In some embodiments, the compositions provided herein comprise an IC50 ranging from about 0.0001 nm, about 0.0005 nm, about 0.001 nm, about 0.005 nm, about 0.01 nM, about 0.05 nM, to about 0.1 nM. In some embodiments, the compositions achieve about 50%, about 60%, about 70%, about 80%, about 90% ANGPTL4 gene knockdown efficiency in a dose-Attomey Docket No. 229670-701601 dependent manner. In some embodiments, the compositions achieve at least 80% ANGPTL4 knockdown in both hepatocytes and epithelial cells.
[0155] In some embodiments, the compositions provided herein reduce the expression of ANGPTL4 by about 10% to about 100% at a target site of a subject as compared to the expression of ANGPTL4 in the subject prior to the administration of the compositions. In some embodiments, the compositions provided herein reduce the expression of ANGPTL4 by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 98% at a target site of a subject as compared to the expression of ANGPTL4 at the target site of the subject prior to the administration of the composition. In some embodiments, the compositions or system provided herein completely silence the expression of ANGPTL4 at a target site of a subject.Cells
[0156] Provided herein are cells contacted with compositions or systems provided herein. Also, provided herein are cells that are modified by compositions or systems provided herein. The cells can be from any source. In some embodiments, the cells are selected from the group consisting of: an adipose cell, preadipocyte, a hepatocyte, a satellite cell, a lymphocyte, a leukocyte, a myeloid cell, a T cell, a natural killer cell, a macrophage, a neutrophil, an eosinophil, a basophil, a dendritic cell, a stem cell, a cancer cell, an induced pluripotent stem-cell derived myeloid cell, an induced pluripotent stem-cell derived leukocyte, and an induced pluripotent stem-cell derived lymphocyte. Provided herein are compositions comprising the cells provided herein.Pharmaceutical Compositions and Combination Therapies
[0157] Provided herein are pharmaceutical compositions comprising compositions provided herein and pharmaceutically acceptable ingredient. In some embodiments, pharmaceutically acceptable ingredients comprise one or more of a pharmaceutically acceptable carrier, a delivery vehicle, a diluent, a carrier, and an excipient. Also, provided herein are pharmaceutical compositions comprising compositions provided herein, cells provided herein or combinations thereof; and one or more pharmaceutically acceptable carriers.
[0158] In some embodiments, compositions provided herein are combined with pharmaceutically acceptable salts, excipients, and / or carriers to form a pharmaceutical composition. Pharmaceutical salts, excipients, and carriers may be chosen based on the route of administration, the location of the target issue, and the time course of delivery of the drug. A pharmaceutically acceptable carrier or excipient may include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., compatible with pharmaceutical administration. In some embodiments, a delivery vehicle comprises a polymer matrix. In some embodiments, a polymer matrix comprises acetylated pullulan, alginate, chitosan, collagen, gelatin, glycerin,Attomey Docket No. 229670-701601 hyaluronic acid, poly(lactic-co-glycolic acid) (PLGA), poly(lactic acid) (PLA), poly(glycolic acid) (PGA) polycaprolactone (PCL), polyethylene glycol (PEG), poly D, L-lactide-polyethylene glycol (PELA), or a combination thereof. In some embodiments, a delivery vehicle or the pharmaceutically acceptable carrier comprises a liposome, an extracellular vesicle, a nanoparticle, or a lipid. In some embodiments, the delivery vehicle or the pharmaceutically acceptable carrier comprises a hydrogel.
[0159] In some embodiments, a pharmaceutical composition is in the form of a solid, semi-solid, liquid, or gas (aerosol). Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
[0160] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the encapsulated or unencapsulated conjugate is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or (a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, (c) humectants such as glycerol, (d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, (e) solution retarding agents such as paraffin, (f) absorption accelerators such as quaternary ammonium compounds, (g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, (h) absorbents such as kaolin and bentonite clay, and (i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also comprise buffering agents.
[0161] Compositions provided herein may be formulated in dosage unit form for ease of administration and uniformity of dosage. A dosage unit form is a physically discrete unit of a composition provided herein appropriate for a subject to be treated. It will be understood, however,Attomey Docket No. 229670-701601 that the total usage of compositions provided herein will be decided by the attending physician within the scope of sound medical judgment. For any composition provided herein the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, such as mice, rabbits, dogs, pigs, or non-human primates. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. Therapeutic efficacy and toxicity of compositions provided herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose is therapeutically effective in 50% of the population) and LDso (the dose is lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50 / ED50. Pharmaceutical compositions which exhibit large therapeutic indices may be useful in some embodiments. The data obtained from cell culture assays and animal studies may be used in formulating a range of dosage for human use.
[0162] Provided herein are combination therapies and pharmaceutical compositions comprising one or more additional therapeutic agents. Non-limiting examples of additional therapeutic agents include: GLP-1 agonists, SLGT inhibitors, DDP-4 inhibitors, metformin, insulin and insulin derivatives, PYY3-36 or analogues thereof, pancreatic polypeptide or analogues thereof, glucagon receptor agonists, GIP receptor agonists or antagonists, ghrelin antagonists or inverse agonists, xenin and analogues thereof, DDP-IV inhibitors, dual SGLT2 / SGLT1 inhibitors, biguanides, Thiazolidinediones, dual PPAR agonists, Sulfonylureas, Meglitinides, alpha-glucosidase inhibitors, Amylin and Amylin analogues, GPR119 agonists, GPR40 agonists, GPR120 agonists, GPR142 agonists, systemic or low-absorbable TGR5 agonists, cycloset, inhibitors of 11 -beta- HSD, activators of glucokinase, inhibitors of DGAT, inhibitors of protein tyrosinephosphatase 1, inhibitors of glucose-6- phosphatase, inhibitors of fructose- 1,6-bisphosphatase, inhibitors of glycogen phosphorylase, inhibitors of phosphoenol pyruvate carboxykinase, inhibitors of glycogen synthase kinase, inhibitors of pyruvate dehydrogenase kinase, alpha2-antagonists, CCR-2 antagonists, modulators of glucose transporter-4, Somatostatin receptor 3 agonists, HMG-CoA- reductase inhibitors, fibrates, nicotinic acid and the derivatives thereof, nicotinic acid receptor 1 agonists, PPAR-alpha, gamma or alpha / gamma agonists or modulators, PPAR-delta agonists, ACAT inhibitors, cholesterol absorption inhibitors, bile acid-binding substances, IB AT inhibitors, MTP inhibitors, modulators of PCSK9, LDL receptor up-regulators by liver selective thyroid hormone receptor P agonists, HDL-raising compounds, lipid metabolism modulators, PLA2 inhibitors , ApoA- 1 enhancers, thyroid hormone receptor agonists, cholesterol synthesis inhibitors, omega-3 fatty acids and derivatives thereof, active substances for the treatment of obesity, such as Sibutramine, Tesofensine, Orlistat, CB- 1 receptor antagonists, MCH-1 antagonists, MC4 receptorAttomey Docket No. 229670-701601 agonists and partial agonists, NPY5 or NPY2 antagonists, NPY4 agonists, beta-3 -agonists, leptin or leptin mimetics, agonists of the 5HT2c receptor, or the combinations of bupropione / naltrexone (CONTRA VE), bupropione / zonisamide (EM-PATIC), bupropione / phentermine or pramlintide / metreleptin, QNEXA (Phentermine+ topiramate), lipase inhibitors, angiogenesis inhibitors, H3 antagonists, AgRP inhibitors, triple monoamine uptake inhibitors (norepinephrine and acetylcholine), MetAP2 inhibitors, nasal formulation of the calcium channel blocker diltiazem, antisense against production of fibroblast growth factor receptor 4, prohibitin targeting peptide- 1, drugs for influencing high blood pressure, chronic heart failure or atherosclerosis, such as angiotensin II receptor antagonists, ACE inhibitors, ECE inhibitors, diuretics, beta-blockers, calcium antagonists, centrally acting hypertensives, antagonists of the alpha- 2-adrenergic receptor, inhibitors of neutral endopeptidase, thrombocyte aggregation inhibitors salts, analogs, or derivatives thereof.
[0163] In some embodiments, the additional therapeutic agent comprises a glucagon-like peptide- 1 (GLP-1) receptor agonist. In some embodiments, the GLP-1 receptor agonist is selected from the group consisting of: exenatide, exenatide LAR, liraglutide, taspoglutide, semaglutide, albiglutide, lixisenatide and dulaglutide.
[0164] In some embodiments, the additional therapeutic agent comprises: a dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the DPP-4 inhibitor is selected from the group consisting of: sitagliptin, saxagliptin, linagliptin, and alogliptin.
[0165] In some embodiments, the additional therapeutic agent comprises: a sodium-glucose cotransporter-2 (SGLT2) inhibitor. In some embodiments, the SLGT2 inhibitor is selected from the group consisting of: canagliflozin, dapagliflozin, empagliflozin, and ertugliflozin.Kits
[0166] In some embodiments, a formulation of a composition described herein is prepared in a single container for administration. In some embodiments, a formulation of a composition described herein is prepared in two containers for administration, for example, separating the nucleic acid from the tissue-targeting moiety. As used herein, “container” includes vessel, vial, ampule, tube, cup, box, bottle, flask, jar, dish, well of a single-well or multi -well apparatus, reservoir, tank, or the like, or other device in which the herein disclosed compositions may be placed, stored and / or transported, and accessed to remove the contents. Examples of such containers include glass and / or plastic sealed or re-sealable tubes and ampules, including those having a rubber septum or other sealing means that is compatible with withdrawal of the contents using a needle and syringe. In some implementations, the containers are RNase free.Attomey Docket No. 229670-701601
[0167] Provided herein are kits comprising a kit for treating a disease or a condition, wherein the kit comprises an siRNA provided herein. Also, provided herein are kits comprises an siRNA provided herein linked to a tissue targeting moiety provided herein by a linker provided herein. Also, provided herein are kits comprising a kit for treating a disease or a condition, wherein the kit comprises cells provided herein. Also, provided herein are kits comprising a kit for treating a disease or a condition, wherein the kit comprises a pharmaceutical composition provided herein.Devices
[0168] Provided herein are devices, wherein the devices comprise a composition provided herein (e.g., a pharmaceutical composition provided herein, a vector provided herein, or a cell provided herein). In some embodiments, the device is an implantable device. In some embodiments, the device is implanted in combination with liposuction surgery in a subject, administration of an additional therapeutic agent to the subject, and / or administration of radiation to the subject.
[0169] A composition provided herein can be loaded by injection of a solution or suspension into a well inside the device followed by solvent removal by drying, evaporation, or lyophilization, or by placement of a composition provided herein in tablet or particulate form into the well. In some embodiments, the device comprises a biocompatible matrix. In some embodiments, the biocompatible matrix is a polymer, a silicone, a plastic, or a metal. In some embodiments, the biocompatible matrix comprises polysiloxane, silicone, or siloxane. In some embodiments, the device is implanted into a tissue of a subject via a catheter, cannula or biopsy needle. The device can be sized to permit placement using a catheter, cannula, or stylet. In some embodiments, the device has a guidewire to assist in placement and retrieval. The device may also include features that assist in maintaining spatial stability of tissue excised with the device, such as fins or stabilizers that can be expanded from the device prior to or at the time of removal. Optionally, the device has fiber optics, sensors and / or interactive features such as remote accessibility (such as Wi-Fi) to provide for in situ retrieval of information and modification of device release properties.
[0170] In some embodiments, the device, allows for the compositions provided herein to achieve a zero-order rate release profile into a tissue of a subject. Composition release pharmacokinetics are a function of the composition solubility, excipients, dimensions of the device or vessel within the device, and tissue into which the device is implanted (with greater rate of release into more highly vascularized tissue, than into less vascular tissue). The devices provided herein may also include materials such as radiopaque materials or materials that can be imaged using ultrasound or MRI. They can be manufactured using techniques such as deep ion etching, nano imprint lithography, micromachining, laser etching, three-dimensional printing or stereolithography.MethodsAttomey Docket No. 229670-701601
[0171] Provided herein are methods of reducing an expression of a target nucleotide, and thereby reducing expression of a protein encoded by the target nucleotide. Also provided herein are methods of reducing expression of a target nucleotide at a target site. In some embodiments, methods described herein comprise administering effective of compositions or pharmaceutical compositions described herein to a subject in need thereof. In some embodiments, a target nucleotide encodes angiopoietin-like protein 4 (ANGPTL4). Accordingly, in some embodiments, the methods can be used for reducing expression of ANGPTL4. In some embodiments, a target site is liver, adipose tissues, or combinations thereof. In some embodiments, a target site is liver, muscle tissues, adipose tissues, adipose tissues associated with liver, adipose tissues associated with muscle tissues, or combinations thereof. In some embodiments, pharmaceutical compositions provided herein are in a form which allows for compositions provided herein to be administered to a subject. Compositions provided herein can be administered to any appropriate tissue in the subject. In some embodiments, the tissue is an adipose tissue associated with one or more of liver, intestine, kidney and peritoneum. In some embodiments, administration of a pharmaceutical composition provided herein is local administration or systemic administration. In some embodiments, a pharmaceutical composition provided herein is formulated for administration / for use in administration via an intra-adipose, intratumoral, intravesicular (e.g. , via the bladder), rectal, subcutaneous, topical, oral, intradermal, intramuscular, inhalation, intranasal, intravenous, intraperitoneal, intraocular, or intracranial route. In some embodiments, the administering is every 1, 2, 4, 6, 8, 12, 24, 36, or 48 hours. In some embodiments, the administering is daily, weekly, monthly, or yearly. In some embodiments, the administering is repeated at least about every 24 hours, every 48 hours, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 14 days, every 21 days, every 28 days, every 35 days, every 42 days, or every 56 days. In some embodiments, methods provided herein reduces plasma concentration of ANGPTL4 at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the plasma concentration of ANGPTL4 prior to administration of the composition to the subject.
[0172] Provided herein are methods of treating a disease or a condition in a subject, the methods comprising: administering to a subject the composition provided herein, thereby treating the disease or the condition. In some embodiments, the disease or the condition comprise a cardiometabolic disorder. In some embodiments, the disease or the condition comprise a cardiovascular disorder (e.g, metabolic disorder, heart disease, myocardial infarction, angina pectoris, atherosclerosis). In some embodiments, the disease or the condition comprise a metabolic disorder (e.g, hyperlipidemia, hypertriglyceridemia, Hypercholesterolemia, diabetes). In some embodiments, the metabolic disorder comprises type 2 diabetes. In some embodiments the diseaseAttomey Docket No. 229670-701601 or conditions comprise metallic disorder associated diseases or conditions, such as steatohepatitis, polycystic ovary syndrome (PCOS), rare (GOF) metabolic, metabolic dysfunction. In some embodiments, the disease or the condition comprise hypertriglyceridemia, severe hypertriglyceridemia, familial partial lipodystrophy, severe dyslipidemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, acute pancreatitis, atherosclerotic cardio-vascular disease, chronic kidney disease, fatty liver disease, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
[0173] Provided herein are methods of reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in a subject, the method comprising: administering to the subject a composition provided herein, thereby reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in the subject.
[0174] Provided herein are methods of treating a condition in a subject, the method comprising: administering to the subject a composition provided herein, thereby reducing plasma concentration of total cholesterol, reducing plasma concentration of triglyceride, reducing plasma concentration of low-density lipoprotein (LDL), reducing plasma concentration of very low-density lipoprotein (VLDL), increasing plasma concentration of high-density lipoprotein (HDL), reducing blood glucose concentration, reducing insulin concentration in blood, increasing insulin sensitivity or combinations thereof. In some embodiments, a condition comprises CVD risk, diabetes mellitus, hypertension, obesity, metabolic syndrome, dyslipidemia, or combinations thereof. In some embodiments, methods provided herein reduces plasma concentration of total cholesterol at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the plasma concentration of total cholesterol prior to administration of the composition to the subject. In some embodiments, methods provided herein reduce plasma concentration of triglyceride at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the plasma concentration of triglyceride prior to administration of the composition to the subject. In some embodiments, methods provided herein reduce plasma concentration of LDL at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at leastAttomey Docket No. 229670-70160160%, or at least 70% relative to the plasma concentration of LDL prior to administration of the composition to the subject. In some embodiments, methods provided herein reduce plasma concentration of VLDL at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the plasma concentration of VLDL prior to administration of the composition to the subject. In some embodiments, methods provided herein increase plasma concentration of HDL at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the plasma concentration of HDL prior to administration of the composition to the subject. In some embodiments, methods provided herein reduce blood glucose concentration at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the blood glucose concentration prior to administration of the composition to the subject. In some embodiments, methods provided herein increase insulin sensitivity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the insulin sensitivity prior to administration of the composition to the subject. In some embodiments, methods provided herein reduce insulin concentration in blood at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% relative to the insulin concentration in blood prior to administration of the composition to the subject. In some embodiments, treating a disease or a condition comprises preventing, inhibiting, or reversing the disorder in a subject.
[0175] In some embodiments, provided herein are method of treating diabetes in a subject, the method comprising administering to the subject an effective amount of the compositions described herein, wherein the administering of the composition increases insulin sensitivity and reduces blood glucose and A1C level in the subject as compared their level prior to the administration. In some embodiments, the compositions and systems provided herein increase insulin sensitivity in a subject as measured by the subject’s response to glucose challenge by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold or more. In some embodiments, the compositions and systems provided herein reduce blood glucose and A1C level in the subject by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 98% or more in the subject as compared to the fat deposits prior to the administration.
[0176] In some embodiments, provided herein are methods of treating obesity in a subject, the method comprising administering to the subject an effective amount of a composition described herein, wherein the administering of the composition reduces adipose tissue deposition and / or ectopic fat in the subject as compared to the adipose tissue deposition and / or ectopic fat prior to the administration. In some embodiments, the compositions and systems provided herein reduce adipose tissue deposition and / or ectopic fat in the subject by about 10%, about 20%, about 30%,Attomey Docket No. 229670-701601 about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 98% in the subject as compared to the fat deposits prior to the administration.
[0177] In some embodiments, provided herein are method of treating hypertriglyceridemia in a subject, the method comprising administering to the subject an effective amount of a composition described herein, wherein the administering of the composition reduces the level of triglycerides, cholesterol, and / or LDL-cholesterol in the subject as compared the triglycerides, cholesterol, and / or LDL-cholesterol level prior to the administration. In some embodiments, the compositions and systems provided herein reduce the triglycerides, cholesterol, and / or LDL-cholesterol in the subject by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 98% in a subject as compared to the level prior to the administering.
[0178] In some embodiments, the administering is local or systemic. In some embodiments, the administering is by subcutaneous, intravenous, intradermal, intramuscular, intraadipose, inhalation, intravenous, intraperitoneal, intraocular, intravitreal, intratumoral, intracranial, sublingual, oral, or intrathecal administration.
[0179] In some embodiments, the methods further comprise administering to the subject an additional therapeutic agent. In some embodiments, the additional therapeutic agent comprises: a glucagon-like peptide-1 (GLP-1) receptor agonist, a dipeptidyl peptidase 4 (DPP -4) inhibitor, a sodium-glucose cotransporter-2 (SGLT2) inhibitor, metformin, insulin, an angiotensin II receptor antagonist, an angiotensin converting enzyme (ACE) inhibitor, a beta-blocker, a calcium channel blocker, a thrombocyte aggregation inhibitor, salts, or derivatives thereof. In some embodiments, the GLP-1 receptor agonist is selected from the group consisting of: exenatide, exenatide LAR, liraglutide, taspoglutide, semaglutide, albiglutide, lixisenatide and dulaglutide. In some embodiments, the DPP -4 inhibitor is selected from the group consisting of: sitagliptin, saxagliptin, linagliptin, and alogliptin. In some embodiments, the SLGT2 inhibitor is selected from the group consisting of: canagliflozin, dapagliflozin, empagliflozin, and ertugliflozin. In some embodiments, the additional therapeutic agent is administered before, simultaneously, or after administration of a composition provided herein comprising the RNA polynucleotide.
[0180] In some embodiments, the method decreases food intake, increases energy expenditure, reduces body weight, regulates appetite, induces satiety, or prevents weight regain after successful weight loss relative to the subject before administration.Subjects
[0181] In some embodiments of the methods described herein include treating a disease or a condition of a subject. Non-limiting examples of subjects include vertebrates, animals, mammals, dogs, cats, cattle, rodents, mice, rats, primates, monkeys, and humans. In some embodiments, theAttomey Docket No. 229670-701601 subject is a vertebrate. In some embodiments, a subject is an animal. In some embodiments, a subject is a mammal. In some embodiments, a subject is a human.
[0182] In some embodiments, a subject has a body mass index (BMI) of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more. In some embodiments, a subject is overweight or obese. In some embodiments, a subject has a BMI of 25 or more. In some embodiments, a subject has a BMI in a range of from 25 to 50, from 25 to 40, from 25 to 30, from 30 to 50, from 30 to 40, or from 40 to 50.
[0183] In some embodiments, a subject is between 0 and 100 years of age, between 20 and 90 years of age, between 30 and 80 years of age, between 40 and 75 years of age, between 50 and 70 years of age, or between 40 and 85 years of age.
[0184] In some embodiments, the subject has, is diagnosed with or is suspected of having a disease or condition. In some embodiments, the disease or condition comprises a neurological disease, obesity, a cardiovascular disease, or diabetes. In some embodiments, the disease or condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motorneuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
[0185] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention provided herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.Attomey Docket No. 229670-701601EXAMPLESExample 1: siRNA Chemistries & Delivery Platform for Metabolic Tissues.
[0186] Modified divalent siRNAs are designed as shown in FIG. 1 and FIG. 3. Briefly, siRNAs targeting an mRNA that encodes ANGPTL4 are prepared and modified according to the method provided in FIG. 2. FIG. 3 provides list of compositions that are synthesized.
[0187] The divalent siRNAs are evaluated for RISC interactions. The modifications can significantly improve the durability of siRNA when combined with the standard phosphorothioate modifications typical of enhanced stabilization chemistry (ESC) of contemporary siRNA constructs.
[0188] The divalent siRNA constructs that specifically target one or more relevant tissues / targets such as adipose tissues or liver can impact the metabolic status of individuals with major alterations in lipid status (i.e. remnant cholesterol particles). Genetic support for these targets / tissues comes from human genome wide association studies (GWAS) / EWAS / WGS studies demonstrating the positive effects of loss of function genetics of certain key pathway targets in humans such as ANGPLT4. Accordingly, diet-induced obese mice are treated with the ANGPTL4-targeting compositions. VLDL cholesterol is measured. Liver triglycerides and plasma triglyceride levels are determined. Lipid deposition in each tissue (liver and adipose tissue) is evaluated. Waist-to-hip ratios and body weight are assessed in the obese mice that are treated with the ANGPTL4-targeting compositions and in controls.
[0189] ANGPTL4 knock down can result in improvements across the metabolic spectrum including reduced VLDL (“remnant cholesterol”), reduced plasma triglycerides, reduced ectopic lipid deposition and improved glucose tolerance in the diet-induce obesity model. Knock out of ANGPTL4 by the compositions provided herein can reduce waist:hip ratio while sparing lean mass in animal models and humans. ANGPTL4 targeting compositions can be administered to subjects with cardiometabolic disorders as a treatment for such conditions.Example 2: Screening for ANGPTL4 siRNA.
[0190] Modified divalent siRNAs are designed as shown in FIG. 1. Briefly, siRNAs targeting an mRNA that encodes ANGPTL4 are prepared and modified according to the method provided in FIG. 2. For improved manufacture efficiency, oligos were further screened to have a low GC content (10-65%) and to be devoid of runs of more than 3 G residues. G runs tend to result in poor synthesis yields and tend to aggregate in solution due to the potential to form “G quartet” structures between strands. Both the sense and antisense strands of the siRNAs were checked for the presence of seed sequences (positions 2-7 or 2-8 of the oligo) that match known human miRNA seed sequences, as this increases the risk that the oligo acts as a miR-mimic when it loads into RISC.Attomey Docket No. 229670-701601The presence of matching 7-mer seed sequences was avoided in the final designs, while a small number of matching 6-mer seed sequences were allowed. Finally, the oligos were checked for the absence of 13-mer subsequences that are abundant in the human genome or transcriptome. The design and selection of the siRNAs follows the hypothesis that high abundance subsequences are more likely to result in off-target binding by the oligo than low-abundance subsequences. Additionally, the oligos were selected from the lower half of the frequency distribution.Example 3: Generating ANGPTL4 siRNA
[0191] A list of candidate oligos were generated from human ANGPTL4 transcript variants, e.g., GenBank Accession numbers NM_139314.3 and NM_001039667.3. One set of oligos was generated by splitting the sequence into all possible overlapping 21 / 23-mer duplex fragments having 21 nt in the sensestrand, 23 nt in the antisense strand, and containing 2 nt 3’ overhangs on the 3’ end of the antisense strand. Another set of oligos was generated by splitting the sequence into all possible overlapping 19 / 21-mer duplex fragments having 19 nt in the sense strand, 21 nt in the antisense strand, and containing 2 nt 3’ overhangs on the 3’ end of the antisense strand. The base sequences were then overlaid with a set of modification patterns on the sense strand, antisense strand, or both. For example, the sense strand was modified to comprise all 2’-O-methyl (OMe) sugar modifications except for 2’ -fluoro sugar at positions 7, and 9-11 counting from the 5’ end; with two phosphorothioate (PS) linkage modifications at each end of each oligo; and with a 2’-O-methyl A residue substituted at the 3’ end of the molecule regardless of the original sequence at that position. The antisense strand was modified to comprise all 2’-O-methyl (OMe) sugar modifications except for 2’-fluoro sugar at positions 2, 6, 14 & 16 counting from the 5’ end; with two phosphorothioate (PS) linkage modifications at each end of each oligo; with a vinyl phosphonate linkage attached to the 5’ end; and with a 2’-O-methyl U residue substituted at the 5’ end of the molecule regardless of the original sequence at that position. Further, the oligo base sequences were checked for potential overlap with common SNPs (>=1% occurrence). siRNAs that have overlapping SNPs are omitted from the final selections. The predicted binding and folding behavior of the modified siRNA sequences were evaluated. Oligos with weak predicted self-folding and self-binding were ranked more favorably in this test, as were oligos predicted to have net on-target binding affinities of at least -20 kcal / mole or stronger. The nearest neighbor free energy parameters were used for DNA, DNA phosphorothioate, RNA, 2’-O-methyl, 2’-fluoro, 2’-M0E, LNA and several other common modifications used in siRNAdesign. Duplexes were chosen from whose antisense strands having minimal self-folding (weaker than -6 kcal / mole), weak target self-folding (weaker than -11 kcal / mole, where the target included the binding site plus an additional 10 nt of flanking sequence), minimal homodimer formation between antisense strands (weaker than -13 kcal / mole), and at leastAttomey Docket No. 229670-701601-26 kcal / mole of net binding free energy between the antisense strand and its target. To assess cross reactivity of siRNA from different animal species, oligos were searched against the monkey (cynomolgus monkey and Rhesus), mouse, and rat ANGPTL4 transcripts looking for matches that are exact or have minimal numbers of mismatches relative to the siRNA antisense sequence. siRNAs were selected from the ones having a perfect match to monkey ANGPTL4, while cross-reactivity with mouse and rat is more sporadic.
[0192] A list of ANGPTL4 siRNA sense strand sequences selected from the study comprises: SEQ ID NOs: 18-160, 304-405, and 712-811
[0193] A list of ANGPTL4 siRNA antisense strand sequences selected from the study comprises: SEQ ID NOs: 161-303, 406-507, and 2566-2664
[0194] A list of ANGPTL4 siRNA modified sense strand sequences selected from this study comprises: SEQ ID NOs: 508-609.
[0195] A list of ANGPTL4 siRNA modified antisense strand sequences selected from this study comprises: SEQ ID NOs: 610-711.Example 4: Linker position and divalent siRNA synthesis
[0196] Lipid nanoparticles (LNPs) are used in the study for siRNA conjugation. The LNPs- siRNAs conjugates are employed to target specific cellular receptors. The siRNAs are further conjugated to one or more moieties. The one or more moieties include fatty acids, peptides, cholesterol, antibodies, and a variety of small molecules that are recognized by cell surface receptors. The moieties are connected to several positions on either strand of the siRNA, for instance at the 3’ end of the sense strand (FIG. 4, label A). Conjugation to either end of the sense strand (FIG. 4, labels A & B) is equally effective and advantageous in removing the conjugate species when the sense strand is removed during RISC loading. Conjugation to the 3’ end of the antisense strand (FIG. 4, label C) is less favored due to concerns that such an attachment may interfere with RNAi activity, and the 5’ end of the antisense strand (FIG. 4, label E) is avoided as an attachment point due to its involvement in gene silencing activity. Internal attachment points for conjugates are also explored (FIG. 4, label D) with some attachment points retaining gene silencing activity while other attachments largely eliminate RNAi.
[0197] The siRNAs in the studies are synthesized with attached C12 linkers using standard polynucleotide synthesis methods, such as the solid phase phosphate triester methods. The protected phosphoramidite polynucleotides are shown in FIG. 5 while the protected phosphoramidite C12 linker is shown in FIG. 6. Both compounds contain a DMT protecting group at the left side (5’ end of the nucleotide) and a reactive 2-cyanoethyl group at the right end (3’ end of the nucleotide).Attomey Docket No. 229670-701601Additional protecting groups are present on the base (depending on the base) and at the 2’ position in RNA.
[0198] The C12 linker can be coupled to the polynucleotide using the same synthesis cycle as for standard nucleotide couplings. FIG. 7 shows a schematic of the coupling reaction. The C12 linker can be inserted at the 5’ end of the polynucleotide, the 3’ end of the polynucleotide, or even internally. The C12 linker comprising a 5’ amino modifier group can be used to conjugate the siRNA with proteins or other compounds using amine reaction chemistry. FIG. 8 shows a schematic of the C 12 amino modifier spacer after coupling to the 5’ end of a polynucleotide (O — 3’ at lower right) and after deprotection of the oligo.Example 5: In vitro gene silencing efficacy of divalent ANGPTL4 siRNA constructs in adipocytes
[0199] In this study, the effects of divalent ANGPTL4 siRNA construct are evaluated in vitro. More specifically, divalent ANGPTL4 siRNA constructs disclosed in Example 3 are synthesized with the methods described in Example 4. The divalent ANGPTL4 siRNA constructs comprise two ANGPTL4 siRNAs, which can be the same or different. Comparable single ANGPTL4 siRNAs are used as control. 3T3L1 adipocytes are cultured at the appropriate condition and treated with either divalent ANGPTL4 siRNA constructs or the corresponding single ANGPTL4 siRNAs. Cell viability and ANGPTL4 expression are measured at 3 days, 6 days, and 9 days post treatment. The divalent ANGPTL4 siRNA constructs can advantageously increase ANGPTL4 silencing effects than any one of the single ANGPTL4 siRNAs across the various time points that are measured.Example 6: In vitro evaluation of divalent ANGPTL4 siRNAs constructs in ANGPTL4 gene knockdown using adipocyte and hepatocyte co-culturing system
[0200] This study investigates the efficiency of ANGPTL4 knockdown in both adipocytes and hepatocytes using divalent ANGPTL4 siRNAs. More specifically, divalent ANGPTL4 siRNA constructs disclosed in Example 3 are synthesized with the methods described in Example 4. The divalent ANGPTL4 siRNA constructs comprise two ANGPTL4 siRNAs, which can be the same or different. The corresponding single ANGPTL4 siRNA are used as control. The divlent ANGPTL4 siRNAs are conjugated with adipocyte and hepatocyte-specific moieties for cellspecific siRNA delivery. 3T3L1 cells and HepG2 cells are co-cultured in appropriate culture condition. Cells are treated with the divalent ANGPTL4 siRNAs, single ANGPTL4 siRNA targeting adipocyte, or single ANGPTL4 siRNA targeting hepatocyte. Cell viability and ANGPTL4 expression are measured at 3, 6, and 9 days post treatment. Adipocyte and hepatocyteAttomey Docket No. 229670-701601 are sorted using flow cytometry and knock down efficiency is determined. The divalent ANGPTL4 siRNAs can achieve ANGPTL4 knockdown in both adipocyte and hepatocyte simultaneously. The ANGPTL4 knockdown efficiency of the divalent ANGPTL4 siRNAs in adipocyte and hepatocyte can be greater or comparable to single ANGPTL4 siRNA targeting adipocyte or hepatocyte without affecting cell viability. Further siRNA with cell-specific targeting moieties can achieve better knockdown efficiency in the targeted cells than siRNA without the modifications. In certain cases, the divalent ANGPTL4 siRNAs can possess synergistic ANGPTL4 knockdown effects when targeting multiple tissues or cell types at the same time, which can be associated with cellular crosstalk among the targeted tissues or cells.Example 7. In vitro evaluation of divalent ANGPTL4 siRNAs with C12 linker constructs in ANGPTL4 gene knockdown in human hepatocytes and epithelial cells
[0201] This study evaluated the potency of divalent ANGPTL4 siRNAs linked with C12 linker (FIG. 9). In particular, the ANGPTL4 siRNAs comprised an antisense strand sequence set forth in SEQ ID NO: 168 and sense strand sequence set forth in SEQ ID NO: 25, wherein the antisense strand comprised a modification pattern of mfMMMFMMMMMMMFMFMMmmM and the sense strand comprised a modification pattern of mmMMFMFMFMMMMMMMMMMmm, wherein m refers to 2'-OMe 3'-phosphorothioate, M refers to 2'-0me, F refers to 2'-fluoro, and f refers to 2'- fluoro 3'-phosphorothioate. A dose response analysis of the divalent ANGPTL4 siRNAs was evaluated in two cell lines, namely, the Hep3B and HuH-7 cells. Both cell types were plated at 2.5 x 104cells / well and transfected with the divalent ANGPTL4 siRNA via lipid mediated delivery in a 10-point dose response with the final test concentration at 50nM, 16.67nM, 5.56nM, 1.85nM, 0.62nM, 0.21nM, 0.07nM, 0.023nM, 0.007667nM, and 0.0026nM. Total RNA was isolated, followed by cDNA synthesis and RT-qPCR analysis using hsANGPTL4 TaqMan primer / probe sets in combination with a primer-limited hsGAPDH TaqMan primer / probe set. Dose response curves were plotted using the % expression of ANGPTL4. IC20 and IC50 values were calculated using non-linear regression analysis.
[0202] FIG. 10 and FIG. 11 shows results of gene silencing effects of ANGPTL4 siRNA conjugated to C12 linker in hepatocytes and epithelial cells, respectively. An analysis of FIG. 10 shows that the provided divalent ANGPTL4 siRNA conjugated to C12 linker effectively inhibited ANGPTL4 expression in hepatocytes in a dose-dependent manner up to about InM with IC20 at 0.002 nM and IC50 at 0.041 nM. Similarly, an analysis of FIG. 11 indicates that the ANGPTL4 siRNA conjugated to C12 linker decreased ANGPTL4 expression in epithelial cells in a dosedependent manner with the IC20 at 0.003 nM and IC50 at 0.014 nM. The divalent ANGPTL4Attomey Docket No. 229670-701601 siRNAs achieved about 82% ANGPTL4 knockdown in both cell lines, suggesting the divalent ANGPTL4 siRNAs conjugated to C12 linker can be used in multi-tissue ANGTPL4 silencing.Example 8. In vivo evaluation of divalent ANGPTL4 siRNA constructs for the treatment of metabolic disorders.
[0203] The effects of divalent ANGPTL4 siRNAs mediated ANGPTL4 silencing are evaluated in subjects with metabolic disorders. The divalent ANGPTL4 siRNAs are either conjugated to adipose tissue targeting moiety, or conjugated to both, adipose tissue and liver tissue targeting moieties. The divalent ANGPTL4 siRNA constructs are synthesized according to the methods described in Example 4. Briefly, the divalent ANGPTL4 siRNA constructs comprise two ANGPTL4 siRNAs, which can be the same or different. The corresponding single ANGPTL4 siRNA without adipose tissue and liver targeting moieties are used as control. The subjects are treated with either the divalent ANGPTL4 siRNAs or corresponding control siRNA for multiple doses that are 2 days to 4 weeks apart for a period of 3 months to 2 years. Cholesterol, LDL-C, HDL-C, triglycerides, apolipoproteins, lipoproteins, alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and A1C level are measured before the treatment (dO) and every month after the start of the treatment till the end of the treatment. Body weight of the subjects is recorded daily, and BMI of the subjects is measured monthly. The expression level of ANGPTL4 in targeted issue is evaluated for experimental animal subjects. Subjects administered with the divalent ANGPTL4 siRNAs can have significantly greater reduction of ANGPTL4 expression in the targeted tissue as compared to the ones in the subjects that receive the corresponding control siRNA. Accordingly, the subjects administered with the divalent ANGPTL4 siRNAs can have lower BMI, triglycerides, LDL-C / HDL-C ratio, A1C, as compared to the ones administered with the control siRNA. siRNA modifications described herein can also increase ANGPTL4 siRNA knockdown efficiency.
Claims
1. Attorney Docket No. 229670-701601CLAIMSWHAT IS CLAIMED IS:
1. A composition comprising:(a) at least two small interfering ribonucleic acids (siRNAs) that when administered to a cell decreases expression of a gene, wherein each of the at least two siRNAs comprises a sense strand and an antisense strand, wherein at least one of the at least two siRNAs comprises at least one modified inter-nucleoside linkage, at least one modified nucleoside, or a combination thereof, and wherein at least one of the at least two siRNAs comprises an antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and(b) a multivalent linker that directs the composition to a target site, wherein the target site is an adipose tissue, a liver tissue or a combination thereof.
2. The composition of claim 1, wherein the multivalent linker selectively directs the composition to an adipose tissue associated with one or more of liver, intestine, kidney and peritoneum.
3. The composition of claim 1 or 2, wherein at least one siRNA of the at least two siRNAs comprises a length in a range of from 21 nucleotides to 23 nucleotides.
4. The composition of any one of claims 1-3, wherein the sense strand and the antisense strand independently have a length in a range of from 21 nucleotides to 23 nucleotides.
5. The composition of any one of claims 1-4, wherein the antisense strand of at least one of the at least two siRNAs comprises a 3' overhang relative to the sense strand of the siRNA.
6. The composition of any one of claims 1-4, wherein the sense strand of at least one of the at least two siRNAs comprises a 3' overhang relative to the antisense strand of the siRNA.
7. The composition of any one of claims 1-6, wherein the antisense strand and the sense strand of at least one of the at least two siRNAs have different lengths relative to each other.
8. The composition of any one of claims 1-4, wherein the antisense strand and the sense strand of at least one of the at least two siRNAs have the same lengths relative to each other.
9. The composition of any one of claims 1-8, wherein at least one of the at least two siRNAs comprises one or more xeno nucleic acid (XNA) modifications.
10. The composition of any one of claims 1-8, wherein at least one of the at least two siRNAs comprises an antisense strand that hybridizes to an mRNA encoding angiopoietin-like proteins or variants thereof.
11. The composition of any one of claims 1-9, wherein the modified inter-nucleoside linkage comprises:Attorney Docket No. 229670-701601Formula XXVI; Formula XXVII; Formula XXVIII; or a combination thereof.
12. The composition of any one of claims 1-9, wherein the modified inter-nucleoside linkage comprises:(Formula IV); (Formula V); (Formula VI); orAttorney Docket No. 229670-701601(Formula VII); wherein: each B is, independently, a base pairing moiety;W is selected from the group consisting of O, OCH2, OCH, CH2, and CH; each X is, independently, selected from the group consisting of halo, hydroxy, and Ci- 6 alkoxy;Y is selected from the group consisting of O , OH, OR, NH , NH2, S", and SH;Z is selected from the group consisting of O and CH2; when Y is O or S", either Z or W is not O;R is a protecting group; and is an optional double bond.
13. The composition of claim 11, wherein the base pairing moiety B is selected from the group consisting of adenine (A), guanine (G), cytosine (C), and uracil (U).
14. The composition of any one of claims 11 to 13, wherein the R is a protecting group selected from the group consisting of: dimethoxy trityl (DMTr), succinate, tert-butyl dimethyl silyl (TBDMS), benzoyl (Bz), benzyl (Bn), methoxyethoxymethyl ether (MOM), methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuranyl (THF), trityl (Trt), triisopropyl silyl (TIPS), tertbutyldiphenylsilyl (TBDPS), and acetate.
15. The composition of any one of claims 1-8, wherein at least one of the at least two siRNAs comprises one or more extended-Nucleic Acid (exNA) modifications.
16. The composition of claim 1, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6.
17. The composition of claim 1, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7.Attomey Docket No. 229670-70160118. The composition of claim 1, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 18-160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-266419. The composition of claim 1, wherein the at least one of the at least two siRNAs comprises a sense strand and / or an antisense strand, wherein the sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711.
20. The composition of any one of claims 1-19, wherein the multivalent linker comprises a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof.
21. The composition of claim 20, wherein the multivalent linker is a divalent linker.
22. The composition of any one of claims 1-21 further comprising at least one moiety, wherein the at least one moiety is selected from a lipid, a peptide, a protein, an antibody, an antibody fragment, a small molecule, a nanobody, a sugar, a polymer, a polynucleotide, or a combination thereof.
23. The composition of any one of claims 20-22, wherein the sugar comprises an N- acetylgalactosamine (GalNAc) amino sugar or a derivative thereof.
24. The composition of claim 22 or 23, wherein the moiety is an adipose tissue targeting moiety.
25. The composition of claim 22 or 23, wherein the moiety is a liver targeting moiety.
26. The composition of any one of claims 1-25, wherein the composition is hydrophobic.
27. The composition of any one of claims 1-26, wherein the composition has in vivo half-life that is at least 10% longer than a half-life of a corresponding composition that does not comprise modifies siRNAs.
28. The composition of any one of claims 1-27, wherein the composition has at least 10% more in vivo bioavailability in liver or adipose tissue than bioavailability in brain, intestine, thyroid, kidney, and heart combined together.
29. The composition of any one of claims 1-28 further comprising a pharmaceutically acceptable carrier or excipient.
30. A composition comprising:(a) at least two siRNAs, wherein at least one siRNA of the at least two siRNA hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof or a fragment thereof in a cell or a tissue, wherein at least one of the atAttorney Docket No. 229670-701601 least two siRNAs comprises at least one modified inter-nucleoside linkage selected from:Formula IV; Formula V; Formula VI; orFormula VII; wherein: each B is, independently, a base pairing moiety;W is selected from the group consisting of O, OCH2, OCH, CH2, and CH; each X is, independently, selected from the group consisting of halo, hydroxy, andCi-6 alkoxy;Attomey Docket No. 229670-701601Y is selected from the group consisting of O , OH, OR, NH , NH2, S , and SH;Z is selected from the group consisting of O and CH2; when Y is O or S", either Z or W is not O;R is a protecting group; and is an optional double bond; and(b) a multivalent linker that connects the at least two siRNAs to each other, wherein the multivalent linker selectively directs the composition to an adipose tissue.
31. A composition comprising:(a) at least two double stranded polynucleotides, wherein at least one of the at least two double stranded polynucleotides comprises: an antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and a polynucleotide interlinkage modification;(b) a multivalent linker that connects the at least two siRNAs to each other, wherein the multivalent linker directs the composition to an adipose tissue; and(c) a liver targeting moiety.
32. The composition of claim 30 or 31, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6.
33. The composition of claim 30 or 31, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7.
34. The composition of claim 30 or 31, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in 18-160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-266435. The composition of claim 30 or 31, wherein the at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-71136. A method of reducing expression of angiopoietin-like protein 4 (ANGPTL4) in adipose tissues, the method comprising administering to a subject the composition of any one of claims 1-35.Attomey Docket No. 229670-70160137. A method of treating a disease or a condition in a subject, the method comprising administering to the subject the composition of any one of claims 1-35, thereby treating the disease or the condition.
38. A method of reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in a subject, the method comprising administering to the subject the composition of any one of claims 1-35, thereby reducing body weight or body fat and maintaining reduced body weight or body fat, or both, in the subject.
39. The method of any one of claims 36-38, wherein the administering is local or systemic.
40. The method of any one of claims 36-39, wherein the administering is by subcutaneous, intravenous, intradermal, intramuscular, intraadipose, inhalation, intravenous, intraperitoneal, intraocular, intravitreal, intratumoral, intracranial, sublingual, oral, or intrathecal administration.
41. The method of any one of claims 36-40, further comprising administering to the subject an additional therapeutic agent.
42. The method of claim 41, wherein the additional therapeutic agent comprises: a glucagon- like peptide-1 (GLP-1) receptor agonist, a dipeptidyl peptidase 4 (DPP -4) inhibitor, a sodium-glucose cotransporter-2 (SGLT2) inhibitor, metformin, insulin, an angiotensin II receptor antagonist, an angiotensin converting enzyme (ACE) inhibitor, a beta-blocker, a calcium channel blocker, a thrombocyte aggregation inhibitor, salts, or derivatives thereof.
43. The method of claim 42, wherein the GLP-1 receptor agonist is selected from the group consisting of: exenatide, exenatide LAR, liraglutide, taspoglutide, semaglutide, albiglutide, lixisenatide and dulaglutide.
44. The method of claim 42, wherein the DPP-4 inhibitor is selected from the group consisting of: sitagliptin, saxagliptin, linagliptin, and alogliptin.
45. The method of claim 42, wherein the SLGT2 inhibitor is selected from the group consisting of: canagliflozin, dapagliflozin, empagliflozin, and ertugliflozin.
46. The method of any one of claims 37-45, wherein the condition comprises CVD risk, diabetes mellitus, hypertension, obesity, metabolic syndrome, dyslipidemia, or combinations thereof.
47. The method of any one of claims 37-46, wherein the disease or condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts,Attomey Docket No. 229670-701601 diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
48. The method of any one of claims 37-47, wherein the method decreases food intake, increases energy expenditure, reduces body weight, regulates appetite, induces satiety, or prevents weight regain after successful weight loss relative to the subject before administration.
49. A composition comprising:(a) two small interfering ribonucleic acids (siRNAs) that when administered to a cell decreases expression of a gene, wherein at least one of the two siRNAs comprises one or more xeno nucleic acid (XNA) modifications, and wherein at least one of the at least two siRNAs comprises an antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and(b) a multivalent linker that directs the composition to an adipose tissue, a liver tissue or a combination thereof.
50. The composition of claim 49, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the nucleotide sequences provided in Table 4 or Table 6.
51. The composition of claim 49, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the antisense strand comprises any one of the nucleotide sequences provided in Table 5 or Table 7.
52. The composition of claim 49, wherein the at least one of the at least two siRNAs comprises a sense strand and an antisense strand, wherein the sense strand comprises any one of the sequences set forth in 18-160, 304-405, and 712-811, and wherein the antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 161-303, 406-507, and 2566-266453. The composition of claim 49, wherein the at least one of the at least two siRNAs comprises a modified sense strand or a modified antisense strand, wherein the modified sense strand comprises any one of the sequences set forth in SEQ ID NOs: 508-609; and wherein the modified antisense strand comprises any one of the sequences set forth in SEQ ID NOs: 610-711Attorney Docket No. 229670-70160154. A method of treating a disease or a condition in a subject, the method comprising administering to the subject the composition from any one of claims 49-51, thereby treating the disease or the condition, wherein the disease or the condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
55. A composition comprising:(a) a small interfering ribonucleic acid (siRNA) that when administered to a cell decreases expression of a gene, wherein the siRNA comprises one or more xeno nucleic acid (XNA) modifications, and wherein the siRNA comprises an antisense strand that hybridizes to an mRNA encoding angiopoietin-like protein 4 (ANGPTL4) (SEQ ID NO: 1), a portion thereof, or a fragment thereof; and(b) a linker comprising a sugar or a peptide, wherein the linker directs the composition to an adipose tissue.
56. A method of treating a disease or a condition in a subject, the method comprising administering to the subject the composition of claim 55, thereby treating the disease or the condition, wherein the disease or the condition comprises hypertriglyceridemia, familial chylomicronemia syndrome, dyslipidemia, homozygous familial hypercholesterolemia, obesity, type II diabetes, cancer, learning impairment, memory impairment, myocardial infarction, stroke, a neurodegenerative disorder, impaired glucose tolerance, impaired fasting glucose, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, myocardial infarction, angina pectoris, hypertension, epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease,Attomey Docket No. 229670-701601 motor-neuron disease, traumatic brain injury, spinal cord injury, peripheral neuropathy, eating disorders, pancreatitis, or a combination thereof.
57. A method of treating diabetes in a subject, the method comprising administering to the subject an effective amount of composition in any one of claims 1, 30, 31, 49, and 55, wherein the administering of the composition increases insulin sensitivity and reduces blood glucose and A1C level in the subject as compared their level prior to the administration.
58. A method of treating obesity in a subject, the method comprising administering to the subject an effective amount of composition in any one of claims 1, 30, 31, 49, and 55, wherein the administering of the composition reduces adipose tissue deposition and / or ectopic fat in the subject as compared to the adipose tissue deposition and / or ectopic fat prior to the administration.
59. A method of treating hypertriglyceridemia in a subject, the method comprising administering to the subject an effective amount of composition in any of claims 1, 30, 31, 49, and 55, wherein the administering of the composition reduces the level of triglycerides, cholesterol, and / or LDL-cholesterol in the subject as compared the triglycerides, cholesterol, and / or LDL-cholesterol level prior to the administration.
Citation Information
Patent Citations
Adipocyte-targeting non-viral gene delivery system
US20160130579A1
Oligonucleotides for treatment of angiopoietin like 4 (angptl4) related diseases
US20220340907A1
Therapeutic combination of galnac-oligonucleotide conjugate and saponin, and uses thereof
US20230293562A1