Pancoronavirus biomarker panel

The pancoronavirus biomarker panel addresses the limitations of current SARS-CoV-2 detection methods by using specific primers and probes for rapid, sensitive, and quantitative detection of multiple coronaviruses, including SARS-CoV-2 variants, in a single sample, suitable for point-of-care testing.

WO2026064358A1PCT designated stage Publication Date: 2026-03-26CEPHEID INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current methods for detecting SARS-CoV-2 variants are costly, slow, and require specialized instruments, making them unsuitable for point-of-care settings, and multiplexed nucleic acid detection often leads to erroneous results due to variations in sampling and assay conditions.

Method used

A pancoronavirus biomarker panel using specific primers and probes for multiple coronavirus genes, enabling rapid, sensitive, and quantitative detection of multiple targets in a single sample using a closed, affordable instrument, suitable for point-of-care testing.

Benefits of technology

The biomarker panel allows for rapid, sensitive, and accurate detection of various coronaviruses, including SARS-CoV-2 variants, in a single sample, overcoming the limitations of existing methods by providing a cost-effective and reliable point-of-care solution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046712_26032026_PF_FP_ABST
    Figure US2025046712_26032026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides pancoronavirus biomarker panels that can be used to detect a wide variety of characterized coronavirus strains and, in some embodiments, emerging or novel coronavirus strains. In certain embodiments, this detection can be carried out in a single, highly multiplexed nucleic acid amplification assay.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No: P2024-0535-WO (68634WO01) Patent Application For PANCORONAVIRUS BIOMARKER PANELInventor(s): Linda Strömqvist Meuzelaar, a citizen of Sweden, with a mailing address of c / o Cepheid, Röntgenvägen, SE-17154 Solna, SWEDEN. Ning Wang, a citizen of China, with a mailing address of c / o Cepheid, Röntgenvägen, SE-17154 Solna, SWEDEN. Johan Nordholm, a citizen of Sweden, with a mailing address of c / o Cepheid, Röntgenvägen, SE-17154 Solna, SWEDEN. Assignee: Cepheid Entity: LargeDocket No. P2024-0535-WO (68634WO01) PANCORONAVIRUS BIOMARKER PANEL CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 695,758, filed on September 17, 2024, the content of which is hereby incorporated by reference in its entirety into this disclosure. INCORPORATION BY REFERENCE OF AN ELECTRONIC SEQUENCE LISTING

[0002] This application contains a Sequence listing that has been submitted in a computer readable format and is hereby incorporated by reference in its entirety. The computer readable file, created on September 17, 2025, is named 68634WO01_SEQ_LIST_ST26.xml and is 155,648 bytes in size. STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0003] Not applicable. FIELD

[0004] The present invention relates to generally to the area of pancoronavirus detection. BACKGROUND

[0005] The coronavirus disease-2019 (COVID-19) pandemic has changed the world, leading to millions of deaths and disability in some survivors. Despite advances in diagnosis and vaccination, the emergence of severe acute respiratory syndrome coronavirus 2 (SARS- CoV-2) variants continues to threaten human populations. The World Health Organization and the CDC have identified SARS-CoV-2 variants of concern (VOCs), which lead to increased disease severity, increased transmission, and immune / vaccine evasion. Variants of interest also have been identified that present theoretical risks because they possess mutations similar to the mutations in the VOC. Specific frequently occurring mutations alsoDocket No. P2024-0535-WO (68634WO01) have been identified that can affect therapeutic antibody treatments for patients infected with such variants.

[0006] Initially, the most common technique to identify, classify, and track variants of SARS-CoV-2 was deep sequencing. Although sequencing is accurate and can identify each mutation present in a sample, it is costly, slow, and requires specialized instruments and interpretation when compared with other genotyping techniques, such as polymerase chain reaction (PCR).

[0007] PCR and other nucleic acid amplification methods can provide higher sensitivity and faster time to results than sequencing. However, current nucleic acid amplification methods have limitations because the amplification reaction and signal detection require a controlled environment and precise measurement with expensive instruments. Thus, the methods are often cost-prohibitive for use in point-of-care situations. Additionally, some methods are not optimized for detection of multiplexed target nucleic acids in single patient samples. Detection of multiplexed targets may be accomplished by signal multiplexing in single-pot reactions (fluorescent spectral multiplexing, arrays of electrochemical detectors), physical separation of multiple reactions into unique reaction vessels, or a combination thereof. Physical separation of multiple reactions into unique reaction vessels can lead to erroneous results due to differences in sampling or in assay conditions during reactions, which can confound efforts to make differential diagnoses. Multiplexing can overcome some of these difficulties, but presents its own technical challenges, particularly with attempts to assay for more than a few pathogens in a single reaction mixture. Since the early 2000s DNA-detection technologies have bifurcated into either massively multiplexed but slow systems (next-generation sequencing (NGS) and microarrays), or rapid assays with limited capacity for multiplexing (quantitative PCR (qPCR) and isothermal amplification).

[0008] Furthermore, in the case of a CLIA-waived test, no more than three simple steps must be required by the user to simultaneously query a panel of target nucleic acids using a single patient sample. Physical separation of samples into discrete chambers quickly becomes infeasible for CLIA-waived tests, unless a complicated device or disposable automatically handles processing. Spectral multiplexing with fluorescence can reduce the number of unique reactions required to detect a panel of target nucleic acids, but spectralDocket No. P2024-0535-WO (68634WO01) multiplexing LAMP reactions has required dramatic sacrifices in assay speed or signal strength, dampening prospects for successful application to point-of-care testing.

[0009] The methods, compositions, and devices presented herein achieve rapid, sensitive, qualitative and optionally quantitative detection of many target nucleic acids (DNA and RNA) from a single sample, in some embodiments, using a closed and affordable instrument. SUMMARY

[0010] Various embodiments contemplated herein may include, but need not be limited to, one or more of the following:

[0011] Embodiment 1: A set of primers and / or probes for detecting the presence of coronavirus in a sample, the set comprising: at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of β-coronavirus C (Merbecovirus), comprising an oligonucleotide sequence conserved across β-coronavirus C; at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of β-coronavirus B (Sarbecovirus), comprising an oligonucleotide sequence conserved across β-coronavirus B; and at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of SARS-CoV-2, comprising an oligonucleotide sequence that is not conserved across Sarbecovirus.

[0012] Embodiment 2: The set of embodiment 1, comprising: the at least one primer pair and / or probe specific for the ORF gene of β-coronavirus C (Merbecovirus), which is specific for the ORF1ab gene of β-coronavirus C; the at least one primer pair and / or probe specific for the E gene of β-coronavirus B (Sarbecovirus); and an additional primer pair and / or probe specific for two or more of the N gene, ORF gene, and the RdRp gene of SARS-CoV-2, comprising oligonucleotide sequences that are not conserved across Sarbecovirus.

[0013] Embodiment 3: The set of embodiment 2, wherein: the at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:4, 5, and 24-30; the at least one primer pair and / or probe specific for the EDocket No. P2024-0535-WO (68634WO01) gene of β-coronavirus B (Sarbecovirus) comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:12, 13, and 43-46; and the additional primer pair and / or probe specific for two or more of the N gene, ORF gene, and the RdRp gene of SARS-CoV-2, comprising oligonucleotide sequences that are not conserved across Sarbecovirus, comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs: 105, 106, and 110-129.

[0014] Embodiment 4: The set of embodiment 1, comprising: the at least one primer pair and / or probe specific for the ORF gene of β-coronavirus C (Merbecovirus), which is specific for the ORF1ab gene of β-coronavirus C; the at least one primer pair and / or probe specific for the E gene of β-coronavirus B (Sarbecovirus); at least one primer pair and / or probe specific for an oligonucleotide sequence between the N gene and the 3’ UTR of β- coronavirus B (Sarbecovirus), wherein the oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus) is conserved across β-coronavirus B; the at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of SARS-CoV-2, which is specific for the ORF1ab gene of SARS-CoV-2, wherein the primer pair and / or probe specific for the ORF1ab gene of SARS- CoV-2 comprise an oligonucleotide sequence that is not conserved across Sarbecovirus.

[0015] Embodiment 5: The set of embodiment 4, wherein: the at least one primer pair and / or probe specific for ORF1ab gene of β-coronavirus C comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:4, 5, and 24-30; the at least one primer pair and / or probe specific for the E gene of β- coronavirus B (Sarbecovirus) comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:12, 13, and 43-46; the at least one primer pair and / or probe specific for an oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus), wherein the oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus) is conserved across β-coronavirus B, comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:107 and 130-138; the at least one primer pair and / or probe specific for the ORF1ab gene of SARS-CoV-2 comprising an oligonucleotide sequence that is not conserved across SarbecovirusDocket No. P2024-0535-WO (68634WO01) comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:105, 106, and 110-129.

[0016] Embodiment 6: The set of any one of embodiments 1-5, further comprising a pancoronavirus set of primers and / or probes for detecting the presence of pancoronavirus in the sample, the pancoronavirus set comprising: at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus; and at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of all three of β-coronavirus, γ-coronavirus, and δ-coronavirus.

[0017] Embodiment 7: The set of any one of embodiments 1-5, further comprising a pancoronavirus set of primers and probes for detecting the presence of pancoronavirus in the sample, the pancoronavirus set comprising: at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β- coronavirus, and δ-coronavirus; at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus; and at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus.

[0018] Embodiment 8: The set of any one of embodiments 1-7, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C.

[0019] Embodiment 9: The set of any one of embodiments 1-8, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2, preferably all three of the E gene, N gene, and RDRP gene of SARS-CoV-2.

[0020] Embodiment 10: The set of any one of embodiments 1-9, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the N gene of β-coronavirus C.

[0021] Embodiment 11: The set of any one of embodiments 1-10, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1a gene, S2 gene, or a combination thereof, of SARS-CoV-1.Docket No. P2024-0535-WO (68634WO01)

[0022] Embodiment 12: The set of any one of embodiments 1-11, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A.

[0023] Embodiment 13: The set of any one of embodiments 1-12, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the S gene of α-coronavirus.

[0024] Embodiment 14: The set of any one of embodiments 1-5, further comprising a pancoronavirus set of primers and / or probes for detecting the presence of pancoronavirus in a sample, the pancoronavirus set comprising: at least one primer pair and / or probe specific for the N gene of β-coronavirus C; at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C; at least one primer pair and / or probe specific for the ORF1a gene, S gene, or a combination thereof, of SARS-CoV-1; at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2; at least one primer pair and / or probe specific for the ORF1a gene of β- coronavirus A; and at least one primer pair and / or probe specific for the S gene of α- coronavirus.

[0025] Embodiment 15: The set of embodiment 14, wherein the pancoronavirus set additionally comprises: at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ- coronavirus; at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus; and at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ- coronavirus.

[0026] Embodiment 16: The set of any one of embodiments 6-15, wherein, when present: the at least one primer pair and / or probe specific for the N gene of β-coronavirus C comprises an oligonucleotide sequence present in MERS-CoV but not conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1ab gene of β- coronavirus C comprises an oligonucleotide sequence conserved across Merbecovirus; the at least one primer pair and / or probe specific for the E gene of SARS-CoV-2 comprises an oligonucleotide sequence conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A comprises an oligonucleotideDocket No. P2024-0535-WO (68634WO01) sequence present in CoV-OC43 and CoV-HKU1; and / or the at least one primer pair and / or probe specific for the S gene of α-coronavirus A comprises an oligonucleotide sequence present in CoV-229E and CoV-NL63.

[0027] Embodiment 17: The set of embodiment 16, wherein: the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A is not conserved across β- coronavirus A; and the at least one primer pair and / or probe specific for the S gene of α- coronavirus A is not conserved across α-coronavirus A.

[0028] Embodiment 18: The set of embodiment 16, wherein the pancoronavirus set comprises the at least one primer pair and / or probe specific for the ORF1a gene of β- coronavirus A, which comprises: at least one primer pair and / or probe specific for the ORF1a gene of CoV-OC43; and / or at least one primer pair and / or probe specific for the ORF1a gene of CoV-HKU1.

[0029] Embodiment 19: The set of embodiment 18, wherein the at least one primer pair specific for the ORF1a gene of CoV-OC43 and the at least one primer pair specific for the ORF1a gene of CoV-HKU1 have greater than 85% homology.

[0030] Embodiment 20: The set of embodiment 16 or embodiment 18, wherein the pancoronavirus set comprises at least one primer pair and / or probe specific for the S gene of α-coronavirus, which comprises: at least one primer pair and / or probe specific for the S gene of CoV-229E; and / or at least one primer pair and / or probe specific for the S gene of CoV-NL63.

[0031] Embodiment 21: The set of embodiment 20, wherein the at least one primer pair specific for the S gene of CoV-229E and the at least one primer pair specific for the S gene of CoV-NL63 have greater than 85% homology.

[0032] Embodiment 22: The set of any one of embodiments 6-13, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus comprises an oligonucleotide sequence conserved across α-coronavirus; and the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus, γ-coronavirus, and δ- coronavirus comprises an oligonucleotide sequence present in β-coronavirus A, β- coronavirus D, γ-coronavirus, and δ-coronavirus but not conserved in Merbecovirus (β- coronavirus C) and / or not in Sarbecovirus (β-coronavirus B).Docket No. P2024-0535-WO (68634WO01)

[0033] Embodiment 23: The set of any one of embodiments 6-13, wherein: the at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ-coronavirus comprises an oligonucleotide sequence conserved across all α-coronavirus, γ-coronavirus, β-coronavirus and δ-coronavirus; the at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus comprises at least one oligonucleotide sequence present in α-coronavirus, and at least one oligonucleotide sequence present in γ-coronavirus; and the at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus comprises at least one oligonucleotide sequence present in β-coronavirus, and at least one oligonucleotide sequence present in δ-coronavirus, wherein the at least one oligonucleotide sequence present in β-coronavirus is not conserved in Merbecovirus (β-coronavirus C) and / or in Sarbecovirus (β-coronavirus B).

[0034] Embodiment 24: The set of embodiment 14, wherein: the at least one primer pair and / or probe specific for the N gene of β-coronavirus C comprises at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C comprises at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene, S gene, or a combination thereof, of SARS-CoV-1 comprises: at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2 comprises: at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene is conserved across Sarbecovirus; and at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene of β- coronavirus A comprises: at least one primer pair and / or probe specific for the ORF1aDocket No. P2024-0535-WO (68634WO01) gene of CoV-OC43, wherein the ORF1a gene is not conserved across β-coronavirus A; and at least one primer pair and / or probe specific for the ORF1a gene of CoV- HKU1, wherein the ORF1a gene is not conserved across β-coronavirus A; and the at least one primer pair and / or probe specific for the S gene of α-coronavirus comprises: at least one primer pair and / or probe specific for the S gene of CoV-229E, wherein the S gene is not conserved across α-coronavirus; and at least one primer pair and / or probe specific for the S gene of CoV-NL63, wherein the S gene is not conserved across α-coronavirus.

[0035] Embodiment 25: The set of any one of embodiments 6-13, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene or an ORF1ab gene that is conserved across α-coronavirus; the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus, γ-coronavirus, and δ-coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene or an ORF1ab gene that is conserved across β-coronavirus A, β-coronavirus D, γ-coronavirus, and δ-coronavirus, but not conserved in Merbecovirus (β-coronavirus C) and / or not in Sarbecovirus (β-coronavirus B); and the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene is conserved across Sarbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of CoV-OC43, wherein the ORF1a gene is not conserved across β-coronavirus A; at least one primer pair and / or probe specific for the ORF1a gene of CoV-HKU1, wherein the ORF1a gene is not conserved across β- coronavirus A; at least one primer pair and / or probe specific for the S gene of CoV-229E,Docket No. P2024-0535-WO (68634WO01) wherein the S gene is not conserved across α-coronavirus; and at least one primer pair and / or probe specific for the S gene of CoV-NL63, wherein the S gene is not conserved across α-coronavirus.

[0036] Embodiment 26: The set of embodiment 6, wherein: at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α- coronavirus, β-coronavirus, γ-coronavirus, and δ-coronavirus, wherein the at least one primer pair and / or probe is conserved across α-coronavirus, β-coronavirus A, β-coronavirus D, γ-coronavirus, and δ-coronavirus, but not conserved in Merbecovirus (β-coronavirus C) and in Sarbecovirus (β-coronavirus B); at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene is conserved across Sarbecovirus.

[0037] Embodiment 27: The set of embodiment 7, wherein: the at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α- coronavirus, γ-coronavirus, β-coronavirus and δ-coronavirus comprise at least one nucleotide sequence having at least about 60% homology to an identical or complementary sequence of SEQ ID NO:61 and / or SEQ ID NO:74.

[0038] Embodiment 28: The set of embodiment 7, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, β-coronavirus, γ-coronavirus, and δ-coronavirus, comprise a degenerate nucleotide sequence.Docket No. P2024-0535-WO (68634WO01)

[0039] Embodiment 29: The set of any one of embodiments 6-28, wherein: the at least one primer pair and / or probe specific for the ORF1ab gene of Merbecovirus, comprise a degenerate nucleotide sequence.

[0040] Embodiment 30: The set of any one of embodiments 24-26, wherein, when present, the primers and / or probe specific for the N gene of MERS-CoV comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 1, 21, 22, and 23; the primers and / or probe specific for the ORF1ab gene of β-coronavirus C (Merbecovirus) comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 4, 5, 24, 25, 26, 27, 28, 29, and 30; the primers and / or probe specific for the ORF1a gene of SARS-CoV-1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 9, 31, 32, and 33; the primers and / or probe specific for the S gene of SARS-CoV-1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 6, 7, 34, 35, and 36; the primers and / or probe specific for the N gene of SARS-CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 10, 37, 38, and 39; the primers and / or probe specific for the RDRP gene of SARS-CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 11, 40, 41, and 42; the primers and / or probe specific for the E gene of SARS-CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 12, 13, 43, 44, 45, and 46; the primers and / or probe specific for the ORF1a gene of CoV-OC43 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 16, 47, 48, 49, and 50; the primers and / or probe specific for the ORF1a gene of CoV-HKU1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 17, 51, 52, 53, and 54; the primers and / or probe specific for the S gene of CoV-229E comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 14, 58, 59, and 60; the primers and / or probe specific for the S gene of CoV-NL63 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 15, 555, 56, and 57; the primers and / or probe specific for the RdRP gene conserved across α-coronavirus comprise a sequence that is identical orDocket No. P2024-0535-WO (68634WO01) complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 61, 62, 63, 64, 65, 74, 75, 76, 80, 81, 82, 83, and 89; the primers and / or probe specific for the RdRP gene conserved in β-coronavirus, γ-coronavirus, and δ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, and 90-104 ; the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β- coronavirus and δ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, and 61-77; the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 80, 81, 82, 83, 84, and 85; and the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 78, 79, 86, 87, and 88.

[0041] Embodiment 31: The set of any one of embodiments 1-30, wherein at least one of the primers and / or probes comprises a detectable label.

[0042] Embodiment 32: The set of any one of embodiments 1-31, wherein the set comprises at least one probe comprising a fluorescent dye and a quencher molecule.

[0043] Embodiment 33: The set of any one of embodiments 1-32, further comprises a primer pair specific for an exogenous control and / or an endogenous control, wherein the exogenous control is a sample processing control, and wherein the endogenous control is a sample adequacy control.

[0044] Embodiment 34: The set of any one of embodiments 1-33, wherein the set is contained within one or more cartridge(s).

[0045] Embodiment 35: The set of embodiment 34, wherein the set is contained in one cartridge.

[0046] Embodiment 36: The set of embodiment 35, wherein the cartridge comprises: a cartridge body having a plurality of chambers defined therein, wherein the plurality of chambers is in fluidic communication through a fluidic path of the cartridge; a reaction vessel comprising one or more reaction chambers and configured for amplification of theDocket No. P2024-0535-WO (68634WO01) nucleic acid, wherein each reaction chamber is configured for detection of a plurality of amplification products, wherein the reaction vessel is attached to the cartridge body and fluidically coupled to the fluidic path of the cartridge; and a filter disposed in the fluidic path between the plurality of chambers and the reaction vessel.

[0047] Embodiment 37: The set of any one of embodiments 34-36, wherein the at least one of the plurality of chambers comprises the set of primers and / or probes, or subset thereof, and at least one different chamber of the plurality of chambers comprises one or more lysis reagents for releasing nucleic acid from a sample.

[0048] Embodiment 38: A cartridge for detecting coronaviruses in a biological sample, the cartridge comprising: a cartridge body comprising a plurality of chambers therein, wherein the plurality of chambers includes: a sample chamber having at least a fluid outlet in fluid communication with another chamber of the plurality; and a lysis chamber in fluidic communication with the sample chamber, the lysis chamber comprising one or more lysis reagents for releasing nucleic acid, optionally wherein the sample chamber and lysis chamber are the same; a reaction vessel fluidically coupled to the plurality of chambers of the cartridge body and configured for i) amplification of nucleic acid and ii) detection of a plurality of amplification products; a filter disposed in a fluidic path between the lysis chamber and the reaction vessel; and a set of primers and / or probes according to any one of embodiments 1-33, the set disposed in one or more chambers of the plurality of chambers and / or in the reaction vessel for detection of nucleic acid sequences characteristic of β- coronavirus C, β-coronavirus A, α-coronavirus, SARS-CoV-1, and / or SARS-CoV-2.

[0049] Embodiment 39: The cartridge of embodiment 38, wherein the sample chamber and the lysis chamber are the same.

[0050] Embodiment 40: A cartridge for detecting coronaviruses in a biological sample, the cartridge comprising: a first body having a plurality of chambers; a second body fluidically coupled to the first body; a valve assembly configured to rotate and having at least one port fluidically coupled to the second body; a reaction vessel fluidically coupled to the first body or the second body and configured for i) amplification of nucleic acid and ii) detection of a plurality of amplification products; and a set of primers and / or probes according to any one of embodiments 1-33, the set disposed in one or more chambers of the plurality of chambers and / or in the reaction vessel for detection of nucleic acid sequencesDocket No. P2024-0535-WO (68634WO01) characteristic of β-coronavirus C, β-coronavirus A, α-coronavirus, SARS-CoV-1, and / or SARS-CoV-2.

[0051] Embodiment 41: The cartridge of embodiment 40, wherein the cartridge comprises a plurality of flow paths formed on the upper region of the second body, one end overlapping the port of the piston and the other end overlapping the port of the first body.

[0052] Embodiment 42: The cartridge of any one of embodiments 38-41, wherein the reaction vessel comprises one or more reaction chambers for detection of the plurality of amplification products.

[0053] Embodiment 43: The cartridge of embodiment 42, wherein each reaction chamber is configured to detect a single amplification product.

[0054] Embodiment 44: The cartridge of embodiment 42 or embodiment 43, wherein each reaction chamber is configured to detect a plurality of amplification products.

[0055] Embodiment 45: The cartridge of embodiment 44, wherein the cartridge is configured to detect simultaneously a plurality of amplification products present in solution in a single reaction chamber.

[0056] Embodiment 46: The cartridge of any one of embodiments 38-44, wherein the cartridge is a Clinical Laboratory Improvement Amendments (CLIA)-compliant cartridge.

[0057] Embodiment 47: The cartridge of any one of embodiments 38-46, wherein the cartridge is configured to carry our isothermal amplification.

[0058] Embodiment 48: The cartridge of any one of embodiments 38-46, wherein the cartridge is configured to carry out non-isothermal, optionally by thermal cycling or temperature oscillation.

[0059] Embodiment 49: A kit comprising a set according to any one of embodiments 1-37 or a cartridge according to any one of embodiments 38-48.

[0060] Embodiment 50: A method for detecting coronaviruses in a biological sample, the method comprising: a) contacting nucleic acid from the sample with a set of primers and optional probes according to any one of embodiments 1-33; b) subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions; c) detecting the presence of amplification product(s), optionally via real-time PCR, melt curve analysis,Docket No. P2024-0535-WO (68634WO01) or a combination thereof, and d) detecting the presence of a coronavirus in the sample based on detection of the amplification products.

[0061] Embodiment 51: The method of embodiment 50, wherein the method comprises administering a treatment regimen to a subject based on detecting the presence of a coronavirus in the sample.

[0062] Embodiment 52: The method of embodiment 50 or embodiment 51, wherein detecting the presence of amplification product(s) comprises: performing melt assay of the amplification products; and conducting melt curve analysis to detect the presence of one or more amplification products in the reaction vessel.

[0063] Embodiment 53: The method of embodiment 50 or embodiment 51, wherein detecting the presence of amplification product(s) comprises both real-time PCR and melt curve analysis.

[0064] Embodiment 54: The method of any one of embodiments 50-53, wherein: a) said contacting nucleic acid from the sample with the set of primers and optional probes comprises: placing the sample in a cartridge comprising a cartridge body having a plurality of chambers in fluidic communication, a reaction vessel having one or more reaction chambers and configured for amplification of the nucleic acid, a fluidic path between the plurality of chambers and the reaction vessel, and a filter in the fluidic path; and if the sample comprises cells, lysing cells in the sample with one or more lysis reagents present within at least one of the plurality of chambers; b) said subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions comprises amplifying the nucleic acid with primers and probes present in solution within at least one of the plurality of chambers; and c) said subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions comprises amplifying the nucleic acid with primers and probes present in solution within at least one of the plurality of chambers.

[0065] Embodiment 55: The method of embodiments 54, wherein the filter is configured to bind nucleic acid and allow unwanted material to pass through.

[0066] Embodiment 56: The method of embodiment 54 or embodiment 55, wherein amplification is isothermal.

[0067] Embodiment 57: The method of embodiment 54 or embodiment 55, wherein amplification is non-isothermal, preferably by thermal cycling or temperature oscillation.Docket No. P2024-0535-WO (68634WO01)

[0068] Embodiment 58: The method of embodiment 57, wherein said detecting the presence of a coronavirus comprises real-time PCR, melt curve analysis, or a combination thereof.

[0069] Embodiment 59: The method of any one of embodiments 54-58, wherein said detecting is carried out in a single reaction chamber.

[0070] Embodiment 60: The method of any one of embodiments 50-59, wherein the biological sample is a respiratory sample selected from a nasopharyngeal swab (NP), oral- pharyngeal swab (OP), nasal swab (NS), respiratory mucus sample, respiratory tissue sample, respiratory cell sample, saliva sample, sputum sample, or combination thereof.

[0071] Embodiment 61: The method of any of embodiments 50-59, wherein the biological sample is a wastewater sample.

[0072] Embodiment 62: The method of any one of embodiments 50-59, wherein said detecting and is done at the same facility where the biological sample was collected from a subject.

[0073] Embodiment 63: The method of any one of embodiments 50-62, wherein the method is a point-of-care method.

[0074] Embodiment 64: The method of any one of embodiments 50-63, wherein the method is carried out in a hospital, an urgent care center, an emergency room, a physician’s office, a health clinic, or a home.

[0075] Embodiment 65: The method of any one of embodiments 50-64, wherein the method is a Clinical Laboratory Improvement Amendments (CLIA)-waived test.

[0076] Embodiment 66: The method of any one of embodiments 54-64, wherein the cartridge is a Clinical Laboratory Improvement Amendments (CLIA)-compliant cartridge, is operated in compliance with CLIA, is operated by a CLIA-compliant laboratory, or is operated in a CLIA-compliant location.

[0077] Embodiment 67: The method of any one of embodiments 54-66, wherein the method is carried out to facilitate a response to a pandemic, epidemic, and / or endemic pathogen.Docket No. P2024-0535-WO (68634WO01)

[0078] Embodiment 68: The method of any one of embodiments 54-67, wherein the method is carried out to distinguish between a virulent pathogen and a less virulent pathogen.

[0079] Embodiment 69: The method of any one of embodiments 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying MERS-CoV, β- coronavirus C (Merbecovirus), SARS-CoV-1, SARS-CoV-2, β-coronavirus B (Sarbecovirus), CoV-OC43 or CoV-HKU1, CoV-229E or CoV-NL63, α-coronavirus or γ- coronavirus, and β-coronavirus or δ-coronavirus.

[0080] Embodiment 70: The method of any one of embodiments 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying MERS-CoV, β- coronavirus C (Merbecovirus), SARS-CoV-1, SARS-CoV-2, β-coronavirus B (Sarbecovirus), CoV-OC43, CoV-HKU1, CoV-229E, CoV-NL63, α-coronavirus, β- coronavirus, γ-coronavirus, and δ-coronavirus.

[0081] Embodiment 71: The method of any one of embodiments 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying β-coronavirus C (Merbecovirus), SARS-CoV-2, and β-coronavirus B (Sarbecovirus).

[0082] Embodiment 72: The set of embodiment 36 or embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-66, wherein the cartridge facilitates and / or the method comprises detection of coronaviruses within the biological sample within 60 minutes, within 45 minutes, or within 30 minutes of collecting the sample from the subject.

[0083] Embodiment 73: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-72, wherein the one or more lysis reagents comprise a chaotropic agent, a chelating agent, a buffer, and a detergent.

[0084] Embodiment 74: The set, cartridge, or method of embodiment 73, wherein the chaotropic agent is selected from guanidinium thiocyanate, guanidinium hydrochloride, alkali perchlorate, alkali iodide, urea, formamide, or a combination thereof.

[0085] Embodiment 75: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-72, wherein the one or more lysis reagents comprise a guanidinium compound, sodium hydroxide, EDTA, a buffer, and a detergent.Docket No. P2024-0535-WO (68634WO01)

[0086] Embodiment 76: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-75, wherein the filter is configured to bind the nucleic acid to be analyzed.

[0087] Embodiment 77: The set, cartridge, or method of embodiment 76, wherein the filter comprises glass fibers and optionally a polymeric binder, or the glass fibers are optionally modified with a DNA binding ligand such as an alkylamine, a cycloalkylamine, an alkyloxy amine, a polyamine moiety, an arylamine, an intercalating agent, a DNA groove binder, a peptide, an amino acid, a protein, or a combination thereof.

[0088] Embodiment 78: The set, cartridge, or method of embodiment 77, wherein the filter comprises a 500 micron to 2000 microns thick glass fiber disk having a pore size of 0.2 microns to 1 micron.

[0089] Embodiment 79: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-75, wherein the filter is configured to bind unwanted material and allow the nucleic acid to pass through.

[0090] Embodiment 80: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-79, wherein the cartridge further comprises a binding reagent, wash reagent, eluting reagent, or a combination thereof.

[0091] Embodiment 81: The set, cartridge, or method of embodiment 80, wherein the eluting reagent comprises ammonia or an alkali metal hydroxide.

[0092] Embodiment 82: The set, cartridge, or method of embodiment 80 or embodiment 81, wherein the eluting reagent has a pH above about 9, above about 10, or above about 11.

[0093] Embodiment 83: The set, cartridge, or method of any one of embodiments 80-82, wherein the eluting reagent comprises a polyanion, optionally a carrageenan, a carrier nucleic acid, or i-carrageenan and KOH.

[0094] Embodiment 84: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-83, wherein the reaction vessel comprises up to 4 reaction chambers.Docket No. P2024-0535-WO (68634WO01)

[0095] Embodiment 85: The set, cartridge, or method of embodiment 84, wherein the reaction vessel comprises one reaction chamber.

[0096] Embodiment 86: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-85, wherein at least one of the plurality of chambers comprises one or more lyophilized reagents.

[0097] Embodiment 87: The set, cartridge, or method of embodiment 86, wherein the one or more lyophilized reagents is / are in the form of one or more beads.

[0098] Embodiment 88: The set, cartridge, or method of embodiment 87, wherein the one or more lyophilized reagents are selected from primers, probes, a salt, dNTPs, a thermostable polymerase, a reverse transcriptase, or a combination thereof.

[0099] Embodiment 89: The set, cartridge, or method of embodiment 88, wherein the one or more lyophilized reagents comprise lyophilized primers and probes.

[0100] Embodiment 90: The set of embodiment 37, the cartridge of embodiment 38 or embodiment 46, or the method of any one of embodiments 54-85, reagents and components in the reaction vessel are in solution.

[0101] Embodiment 91: A system for detecting pathogens in a biological sample, the system comprising: a module having a receiving bay for receiving the cartridge of embodiment 38 or embodiment 46, wherein the module includes one or more mechansims within the receiving bay for manipulating a fluid sample within the cartridge, and an instrument that interfaces with the reaction vessel; and a memory having programmable instructions recorded thereon, that are specially configured to operate the module according to a pancoronavirus assay protocol to determine nucleic acid sequence characteristics of α- coronavirus, β-coronavirus, γ-coronavirus, or δ-coronavirus.

[0102] Embodiment 92: The system of embodiment 91, wherein the module and / or system further comprises: a scanner or reader configured to read an identifier on the cartridge; wherein the instructions are configured to determine an applicable protocol based on reading or scanning of the identifier; and wherein the system operates the module according to the applicable protocol based on an input from the scanner or reader.

[0103] Embodiment 93: The system of embodiment 91 or embodiment 92, wherein the module and / or system further comprises: an enclosure; a plurality of modules thatDocket No. P2024-0535-WO (68634WO01) includes said module, wherein modules are substantially identical and configured to concurrently perform assays on cartridges received therein.

[0104] Embodiment 94: The system of any one of embodiments 91-93, further comprising a networking platform for transmitting results derived from module operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] FIGS.1A-1C show an overview of a sample cartridge with a valve assembly configured for performing differing sample processes, including chemical lysing of targets, which is configured for PCR and optional integrated nucleic acid analysis of the coronavirus biomarker panel in accordance with some embodiments of the invention. FIG.1A shows the sample cartridge body with reaction vessel, FIG.1B shows an exploded view of the sample cartridge, and FIG.1C shows components of the valve assembly, in accordance with some embodiments.

[0106] FIG.2 illustrates various valve assemblies A, B, C, D, each suited for one or more types of target lysing, any of which may be used in a respective sample cartridge.

[0107] FIGS.3A-3B show illustrative, but non-limiting, embodiments of the modules and systems (e.g., processing units) for the PCR detection and / or quantification and optional integrated nucleic acid analysis for the biomarker panel. FIG.3A illustrates a module configured to receive and interact with the valve assembly of the cartridge to operate the cartridge to facilitate sample preparation and analysis. FIG.3B illustrates a processing unit (e.g., analytical testing unit) of the module that interacts with the fluid sample in the reaction vessel to facilitate sample processing and analytical testing (e.g., PCR and, optionally, nucleic acid analysis) for the biomarker panel.

[0108] FIG.4 illustrates an exploded view of the sample cartridge illustrating its major components, including the lid, multi-chamber body, reaction vessel, valve assembly and base, in accordance with some embodiments. The chambers may be used to perform various processes (e.g., extract, purify, deamidate, desulfonate) on the sample.Docket No. P2024-0535-WO (68634WO01)

[0109] FIGS.5A-5B show specialized components of the cartridge configured for the targeted assay panel, in accordance with some embodiments. As pictured, a specialized component is a valve assembly having a syringe tube through which the sample is injected and multiple ports on a valve body that facilitate transport of fluid sample between the respective processing chambers upon rotation of the valve assembly.

[0110] FIG.6: A schematic showing the relatedness and classifications of known coronavirus strains.

[0111] FIG.7: Workflow to generate a dataset of broad Sarbeco genomes.

[0112] FIG.8: Detection of synthetic DNA for broad Sarbeco (OQ297732; OR233324; MT121216; OR233302; OK017805) and SARS-CoV-2 with Xpert Pan Corona.

[0113] FIG.9: Detection of bovine coronavirus and human OC43 virus with Xpert Pan Corona.

[0114] FIG.10: Detection of bovine coronavirus with Xpert Respiratory Panel.

[0115] FIG.11A-11B: Detection of bovine coronavirus with BioFire Respiratory Panel 2.1 plus.

[0116] FIG.12: Detection of synthetic DNA for FJ710056.1 or human 229E with Xpert Pan Corona. DETAILED DESCRIPTION

[0117] The present disclosure provides pancoronavirus biomarker panels that can be used to detect a wide variety of characterized coronavirus strains and, in some embodiments, emerging or novel coronavirus strains. In certain embodiments, this detection can be carried out in a single, highly multiplexed nucleic acid amplification assay. This assay can, for example, be cartridge-based and optionally incorporated into a point-of-care (POC) device. Definitions

[0118] Terms used in the claims and specification are defined as set forth below unless otherwise specified.Docket No. P2024-0535-WO (68634WO01)

[0119] As used herein, the term “pancoronavirus” refers to intended applicability to all known coronaviruses of the Coronaviridae family. The term does not imply that this intention is fully met. The pancoronavirus panel of biomarkers described herein is designed to detect coronavirus strains that have been described and, in some embodiments, coronavirus that may emerge in the future, but those of skill in the art understand that, as the virus evolves, some strains may not be detectable by the pancoronavirus panel described herein.

[0120] The Coronaviridae family is classified into four genera α-, β-, γ- and δ- coronavirus. Human coronaviruses belong to β-coronavirus and α-coronavirus genera. β- coronavirus genus has five subgenera including Embecovirus (HCoV-OC43, HCoV- HKU1), Sarbecovirus (SARS-CoV, SARS-CoV-2), Merbecovirus (MERS-CoV), Nobecovirus, and Hibecovirus. The genomes of coronaviruses encode four structural proteins (Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N) and several accessory protein ORFs (including 3a, 3b, 6, 7a, 7b, 8, 9b, 9c, and 10). Accessory proteins of SARS-CoV-2, such as ORF3b, ORF9b and ORF9c, are essential as virulence factors during SARS-CoV-2 infection, although some of the accessory proteins are not important for replication. All members of β-coronavirus from the Embecovirus subgenus have an additional HE gene which is located upstream of that encoding the S protein. HE is an integral membrane protein with a single TM domain and a relatively large ectodomain, which has the esterase core domain and a lectin subdomain acting as the receptor-binding domain (RBD).

[0121] SARS-CoV-2 has a 29,903-nucleotide long viral genome with genes encoding structural proteins: spike (S), envelope (E), transmembrane (M), helicase (Hel), and nucleocapsid (N). There are also species-specific genes necessary for viral replication. These are RNA-dependent RNA polymerase (RdRp), hemagglutinin-esterase (HE) and open reading frames ORFla and ORF1b. ORF1ab, the largest gene, contains overlapping open reading frames that encode polyproteins PP1ab and PP1a. The polyproteins are cleaved to yield 16 nonstructural proteins, NSP1-16. Production of the longer (PP1ab) or shorter protein (PP1a) depends on a -1 ribosomal frameshifting event. The proteins, based on similarity to other coronaviruses, include the papain-like proteinase protein (NSP3), 3C- like proteinase (NSP5), RNA-dependent RNA polymerase (NSP12, RdRp), helicase (NSP13, HEL), endoRNAse (NSP15), 2'-O-Ribose-Methyltransferase (NSP16) and otherDocket No. P2024-0535-WO (68634WO01) nonstructural proteins. The N, E, S, ORF and RdRp are the target viral genes that can be used for molecular diagnostic tests, with test kits having numerous different primer sets directed against these regions.

[0122] The term “nucleic acid” refers to a nucleotide polymer, and unless otherwise limited, includes analogs of natural nucleotides that can function in a similar manner (e.g., hybridize) to naturally occurring nucleotides.

[0123] The term nucleic acid includes any form of DNA or RNA, including, for example, genomic DNA; complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or viral RNA or by amplification; DNA molecules produced synthetically or by amplification; mRNA; and non-coding RNA.

[0124] The term nucleic acid encompasses double- or triple-stranded nucleic acid complexes, as well as single-stranded molecules. In double- or triple-stranded nucleic acid complexes, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands).

[0125] The term nucleic acid also encompasses any modifications thereof, such as by methylation and / or by capping. Nucleic acid modifications can include addition of chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and functionality to the individual nucleic acid bases or to the nucleic acid as a whole. Such modifications may include base modifications such as 2’- position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, substitutions of 5-bromo-uracil, sugar-phosphate backbone modifications, unusual base pairing combinations such as the isobases isocytidine and isoguanidine, and the like.

[0126] More particularly, in some embodiments, nucleic acids, can include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of nucleic acid that is an N- or C-glycoside of a purine or pyrimidine base, as well as other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino polymers (see, e.g., Summerton and Weller (1997) “Morpholino Antisense Oligomers: Design, Preparation, and Properties,” Antisense & Nucleic Acid Drug Dev.7:1817-195; Okamoto etDocket No. P2024-0535-WO (68634WO01) al. (20020) “Development of electrochemically gene-analyzing method using DNA- modified electrodes,” Nucleic Acids Res. Supplement No.2:171-172), and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. The term nucleic acid also encompasses locked nucleic acids (LNAs), which are described in U.S. Patent Nos.6,794,499, 6,670,461, 6,262,490, and 6,770,748, which are incorporated herein by reference in their entirety for their disclosure of LNAs.

[0127] The nucleic acid(s) can be derived from a completely chemical synthesis process, such as a solid phase-mediated chemical synthesis, from a biological source, such as through isolation from any species that produces nucleic acid, or from processes that involve the manipulation of nucleic acids by molecular biology tools, such as DNA replication, PCR amplification, reverse transcription, or from a combination of those processes.

[0128] As used herein, the term “gene” encompasses coding sequences, introns, and any associated control sequences that participate in the expression of the coding sequences.

[0129] The term “sequence identity,” in the context of two or more amino acid or nucleotide sequences, refers to two or more sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.

[0130] For sequence comparison to determine percent nucleotide or amino acid sequence identity, typically one sequence acts as a “reference sequence,” to which a “test” sequence is compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence relative to the reference sequence, based on the designated program parameters. Alignment of sequences for comparison can be conducted using BLAST set to default parameters.

[0131] The term “conserved” refers to a sequence identical or similar across multiple iterations of the sequence in nature. A given “conserved” sequence may, in different embodiments have at least 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98,Docket No. P2024-0535-WO (68634WO01) or 99 % nucleotide sequence identity, or may be 100% identical across a data set. For these purposes, the percent sequence identity requirement is met where all sequences in the data set meet this requirement when aligned with a reference sequence from the data set. The data set can include sequences from a given viral strain or clade, for example, in which case, the sequence can be said to be conserved within (or across) that strain or clade. The data set can include sequences from multiple viral strains or clades, for example, in which case the sequence can be said to be conserved across those multiple viral strains or clades. A sequence can be conserved in one strain or clade, for example, and not in another strain or clade. Data sets can have at least 3, 5, 10, 15, 20, 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more sequences in it. For example, a sequence can be at least 60% conserved across a data set of at least 500, at least 65% conserved across a data set of at least 400, at least 65% conserved across a data set of at least 300, at least 65% conserved across a data set of at least 200, at least 66% conserved across a data set of at least 150, at least 67% conserved across a data set of at least 100, at least 68% conserved across a data set of at least 50, at least 68% conserved across a data set of at least 10, at least 69% conserved across a data set of at least 5, at least 70% conserved across a data set of at least 10, at least 70% conserved across a data set of at least 5, etc.

[0132] As used herein, a “conserved region” refers to a subsequence of a longer nucleic acid sequence that is conserved, as defined above. The length of the conserved subsequence can be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or more nucleotides in length. In some embodiments, a conserved region can be less than 500, 400, 300, 200, or one hundred nucleotides in length. Thus, for example, a conserved region can be between 10 and 500, 15 and 400, 20 and 300, 25 and 200, or 30 and 100 nucleotides long and have at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 % nucleotide sequence identity over this subsequence.

[0133] For nucleotide sequences or subsequences described herein, the term “conserved” indicates at least about 60% sequence identity over at least 15 consecutive nucleotides in at least 3 members of a gene family, although embodiments with higher degrees of conservation based on the values given above are also contemplated. A sequence or subsequence is not conserved in a strain if it does not have at least the degree of conservation set forth in this paragraph. In some embodiments, if the degree of conservationDocket No. P2024-0535-WO (68634WO01) is higher, then a sequence or subsequence is not conserved if it does not have the higher degree of conservation.

[0134] As used herein, the term “complementary” refers to the capacity for precise pairing between two nucleotides; i.e., if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding with a nucleotide of another nucleic acid to form a canonical base pair, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be “partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.

[0135] “Specific hybridization” refers to the binding of a nucleic acid to a target nucleotide sequence in the absence of substantial binding to other nucleotide sequences present in the hybridization mixture under defined stringency conditions. Those of skill in the art recognize that relaxing the stringency of the hybridization conditions allows sequence mismatches to be tolerated.

[0136] In some embodiments, hybridizations are carried out under stringent hybridization conditions. The phrase “stringent hybridization conditions” generally refers to a temperature in a range from about 5°C to about 20°C or 25°C below than the melting temperature (Tm) for a specific sequence at a defined ionic strength and pH. As used herein, the Tm is the temperature at which a population of double-stranded nucleic acid molecules becomes half-dissociated into single strands. Methods for calculating the Tm of nucleic acids are well known in the art (see, e.g., Berger and Kimmel (1987) METHODS IN ENZYMOLOGY, VOL.152: GUIDE TO MOLECULAR CLONING TECHNIQUES, San Diego: Academic Press, Inc. and Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY MANUAL, 2ND ED., VOLS.1-3, Cold Spring Harbor Laboratory), both incorporated herein by reference for their descriptions of stringent hybridization conditions). As indicated by standard references, a simple estimate of the Tmvalue may be calculated by the equation: Tm =81.5+0.41(% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see, e.g., Anderson and Young, Quantitative Filter Hybridization in NUCLEIC ACID HYBRIDIZATION (1985)). The melting temperature of a hybrid (and thus the conditions for stringent hybridization) is affected by various factors such as the length and natureDocket No. P2024-0535-WO (68634WO01) (DNA, RNA, base composition) of the primer or probe and nature of the target nucleic acid (DNA, RNA, base composition, present in solution or immobilized, and the like), as well as the concentration of salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol). The effects of these factors are well known and are discussed in standard references in the art. Illustrative stringent conditions suitable for achieving specific hybridization of most sequences are: a temperature of at least about 60°C and a salt concentration of about 0.2 molar at pH7. Tm calculation for oligonuclotide sequences based on nearest-neighbors thermodynamics can carried out as described in “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest- neighbor thermodynamics” John SantaLucia, Jr., PNAS February 17, 1998 vol.95 no.4 1460-1465 (which is incorporated by reference herein for this description).

[0137] The term “oligonucleotide” is used to refer to a nucleic acid that is relatively short, generally shorter than 200 nucleotides, more particularly, shorter than 100 nucleotides, most particularly, shorter than 50 nucleotides. Typically, oligonucleotides are single-stranded DNA molecules.

[0138] The term “primer” refers to an oligonucleotide that is capable of hybridizing (also termed “annealing”) with a nucleic acid and serving as an initiation site for nucleotide (RNA or DNA) polymerization under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. The appropriate length of a primer depends on the intended use of the primer, but primers are typically at least 7 nucleotides long and, in some embodiments, range from 10 to 30 nucleotides, or, in some embodiments, from 10 to 60 nucleotides, in length. In some embodiments, primers can be, e.g., 15 to 50 nucleotides long. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template.

[0139] A primer is said to “anneal to” or “hybridize to” another nucleic acid if the primer, or a portion thereof, hybridizes to a nucleotide sequence within the nucleic acid. The statement that a primer hybridizes to a particular nucleotide sequence is not intended to imply that the primer hybridizes either completely or exclusively to that nucleotide sequence. For example, in some embodiments, amplification primers used herein are said toDocket No. P2024-0535-WO (68634WO01) “anneal to” or be “specific for” a nucleotide sequence.” This description encompasses primers that anneal wholly to the nucleotide sequence, as well as primers that anneal partially to the nucleotide sequence.

[0140] The term “primer pair” refers to a set of primers including a 5’ “upstream primer” or “forward primer” that hybridizes with the complement of the 5’ end of the DNA sequence to be amplified and a 3’ “downstream primer” or “reverse primer” that hybridizes with the 3’ end of the sequence to be amplified. As will be recognized by those of skill in the art, the terms “upstream” and “downstream” or “forward” and “reverse” are not intended to be limiting, but rather provide illustrative orientations in some embodiments.

[0141] A “probe” is a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, generally through complementary base pairing, usually through hydrogen bond formation, thus forming a duplex structure. The probe can be labeled with a detectable label to permit facile detection of the probe, particularly once the probe has hybridized to its complementary target. Alternatively, however, the probe may be unlabeled, but may be detectable by specific binding with a ligand that is labeled, either directly or indirectly. Probes can vary significantly in size. Generally, probes are at least 7 to 15 nucleotides in length. Other probes are at least 20, 30, or 40 nucleotides long. Still other probes are somewhat longer, being at least 50, 60, 70, 80, or 90 nucleotides long. Yet other probes are longer still, and are at least 100, 150, 200 or more nucleotides long. Probes can also be of any length that is within any range bounded by any of the above values (e.g., 15-20 nucleotides in length).

[0142] The primer or probe can be perfectly complementary to the target nucleotide sequence or can be less than perfectly complementary. In some embodiments, the primer has at least 65% identity to the complement of the target nucleotide sequence over a sequence of at least 7 nucleotides, more typically over a sequence in the range of 10-30 nucleotides, and, in some embodiments, over a sequence of at least 14-25 nucleotides, and, in some embodiments, has at least 75% identity, at least 85% identity, at least 90% identity, or at least 95%, 96%, 97%, 98%, or 99% identity. It will be understood that certain bases (e.g., the 3’ base of a primer) are generally desirably perfectly complementary to corresponding bases of the target nucleotide sequence. Primer and probes typically anneal to the target sequence under stringent hybridization conditions.Docket No. P2024-0535-WO (68634WO01)

[0143] As used herein with reference to a portion of a primer or a nucleotide sequence within the primer, the term “specific for” a nucleic acid, refers to a primer or nucleotide sequence that can specifically anneal to the target nucleic acid under suitable annealing conditions.

[0144] The term “target” is used herein with reference to “target nucleic acids,” as well as “target organisms.” The former refers to nucleic acids to be detected, and the latter refers to organisms to be detected. The term, “target nucleic acid” is generally used herein to refer to a segment of nucleic acid that is defined by a primer pair and that gives rise to an amplicon produced in an amplification reaction; the term “amplification target” is also used herein to refer to this type of target nucleic acid. Primers and probes are also said to “target” nucleic acid sequences, and so these sequences can also be understood as “target nucleic acids.” Additionally, primers and probes are said to “target” or “be specific for” genes. In this usage, the primers and probes can be used to detect the presence of a particular gene by specifically hybridizing to a portion of the gene that indicates its presence. The meaning of “target” and “target nucleic acids” will be clear to one of skill in the art from the context in which the term is employed. In some embodiments, multiple target nucleic acids can be detected to detect a single target organism. In some embodiments, a single target nucleic acid can be detected to detect a single target organism. In some embodiments, an assay can employ multiple target nucleic acids for one or more target organisms and single target nucleic acids for one or more different target organisms.

[0145] Amplification according to the present teachings encompasses any means by which at least a part of at least one target nucleic acid is reproduced, typically in a template- dependent manner, including without limitation, a broad range of techniques for amplifying nucleic acid sequences, either linearly or exponentially. Illustrative means for performing an amplifying step include PCR, nucleic acid strand-based amplification (NASBA), two-step multiplexed amplifications, rolling circle amplification (RCA), and the like, including multiplex versions and combinations thereof, for example but not limited to, OLA / PCR, PCR / OLA, LDR / PCR, PCR / PCR / LDR, PCR / LDR, LCR / PCR, PCR / LCR (also known as combined chain reaction--CCR), helicase-dependent amplification (HDA), and the like. Descriptions of such techniques can be found in, among other sources, Ausubel et al.; PCR Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor Press (1995); The Electronic Protocol Book, Chang Bioscience (2002); Msuih et al., J. Clin. Micro.34:501-07Docket No. P2024-0535-WO (68634WO01) (1996); The Nucleic Acid Protocols Handbook, R. Rapley, ed., Humana Press, Totowa, N.J. (2002); Abramson et al., Curr Opin Biotechnol.1993 Feb.;4(1):41-7, U.S. Pat. No. 6,027,998; U.S. Pat. No.6,605,451, Barany et al., PCT Publication No. WO 97 / 31256; Wenz et al., PCT Publication No. WO 01 / 92579; Day et al., Genomics, 29(1): 152-162 (1995), Ehrlich et al., Science 252:1643-50 (1991); Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press (1990); Favis et al., Nature Biotechnology 18:561-64 (2000); and Rabenau et al., Infection 28:97-102 (2000); Belgrader, Barany, and Lubin, Development of a Multiplex Ligation Detection Reaction DNA Typing Assay, Sixth International Symposium on Human Identification, 1995 (available on the world wide web at: promega.com / geneticidproc / ussymp6proc / blegrad.html- ); LCR Kit Instruction Manual, Cat. #200520, Rev. #050002, Stratagene, 2002; Barany, Proc. Natl. Acad. Sci. USA 88:188- 93 (1991); Bi and Sambrook, Nucl. Acids Res.25:2924-2951 (1997); Zirvi et al., Nucl. Acid Res.27:e40i-viii (1999); Dean et al., Proc Natl Acad Sci USA 99:5261-66 (2002); Barany and Gelfand, Gene 109:1-11 (1991); Walker et al., Nucl. Acid Res.20:1691-96 (1992); Polstra et al., BMC Inf. Dis.2:18- (2002); Lage et al., Genome Res.2003 Feb.;13(2):294-307, and Landegren et al., Science 241:1077-80 (1988), Demidov, V., Expert Rev Mol Diagn.2002 Nov.;2(6):542-8., Cook et al., J Microbiol Methods.2003 May;53(2):165-74, Schweitzer et al., Curr Opin Biotechnol.2001 Feb.;12(1):21-7, U.S. Pat. No.5,830,711, U.S. Pat. No.6,027,889, U.S. Pat. No.5,686,243, PCT Publication No. WO0056927A3, and PCT Publication No. WO9803673A1.

[0146] In some embodiments, amplification comprises at least one cycle of the sequential procedures of: annealing at least one primer with complementary or substantially complementary sequences in at least one target nucleic acid; synthesizing at least one strand of nucleotides in a template-dependent manner using a polymerase; and denaturing the newly-formed nucleic acid duplex to separate the strands. The cycle may or may not be repeated. Amplification can comprise thermocycling or can be performed isothermally.

[0147] As used herein, the term “amplification conditions” refers to conditions that promote amplification of a target nucleic acid in the presence of suitable primers.

[0148] As used herein, “in solution” means not immobilized on a substrate of any kind, for example, a bead or a surface in a cartridge, such as a chamber wall.Docket No. P2024-0535-WO (68634WO01)

[0149] A “multiplex amplification reaction” is one in which two or more nucleic acids distinguishable by sequence are amplified simultaneously.

[0150] The term “qPCR” is used herein to refer to quantitative real-time polymerase chain reaction (PCR), which is also known as “real-time PCR” or “kinetic polymerase chain reaction;” all terms refer to PCR with real-time signal detection.

[0151] The term “melt curve analysis” refers to the use of the dissociation characteristics of a segment of double-stranded nucleic during heating. Originally, strand dissociation was observed using UV absorbance measurements, but techniques based on fluorescence measurements are now the most common approach. The temperature- dependent dissociation between two DNA-strands can be measured in a “melt assay,” for example, using a DNA-intercalating fluorophore, such as SYBR green or EvaGreen, or fluorophore-labelled DNA probes. In the case of SYBR green (which fluoresces 1000-fold more intensely while intercalated in the minor groove of two strands of DNA), the dissociation of the DNA during heating is measurable by the large reduction in fluorescence that results. Alternatively, juxtapositioned probes (one featuring a fluorophore and the other, a suitable quencher) can be used to determine the complementarity of the probe to the target sequence.

[0152] A “reagent” refers broadly to any agent used in a reaction, other than the analyte (e.g., nucleic acid being analyzed). Illustrative reagents for a nucleic acid amplification reaction include, but are not limited to, buffer, metal ions, polymerase, reverse transcriptase, primers, template nucleic acid, nucleotides, labels, dyes, nucleases, dNTPs, and the like. Reagents for enzyme reactions include, for example, substrates, cofactors, buffer, metal ions, inhibitors, and activators.

[0153] The term “label,” as used herein, refers to any atom or molecule that can be used to provide a detectable and / or quantifiable signal. In particular, the label can be attached, directly or indirectly, to a nucleic acid or protein. Suitable labels that can be attached to probes include, but are not limited to, radioisotopes, fluorophores, chromophores, mass labels, electron dense particles, magnetic particles, spin labels, molecules that emit chemiluminescence, electrochemically active molecules, enzymes, cofactors, and enzyme substrates.Docket No. P2024-0535-WO (68634WO01)

[0154] The term “dye,” as used herein, generally refers to any organic or inorganic molecule that absorbs electromagnetic radiation and produces a detectable signal (e.g., a fluorescent signal).

[0155] The term “quencher,” as used herein generally refers to any organic or inorganic molecule that reduces the level of a detectable signal.

[0156] As used herein, the term “detecting” refers to “determining the presence of” an item, such as a nucleic acid sequence, e.g., one that is indicative of the presence of a coronavirus. Detection can include the determination of the presence of a coronavirus, without definitive identification of that coronavirus; the determination of the presence of one or more coronaviruses belonging to a class of coronaviruses; the determination of the presence of a particular known coronavirus strain; or the determination of the presence of a novel (not previously described) coronavirus strain.

[0157] As used herein, the term “identifying” refers to the determination of the presence of a particular, known coronavirus strain or the determination of the presence of a novel (not previously described) coronavirus strain.

[0158] As used herein, the term “treatment regimen” refers to any medical intervention intended to mitigate the symptoms and / or the pathology of a disorder. The treatment regimen can include one or more actions (e.g., bed rest, increasing fluid intake), non-prescription or prescription medications, supplements, foods, drinks, or the use of medical devices (e.g., a respirator).

[0159] As used herein, “Clinical Laboratory Improvement Amendments (CLIA)” refers to The Clinical Laboratory Improvement Amendments of 1988 (CLIA) regulations in effect as of the original filing date of the present application. The CLIA regulations include federal standards applicable to all U.S. facilities or sites that test human specimens for health assessment or to diagnose, prevent, or treat disease. A “CLIA-compliant” test is one that complies with these regulations. “CLIA-waived” tests include tests that does not comply with all of these regulations. For example, CLIA-waived tests include test systems cleared by the U.S. Food and Drug Administration for home use and those tests approved for waiver under the CLIA criteria.

[0160] As used herein, the term “virulent” can refer to the degree of infectivity of, and / or the severity of disease induced by, a pathogen, such as a virus. A “more virulent”Docket No. P2024-0535-WO (68634WO01) virus is more infective and / or induces more severe disease than a reference virus and vice versa. In many embodiments, a “less virulent” virus does not typically induce disease requiring hospitalization.

[0161] An “endogenous control,” as used herein refers to a moiety that is naturally present in the sample to be used for detection. In some embodiments, an endogenous control is a “sample adequacy control” (SAC), which may be used to determine whether there was sufficient sample used in the assay, or whether the sample comprised sufficient biological material, such as cells. In some embodiments, an endogenous control is an RNA (such as an mRNA, tRNA, ribosomal RNA, etc.), such as a human RNA for a human sample. Nonlimiting exemplary endogenous controls include ABL mRNA, GUSB mRNA, GAPDH mRNA, TUBB mRNA, and UPKla mRNA. In some embodiments, an endogenous control, such as an SAC, is selected that can be detected in the same manner as the target nucleic acid (e.g., RNA) is detected and, in some embodiments, simultaneously with the target nucleic acid (e.g., RNA).

[0162] An “exogenous control,” as used herein, refers to a moiety that is added to a sample or to an assay, such as a “sample processing control” (SPC). In some embodiments, an exogenous control is included with the assay reagents. An exogenous control is typically selected that is not expected to be present in the sample to be used for detection or is present at very low levels in the sample such that the amount of the moiety naturally present in the sample is either undetectable or is detectable at a much lower level than the amount added to the sample as an exogenous control. I n some embodiments, an exogenous control comprises a nucleotide sequence that is not expected to be present in the sample type used for detection of the target nucleic acid (e.g., RNA). In some embodiments, an exogenous control comprises a nucleotide sequence that is not known to be present in the species from whom the sample is taken. In some embodiments, an exogenous control comprises a nucleotide sequence from a different species than the subject from whom the sample was taken. In some embodiments, an exogenous control comprises a nucleotide sequence that is not known to be present in any species. In some embodiments, an exogenous control is selected that can be detected in the same manner as the target nucleic acid (e.g., RNA) is detected and, in some embodiments, simultaneously with the target nucleic acid (e.g., RNA). In some embodiments, the exogenous control is an RNA. In some such embodiments, the exogenous control is an Armored RNA®, which comprises RNADocket No. P2024-0535-WO (68634WO01) packaged in a bacteriophage protective coat. See, e.g., WalkerPeach et al, Clin. Chem.45: 12: 2079-2085 (1999). Pancoronavirus Assay

[0163] The pancoronavirus assay is a rapid, qualitative, in-vitro test for the simultaneous qualitative detection and differentiation of RNA from one or more (and preferably all) of potentially novel or emerging coronaviruses and the coronaviruses known to infect humans. In some embodiments, the test detects and differentiates RNA from potentially novel or emerging coronaviruses (“emerging-CoV”) and the following coronaviruses known to infect humans, including: Severe Acute Respiratory Syndrome Coronavirus 1 (SARS-CoV-1), SARS-CoV-2, and Middle East Respiratory Syndrome Coronavirus (MERS-CoV). In some embodiments, the test detects and differentiates RNA from potentially novel or emerging coronaviruses (“emerging-CoV”) and the following coronaviruses known to infect humans, including: SARS-CoV-1, SARS-CoV-2, MERS- CoV, Human coronavirus OC43, Human coronavirus HKU1, Human coronavirus 229E, and Human coronavirusNL63. In the absence of an ongoing outbreak of an emerging-CoV infection, animal coronaviruses can be used as surrogates for emerging-CoV for analytical testing of the broad targets. This approach is scientifically sound for the following reasons. Most human infectious diseases (60-75%) are derived from pathogens that originally circulated in non-human animal species. The recent emergence and spread of zoonotic viruses, including SARS-CoV-2, demonstrate the threat posed by animal-origin viruses to global public health. Further, they reveal that spillover has a fundamental role in the emergence of new human infectious diseases, supporting the use of animal coronaviruses as surrogates for emerging-CoV.

[0164] In some embodiments, detection is carried out using either nasopharyngeal (NP), oral-pharyngeal (OP), or co-collected NP / OP swabs from individuals suspected by their healthcare provider to have respiratory infection with a coronavirus, e.g., an uncommon or emerging coronavirus. Sample material can be released into an appropriate viral transport medium, such as, e.g., VTM / UTM.

[0165] In some embodiments, the assay is a multiplexed real-time RT-PCR assay. In illustrative embodiments, the pancoronavirus assay can be run on the GeneXpert®Instrument Systems (GeneXpert Dx and GeneXpert Infinity). The GeneXpert SystemDocket No. P2024-0535-WO (68634WO01) employs single-use disposable cartridges that contain the reagents used for RNA isolation and the RT-PCR process. Because the cartridges are self-contained, cross-contamination between cartridges during the testing process is minimized.

[0166] In some embodiments, one or more or all of a Sample Processing Control (SPC), a Sample Adequacy Control (SAC) and a Probe Check Control (PCC) are also included. The SPC is present to control for adequate processing of the sample and to monitor for the presence of potential inhibitor(s) in the RT-PCR reaction. The SPC also ensures that the RT-PCR reaction conditions (temperature and time) are appropriate for the amplification reaction and that the RT-PCR reagents are functional. The SAC reagents detect the presence of a single copy human gene and monitor whether the sample contains human DNA. The PCC verifies reagent rehydration, PCR tube filling, and confirms that all reaction components are present in the cartridge including monitoring for probe integrity and dye stability.

[0167] In illustrative embodiments, the fluid sample is exposed to a sample treatment, such a chemical lysis to release nucleic acids. The release nucleic acids can then bind to a filter. This step can utilize precipitating and binding reagent. Next, the filter can be washed with a rinse reagent while the nucleic acids remain bound to the filter. Typically, the wash reagents have some amount of salt which promotes the binding of the nucleic acids to the filter, while allowing removal of non-target materials. After washing, the nucleic acids can be eluted from the filter. In some embodiments, the elution is performed with a pH- neutral or basic buffer. The nucleic acids can then be delivered to a reaction vessel to perform nucleic acid amplification and, optionally, melt curve analysis. In some embodiments (e.g., in the GeneXpert®system), the sample treatment and subsequent steps are performed in the cartridge which includes the reaction vessel.

[0168] The coronavirus biomarker targets can then be detected and preferably differentially identified by RT-PCR and / or melt-curve analysis. A sample that is positive for Sarbecovirus or Merbecovirus or other pancoronavirus target, but negative for the relevant known coronavirus targets, may represent a potentially novel or an emerging coronavirus. Extended Pancoronavirus Assay

[0169] The extended pancoronavirus assay can include one or more primers and / or probes specific for one or more (or all) targets in the above-described pancoronavirus assayDocket No. P2024-0535-WO (68634WO01) and one or more primers and probes for one or more additional targets in coronaviruses known to infect humans including SARS-CoV-1, SARS-CoV-2, MERS-CoV, CoV-229E, CoV-NL63, CoV-OC43, and CoV-HKU1. In illustrative embodiments the assay also includes one or more targets to broadly detect nucleic acids from the CoV family (“Pan- CoV” or “Pan-Coronavirus” targets).

[0170] In exemplary embodiments, the extended pancoronavirus assay can include one or more primers and / or probes for: 1) targets to broadly detect RNA from the sarbecovirus and merbecovirus sub-genera, 2) a Pan-CoV target that broadly detects RNA from coronaviruses (other than the sarbecovirus and merbecovirus sub-genera), and 3) targets for the detection and differentiation of RNA from the following coronaviruses that are known to infect humans: SARS-CoV-1, SARS-CoV-2, MERS-CoV) and seasonal alpha CoVs (CoV-229E / NL63), and beta-CoVs (CoV-OC43 / HKU1). In these embodiments, a sample that is positive for the sarbecovirus, merbecovirus or “Pan-Coronavirus” target, but negative for the relevant known-coronavirus targets, may represent a potentially novel or an emerging CoV. Pancoronavirus / Coronavirus Biomarker Targets and Assay

[0171] In some embodiments, the coronaviruses discussed above can be detected by nucleic acid amplification in a pancoronavirus assay (or extended pancoronavirus assay), for example, in multiplex amplification reactions, which can be designed to detect 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more target nucleic acids per amplification reaction mixture. This degree of multiplexing can be achieved by using primers and probes that do not substantially cross-react or bind off-target and that can reliably identify the coronaviruses they target in the face of antigenic drift. Bioinformatic analysis of multiple databases can be carried out to identify primers and probes for highly conserved regions in the genomes of these coronaviruses.

[0172] Recognized herein are various issues with currently available multiplexed PCR methods. For instance, while multiplexing a large number of target amplification reactions (e.g., multiplexed PCR) may be possible, it is not straightforward to detect multiple amplicons simultaneously. So far, multiplexed q-PCR methods, defined as the processes by which one amplifies and detects a plurality of nucleic acid sequences simultaneously in a single reaction chamber, have been implemented for a small number ofDocket No. P2024-0535-WO (68634WO01) amplicons, generally less than ten. It is of great interest to efficiently multiplex the assays in the same reaction volume and allow for multiple concurrent target amplification and detection in the same reaction chamber. Such an approach may not only better utilize the original DNA sample but also significantly reduce any complexities associated with the fluidics and liquid-handling procedures for running multiple single-plex reactions.

[0173] Attempts at creating multiplexed q-PCR methods have been plagued by practical issues of simultaneously detecting different nucleic acid sequences in a single sample. A possible approach is to associate different reporter molecules (e.g., fluorescent dyes) with individual amplicons during the PCR reaction which may enable parallel detection of individual reporters by different “colors”. While such approach, in theory, may offer parallelism, it is limited by: (i) the number of different reporter molecules available; (ii) crosstalk optical signal present in a channel due to the optical signal in an adjacent channel; and (iii) the availability of imagers and detectors capable of differentiating different signals. Another possible approach to offer multiplexing capability is to divide the biological sample of interest and physically place it, using fluidic systems, into separate, single and isolated amplification chambers. While this approach may effectively create multiplex q-PCR by performing multiple single-plex (i.e., one amplicon per chamber) q- PCR reactions, it may be suboptimal, since it may reduce the number of target nucleic acid sequences in each chamber which may create stochastic anomalies (Poisson noise) in the acquired data when the original sample has a small concentration. Further, it requires complex fluidic handling procedures.

[0174] Highly multiplexed detection of DNA sequences in a sample may be done through adopting analytical platforms such as DNA microarrays or next-generation DNA sequencers, but not q-PCR or equivalent. Microarrays, in particular, are massively parallel, affinity-based biosensors where target nucleic acids are captured selectively from the same sample at different addressable coordinates (e.g., pixels) on a solid surface. Each addressable coordinate can have a unique capturing DNA or RNA probe, complementary to a target nucleic acid sequence to be detected in the sample. While microarrays may offer high multiplexing capability, they are semiquantitative and are inferior in terms of limit-of- detection (LOD) and detection dynamic range (DDR), due to their end-point detection nature (i.e., no real-time detection) and the fact that they lack any target amplification.Docket No. P2024-0535-WO (68634WO01)

[0175] Due to the vast range of targets for primers and probes and target amplicons, a multiplex strategy can be followed to screen and select primers and oligonucleotides. The pancoronavirus (or extended pancoronavirus) biomarker panel multiplex design strategy can involve the following steps: singleplex design for all primer / probes, multiplex with background oligos and matrix for primer / probe, multiplex with primers and probes divided in different pools, sequencing of samples, re-design of primer / probes if required, multiplex with all panel primer / probes together, and repeat one or more steps when required. In this regard, non-specific interactions caused by a high number of oligonucleotides may be observed during assay development. Oligonucleotides with the weakest interactions can be selected from the sequencing of PCR products and thorough in-silico analysis. The assay can also be optimized for salt, enzyme, oligonucleotide concentration and the PCR profile of the over multiple amplicons present in solution.

[0176] In addition, to increase the number of target nucleic acids detected per channel, the following approaches can be used: (i) Taqman and melt probes were combined in the same channel using melt probe with a Tm below annealing temperature (no amplification curve); and (ii) several melt target nucleic acids in one channel; the melt window for each target was dependent on the sequence variation of the target. Several channel options and designs were investigated for each target to find the optimum arrangement.

[0177] Due to the high mutation rate of the viral target organisms, which can make it difficult to find conserved regions, amplification detection may be preferred to avoid a large variation in the melt probes and Tm windows associated with the mutations.

[0178] Because a large number of oligonucleotides combined in one reaction mixture can lead to unwanted interactions between them, in some embodiments, modified nucleotides can be used to reduce primer-primer interactions.

[0179] The reference genomes and position of primers and probes for the genes being targeted in an illustrative pancoronavirus / extended pancoronavirus biomarker panel are provided below in Table A. Particular embodiments of a pancoronavirus / extended pancoronavirus biomarker panel may include one amplification target per organism to be detected or more than one amplification target. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,Docket No. P2024-0535-WO (68634WO01) 12, 13, or all of the organisms listed in Table A can in various embodiments be detected using 2, 3, or more amplification targets per organism.Docket No. P2024-0535-WO (68634WO01) Table A: Pancoronavirus / Extended Pancoronavirus Biomarker Target Nucleic Acids SEQ Organism Region GenBank Acc. No. Position Exemplary Amplicon Sequence ID NO.Docket No. P2024-0535-WO (68634WO01) SEQ Organism Region GenBank Acc. No. Position Exemplary Amplicon Sequence ID NO. 0 1 5 6 2 3 7 4Docket No. P2024-0535-WO (68634WO01) SEQ Organism Region GenBank Acc. No. Position Exemplary Amplicon Sequence ID NO. 8 5 6 9 7 8 9 0Docket No. P2024-0535-WO (68634WO01) SEQ Organism Region GenBank Acc. No. Position Exemplary Amplicon Sequence ID NO.Docket No. P2024-0535-WO (68634WO01)

[0180] The “Pan Corona” targets 1 and 2 identified in Table A are particularly noteworthy as one or both of these targets can be employed to detect emerging and novel coronavirus strains that may not be detected by any of the other coronavirus targets. The inclusion of primers and optional probes for one or both of these pancoronavirus targets in a pancoronavirus / extended pancoronavirus biomarker panel assay increases the odds of detecting infections with rare or completely new coronavirus strains that would otherwise be missed.

[0181] Nonlimiting exemplary primer pairs and optional probes are shown in Table B. Each primer pair can include one or more forward primers and one or more reverse primers. In some examples, a primer pair includes a set of degenerate forward primers and / or a set of degenerate reverse primers. The term “degenerate primer” refers to a mix of oligonucleotide sequences in which one or more positions contain a number of possible bases, giving a population of primers with similar sequences that cover possible nucleotide combinations for a given nucleotide sequence coding for a specific gene target. The degenerate primers can include modified bases which can match different bases. Table B: Primer, Probe, and Amplicon Nucleotide Sequences for Pancoronavirus / Extended Pancoronavirus Biomarker Targets Target Organism Target Oligo Label SEQUENCE SEQ Re ion IDDocket No. P2024-0535-WO (68634WO01) Target Organism Target Oligo Label SEQUENCE SEQ Region ID 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9Docket No. P2024-0535-WO (68634WO01) Target Organism Target Oligo Label SEQUENCE SEQ Region ID 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0Docket No. P2024-0535-WO (68634WO01) Target Organism Target Oligo Label SEQUENCE SEQ Region ID 1 2 3 4 5 6 7 8 9 0 1 2 3Docket No. P2024-0535-WO (68634WO01) Target Organism Target Oligo Label SEQUENCE SEQ Region IDDocket No. P2024-0535-WO (68634WO01) Target Organism Target Oligo Label SEQUENCE SEQ Region ID 0 1 2 3 4p p p g s biomarkers are described in more detail below in the section entitled “Exemplary Polynucleotides.”

[0183] Illustrative pancoronavirus / extended pancoronavirus biomarker panels are described below. Pancoronavirus Biomarker Panel

[0184] In various embodiments, the pancoronavirus biomarker panel can include one or more broad Sarbecovirus targets, i.e., targets for detecting a plurality of coronaviruses in the sarbecovirus subgenus; and / or broad Merbecovirus targets. i.e., targets for detecting a plurality of coronaviruses in the Merbecovirus subgenus; and / or targets for detecting other one or more other coronaviruses, e.g., all coronaviruses other than those in the Sarbecovirus and Merbecovirus subgenera, namely, α-coronaviruses, β-coronaviruses (other than the Sarbecovirus and Merbecovirus subgenera), γ-coronaviruses, and γ- coronaviruses.

[0185] In some embodiments, the panel can include primer pair and / or probe specific for two or more targets for the coronaviruses. For example, the panel can include dual targets for SARS-CoV-2 and Sarbecovirus. The two or more targets can be within the same gene or different genes. In illustrative embodiments, the panel includes at least one primer pair and / or probe specific for each of the following targets:Docket No. P2024-0535-WO (68634WO01)

[0186] the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene target is conserved across Merbecovirus;

[0187] a first and a second region of the ORF1ab gene of SARS-CoV-2, wherein the first and second region of the ORF1a gene target is not conserved across Sarbecovirus;

[0188] the E gene of Sarbecovirus, wherein the E gene target is conserved across Sarbecovirus; and

[0189] the 3’ end (between the N gene and the 3’ UTR) of Sarbecovirus, wherein the 3’ end (between the N gene and the 3’ UTR) target is conserved across Sarbecovirus. Extended Pancorornavirus Biomarker Panel - Embodiment 1

[0190] A first embodiment of an extended pancoronavirus biomarker panel includes at least one primer pair and / or probe specific for one or more of the basic coronavirus biomarker panel (described immediately above) targets and one or more of each of the following targets:

[0191] the N gene of MERS-CoV, wherein the N gene target is not conserved across Merbecovirus;

[0192] the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene target is conserved across Merbecovirus;

[0193] the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene target is not conserved across Sarbecovirus; and / or the S gene of SARS-CoV-1, wherein the S gene target is not conserved across Sarbecovirus;

[0194] the E gene of SARS-CoV-2, wherein the E gene target is conserved across Sarbecovirus; and / or the N gene of SARS-CoV-2, wherein the N gene target is not conserved across Sarbecovirus; and / or the RDRP gene of SARS-CoV-2, wherein the RDRP gene target is not conserved across Sarbecovirus;

[0195] the ORF1a gene of CoV-OC43, optionally wherein the ORF1a gene target is not conserved across β-coronavirus A; and ORF1a gene of CoV-HKU1, optionally wherein the ORF1a gene target is not conserved across β-coronavirus A; andDocket No. P2024-0535-WO (68634WO01)

[0196] the S gene of CoV-229E, wherein the S gene target is not conserved across α-coronavirus; and the S gene of CoV-NL63, wherein the S gene is not conserved across α- coronavirus. Extended Pancorornavirus Biomarker Panel - Embodiment 2

[0197] A second embodiment of an extended pancoronavirus biomarker panel includes at least one primer pair and / or probe specific for one or more of the basic coronavirus biomarker panel targets (described above) and one or more of each of the following targets, which are selected to detect novel and emerging coronaviruses:

[0198] the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus [Pan-Cov-1]; and

[0199] the RdRP gene, the ORF1a gene, or a combination thereof, of all three of β- coronavirus, γ-coronavirus, and δ-coronavirus [Pan-Cov-2].

[0200] In particular embodiments of the embodiment 2 panel,

[0201] the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene target or an ORF1ab gene target that is conserved across α-coronavirus;

[0202] the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus, γ-coronavirus, and δ-coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene target or an ORF1ab gene target that is conserved across β-coronavirus A, β-coronavirus D, γ- coronavirus, and δ-coronavirus, but not conserved in Merbecovirus (β-coronavirus C) and / or not in Sarbecovirus (β-coronavirus B).

[0203] In such embodiments, the panel additionally includes at least one primer pair and / or probe specific for each of the following targets:

[0204] the N gene of MERS-CoV, wherein the N gene target is not conserved across Merbecovirus;

[0205] the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene target is conserved across Merbecovirus;Docket No. P2024-0535-WO (68634WO01)

[0206] the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene target is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene target is not conserved across Sarbecovirus;

[0207] the N gene of SARS-CoV-2, wherein the N gene target is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene target is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene target is conserved across Sarbecovirus;

[0208] the ORF1a gene of CoV-OC43, wherein the ORF1a gene target is not conserved across β-coronavirus A;

[0209] the ORF1a gene of CoV-HKU1, wherein the ORF1a gene target is not conserved across β-coronavirus A;

[0210] the S gene of CoV-229E, wherein the S gene target is not conserved across α-coronavirus; and

[0211] the S gene of CoV-NL63, wherein the S gene target is not conserved across α-coronavirus. Controls

[0212] In some embodiments, an assay described herein comprises detecting the coronavirus biomarkers described above and at least one endogenous control. In some embodiments, the endogenous control is a sample adequacy control (SAC). In some such embodiments, if no coronavirus biomarker is detected in a sample, and the SAC is also not detected in the sample, the assay result is considered “invalid” because the sample may have been insufficient. While not intending to be bound by any particular theory, an insufficient sample may be too dilute, contain too little cellular material, or contain an assay inhibitor, etc. In some embodiments, the failure to detect an SAC may indicate that the assay reaction failed. In some embodiments, an endogenous control is an RNA (such as an mRNA, tRNA, ribosomal RNA, etc.). Nonlimiting exemplary endogenous controls include ABL mRNA, GUSB mRNA, GAPDH mRNA, TUBB mRNA, and UPKla mRNA.

[0213] In some embodiments, an assay described herein comprises detecting the coronavirus biomarkers described above and at least one exogenous control. In someDocket No. P2024-0535-WO (68634WO01) embodiments, the exogenous control is a sample processing control (SPC). In some such embodiments, if no coronavirus biomarker described above is detected in a sample, and the SPC is also not detected in the sample, the assay result is considered “invalid” because there may have been an error in sample processing, including but not limited to, failure of the assay. Nonlimiting exemplary errors in sample processing include, inadequate sample processing, the presence of an assay inhibitor, the presence of a nuclease (such as an RNase), or compromised reagents, etc. In some embodiments, an exogenous control (such as an SPC) is added to a sample. In some embodiments, an exogenous control (such as an SPC) is added during performance of an assay, such as with one or more buffers or reagents. In some embodiments, when a GeneXpert® system is to be used, the SPC is included in the GeneXpert® cartridge. In some embodiments, an exogenous control (such as an SPC) is an Armored RNA®, which is protected by a bacteriophage coat.

[0214] In some embodiments, an endogenous control and / or an exogenous control is / are detected contemporaneously, such as in the same assay, as detection of the coronavirus biomarkers. In some embodiments, an assay comprises reagents for detecting the coronavirus biomarkers described above, and a SAC and / or an exogenous control, simultaneously in the same assay reaction mixture. In some such embodiments, for example, an assay reaction mixture comprises primer sets for amplifying the coronavirus biomarkers described above, a primer set for amplifying a SAC and / or a primer set for amplifying an exogenous control, as well as optional labeled probes for detecting the amplification products (such as, for example, TaqMan® probes). Polynucleotides

[0215] In some embodiments, polynucleotides are provided for detecting the biomarkers described above. In some embodiments, synthetic polynucleotides are provided. Synthetic polynucleotides, as used herein, refer to polynucleotides that have been synthesized in vitro either chemically or enzymatically. Chemical synthesis of polynucleotides includes, but is not limited to, synthesis using polynucleotide synthesizers, such as OligoPilot™ (GE Healthcare), ABI 3900 DNA Synthesizer (Applied Biosystems), and the like. Enzymatic synthesis includes, but is not limited, to producing polynucleotides by enzymatic amplification, e.g., PCR. A polynucleotide may comprise one or more analog of the canonical nucleotides (e.g., modified nucleotides).Docket No. P2024-0535-WO (68634WO01)

[0216] In some embodiments, a polynucleotide is provided that comprises a region that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to, or at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to, at least 6, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 contiguous nucleotides of the coronavirus targets, and / or exemplary controls discussed above.

[0217] In various embodiments, an exemplary polynucleotide comprises at least: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In various embodiments, a polynucleotide comprises fewer than: 200, 150, 100, 50, 40, 30, or 20 nucleotides. In various embodiments, an exemplary polynucleotide is between 6 and 200, between 8 and 200, between 8 and 150, between 8 and 100, between 8 and 75, between 8 and 50, between 8 and 40, between 8 and 30, between 15 and 100, between 15 and 75, between 15 and 50, between 15 and 40, or between 15 and 30 nucleotides long.

[0218] In some embodiments, detection of each target nucleic acid can be carried out using a single labeled primer or probe, specific for each target nucleic acid. Different primers and / or probes can have the same label. By using primers or probes labeled with different detectable moieties (e.g., different fluorescent reporter dyes), numerous target nucleic acids can be detected simultaneously in a single reaction mixture. In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more different labels can be used in a single reaction mixture or a plurality of reaction mixtures. Each target nucleic acid can be independently monitored using such multiplexing technology. In some embodiments, detection of a plurality of target nucleic acids can be carried out using a single labeled primer or probe. A melt curve may be generated in order to distinguish two or more target nucleic acids that each use the same label, but such analysis may not be necessarily required.Docket No. P2024-0535-WO (68634WO01) Polynucleotide Modifications

[0219] In some embodiments, the methods of detecting at least one target nucleic acid described herein employ one or more polynucleotides that have been modified, such as polynucleotides comprising one or more affinity-enhancing nucleotide analogs. Modified polynucleotides useful in the methods described herein include primers for reverse transcription, PCR amplification primers, and probes. In some embodiments, the incorporation of affinity-enhancing nucleotides increases the binding affinity and specificity of a polynucleotide for its target nucleic acid as compared to polynucleotides that contain only the canonical deoxyribonucleotides, which allows for the use of shorter polynucleotides or for shorter regions of complementarity between the polynucleotide and the target nucleic acid.

[0220] In some embodiments, affinity-enhancing nucleotide analogs include nucleotides comprising one or more base modifications, sugar modifications, and / or backbone modifications. In some embodiments, modified bases for use in affinity- enhancing nucleotide analogs include 5-methylcytosine, isocytosine, pseudoisocytosine, 5- bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, 2- chloro-6-aminopurine, xanthine and hypoxanthine. In some embodiments, affinity- enhancing nucleotide analogs include nucleotides having modified sugars such as 2′- substituted sugars, such as 2′-O-alkyl-ribose sugars, 2′-amino-deoxyribose sugars, 2′-fluoro- deoxyribose sugars, 2′-fluoro-arabinose sugars, and 2′-O-methoxyethyl-ribose (2′MOE) sugars. In some embodiments, modified sugars are arabinose sugars, or d-arabino-hexitol sugars.

[0221] In some embodiments, affinity-enhancing nucleotide analogs include backbone modifications such as the use of peptide nucleic acids (PNA; e.g., an oligomer including nucleobases linked together by an amino acid backbone). Other backbone modifications include phosphorothioate linkages, phosphodiester-modified nucleic acids, combinations of phosphodiester and phosphorothioate nucleic acid, methylphosphonate, alkylphosphonates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters, methylphosphorothioate, phosphorodithioate, p-ethoxy modifications, and combinations thereof.Docket No. P2024-0535-WO (68634WO01)

[0222] In some embodiments, a polynucleotide includes at least one affinity- enhancing nucleotide analog that has a modified base, at least nucleotide (which may be the same nucleotide) that has a modified sugar, and / or at least one internucleotide linkage that is non-naturally occurring.

[0223] In some embodiments, an affinity-enhancing nucleotide analog contains a locked nucleic acid (“LNA”) sugar, which is a bicyclic sugar. In some embodiments, a polynucleotide for use in the methods described herein comprises one or more nucleotides having an LNA sugar. In some embodiments, a polynucleotide contains one or more regions consisting of nucleotides with LNA sugars. In other embodiments, a polynucleotide contains nucleotides with LNA sugars interspersed with deoxyribonucleotides. See, e.g., Frieden, M. et al. (2008) Curr. Pharm. Des.14(11):1138-1142. Primers

[0224] In some embodiments, the polynucleotide is a primer. Primers useful in the methods described herein are generally capable of selectively hybridizing to: genomic DNA, a target RNA (genomic or transcript), a cDNA reverse transcribed from the target RNA, and / or an amplicon that has been amplified from genomic DNA, a target RNA, or a cDNA (collectively referred to as “template”), and, in the presence of the template, a polymerase and suitable buffers and reagents, can be extended to form a primer extension product. Primers are generally of a sufficient length to ensure selective hybridization to their target nucleic acids. Generally, primers of at least 15 nucleotides in length hybridize specifically in most contexts, and this length can be reduced, e.g., by including affinity- enhancing modifications, such as those discussed above. Primers can but need not be exactly complementary to their target nucleic acids. Primers can have any degree of complementarity described above for exemplary polynucleotides. In illustrative embodiments, primers can be 8 to 40 nucleotides in length and at least 90% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 95% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 99% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 90% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 95% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 99% complementary to their target nucleic acids. In embodiments wherein a primer is less than 100%Docket No. P2024-0535-WO (68634WO01) complementary to its target nucleic acid, having the 3’ nucleotide in the primer be complementary to its target nucleic acid facilitates the production of an extension product.

[0225] In some embodiments, a primer that selectively hybridizes to its target nucleic acid hybridizes to its target nucleic acid with at least 5-fold greater affinity than to non-target nucleic acid under the same assay conditions. In some embodiments, a primer that selectively hybridizes to its target nucleic acid hybridizes to its target nucleic acid with at least 10-fold greater affinity than to non-target nucleic acid under the same assay conditions.

[0226] In some embodiments, a primer pair is designed to produce an amplicon that is 50 to 1500 nucleotides long, 50 to 1000 nucleotides long, 50 to 750 nucleotides long, 50 to 500 nucleotides long, 50 to 400 nucleotides long, 50 to 300 nucleotides long, 50 to 200 nucleotides long, 50 to 150 nucleotides long, 100 to 300 nucleotides long, 100 to 200 nucleotides long, or 100 to 150 nucleotides long.

[0227] In some embodiments, the primer is labeled with a detectable moiety. In some embodiments, a primer is not labeled. Probes

[0228] In some embodiments, the polynucleotide is a probe. Probes useful in the methods described herein are generally capable of selectively hybridizing to: genomic DNA, a target RNA (genomic or transcript), a cDNA reverse transcribed from the target RNA, and / or an amplicon that has been amplified from genomic DNA, a target RNA, or a cDNA (collectively referred to as “template”). Generally, probes of at least 15 nucleotides in length hybridize specifically in most contexts, and this length can be reduced, e.g., by including affinity-enhancing modifications, such as those discussed above. Probes can but need not be exactly complementary to their target nucleic acids. For example, probes can deliberately include “mismatches” to adjust the Tm of a melt probe. Probes can have any degree of complementarity described above for exemplary polynucleotides. In illustrative embodiments, probes can be 8 to 40 nucleotides in length and at least 70% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 75% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 80% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 85% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 90% complementaryDocket No. P2024-0535-WO (68634WO01) to their target nucleic acids; 8 to 40 nucleotides in length and at least 95% complementary to their target nucleic acids; 8 to 40 nucleotides in length and at least 99% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 90% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 95% complementary to their target nucleic acids; 8 to 30 nucleotides in length and at least 99% complementary to their target nucleic acids. In embodiments wherein a probe is less than 100% complementary to a target nucleic acid, any points or regions of non-complementarity are typically located so as not to disrupt the ability of the probe to selectively hybridize to its target nucleic acid.

[0229] In some embodiments, a probe that selectively hybridizes to its target nucleic acid hybridizes to its target nucleic acid with at least 5-fold greater affinity than to non- target nucleic acid under the same assay conditions. In some embodiments, a probe that selectively hybridizes to its target nucleic acid hybridizes to its target nucleic acid with at least 10-fold greater affinity than to non-target nucleic acid under the same assay conditions. Polynucleotide Labels

[0230] In some embodiments, the primer or probe is labeled with a detectable moiety. Detectable moieties include directly detectable moieties, such as fluorescent dyes, and indirectly detectable moieties, such as members of binding pairs. When the detectable moiety is a member of a binding pair, in some embodiments, the probe can be detectable by incubating the probe with a detectable label bound to the second member of the binding pair. In some embodiments, a primer or probe is not labeled, such as when a primer or probe is immobilized, e.g., on a microarray or bead. A labeled primer is extendable, e.g., by a polymerase. In some embodiments, a probe is extendable. In other embodiments, a probe is not extendable. The following discussion centers on probes, as these are more typically employed for detecting in the methods described here, but those of skill in the art appreciate that the polynucleotide labeling strategies described below apply equally to the labeling of primers.

[0231] In some embodiments, the probe is a FRET probe that, in some embodiments, is labeled at the 5′-end with a fluorescent dye (donor) and at the 3′-end with a quencher (acceptor), a chemical group that absorbs (i.e., suppresses) fluorescence emissionDocket No. P2024-0535-WO (68634WO01) from the dye when the groups are in close proximity (e.g., attached to the same probe). Thus, in some embodiments, the emission spectrum of the dye should overlap considerably with the absorption spectrum of the quencher. In other embodiments, the dye and quencher are not at the ends of the FRET probe.

[0232] Illustrative FRET probes, which include, but are not limited to, a TaqMan® probe, a Molecular beacon probe and a Scorpion probe. A TaqMan® probe is a linear probe that typically has a fluorescent dye covalently bound at one end of the DNA and a quencher molecule covalently bound elsewhere, such as at the other end of the DNA. The FRET probe comprises a sequence that is complementary to a region of the cDNA or amplicon such that, when the FRET probe is hybridized to the cDNA or amplicon, the dye fluorescence is increased due to increased distance between dye and quencher; when the FRET probe is non-hybridized, the dye fluorescence is quenched; and when the probe is digested during amplification of the cDNA or amplicon, the dye is released from the probe and produces a fluorescence signal. In some embodiments, the amount of target nucleic in the sample is proportional to the amount of fluorescence measured during amplification.

[0233] Like TaqMan® probes, Molecular Beacons use FRET to detect a PCR product via a probe having a fluorescent dye and a quencher attached at the ends of the probe. Unlike TaqMan® probes, Molecular Beacons remain intact during the PCR cycles. Molecular Beacon probes form a stem-loop structure when free in solution, thereby allowing the dye and quencher to be in close enough proximity to cause fluorescence quenching. When the Molecular Beacon hybridizes to a target nucleic acid, the stem-loop structure is abolished so that the dye and the quencher become separated in space and the dye fluoresces. Molecular Beacons are available, e.g., from Gene Link™ (see www.genelink.com / newsite / products / mbintro.asp).

[0234] In some embodiments, Scorpion probes can be used as sequence-specific primers and for PCR product detection. Like Molecular Beacons, Scorpion probes form a stem-loop structure when not hybridized to a target nucleic acid. However, unlike Molecular Beacons, a Scorpion probe achieves both sequence-specific priming and PCR product detection. A fluorescent dye molecule is attached to the 5’-end of the Scorpion probe, and a quencher is attached elsewhere, such as to the 3’-end. The 3’ portion of the probe is complementary to the extension product of the PCR primer, and this complementary portion is linked to the 5 ‘-end of the probe by a non-amplifiable moiety.Docket No. P2024-0535-WO (68634WO01) After the Scorpion primer is extended, the target-specific sequence of the probe binds to its complement within the extended amplicon, thus opening up the stem-loop structure and allowing the dye on the 5 ‘-end to fluoresce and generate a signal. Scorpion probes are available from, e.g., Premier Biosoft International (see www.premierbiosoft.com / tech_notes / Scorpion.html).

[0235] In some embodiments, labels that can be used on the FRET probes include colorimetric and fluorescent dyes, such as Alexa Fluor dyes; BODIPY dyes, such as BODIPY FL, Cascade Blue, and Cascade Yellow; coumarin and its derivatives, such as 7- amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye™; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; fluorescent energy transfer dyes, such as thiazole orange- ethidium heterodimer; and TOTAB.

[0236] Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine- reactive BODIPY dyes, such as BODIPY 493 / 503, BODIPY 530 / 550, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650, BODIPY 650 / 655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6- FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2’, 4’,5’,7’-Tetrabromosulfonefluorescein, and TET.

[0237] Examples of dye / quencher pairs (i.e., donor / acceptor pairs) include, but are not limited to, fluorescein / tetramethylrhodamine; IAEDANS / fluorescein; EDANS / dabcyl; fluorescein / fluorescein; BODIPY FL / BODIPY FL; and fluorescein / QSY 7 or QSY 9 dyes. When the donor and acceptor are the same, FRET may be detected, in some embodiments, by fluorescence depolarization. Certain specific examples of dye / quencher pairs (i.e., donor / acceptor pairs) include, but are not limited to, Alexa Fluor 350 / Alexa Fluor488; Alexa Fluor 488 / Alexa Fluor 546; Alexa Fluor 488 / Alexa Fluor 555; Alexa FluorDocket No. P2024-0535-WO (68634WO01) 488 / Alexa Fluor 568; Alexa Fluor 488 / Alexa Fluor 594; Alexa Fluor 488 / Alexa Fluor 647; Alexa Fluor 546 / Alexa Fluor 568; Alexa Fluor 546 / Alexa Fluor 594; Alexa Fluor 546 / Alexa Fluor 647; Alexa Fluor 555 / Alexa Fluor 594; Alexa Fluor 555 / Alexa Fluor 647; Alexa Fluor 568 / Alexa Fluor 647; Alexa Fluor 594 / Alexa Fluor 647; Alexa Fluor 350 / QSY35; Alexa Fluor 350 / dabcyl; Alexa Fluor 488 / QSY 35; Alexa Fluor 488 / dabcyl; Alexa Fluor 488 / QSY 7 or QSY 9; Alexa Fluor 555 / QSY 7 or QSY9; Alexa Fluor 568 / QSY 7 or QSY 9; Alexa Fluor 568 / QSY 21; Alexa Fluor 594 / QSY 21; and Alexa Fluor 647 / QSY 21. In some instances, the same quencher may be used for multiple dyes, for example, a broad-spectrum quencher, such as an Iowa Black® quencher (Integrated DNA Technologies, Coralville, IA) or a Black Hole Quencher™ (BHQ™; Sigma-Aldrich, St. Louis, MO).

[0238] Specific examples of fluorescently labeled ribonucleotides useful in the preparation of probes for use in some embodiments of the methods described herein are available from Molecular Probes (Invitrogen), and these include, Alexa Fluor 488-5-UTP, Fluorescein- 12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences (GE Healthcare), such as Cy3-UTP and Cy5-UTP.

[0239] Specific examples of fluorescently labeled deoxyribonucleotides useful in the preparation of probes for use in the methods described herein include Dinitrophenyl (DNP)-l ‘-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein- 12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630 / 650- 14-dUTP, BODIPY 650 / 665- 14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7-OBEA-dCTP, and Alexa Fluor 647-12-OBEA-dCTP. Fluorescently labeled nucleotides are commercially available and can be purchased from, e.g., Invitrogen.

[0240] As noted above, exemplary detectable moieties also include members of binding pairs. Exemplary binding pairs include, but are not limited to, biotin and streptavidin, antibodies and antigens, etc.Docket No. P2024-0535-WO (68634WO01) Sample

[0241] The sample to be tested can be any sample suspected of containing at least on the coronavirus biomarkers described herein. In some embodiments, the sample is a biological sample collected from a subject. In other embodiments, the sample is a sample that is not collected directly from a subject, such as, e.g., a wastewater sample or a sample from an air filter in a building.

[0242] Illustrative biological samples include samples of bodily fluids, such as nasal aspirates, nasal washes, nasal swabs, nasopharyngeal swabs, saliva, oropharyngeal swabs, throat swabs, bronchoalveolar lavage samples, bronchial aspirates, bronchial washes, endotracheal aspirates, endotracheal washes, tracheal aspirates, nasal secretion samples, mucus samples, sputum samples, lung tissue samples, etc.

[0243] The sample to be tested is, in some embodiments, fresh (i.e., never frozen). In other embodiments, the sample is a frozen specimen. In some embodiments, the sample is a tissue sample, such as a formalin-fixed paraffin embedded sample. In some embodiments, the sample is a liquid cytology sample.

[0244] In some embodiments, a sample to be tested is contacted with a buffer after collection. For example, in the case of a nasal aspirate sample or nasal wash sample or a sample derived from a nasal aspirate sample or nasal wash sample, a buffer (including, e.g., a preservative) can be added to the nasal aspirate sample or nasal wash sample. In embodiments where the sample is a nasopharyngeal swab sample, the swab can simply be placed in a buffer. In some embodiments, that sample is contacted with the buffer immediately; in the case of a swab, the swab is immediately placed in the buffer. In some embodiments, the sample (e.g., including the swab) is contacted with buffer within 5 minutes, within 10 minutes, within 30 minutes, within 1 hour, or within 2 hours of sample collection.

[0245] In some embodiments, less than 5 ml, less than 4 ml, less than 3 ml, less than 2 ml, less than 1 ml, or less than 0.75 ml of sample or buffered sample are used in the present methods. In some embodiments, 0.1 ml to 1 ml of sample or buffered sample is used in the present methods.Docket No. P2024-0535-WO (68634WO01) Subjects

[0246] A biological sample useful in the methods described herein can be collected from any subject that can be infected by one, several, or all of the coronaviruses described above. In various embodiments, the subject can include non-human animals, e.g., canines, felines, equines, primates, and other non-human mammals, as well as humans.

[0247] In some embodiments, the sample to be tested is obtained from an individual who has one or more symptoms of influenza infection. Nonlimiting exemplary symptoms of influenza include fever, chills, cough, sore throat, runny nose, nasal congestion, muscle ache, headache, fatigue, vomiting, diarrhea, and combinations of any of these symptoms. In some embodiments, the sample to be tested is obtained from an individual who has previously been diagnosed with a condition caused by a coronavirus (e.g., influenza or Covid-19). In some such embodiments, the individual is monitored for recurrence of a condition caused by a coronavirus (e.g., influenza or Covid-19).

[0248] In some embodiments, methods described herein can be used for routine screening of apparently healthy individuals with no risk factors. In some embodiments, methods described herein are used to screen asymptomatic individuals, for example, during routine or preventative care. In some embodiments, methods described herein are used to screen women who are pregnant or who are attempting to become pregnant.

[0249] In some embodiments, the methods described herein can be used to assess the effectiveness of a treatment in an individual undergoing treatment a condition caused by a coronavirus (e.g., influenza or Covid-19). Assay Methods

[0250] Any analytical procedure capable of permitting specific detection of a target nucleic acid can be used in the methods herein presented. In some embodiments, DNA targets can be detected by direct hybridization or, more easily, by amplification of the DNA template and detection of the amplicon. In some embodiments, RNA targets can be detected by direct hybridization or, more easily, by reverse transcribing a target RNA to produce a cDNA that is complementary to the target RNA. This cDNA can be directly detected by direct hybridization or by amplification of the cDNA template.Docket No. P2024-0535-WO (68634WO01)

[0251] Nucleic acid amplification provides rapid, sensitive, and specific detection of nucleic acid targets, and has been employed in a wide variety of assay formats to detect nucleic acid targets. Those of skill in the art can, following the guidance herein, carry out the methods described herein in any number of different nucleic acid amplification-based assays, using, for example, any of the nucleic acid amplification methods discussed above. Such methods can entail thermocycling, but need not do so, as in the case of isothermal amplification. Exemplary methods include, but are not limited to, isothermal amplification, real time RT-PCR, endpoint RT-PCR, and amplification using T7 polymerase from a T7 promoter annealed to a DNA, such as provided by the SenseAmp Plus™ Kit available at Implen, Germany. Amplification and detection can be carried out in solution or can make use of a solid support (e.g., a biochip). Nucleic acid amplification-based assays can employ a single reaction chamber or multiple reaction chambers. Amplification can be nested or non-nested. In some embodiments, detection includes electrochemical detection.

[0252] In some embodiments, target nucleic acids, such as coronavirus biomarkers and / or optional controls, can be detected by (a) contacting nucleic acid from the sample with a set of primers and optional probes for detecting the presence of the desired target nucleic acids, (b) subjecting the nucleic acid, primers, and optional probes to amplification conditions; (c) detecting the presence of any amplification product(s), optionally via real- time PCR, melt curve analysis, or a combination thereof, and (d) differentially identifying the presence of a viral and / or bacterial coronavirus in the sample, or determining that no viral or bacterial pathogen detectable using the set of primers is present, based on detection of the amplification product(s) or lack thereof, respectively. In this context, “differentially identifying” refers to the ability to determine that a particular target organism is present and that one or more other target organisms of the assay are not. In some embodiments, the assay is able to determine the presence of any target organism present in the sample, while ruling out the presence of the other target organisms (above the detection limit of the assay).

[0253] In some embodiments of amplification by polymerase chain reaction (PCR), an exemplary cycle comprises an initial denaturation at 90°C to 100°C for 20 seconds to 5 minutes, followed by cycling that comprises denaturation at 90°C to 100°C for 1 to 10 seconds, followed by annealing and amplification at 60°C to 75°C for 10 to 40 seconds. A further exemplary cycle comprises 20 seconds at 94°C, followed by up to 3 cycles of 1 second at 95°C, 35 seconds at 62°C, 20 cycles of 1 second at 95°C, 20 seconds at 62°C, andDocket No. P2024-0535-WO (68634WO01) 14 cycles of 1 second at 95°C, 35 seconds at 62°C. In some embodiments, for the first cycle following the initial denaturation step, the cycle denaturation step is omitted. In some embodiments, Taq polymerase is used for amplification. In some embodiments, the cycle is carried out at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 35 times, at least 40 times, or at least 45 times. In some embodiments, Taq is used with a hot-start function. In some embodiments, detection of the target nucleic acids occurs in less than 3 hours, less than 2.5 hours, less than 2 hours, less than 1 hour, or less than 30 minutes from initial denaturation through the last extension. In some embodiments, target nucleic acids are detected by a method that includes real-time quantitative PCR, e.g., using FRET probes, such as those described above.

[0254] In some embodiments, quantitation of the results of real-time PCR assays is done by constructing a standard curve from a nucleic acid of known concentration and then extrapolating quantitative information for target nucleic acids of unknown concentration. In some embodiments, the nucleic acid used for generating a standard curve is a DNA (for example, an endogenous control, or an exogenous control). In some embodiments, the nucleic acid used for generating a standard curve is a purified double-stranded plasmid DNA or a single-stranded DNA generated in vitro.

[0255] In some embodiments, in order for an assay to indicate that a given target nucleic acid is not present in a sample, the Ct values for an endogenous control (such as an SAC) and / or an exogenous control (such as an SPC) must be within previously-determined valid ranges. For example, in some embodiments, the absence of a particular target nucleic acid cannot be confirmed unless the controls are detected, indicating that the assay was successful.

[0256] In some embodiments, a threshold Ct (or a “cutoff Ct”) value for a target nucleic acid (including an endogenous control and / or exogenous control), below which the gene is considered to be detected, has previously been determined. In some embodiments, a threshold Ct is determined using substantially the same assay conditions and system (such as a GeneXpert®) on which the samples will be tested.

[0257] Real-time PCR is performed using any PCR instrumentation available in the art. Typically, instrumentation used in real-time PCR data collection and analysis comprisesDocket No. P2024-0535-WO (68634WO01) a thermal cycler, optics for fluorescence excitation and emission collection, and optionally a computer and data acquisition and analysis software.

[0258] In some embodiments, the number of target nucleic acids in an assay exceeds the number of labels that can be detected, e.g., in particular instrument. Therefore, the PCR amplification can be followed by a melt analysis to increase the number of possible reported results. In general, target organisms requiring high sensitivity, e.g., viruses, can be detected with real-time PCR detection using TaqMan probes or molecular beacon probes, and target organisms requiring less sensitivity, e.g., bacteria can be detected with melt analysis. However, some viruses, such as metapneumovirus and influenza H1N1, can be detected with melt analysis.

[0259] Another approach to detect target nucleic acids can include high-resolution melt alone. For example, the Biofire® FilmArray® System performs a nested multiplex PCR by first performing reverse transcription, followed by a multiplexed first-stage PCR reaction (PCR1). Multiple simultaneous second-stage PCR reactions (PCR2) are then performed in an array to amplify sequences within the PCR1 products. Endpoint melting curve data to detect target nucleic acids and analyses can then be performed to generate a result for each analyte.

[0260] Target nucleic acids can also be detected by real-time PCR but in more than one reaction chambers. The QIAstat-Dx Analyzer utilizes 8 real-time PCR reaction chambers with 6-plex capability. Another approach to detect a target nucleic acid can include digital microfluidics or electrowetting and electrochemical detection. For example, the Dx ePlex instrument utilizes digital microfluidics or electrowetting, responsible for the movement and transfer of samples and reagents inside a cartridge. The ePlex system includes a microarray for detection, consisting of target-specific capture probes attached to gold electrodes (solid-support), which generates a voltage signal if a “target DNA / signal probe” hybridizes with the capture probes. Target nucleic acids can also be detected using a chip that includes an integrated sensor array.

[0261] Examples of other approaches that can be employed in the methods describe herein include bead-based flow cytometric assay. See Lu J. et al. (2005) Nature 435:834- 838, which is incorporated herein by reference for this description. An example of a bead- based flow cytometric assay is the xMAP® technology of Luminex, Inc. SeeDocket No. P2024-0535-WO (68634WO01) www.luminexcorp.com / technology / index.html. Another approach uses microfluidic devices and single-molecule detection. See U.S. Patent Nos.7,402,422 and 7,351,538 to Fuchs et al, U.S. Genomics, Inc., each of which is incorporated herein by reference in its entirety. Yet another approach is simple gel electrophoresis and detection with labeled probes (e.g., probes labeled with a radioactive or chemiluminescent label), such as by northern blotting.

[0262] In some embodiments, the approach for detecting a target nucleic acid does not include bead-based flow cytometric assay, microfluidic devices and single-molecule detection, simple gel electrophoresis, use of a capture probe attached to a solid-support, separation of reaction mixture into multiple reaction chambers, array-based detection, nested amplification, electrochemical detection, high resolution melt only, or a combination thereof. Automated Assay Methods

[0263] Readily automated approaches are of great interest. The methods described herein can be carried out in a substantially automated manner using a commercially available nucleic acid amplification system. Exemplary nonlimiting nucleic acid amplification systems that can be used to carry out the methods of the invention include the GENEXPERT® system, a GENEXPERT® Infinity system, and GENEXPERT® Xpress System (Cepheid, Sunnyvale, Calif.). In some embodiments, the amplification system may be available at the same location as the individual to be tested, such as a health care provider’s office, a clinic, or a community hospital, so processing is not delayed by transporting the sample to another facility. Assays according to the method described herein can be completed in under 3 hours, in some embodiments, under 2 hours, in some embodiments, under 1 hour, in some embodiments, under 45 minutes, in some embodiments, under 35 minutes, and in some embodiments, under 30 minutes, using an automated system, for example, the GENEXPERT® system. The GENEXPERT® utilizes a self-contained, single-use cartridge. Sample extraction, amplification, and detection may all carried out within this self-contained sample cartridge as described herein.

[0264] In some embodiments, after the sample is added to the cartridge, the sample is contacted with lysis buffer and released nucleic acid (NA) is bound to a NA-binding substrate, such as a silica or glass substrate. The sample supernatant is then removed and theDocket No. P2024-0535-WO (68634WO01) NA eluted in an elution buffer, such as a Tris / EDTA buffer. The eluate may then be processed in the cartridge to detect target nucleic acids as described herein. In some embodiments, the eluate is used to reconstitute at least some of the PCR reagents, which are present in the cartridge as lyophilized particles.

[0265] A cartridge having a plurality of chambers can have the set of primers and optional probes described herein, or a subset thereof, disposed in a chamber. In some embodiments, the set of primers and optional probes described herein, or a subset thereof, are disposed in more than one of the plurality of chambers.

[0266] In some embodiments, RT-PCR is used to amplify and analyze the presence of the target nucleic acids. In some embodiments, the reverse transcription uses MMLV and / or CAT-A RT enzyme and an incubation of 5 to 20 minutes at 40°C to 50°C. In some embodiments, the PCR uses Taq polymerase with hot-start function, such as AptaTaq (Roche). In some embodiments, the initial denaturation is at 90°C to 100°C for 20 seconds to 5 minutes; the cycling denaturation temperature is 90°C to 100°C for 1 to 10 seconds; the cycling anneal and amplification temperature is 60°C to 75°C for 10 to 40 seconds; and up to 50 cycles are performed.

[0267] In some embodiments, a double-denature method is used to amplify low- copy number target nucleic acids. A double-denature method comprises, in some embodiments, a first denaturation step followed by addition of primers and / or probes for detecting target nucleic acids. All or a substantial portion of the nucleic acid-containing sample (such as a DNA eluate) is then denatured a second time before, in some instances, a portion of the sample is aliquoted for cycling and detection of the target nucleic acids. While not intending to be bound by any particular theory, the double-denature protocol may increase the chances that a low-copy number target nucleic acid (or its complement) will be present in the aliquot selected for cycling and detection because the second denaturation effectively doubles the number of target nucleic acids (i.e., it separates the target nucleic acid and its complement into two separate templates) before an aliquot is selected for cycling. In some embodiments, the first denaturation step comprises heating to a temperature of 90°C to 100°C for a total time of 30 seconds to 5 minutes. In some embodiments, the second denaturation step comprises heating to a temperature of 90°C to 100°C for a total time of 5 seconds to 3 minutes. In some embodiments, the first denaturation step and / or the second denaturation step are carried out by heating aliquots ofDocket No. P2024-0535-WO (68634WO01) the sample separately. In some embodiments, each aliquot may be heated for the times listed above. As a non-limiting example, a first denaturation step for an NA-containing sample (such as a DNA eluate) may comprise heating at least one, at least two, at least three, or at least four aliquots of the sample separately (either sequentially or simultaneously) to a temperature of 90°C to 100°C for 60 seconds each. As a non-limiting example, a second denaturation step for a NA-containing sample (such as a DNA eluate) containing enzyme, primers, and probes may comprise heating at least one, at least two, at least three, or at least four aliquots of the eluate separately (either sequentially or simultaneously) to a temperature of 90°C to 100°C for 5 seconds each. In some embodiments, an aliquot is the entire NA-containing sample (such as a DNA eluate). In some embodiments, an aliquot is less than the entire NA-containing sample (such as a DNA eluate).

[0268] In some embodiments, an off-line centrifugation is used, for example, with samples with low cellular content. The sample, with or without a buffer added, is centrifuged and the supernatant removed. The pellet is then resuspended in a smaller volume of either supernatant or the buffer. The resuspended pellet is then analyzed as described herein. Exemplary Automation and Systems

[0269] Many existing fully integrated nucleic acid amplification and test systems capable of sample preparation are normally quite complicated and costly. The nucleic acid amplification and test systems provided herein perform rapid, simple, convenient, and affordable nucleic acid analysis. System Overview

[0270] In one aspect, the invention pertains to a sample cartridge that utilizes a valve body platform that allows for detection of enveloped and free target nucleic acids. In some embodiments, the valve body includes a sample processing region or lysing chamber that provides for either or both mechanical and chemical lysis. This allows a single cartridge to provide lysing for a multitude of differing types of targets, thus, can be considered an “panel assay cartridge.” In some embodiments, the sample cartridge can perform processingDocket No. P2024-0535-WO (68634WO01) and detection of both bacterial targets requiring mechanical lysing and viral targets suited for chemical lysing.

[0271] The sample cartridge device can be any device configured to perform one or more process steps relating to preparation and / or analysis of a biological fluid sample according to any of the methods described herein. In some embodiments, the sample cartridge device is configured to perform at least sample preparation. The sample cartridge can further be configured to perform additional processes, such as detection of a target nucleic acid in a nucleic acid amplification test (NAAT), e.g., Polymerase Chain Reaction (PCR) assay, by use of a reaction vessel attached to the sample cartridge. In some embodiments, the reaction vessel extends from the body of the cartridge. Preparation of a fluid sample generally involves a series of processing steps, which can include chemical, electrical, mechanical, thermal, optical or acoustical processing steps according to a specific protocol. Such steps can be used to perform various sample preparation functions, such as cell capture, cell lysis, binding of analyte, and binding of unwanted material.

[0272] A sample cartridge suitable for use with the invention, includes one or more transfer ports through which the prepared fluid sample can be transported into an attached reaction vessel for analysis. FIG.1A illustrates an exemplary panel assay cartridge 100 suitable for sample preparation and analytics testing by PCR when received in an instrument module in accordance with some embodiments. The sample cartridge is attached with a reaction vessel 116 (also referred to as a “reaction tube” or “PCR tube”) adapted for analysis of a fluid sample processed within the sample cartridge 100. In some embodiments the reaction vessel extends from the cartridge body. Such a sample cartridge 100 includes various components including a main housing 102 having one or more chambers 108 for processing of the fluid sample, which typically include sample preparation before analysis. In these embodiments, the sample cartridge can be a fully integrated nucleic acid amplification and test system combining sample preparation, amplification, and detection together. The instrument module facilitates the processing steps needed to perform sample preparation and the prepared sample is transported through one of a pair of transfer ports into fluid conduit of the reaction vessel 116 attached to the housing of the sample cartridge 100. The prepared biological fluid sample is then transported into a reaction chamber of the reaction vessel where the biological fluid sample undergoes nucleic acid amplification. In some embodiments, the amplification is a polymerase chain reaction. In some embodiments,Docket No. P2024-0535-WO (68634WO01) concurrent with the amplification of the biological fluid sample, an excitation means, and an optical detection means of the module is used to detect optical emissions that indicate the presence or absence of a target nucleic acid analyte of interest, e.g., a bacterium, a virus, a pathogen, a toxin, or other target analyte. It is appreciated that such a reaction vessel could include various differing chambers, conduits, or micro-well arrays for use in detecting the target analyte. The sample cartridge can be provided with means to perform preparation of the biological fluid sample before transport into the reaction vessel. Any chemical reagent required for viral or cell lysis or means for binding or detecting an analyte of interest (e.g., reagent beads) can be contained within one or more chambers of the sample cartridge, and as such can be used for sample preparation.

[0273] An exemplary use of a reaction vessel for analyzing a biological fluid sample is described in commonly assigned U.S. Patent No.6,818,185, entitled “Cartridge for Conducting a Chemical Reaction,” filed May 30, 2000, the entire contents of which are incorporated herein by reference for all purposes. Examples of the sample cartridge and associated modules are shown and described in U.S. Patent No.6,374,684, entitled “Fluid Control and Processing System” filed August 25, 2000, and U.S. Patent No, 8,048,386, entitled “Fluid Processing and Control,” filed February 25, 2002, U.S. Patent Application No.63 / 217,672 entitled “Universal Assay Cartridge and Methods of Use” filed July 1, 2021; U.S. Provisional Application No.63 / 319,993 entitled “Unitary Cartridge Body and Associated Components and Methods of Manufacture” filed March 15, 2022; and U.S. Patent No.10,562,030 entitled “Molecular Diagnostic Assay System” filed July 22, 2016; the entire contents of which are incorporated herein by reference in their entirety for all purposes. The above noted patents are included in the attached appendix.

[0274] Various aspects of the sample cartridge 100 can be further understood by referring to U.S. Patent No.6,374,684 “the ‘684 patent”), which described certain aspects of a sample cartridge in greater detail. Such sample cartridges can include a fluid control mechanism, such as a rotary fluid control valve assembly, that is fluidically connected to the chambers of the sample cartridge. The term “chamber” can be used interchangeably with the terms “well”, “tube”, and the like. Rotation of the rotary fluid control valve permits fluidic communication between chambers and the valve so as to control flow of a biological fluid sample deposited in the cartridge into different chambers in which various reagents can be provided according to a particular protocol as needed to prepare the biological fluidDocket No. P2024-0535-WO (68634WO01) sample for analysis. To operate the rotary valve, the cartridge processing module comprises a motor such as a stepper motor that is typically coupled to a drive train that engages with a feature of the valve in the sample cartridge to control movement of the valve in coordination with movement of the syringe, thereby resulting movement of the fluid sample according to the desired sample preparation protocol. The fluid metering and distribution function of the rotary valve according to a particular sample preparation protocol is demonstrated in the ‘684 patent. Exemplary Assay Cartridge and Valve Assemblies Overview

[0275] As shown in FIG.1A, the panel assay cartridge 100 comprises a cartridge body 102 containing a plurality of chambers 108 for reagents or buffers and sample processing. The chambers are disposed around a central syringe barrel 106 that is in fluid communication with a valve body 110 (see FIGS.1B and 1C) and that is sealed with a gasket 104. The valve body 110 can include a cap 112 and the entire cartridge body can be supported on a cartridge base 101. The valve body typically contains one or channels or cavities (chamber(s) 114) that can contain a filter as described herein that can function to bind and elute a nucleic acid. In some embodiments the cartridge further comprises one or more temperature-controlled channels or chambers that can, in certain embodiments, function as thermocycling chambers. A “plunger” not shown can be operated to draw fluid into the syringe barrel 106 and rotation of the valve body 110 provides selective fluid communication between the various reagent chambers 108 and channels, reaction chamber(s), mixing chambers, and optionally, any temperature-controlled regions. Thus, the various reagent chambers 108, reaction chambers, filter material(s), and temperature- controlled chambers or channels are selectively in fluid communication by rotation of the plunger and reagent movement (e.g., chamber loading or unloading) is operated by the “syringe” action of the plunger within the valve assembly. In other embodiments, the various reagent chambers, reaction chambers, filter material, and temperature-controlled chambers or channels are selectively in fluid communication by linear progression (e.g., by forced movement) of the reagents and sample from one chamber to the next.Docket No. P2024-0535-WO (68634WO01) Exemplary Valve Assemblies

[0276] FIG.2 illustrates differing valve assembles that can be used in the sample cartridge of FIG.1A. Each of the valve assemblies is shown inverted to better illustrate the components of the valve body. Valve assembly A performs only mechanical lysing and is suitable for lysing hardy targets (e.g. certain bacteria, spores). Valve assemblies B and C perform only chemical lysing and is suitable for lysing less hardy targets (e.g. viruses, free NA, some spores, some bacteria and yeasts). Valve assembly D can perform both mechanical and chemical lysing for all types of targets. In all such cartridges, the valve assembly includes the syringe tube 106, valve body 110, and valve cap 112. In one aspect, the additional capabilities of the valve assembly of the sample cartridge rely in part on the filter, features of the valve body and cap, as well as the particular workflow sequence performed by the instrument interface of the module. For example, valve assembly A has a valve body 110 shaped with a circular cavity to support a polymer filter disc 116 to filter the sample, and the cap 112 has a sonication dome feature 113, which interfaces with a sonication horn of a cartridge receiving module so as to ultrasonically lyse the target. By contrast, valve assemblies B and C have a valve body 110 with an oblong filter recess 111 that receives a glass filter 114 (e.g. glass column) therein, the glass filter configured for binding with nucleic acid released from the target by chemical lysing. Valve assembly D has a design more similar to valve assembly A, having a cap 112 with a sonication dome 113, and a valve body with a circular cavity for supporting a disc filter, however this design uses a glass fiber filter 117. Utilizing glass fibers to form the filter facilitates affinity bonding with the free nucleic acid released by chemical lysing. Thus, this filter is suited for both mechanical and chemical lysing. U.S. Provisional Application No.63 / 217,672 further details the assay cartridge of valve assembly D and is incorporated herein by reference in its entirety. Reaction Modules

[0277] In certain embodiments the cartridge is configured for insertion into a reaction module 300. The module is configured to receive the cartridge therein. In certain embodiments the reaction module provides heating plates 308 to heat the temperature- controlled chamber or channel. The module can optionally additionally include a fan 304 to provide cooling where the temperature-controlled channel or chamber is a thermocyclingDocket No. P2024-0535-WO (68634WO01) channel or chamber. Electronic circuitry 302 can be provided to pass information (e.g., optical information) top a computer for analysis. In certain embodiments the module can contain optical blocks 306 to provide excitation and / or detection of one or more (e.g., 1, 2, 3, 4, or more) optical signals representing, e.g., signal DNAs amplified for various PCR targets. In various embodiments an electrical connector 312 can be provided for interfacing the module with a system (e.g. system controller or with a discrete analysis / controller unit. The sample can be introduced into the cartridge using a pipette 310. In certain embodiments, the module also contains a controller that operates a plunger in the syringe barrel and the rotation of the valve body. Analytical System

[0278] In certain embodiments a system (e.g., a processing unit) is provided. The system may include an enclosure that is configured to support and power multiple sample processing modules 300, where each processing module is configured to hold and operate a removable cartridge 100. In some embodiments, the system is configured to operate the sample processing modules to perform a PCR assay for one or more target nucleic acid analytes and optionally to determine the level of one or more target RNA / DNA sequences within a corresponding removable sample cartridge. Typically, the processing on a sample within the corresponding removable sample cartridge involves operating the cartridge to perform a method as described herein. In certain embodiments the system is configured to contain one sample processing module. In certain embodiments the system is configured to contain at least two or more sample processing modules (e.g., at least 4, 8, 12, 16, 20, 24, 28, 32, 64, 128 or more) sample processing modules. In some embodiments, the system provides a user interface that allows the user input operational instructions and / or to monitor operation of the cartridges to determine the presence and / or quantity of one or more nucleic acids.

[0279] While the methods described herein are described primarily with reference to the GENEXPERT® cartridge by Cepheid Inc. (Sunnyvale, Calif.) (see, e.g., FIG.1A), it will be recognized, that in view of the teachings provided herein the methods can be implemented on other cartridge / microfluidic systems, including alternative cartridge designs having valve assemblies that involve multiple interfacing components, as well as cartridge body defined by multiple interfacing components to form the multiple chambers of theDocket No. P2024-0535-WO (68634WO01) cartridges, for example, those described in Korean Application No.102293717B1 and KR102362853B1, cartridges that utilizes ultrasonic waves to lyse cells in a biological sample, for example, those described in International Application No. WO2021 / 245390A1, cartridges and systems that utilizes an electrowetting grid for microdroplet manipulation and electrosensor arrays configured to detect analytes of interest, for example, those described in International Application No. WO2016 / 077341A2, cartridges that facilitate movement of nucleic acid from one chamber to the next chamber by opening a vent pocket, for example, those described in International Application No. WO2012 / 145730A2, multiplexed assay systems comprising a plurality of thermocycling units such that individual chambers can be heated, cooled, and / or compressed to mix fluid within the chamber or to propel fluid in the chamber into another chamber, for example, those described in International Application No. WO2015 / 138343A1, and as well as systems for rapid amplification of nucleic acids facilitated by flexible portions of the sample cartridge aligned to accomplish temperature cycling for nucleic acid amplification, for example, those described in International Application No.WO2017 / 147085A1. Such cartridge / microfluidic systems can include, for example microfluidic systems implemented using soft lithography, micro / nano-fabricated microfluidic systems implemented using hard lithography, and the like.

[0280] In one exemplary embodiment, the cartridge can include a plurality of cartridge bodies, such as a first body, a second body, a central syringe barrel that is in fluid communication with the first body and the second body, a reaction vessel, and the like. The first body may be formed of a plurality of chambers separated from each other for reagents or buffers and sample processing. In some embodiments, the first body can be used for the purpose of storing a plurality of reagents. The second body may be formed of one or a plurality of chambers separated from each other and includes a path through which the reagent or sample from the first body moves. When the first body and the second body of cartridge are combined, a liquid flow path and optionally an air flow path can be formed between both compartments via the central syringe barrel. The liquid flow path is connected to the first body to provide a space for samples and reagents to move and mix. The air flow path may connect the reaction vessel and a vacuum control region of the “plunger” to control the vacuum that may occur when the extracted nucleic acid moves to the reaction vessel. Rotation of the syringe barrel comprising a “plunger” that can sequentially suck sample and reagents from the plurality of chambers into an interior space of the syringeDocket No. P2024-0535-WO (68634WO01) barrel and discharge the mixture of the interior space into any one of the plurality of chambers (first body or second body) of the cartridge. Rotation of the syringe barrel comprising a “plunger” can suck the reagent inside the plurality of chambers of the cartridge into the interior space of the syringe barrel and then discharge the mixed reagent to a nucleic acid amplification reaction vessel.

[0281] In another exemplary embodiment, the cartridge includes a flow cover and a base plate, which together form a closed passage therein. In one embodiment of this configuration, an inner chamber containing the reagents required for dielectric extraction is provided separately from an outer chamber, and the upper and lower portions of the inner chamber are sealed. In addition, a double-structured flow cover-pad can be disposed between the outer chamber and the base plate. Closed flow paths are formed by achieving a strong coupling between the base plate - the flow cover - the pad - the outer chamber. Also provided in this configuration are beads necessary for dielectric extraction and amplification which are accommodated in a dual chamber structure of an outer chamber-bead chamber. The beads can be maintained by a dehumidifying unit positioned above the bead chamber even when the bead chamber is opened.

[0282] In further exemplary embodiment, the cartridge can include a plurality of reaction chambers, particularly, the reaction vessel can include a plurality of reaction chambers. In these embodiments, different types of lyophilized primers and probes can be provided in each reaction chamber. For example, primers and probes for viral-associated nucleic acids can be provided in one reaction chamber, and primers and probes for bacterial- associated nucleic acids can be provided in a second chamber for amplification and detection, and such the like. Of course, it is possible to perform various amplification and detection processes at the same time in a single reaction chamber. Accordingly, amplification of each target nucleic acid described herein may be performed individually in separate reaction chambers or wells or carried out in a multiplex reaction in a single reaction chamber or well.

[0283] Additionally, it is appreciated that the panel assay methods described herein (i.e., identification of multiple conditions based on comparative levels of multiple-target nucleic acids obtained from a single sample) can further be realized in entirely different systems, including: isothermal nucleic acid amplification systems, digital RT-PCR, electrochemical PCR, lateral flow testing cartridges, electrochemical sensors, nucleic acidDocket No. P2024-0535-WO (68634WO01) sequencing, CRISPR / Cas based technologies, chemiluminescence, and nanoparticle-based colorimetric detection.

[0284] In various embodiments, the signal DNA(s) from PCR (nucleic acid amplification) reactions are amplified for detection and / or quantification. In certain embodiments, the amplification comprise any of a number of methods including, but not limited to polymerase chain reaction (PCR), ligase chain reaction (LCR), ligase detection reaction (LDR), multiplex ligation-dependent probe amplification (MLPA), ligation followed by Q-replicase amplification, primer extension, strand displacement amplification (SDA), hyperbranched strand displacement amplification, multiple displacement amplification (MDA), nucleic acid strand-based amplification (NASBA), rolling circle amplification (RCA), and the like.

[0285] In illustrative, but non-limiting embodiments, the amplification reaction may produce an optical signal that is proportional to the amount of amplified target nucleic acid (e.g., signal DNA). Illustrative optical signals include, but are not limited to a fluorescent signal, a chemiluminescent signal, an electrochemiluminescent signal, a colorimetric signal, and the like. In certain embodiments the optical signal is a fluorescent optical signal generated by a fluorescent indicator. In certain embodiments the fluorescent indicator is a non-specific intercalating dye that binds to double-stranded DNA products, while in certain other embodiments, the fluorescent indicator comprises a target sequence-specific probe (e.g., a TAQMAN® probe, a SCORPION® probe, a MOLECULAR BEACON®, and the like).

[0286] Single PCR reactions (nucleic acid amplification), or multiple PCR reactions (nucleic acid amplifications) run sequentially (or simultaneously in separate temperature controlled channels or chambers) can also use the same detectable label since sequentially run PCR signal DNAs are analyzed sequentially and the simultaneous PCR signal DNAs are distinguished by the occurrence in different temperature controlled channels or chambers. The signal produced by this amplification can be distinguished from other amplification products because it is not run at the same time and / or because it is run in a different reaction channel / chamber. However, where multiple nucleic acid amplifications are run simultaneously in the same chamber the reaction products of for each analysis are typically detected and / or quantified by the use of different and distinguishable labels.Docket No. P2024-0535-WO (68634WO01)

[0287] In certain embodiments, amplification products (amplified nucleic acid from nucleic acid analysis) can be detected using methods well known to those of skill in the art. In certain embodiments the amplification is a straightforward simple PCR amplification reaction. In certain embodiments, however, a nested PCR reaction is used to amplify the nucleic acid from the nucleic acid analysis. In various embodiments, multiplexed PCR assays are contemplated, particularly where it is desired to analyze multiple products of the nucleic acid analysis in the same amplification reaction. In certain embodiments in such multiplexed amplification reactions, each probe (e.g., for each specific analyte) has its own specific dye / fluor so that it is detectable independently of the other probes. In certain embodiments, typically, for signal generation, the probes used in various amplification reactions utilize a change in the fluorescence of a fluorophore due to a change in its interaction with another molecule or moiety brought about by changing the distance between the fluorophore and the interacting molecule or moiety for detection and / or quantification of the amplified product. Alternatively, other methods of detecting a polynucleotide in a sample, including, but not limited to, the use of radioactively labeled probes, are contemplated. Assay Workflows

[0288] Prior to carrying out amplification reactions on a sample, one or more sample preparation operations are performed on the sample. Typically, these sample preparation operations will include such manipulations as extraction of intracellular material, e.g., nucleic acids from whole cell samples, viruses and the like to form a crude extract, additional treatments to prepare the sample for subsequent operations, e.g., denaturation of contaminating (e.g., DNA binding) proteins, purification, filtration, desalting, and the like. Liberation of nucleic acids from the sample cells or viruses, and denaturation of DNA binding proteins may generally be performed by chemical, physical, or electrolytic lysis methods. For example, chemical methods generally employ lysing agents to disrupt the cells and extract the nucleic acids from the cells, followed by treatment of the extract with chaotropic salts such as guanidinium isothiocyanate or urea to denature any contaminating and potentially interfering proteins. Generally, where chemical extraction and / or denaturation methods are used, the appropriate reagents may be incorporated within a sample preparation chamber, a separate accessible chamber, or may be externally introduced. Preferably, sample preparation is carried out in only one step or no more thanDocket No. P2024-0535-WO (68634WO01) two steps. For example, sample preparation can include heating the sample in a lysis solution without further purification prior to carrying out the amplification reaction. In some embodiments, the lysed sample may be diluted prior to carrying out the amplification reaction. One or more of these various sample preparation operations are readily incorporated into the fluidly closed cartridge systems contemplated herein.

[0289] In one aspect, the assay sample cartridge, as described herein, is capable of a specialized workflow that performs lysing and detection of differing target analytes as required for a particular panel assay. In some embodiments, the cartrdige is configured for chemical lysing of the multiple target organisms. In other embodiments, the cartridge is configured for mechanical lysing of the multiple target organisms. In still other embodiments, the cartridge is configured for both mechanical and chemical lysing to allow lysing of multiple targest of differing types. Accordingly, the sample cartridge can be configured to perform the panel assay by an existing workflow associated with conventional cartridges, or can be operated according to an new workflow specially configured for the panel assay.

[0290] In one aspect, the sample cartridge having a valve assembly is capable of a variety of workflows that perform: chemical lysing of target organisms, mechanical lysing of target organisms, or both. Accordingly, the sample cartridge can perform an existing workflow associated with conventional specialized cartridges or can perform entirely new workflows that perform both.

[0291] Exemplary assay workflows that can be performed with a single universal cartridge, in accordance with some embodiments, are shown in FIG.5. In any of these embodiments, the filter can be formed of glass filter to promote affinity binding of the nucleic acids (NA) to the glass fibers and a pore size suited for chemical lysing as well. In any of these workflows, the nucleic acid amplification can be PCR, real-time PCR, isothermal amplification (including but not limited to nucleic acid sequence-based amplification, loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, multiple displacement amplification, whole genome amplification or recombinase polymerase amplification) or other nucleic acid amplification methods known to persons of skill in the art.Docket No. P2024-0535-WO (68634WO01)

[0292] In Workflow A, the sample is optionally exposed to a sample treatment or chemically lysed, then the treated or lysed fluid sample is flowed through the filter where target organisms are captured. In some embodiments, the sample treatment is used to either weaken the cell wall or to inactivate the sample or make it less viscous to facilitate being processed through the filter. The filter is then washed, leaving the target organisms on the filter. Next, the target organisms are mechanically lysed, such as by sonication, to release nucleic acid (NA). In some embodiments, mechanical lysing includes in-filling glass beads along the filter to aid in mechanical lysing of the target. Next, the NA is eluted from the filter and then nucleic acid amplification is performed is performed.

[0293] In Workflow B, the sample is chemically lysed to obtain the NA targets. In some embodiments, after chemically lysing, the NA is bound to the filter by the presence of precipitating and binding reagent. Next, the filter is washed with a rinse reagent while the NA remains bound to the filter. Typically, the wash reagents have some amount of salt which still promotes the binding of the NA to the filter, while allowing removal of non- target materials. Next, the filter is eluted to remove the NA targets. In some embodiments, the elution is performed with a pH neutral buffer or basic buffer fluid. The target NA is then delivered to an attached reaction vessel to perform nucleic acid amplification.

[0294] In Workflow C, the fluid sample is exposed to sample treatment and / or chemically lyse the target organisms. Next, the NA freed by chemical lysing is bound to the filter. This step may utilize precipitating and binding reagent. Next, the filter is washed with a rinse reagent while the NA remains bound to the filter. Typically, the wash reagents have some amount of salt which still promotes the binding of the NA to the filter, while allowing removal of non-target materials. Next, the target organisms captured in the filter are heat and / or mechanically lysed. This may utilize sonication, and may further utilize glass beads to facilitate mechanical lysing of select target organisms. Then, the lysed target NA is eluted from the filter. In some embodiments, the elution is performed with a pH neutral buffer or basic buffer fluid. The target NA is then delivered to an attached reaction vessel to perform nucleic acid amplification. Thus, in this workflow, the workflow allows for lysing of multiple differing target organisms, some requiring only chemically lysing (e.g. viral targets), and others requiring mechanical lysing (e.g. bacteria, spores, etc.), such that all these target NAs can be released from a single sample and tested by the same sample cartridge. While the above workflow described mechanical lysing after chemical lysing, it isDocket No. P2024-0535-WO (68634WO01) appreciated that other workflows may be utilized in which chemical lysing occurs after mechanical lysing.

[0295] In some embodiments, the sample cartridge includes an identifier with information as to the appropriate workflow needed for a particular panel of assays, so that an instrument module receiving the sample cartridge operates according to the specified workflow. Exemplary Assay Configurations Reagents for Coronavirus Biomarker Panel Assay

[0296] FIG.4 shows an exemplary sample cartridge that can be used as part of the GENEXPERT® system, with the various chambers designated by number. The exemplary cartridge can include: lyophilized reagents in the form of one or more beads as described herein; an optional lysis reagent; alkaline agent, optional binding reagent, filtering reagent, washing reagent, and eluting reagent. The last four reagents are named according to the functions they perform with respect to nucleic acid. Thus, for example the binding reagent facilitates the binding of nucleic acid to a substrate, the filtering reagent facilitates filtration of the nucleic acid.

[0297] In some embodiments, the lysis reagent can include a chaotropic agent, a chelating agent, a buffer, an alkaline agent, or a detergent. The chaotropic agent can be selected from a guanidinium compound such as guanidinium thiocyanate or guanidinium hydrochloride, an alkali perchlorate such as lithium perchlorate, an alkali iodide, magnesium chloride, urea, thiourea, a formamide, or a combination thereof. The concentration of the chaotropic agent can range from about 1 M to about 10 M, such as from about 2.5 M to about 7.5 M, or less than 4.5 M, less than 2 M, or less than 1 M. The chelating agent can be selected from N-acetyl-L-cysteine, ethylenediaminetetraacetic acid (EDTA), diethylene triamine pentaacetic acid (DTPA), ethylenediamine-N,N′-disuccinic acid (EDDS), 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid (BAPTA), and a phosphonate chelating agent. The concentration of the chelating agent can range from about 10 mM to about 100 mM and / or comprises about 0.5% to about 5% of the lysis reagent. The buffer can be selected from the group consisting of Tris, phosphate buffer, PBS, citrate buffer, TAPS, Bicine, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, andDocket No. P2024-0535-WO (68634WO01) MES. The concentration of the buffer can range from about 5 mM to about 100 mM, such as from about 5 mM to about 50 mM. The detergent can be selected from an ionic detergent or a non-ionic detergent. In some examples, the detergent comprises a detergent selected from the group consisting of N-lauroylsarcosine, sodium dodecyl sulfate (SDS), cetyl methyl ammonium bromide (CTAB), TRITON®-X-100, n-octyl-β-D-glucopyranoside, CHAPS, n-octanoylsucrose, n-octyl-β-D-maltopyranoside, n-octyl-β-D- thioglucopyranoside, PLURONIC® F-127, TWEEN® 20, and n-heptyl-β-D- glucopyranoside. The detergent can comprise about 0.1% to about 2% of the lysis reagent, and / or ranges from about 10 mM up to about 100 mM. The lysis reagent can have a pH ranging from about pH 3.0 to about pH 5.5.

[0298] In some embodiments, the assays disclosed herein do not utilize a chaotropic agent or a lysis buffer. When a chaotropic agent or lysis buffer is not used, the sample can be contacted with a buffer (or filtering reagent) including, for example, saline (including one or more inorganic salts, such as CaCl2, MgSO4, KCl, NaHCO3, NaCl, etc.), phosphate buffer, Tris buffer, 2-amino-2-hydroxymethyl-1,3-propanediol, HEPES, PBS, citrate buffer, TES, MOPS, PIPES, Cacodylate, SSC, MES, saccharide or disaccharide, or combinations thereof. For example, the buffer can be a commercially available buffer such as Hanks’ Balanced Salt Solution available from Sigma Aldrich or TE Buffer available from Fisher BioReagents.

[0299] In some embodiments, the alkaline agent can be selected from an alkali metal hydroxide, such as sodium hydroxide or potassium hydroxide. The concentration of the alkaline agent can be about 0.5 N to 5 N.

[0300] The binding reagent can promote binding of nucleic acids to the filter, facilitating the removal of non-target material. In some embodiments, the binding reagent can include a binding polymer such as polyacrylic acid (PAA), polyacrylamide (PAM), polyethylene glycol (PEG), poly(sulfobetaine), or a salt, or combinations thereof. In some embodiments, the filtering reagent and / or the washing reagent can include the binding reagent. For example, the binding reagent, the filtering reagent, and / or the washing reagent can include a binding polymer (e.g., PEG 200), buffer, inorganic salt, antioxidant and / or chelating agent, antifoam SE15, sodium azide, disaccharide or disaccharide derivative, carrier protein, detergent, or DMSO. The binding polymer can be present in an amount of at least 10% v / v, at least 20% v / v, at least 30% v / v, and / or less than 60% v / v, less than 40%Docket No. P2024-0535-WO (68634WO01) v / v, less than 30% v / v, less than 20% v / v, or less than 10% v / v or can fall within any range bounded by any of these values, e.g., from 10% to 60% v / v, of the binding reagent, filtering reagent, and / or the washing reagent. The buffer can be selected from the group consisting of Tris, 2-amino-2-hydroxymethyl-1,3-propanediol, HEPES, phosphate buffer, PBS, citrate buffer, TAPS, Bicine, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, and MES. The concentration of the buffer can range from about 5 mM to about 100 mM, such as from about 5 mM to about 50 mM. The salt, such as NaCl, KCl, or MgCl2, can be present at a concentration from about 0.05 M to about 1 M, such as from about 0.1 M to about 0.5 M. The antioxidant and / or chelating agent comprises an agent selected from the group consisting of N-acetyl-L-cysteine, ethylenediaminetetraacetic acid (EDTA), diethylene triamine pentaacetic acid (DTPA), ethylenediamine-N,N′-disuccinic acid (EDDS), 1,2- bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid (BAPTA), and a phosphonate chelating agent. In some embodiments the antioxidant and / or chelating agent comprises EDTA. In certain embodiments the antioxidant and / or chelating agent comprise 0.2% to about 5%, about 0.2% to about 3%, or about 0.5% to about 2%, or about 0.5% of the binding reagent, filtering reagent, and / or the washing reagent. In some embodiments the concentration of the antioxidant and / or chelating agent in the binding reagent, filtering reagent, or the washing reagent ranges from about 2 mM to about 50 mM or about 5 mM to about 20 mM. In some embodiments, the detergent is an ionic detergent or a non-ionic detergent. The detergent can be selected from an ionic detergent or a non-ionic detergent. In some examples, the detergent comprises a detergent selected from the group consisting of N-lauroylsarcosine, sodium dodecyl sulfate (SDS), cetyl methyl ammonium bromide (CTAB), TRITON®-X-100, n-octyl-β-D-glucopyranoside, CHAPS, n-octanoylsucrose, n- octyl-β-D-maltopyranoside, n-octyl-β-D-thioglucopyranoside, PLURONIC® F-127, TWEEN® 20, Brij-35, and n-heptyl-β-D-glucopyranoside. The detergent can comprise about 0.1% to about 2% of the binding reagent, filtering reagent, and / or the washing reagent, and / or ranges from about 10 mM up to about 100 mM. The binding reagent, filtering reagent and / or the washing reagent can have a pH ranging from about pH 6.0 to about pH 8.0 (such as from about 6.5 to about 7.5).

[0301] In some embodiments, the eluting reagent can have a pH greater than about 9, greater than about 10, greater than about 11, or greater than about 12. The use of high pH to elute nucleic acid such as DNA is unique especially to the cartridges described herein andDocket No. P2024-0535-WO (68634WO01) provides improved speed and performance of the disclosed methods. Speed is provided by the rapid neutralization of acidic ammonium ions by the high concentration of hydroxide ions. Alkylamines have a pKa ~10-11 and are immediately deprotonated at pH 12.7, to form the neutral free base on the solid surface and release the cationic DNA. A further advantage of the high pH is the denaturing effect of KOH on captured DNA or RNA. Acidic functional groups in the heterocyclic bases of DNA or RNA are immediately deprotonated and cannot form Watson-Crick bonds. Double-stranded structures and other secondary structures are disrupted, but can re-nature when neutralized for example, with Tris HCl. This chemical denaturing of captured genomic DNA can be an advantage for isothermal assays that do not undergo the usual heat denaturing of PCR. The cartridges provided herein allow for rapid neutralization of eluted DNA or RNA in KOH followed by reaction with Tris to produce a final pH of about 8.5 for downstream PCR or other nucleic acid assays. In some embodiments, the eluting reagent can have a pH less than about 9, less than about 8.5, or less than about 8. This lower-pH elution of bound DNA or RNA can be an advantage, especially for devices that do not facilitate rapid neutralization of the KOH solution. It is known that RNA is hydrolyzed by high pH, but short exposure times to KOH can provide for good quality RNA. In some examples, the eluting reagent comprises a polyanion, a polycation, ammonia or an alkali metal hydroxide. For example, the eluting reagent may comprise a polyanion such as a carrageenan, a carrier nucleic acid, or a combination thereof.

[0302] In some instances, to reduce bubble formation in one or more of the chambers, the detergent Brij may be added to one or more of the reagents described herein.

[0303] It is understood that various other reagents and initial volumes can be used for performing an automated PCR panel assay on a sample inserted into the cartridge. Specialized Cartridge Components

[0304] FIG.4 illustrates an exemplary cartridge suitable for performing a multi- target panel assay, as described herein. The illustrated cartridges are based on the GENEXPERT® cartridge (Cepheid, Inc., Sunnyvale, Calif.). The cartridge 100 comprises a cartridge body 102 having multiple chambers 108 defined therien for holding various reagent and / or buffers. The chambers are disposed around a central syringe barrel 109 that is in fluid communication with valve body 110 through valve syringe tube 106 extending through the syringe barrel 109. In some embodiments, the valve assembly include any of theDocket No. P2024-0535-WO (68634WO01) valve assemblies described herein, or any suitable valve assembly. In this embodiment directed to an cartridge, the cartridge utilizes a valve assembly capable of chemical lysing, for example, any of valve asemblies B-D in FIG.2. The valve body 110 is interface within the cartridge body and supported on a cartridge base 101. The cartridge typically contains one or channels or cavities that can contain a filter material (e.g. glass filter column) as described herein that can function to bind and elute a nucleic acid. In various embodiments, the cartridge further comprises one or more temperature controlled channels or chambers that can, in certain embodiments, function as thermocycling chambers. A “plunger” not shown can be operated to draw fluid into the syringe barrel 109 and rotation of the valve body / syringe tube provides selective fluid communication between the various reagent chambers and channels, reaction chamber(s). Thus, the various reagent chambers, reaction chambers, matrix material(s), and channels are selectively in fluid communication by rotation of the valve and plunger and reagent movement (e.g., chamber loading or unloading) is operated by the “syringe” action of the plunger. The attached reaction vessel 116 provides optical windows to provide real-time detection of, e.g., amplification products, base identity in sequencing operations, by operation of the module within the system described herein.

[0305] While the methods described above are described with respect to specific chambers in the GENEXPERT® cartridge, it will be recognized that the particular reagent / chamber assignments can be varied depending on the particularities of the nucleic acid detection / quantification assay. It will also be recognized that in certain embodiments, variants of the GENEXPERT® cartridge are also contemplated. Such variants can include, but are not limited to, more reagent chambers or fewer reagent chambers and / or different sized chambers, two (or more) sample receiving chambers, two (or more) temperature controlled channels or chambers, stacked cartridges (providing control of two cartridges by one module), and the like. In one aspect, the sample cartridge includes one or more features or components that are specially configured per the unique requirements of a particular multi-target assay. In this embodiment, the sample cartridge utilizes certain components specifically developed for the Coronavirus Panel assay.

[0306] FIGS.5A-5B show a detailed view of a valve assembly for use in a multi- target panel assay cartridge, in accordance with some embodiments. In this embodiment, the valve assembly is configured for chemical lysing. The valve assembly includes a valve bodyDocket No. P2024-0535-WO (68634WO01) 110 having a disk shape and tubular syringe type 106 along a proximal portion thereof. The disk portion has a generally planar external upper port surface 120 having one or more ports therein (e.g., 142, 146), as shown in FIG.5A. The valve assembly is rotatable relative to the cartridge housing, for example by engagement of an interface feature 123 with a driven mechanism of the module. The ports 142, 146 on the top planar surface permit fluid communication between the syringe tube 106 and each of the chambers within the cartridge and / or one or more channels. In this embodiment, the ports 142, 146 interface with a circular gasket 126 having multiple ports defined therein which interfaces and fluidically couple with corresponding ports on the bottom of the chambers in the cartridge body. Upon rotation of the valve assembly, the top ports 142, 146 interface with differing pairs of ports so as to fluidically couple the various chambers to each other or to channels of the reaction vessel attached to the cartridge so that movement of the “plunger” through the syringe tube advances fluid between the various chambers and / or channels to facilitate processing and subsequent analytical testing of the fluid sample.

[0307] As seen in FIG.5B, the valve body includes a lysing chamber 121 on an underside thereof that may contain solid phase material for capturing cells, spores, viruses, or microorganisms to be lysed. Suitable solid phase materials include, without limitation, filters, beads, fibers, membranes, filter paper, glass wool, polymers, or gels. One or more interior ports facilitate fluid flow into and out of the lysing chamber. In this embodiment, the solid phase material is a glass filter 114 that resides in a filter recess 111 in the valve body 110 for capturing nucleic acid released by chemical lysing of the target organisms in the fluid sample.

[0308] As shown in FIGS.5A-5B, an outer wall 122 of the valve body encloses the lysing chamber 121 along with bottom cap 112. As seen in FIG.5B, the lysing chamber 121 includes a pair of processing ports to facilitate flow of fluid sample into and out of the lysing chamber. A first fluid processing port 124 coupled to a first fluid processing channel defined within the valve body, and a second fluid processing port 125 coupled to a second fluid processing channel defined within the valve body. Through these channels, the first fluid processing channel is coupled to both the inner conduit of the syringe tube 106 and external port 142, while the second fluid processing channel is coupled to the second external port 146. By this configuration, application of pressure by movement of a “plunger” through the syringe tube 106 acts like a syringe, drawing fluid from one chamberDocket No. P2024-0535-WO (68634WO01) into the syringe tube, and after rotation of the valve assembly to position the respective ports to couple with another chamber, movement of the plunger advances the fluid through the valve body and channels into another chamber or channel to the reaction vessel. This approach can perform the various processing steps required to perform a sample preparation protocol for the targeted analytes of the multi-target panel assay.

[0309] In one aspect, the coronavirus panel described herein performs chemical lysing of the targeted bacteria and viruses. Often, in conventional sample cartridges and methods, these bacteria targets are mechanically lysed (e.g., by ultrasonic lysing), whereas chemical lysing is usually reserved for less robust targets such as viruses. In order to perform chemical lysing of both bacterial and viral targets, lysing buffers may have elevated alkalinity (e.g., sodium hydroxide). Further high alkalinity eluting buffers (e.g., ammonia or an alkali metal hydroxide) may be used to elute the nucleic acids bound to the glass filter. While these buffers allow for chemical preparation of the sample, in practice, use of such buffers can be problematic in conventional cartridge as these high alkalinity buffers can degrade the valve assembly material and sealing interfaces between cartridge components, resulting in cracking of the valve assembly and leakage during processing. Such leakage can be detrimental to sample processing. A specialized valve assembly can be used to resist elevated alkalinity (e.g., greater than pH of 10, greater than pH 11, or greater than pH 12) of these buffers. One difficulty in developing conventional valve assemblies is that these valve assemblies are fabricated by injection molding of certain polymer materials, typically polycarbonate, polyolefin (including polyethylene or polypropylene), or combinations thereof. Typical such polymer materials used in injection molding are not resistant to the range of elevated alkalinity noted, and polymer materials that are resistant, may be considerably more costly and may be less suited for injection molding of small-scale microfluidic features. Thus, the specialized valve assemblies can be developed by annealing valve body assemblies formed with conventional polymers in order to harden the polymer material sufficiently to resist elevated alkalinity. Annealing of polycarbonate reduces chemical corrosion by the mixture of NaOH and GTC within the lysis reagent and the eluting reagent. In some embodiments, after the valve assemblies are formed, they are heated to an elevated temperature (e.g., 90-100 ºC, about 100 ºC) for about an hour or more, then allowed to slowly cool in a temperature-controlled manner for at least 30 minutes. Studies showed that these annealed valve assemblies resulted in valve assemblies ofDocket No. P2024-0535-WO (68634WO01) substantially the same design and material as conventional valve assemblies, except they were resistant to high alkalinity buffers that could not have been feasible to use in conventional cartridges. Testing of the annealed valve body to alkaline resistance can be performed by exposing the valve body assembly (VBA) to NaOH / GTC, followed by visual inspection for cracking of VBA after 30 min or so. It is appreciated that this annealed cartridge can be advantageous for various reasons and need not be tied to any particular assay described herein. Moreover, it is further appreciated that the assays described herein may be performed with various other cartridge designs, devices and systems and need not be tied to the particular cartridge designs described herein. Illustrative Embodiments

[0310] In some embodiments, a pancoronavirus assay is a rapid, qualitative, in-vitro, multiplexed real-time RT-PCR test for the simultaneous qualitative detection and differentiation of RNA from various coronaviruses, such as Merbecovirus, Sarbecovirus, and SARS-CoV-2.

[0311] In an illustrative embodiment, an extended pancoronavirus assay is a rapid, qualitative, in-vitro, multiplexed real-time RT-PCR test for the simultaneous qualitative detection and differentiation of RNA from SARS-CoV-1, SARS-CoV-2, MERS-CoV, CoV- 229E / NL63, and CoV-OC43 / HKU1. The assay also includes targets to broadly detect nucleic acids from the CoV family (“Pan-CoV” target) in either nasopharyngeal (NP), or oral-pharyngeal (OP), or co-collected NP / OP swabs in VTM / UTM tubes, e.g., from individuals suspected by their healthcare provider to have respiratory infection with an uncommon or emerging coronavirus.

[0312] In some embodiments, such a test satisfies one or more or all of the following criteria: Input Metric TargetDocket No. P2024-0535-WO (68634WO01) organisms that could be present in different swabsp p y p the GeneXpert® Instrument Systems (GeneXpert Dx and GeneXpert Infinity). The GeneXpert System employs single-use disposable cartridges that contain the reagents used for RNA isolation and the RT-PCR process. Because the cartridges are self-contained, cross- contamination between cartridges during the testing process is minimized.

[0314] A Sample Processing Control (SPC), a Sample Adequacy Control (SAC) and a Probe Check Control (PCC) are also included in the illustrative assay. The SPC is present to control for adequate processing of the sample and to monitor for the presence of potential inhibitor(s) in the RT-PCR reaction. The SPC also ensures that the RT-PCR reaction conditions (temperature and time) are appropriate for the amplification reaction and that the RT-PCR reagents are functional. The SAC reagents detect the presence of a single copy human gene and monitor whether the sample contains human DNA. The PCC verifies reagent rehydration, PCR tube filling, and confirms that all reaction components are present in the cartridge including monitoring for probe integrity and dye stability.

[0315] The fluid sample is exposed to sample treatment and / or chemical lysis to release nucleic acid (NA). The released NA is bound to a filter in the cartridge. This step may utilize precipitating and binding reagents. Next, the filter is washed with a washing reagent while the NA remains bound to the filter. Typically, the washing reagent includes salt at a level that still promotes the binding of the NA to the filter, while allowing removal of non-target materials. The NA is then eluted from the filter. In some embodiments, the elution is performed with a pH-neutral buffer or basic buffer. The target NA is then delivered to an attached reaction vessel to perform nucleic acid amplification and / or melt curve analysis. The targets are detected by RT-PCR and / or melt-curve analysis.Docket No. P2024-0535-WO (68634WO01)

[0316] Several illustrative extended pancoronavirus assay designs are shown below in Tables 1-4.Docket No. P2024-0535-WO (68634WO01) Table 1: Embodiment Design A Channel Function Call-outs Target organisms s sDocket No. P2024-0535-WO (68634WO01) Table 2: Embodiment Design B Channel Probe(s) Function Call-outs Target organisms (gene) 1 2 Ct CoV-HKU1 / OC43 HCoV-HKU1 (RP 1ab) HCoV-OC43 (RP 1ab) One conserved region across 2 3+1 Melt Other Coronavirus (Pan-CoV) all lineages (ORF1ab) (beta + delta) 3 2 Ct SARS-CoV-1 SARS-CoV (S + ORF1a)5 2 Ct SARS-CoV-2 SARS-CoV-2 (N2 + RdRP) 6 2 Ct CoV-229E / NL63 HCoV-229E (S) HCoV-NL63 (S) 7 1 Ct SPC Sample processing Control (SPC) 8 1 Ct MERS-CoV MERS-CoV (N) One conserved region across 9 3+1 Melt Other Coronavirus (Pan-CoV) all lineages (ORF1ab) (alpha + gamma) Ct +Docket No. P2024-0535-WO (68634WO01) Table 3: Embodiment Design C Channel Probe(s) Function Call-outs Target organisms (gene) 1 1 Ct SPC Sample processing Control (SPC) One conserved region across 2 3+1 Melt Other Coronavirus all lineages (ORF1ab) (beta + delta) 3 2 Ct SARS-CoV-1 SARS-CoV (S + ORF1a)5 2 CtSARS-CoV-2 (N2 + RdRP)8 1 Ct MERS-CoV MERS-CoV (N) One conserved region across 9 3+1 Melt Other Coronavirus all lineages (ORF1ab) (alpha + gamma) 10 1 Ct + Melt SAC Sample adequacy Control (SAC)Docket No. P2024-0535-WO (68634WO01) Table 4: Embodiment Design D Channel Probe(s) Function Call-outs Target organisms (gene) 1 1 Ct Other Merbecovirus Broad-range Merbecovirus (ORF1ab) Ct One conserved region across 2 3 (beta) + 2 (delta) Other Coronavirus all lineages (ORF1ab) M+elt (beta + delta)8 1 Ct MERS-CoV MERS-CoV (N) 3 (alpha) + Ct One conserved region across 9 1 (gamma) M+Other Coronavirus all lineages (ORF1ab) elt (alpha + gamma) 10 1 Ct (Melt) SAC Sample adequacy Control (SAC) Kits 0317] Also contemplated is a kit for carrying out the methods described herein. Such kits include one or more reagents useful for practicing any of these methods. A kit generally includes a package with one or more containers holding the reagents, as one or more separate compositions or, optionally, as an admixture where the compatibility of the reagents will allow. The kit can also include other material(s) that may be desirable from a user standpoint, such as a buffer(s), a diluent(s), a standard(s), and / or any other material useful in sample processing, washing, or conducting any other step of the assay.

[0318] Kits preferably include instructions for carrying out one or more of the screening methods described herein. Instructions included in kits can be affixed toDocket No. P2024-0535-WO (68634WO01) packaging material or can be included as a package insert. While the instructions are typically written or printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user can be employed. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” can include the address of an internet site that provides the instructions.

[0319] In some embodiments, a kit includes primer pairs for amplifying and / or detecting the above-described coronavirus biomarker panel targets described above, optionally with probes specific for these targets. In some embodiments, these kits can include primers pairs and optional probes for detecting one or more of the above-described controls

[0320] In some embodiments, the kit can include any the reagents described above provided with or in one or more GENEXPERT® cartridge(s). See e.g., US Patents 5,958,349, 6,403,037, 6,440,725, 6,783,736, 6,818, 185; each of which is herein incorporated by reference for this description).

[0321] Any of the kits described here can include, in some embodiments, a receptacle for a nasal aspirate / wash sample and / or a swab for collecting a nasopharyngeal swab sample. EXAMPLES

[0322] Examples 1-4 describe assays employing the additional coronavirus biomarker targets described above in the “Extended Pancoronavirus Assay” section. Example 1: Analytical Reactivity (Inclusivity) of a Pancoronavirus Assay Prototype

[0323] Inclusivity testing was carried out to evaluate the ability of a pancoronavirus assay to detect clinically relevant coronaviruses that broadly represent genetic and geographical diversity using a first prototype that detects selected coronavirus biomarker targets. Inclusivity testing was also carried out to evaluate the ability of the assay to detect synthetic DNA targets of non-circulating or non-human coronaviruses. More specifically, the assay was carried out according to the method outlined in the Illustrative Embodiment section above with primers and probes (disclosed in Table A, above) designed to detect the following seven strains of human coronavirus (CoV): SARS-CoV-2, SARS-CoV-1, MERS,Docket No. P2024-0535-WO (68634WO01) NL63, 229E, OC43, and HKU1. An additional assay was carried out to test whether 12 synthetic strains of non-human CoV can be detected by the primers and probes from the prototype cartridge. The Pan-Coronavirus assay prototype design is shown in the Table 5 below. Table 5: Pancoronavirus Assay Prototype Design Channel Function Call-outs Target organisms

[0324] The experimental design and results are shown in the tables below. To perform this assay, the samples were applied to a simulated nasal swab matrix and thenDocket No. P2024-0535-WO (68634WO01) diluted to the concentrations shown in the tables below.100 µL of sample was loaded into a Genexpert® pancoronavirus prototype cartridge, and the inclusivity assay was carried out. Table 6: Analytical Reactivity (Inclusivity) Pancoronavirus Prototype Assay Tested Against Selected Human Coronviruses Genus / Tested at Detected Detected Subgenus Species Source / Acc.No. conc Organism: Channel: Ct MPH Tm (°C) YES / NODocket No. P2024-0535-WO (68634WO01) Table 7: Analytical Reactivity (Inclusivity) Pancoronavirus Prototype Assay Tested Against Synthetic Coronviruses Genus / Source / Tested at Detected Detected Tm Detected Sub enus Species AccNo conc Or anism: in Ct MPH (°C) YES / NO S S S S S S S S S S S S

[0325] The results shown in Table 6 demonstrate that the pancoronavirus prototype assay correctly identified all seven of the human CoV samples included in the assay. The results shown in Table 7 demonstrate that the pancoronavirus prototype assay correctly identified all 12 of the 12 synthetic CoV samples included in the assay. Example 2: Analytical Exclusivity Performance of the Pancorornavirus Assay Prototype

[0326] Using the Pancoronavirus Assay Prototype above, analytical exclusivity testing was carried out to evaluate the ability of the pancoronavirus assay to detect viruses other than clinically relevant coronaviruses. The exclusivity study tested strains (n=13) were divided into four pools as shown below, each pool being diluted in simulated matrix (nasal swab matrix):Docket No. P2024-0535-WO (68634WO01) Pool 1: Adenovirus 12, Adenovirus 2, Rhinovirus 2, Rhinovirus 14 Pool 2: hMPV 20 (A2), hMPV 03 (B1), HPIV 4A Pool 3: Enterovirus 68, Coxsackievirus A09, Influenza A (H3N2) Pool 4: Influenza B, RSV A, Bordetella parapertussis

[0327] The assay was carried out according to the method outlined in the Illustrative Embodiment section above with primers and probes (disclosed in Table A, above). Table 8: Analytical Exclusivity of Pancoronavirus Prototype Assay Exclusivity strain Conc. DetectedDocket No. P2024-0535-WO (68634WO01)

[0328] The results shown in Table 8 demonstrate that a pancoronavirus prototype assay correctly tested negative for all strains. All Channels were negative, except for the SPC and SAC channels.

[0329] Conclusion: The prototype assay demonstrated sensitivity and specificity for detection in CoV specimens. The Prototype assay was 100% positive for tested inclusivity strains (close to LoD level) and 100% negative for tested exclusivity strains (n=13; data not shown). Example 3: Clinical Sample Performance Testing of a Pancoronavirus Prototype Assay

[0330] For clinical sample performance testing, a pancoronavirus prototype panel as shown in Example 1 was used.

[0331] To evaluate the clinical performance of the Genexpert® pancoronavirus prototype cartridge, a blind clinical study was conducted to determine whether CoV-2 subtypes could be identified and differentiated in clinical samples. A second study using the clinical samples was conducted to compare the performance of the Genexpert® pancoronavirus prototype cartridge against that of a similar assay designed to detect bacterial and viral respiratory pathogens (RP Assay). A third assay was carried out to compare performance of the Genexpert® pancoronavirus prototype cartridge against that of the respiratory pathogens (RP) Assay on clinical SARS-CoV-2 samples. The assays were carried out as described in Example 1. A Sample Processing Control (SPC, an internal control) and Sample Adequacy Control (SAC, a human mRNA control) were included in the cartridge during the runs.

[0332] The results of the Genexpert® pancoronavirus cartridge assay of clinical samples are summarized in the tables below.Docket No. P2024-0535-WO (68634WO01) Table 9: Performance of Pancoronavirus Prototype Assay Tested Against Clinical Samples in a Blind Study CoV Sample Peak Detected in ConclusionDocket No. P2024-0535-WO (68634WO01) Table 10: Performance of Pancoronavirus Prototype Assay Versus Respiratory Panel Assay Tested Against Clinical Samples Respiratory Sample ID Panel (RP) Pan-Coronavirus (PanC)Docket No. P2024-0535-WO (68634WO01) Table 11: Performance of Pancoronavirus Prototype Assay Versus Respiratory Panel Assay Tested Against SARS-CoV-2 Clinical Samples RP Assay Pan-Coronavirus l ID

[0333] Table 9 shows that all clinical samples yielded peaks. Some sample yielded very small peaks or a TMthat deviated from the estimated TM. Tables 10-11 shows that CoV was detected in all clinical samples by both the pancoronavirus prototype assay and the respiratory panel (RP) assay. Table 10 shows that CoV was identified and differentiated in the pancoronavirus prototype (PanC) assay. The results for all clinical samples were similar for the PanC and RP assays. Table 11 shows the PanC assay has a Ct delay of about 1-1,5 Cts compared to the RP assay (due to different fluorophores and assay settings). However, all samples detected with both assays.

[0334] Conclusion: The PanCoronavirus assay tested on clinical samples demonstrated 100% clinical sample detection rate (10 / 10 + 7 / 7). CoV subtypes were identified and differentiated. Comparable results were demonstrated in the PanCoronavirus assay to those in the RP assay.Docket No. P2024-0535-WO (68634WO01) Example 4: Xpert Pancoronavirus Preliminary Analytical Performance

[0335] Further analytical performance testing was performed to ensure the optimized design had a high likelihood of meeting its design input requirements for analytical performance. The following studies were performed: Limit of Detection (LoD), Analytical Reactivity (Inclusivity), and Analytical Specificity (Exclusivity).

[0336] Preliminary Limit of Detection (LoD): Preliminary LoD was estimated and verified using single infected organism samples. LoD for each strain was estimated by testing a minimum of four-to-five serial dilutions (5 replicates per dilution) within the range of the predicted LoD. The lowest concentration with 100% positivity rate was determined as the preliminary LoD for the organism target. The verification for each organism was tested with 20 replicates at the LoD concentration, using a prototype of the Xpert Pan Coronavirus assay. LoD was verified for most of organisms, however for some organisms, the positivity rate was below 95%. Hence, the LoD verification was performed at a higher concentration (x2 LoD level). Most of the organisms tested showed a positivity rate of 100% except Coronavirus NL63 and Merbeco which had a positivity rate of 95% at 9.4E-03 TCID / ml and 1.95E+02 DNA copies / mL, respectively.Docket No. P2024-0535-WO (68634WO01) Table 12. Summary of Results for Preliminary LoD Verification Target LoD Average Average Organism Isolate ID Estimation LoD Verification Ct MPHDocket No. P2024-0535-WO (68634WO01)

[0337] Analytical Reactivity (Inclusivity): An inclusivity study was performed to demonstrate that the prototype Xpert Pan Coronavirus assay oligos detect the different species or subtypes of Coronaviruses. The organisms were tested at a predetermined concentration depending on the type of sample. Synthetic DNA fragments were purchased for preliminary inclusivity evaluation. When the sample type was a heat-inactivated virus, it was tested at 3 different concentrations (1.0E+04 TCID50 / mL, 1.0E+02 TCID50 / mL and 1.0E+01 TCID50 / mL). When the sample type was synthetic DNA fragments, it was tested at 3 different concentrations (1.0E+06 cp / mL, 1.0E+04 cp / mL and 1.0E+03 cp / mL). Results showed that all* inclusivity targets were detected at the highest sample concentration (Tables 13 and 14).Docket No. P2024-0535-WO (68634WO01) Table 13: Summary of Results, Preliminary Inclusivity Testing - Heat-Inactivated Virus Genus Other Alpha Other Beta Other GammaIBV CoV VR-817 100% 24.81 33.33 100% 32.14 27.45 100% 34.94 20.21Docket No. P2024-0535-WO (68634WO01) Table 14: Summary of Results, Preliminary Inclusivity Testing - Synthetic DNA Fragment Genus Other Alpha Other B Other Gamma OtherDelta Buldeco HKU15 MT227371 100% 27.33 5.3 100% 33.84 9.46 100% 36.625 3.81Docket No. P2024-0535-WO (68634WO01)

[0338] Analytical Reactivity (Exclusivity): It was determined whether microorganisms, commonly found in nasopharyngeal or oropharyngeal clinical matrix or phylogenetically related to the organisms detected by the prototype Xpert Pan Coronavirus assay, interfere with the detection of the target organisms of the Xpert Pan Coronavirus assay.

[0339] Specimens were tested in the absence of the Xpert Pan Coronavirus assay target organisms. The microorganisms were tested in pools (Table 15) and spiked into simulated sample matrix, at a concentration of ≥1E6 CFU / mL for bacteria and at ≥1E5 TCID50 / mL or for viruses**. The test was performed using a preliminary prototype of the Xpert Pan Coronavirus assay. No organisms in Table 15 were detected as a Xpert Pan Coronavirus assay organism. Table 15: Exclusivity List and Results from Tested Organisms Escherichia coli ATCC35218 2.00E+06 Not detectedDocket No. P2024-0535-WO (68634WO01) Candida albicans ZM: 08015042.00E+06 Notdetected Mycoplasma orale ATCC 23714 2.00E+06 NotDocket No. P2024-0535-WO (68634WO01) Mumps#0810079CF2.00E+05 Notdetected Herpes Simplex Virus 1 0810005CF 5.10E+03 Not** For Herpes simplex virus 1 (HSV-1) the concentration tested was 5.10E+03 TCID50 / mL, as the available stock was at the concentration 5.10E+03 TCID50 / mL.

[0340] Summary: There are three broad-range targets (Other Sarbecovirus, Other Merbecovirus and Other Coronavirus) in this assay and a melt function is used in one broad- range target (Other Coronavirus). As far as the inventors are aware, this is the first broad- range target assay that can detect broad-range coronaviruses.Docket No. P2024-0535-WO (68634WO01) Example 5: Specificity of Pancoronavirus Assay Biomarker Targets

[0341] This example provides evidence supporting the specificity of the coronavirus biomarker targets described above in the “Pancoronavirus Assay” section; the embodiment of this assay in this example is denoted “Xpert Pan Coronavirus Assay.” The term “Xpert Respiratory Assay” refers to the assay described in WO Application No. PCT / US2024 / 013392 (RESPIRATORY BIOMARKER PANEL). 1 SARS-CoV-2

[0342] To assess the cross-reactivity to non-SARS-CoV-2 sequences, a dataset of sarbecoviruses was generated. NCBI Virus (www.ncbi.nlm.nih.gov / labs / virus / vssi / # / ) is an integrative, value-added resource supporting retrieval, display, and analysis of a curated collection of virus sequences and large sequence datasets. It uses machine processing of all records from the International Nucleotide Sequence Database Collaboration (INSDC) databases as well as human curation to provide high-quality virus sequences, with standardized metadata for a subset of these sequences (www.ncbi.nlm.nih.gov / labs / virus / vssi / docs / about / #our-data-model).

[0343] The following filters were applied to search for Sarbecoviruses: 1. Virus: Sarbecovirus, taxid:2509511. 2. Virus: Exclude: SARS-CoV-2 (Justification: To not overwhelm the data set with SARS-CoV-2 sequences). 3. Sequence Length: 27.000-33.000 (Justification: The aim of this is to retain only complete or almost complete genomes, which more often have high quality sequences. The aim can also be obtained by checking the Nucleotide Completeness option to Complete, which is defined by whether the GenBank ASN.1 format contains the following descriptors: descr / molinfo / completeness=complete or there is a word 'complete' present in the record’s definition line (defline), and it also includes complete reference records (RefSeqs) (www.ncbi.nlm.nih.gov / labs / virus / vssi / docs / about / #our-data-model). However, in our experience there are several almost complete genomes thatDocket No. P2024-0535-WO (68634WO01) are labeled as Partial Genomes, so for the present work, the Sequence Length option was used to capture these sequences). 4. Ambiguous Characters: 290 (Justification: This sets the desired maximum number of N’s to 290. The aim of this is to omit sequences with lower quality. While the specific threshold is arbitrary, it was set to 290 to represent roughly 1% of the genomic size). 5. Host: Non-human (Justification: This excludes sequences where the host field is “human” or not annotated. This mainly excludes SARS-CoV-1 sequences, so that the data set is more focused on the large sequence variation of non-human Sarbecoviruses, because if these are not excluded then ~half of the final data set will be SARS-CoV-1 sequences).

[0344] The search was performed and yielded 263 sequences. A small number of bat strains known to have high homology to SARS-CoV-2, such as the BANAL strains (doi.org / 10.1038 / s41586-022-04532-4), were found to be missing from the 263 sequences. To retrieve additional sequences that may be Sarbecoviruses but not labeled as such, a highly conserved region in Sarbecoviruses (GCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGT GTGCGTACTGCTGCAATAT; SEQ ID NO:164) was used for a BLAST search, where Sarbecoviruses (taxid:2509511), Synthetic constructs (taxid:32630), and artificial sequences (taxid:81077) were excluded from the search. “Somewhat similar sequences (blastn)” was used as the BLAST algorithm. The search was performed on and yielded 27 sequences.

[0345] 26 sequences remained after applying the sequence length and ambiguous characters filters in to the 27 sequences. The 263 Sarbeco sequences and 26 non-Sarbeco BLAST sequences were added to a separate data set of 69 reference Orthocoronavirus sequences, retrieved by searching for Orthocoronavirinae (taxid:25011931) on NCBI Virus, and filtering by RefSeq Genomes. The resulting 358 sequences were aligned in MAFFT v7.520, and a phylogenetic tree was calculated using Neighbour Joining in JalView v2.11.3.2. The workflow is shown in Figure 7. The 285 sequences are fully absent fromDocket No. P2024-0535-WO (68634WO01) SARS-CoV-2 and mostly, but not fully, absent from SARS-CoV-1. They are herein labeled as “broad Sarbeco” sequences.

[0346] The full target sequences from the SARS-CoV-2 reference genome NC_045512.2 were used for the analysis. For the Xpert Respiratory N2 target, one base was manually edited because the primer has a mismatch to NC_045512.2. The target sequences were used as search string against the 285 broad Sarbeco sequences. To allow for mismatches, the threshold was set to >90% identity. For example, the Xpert Respiratory Panel RdRp target is 93 bases, where 84 identical bases (i.e., 9 mismatches) equal 90.3% identity. The RdRp target sequence was therefore used as search string to the 285 broad Sarbeco genomes with a search attribute to allow for 9-character differences.

[0347] The results are shown in Table 16. Whereas Xpert Respiratory Panel and Xpress CoV- / Flu / RSV plus targets had several sequences with >90% identity (>10% of broad Sarbeco sequences for N2 and >20% for RdRp), there was no broad Sarbeco sequence with >90% identity for the Xpert Pan Corona targets. Table 16. Target specificity of SARS-CoV-2 designs to 285 broad Sarbeco genomes SEQ ID NO >90% identity to % of broad Sarbeco Target broad Sarbeco genomes that meet

[0348] There are broad Sarbeco genomes with only 1 mutation to the RdRp target and 2 mutations to the N2 target. Meanwhile, all broad Sarbeco genomes have ≥8 mutationsDocket No. P2024-0535-WO (68634WO01) to the NSP3a target. Synthetic NSP3a DNA for the five most similar sequences were ordered and tested at 1E6 cp / mL. Figure 8 shows that all except one synthetic DNA have non-detectable fluorescence. The one sequence that is detected in ¾ replicates is 16 Ct delayed compared to SARS-CoV-2 wild type, and the sequence is only found in 5 GenBank sequences. 2. Seasonal OC43

[0349] Human coronavirus OC43 share high sequence homology to Betacoronavirus type 1. To assess the cross-reactivity, bovine coronaviruses were retrieved from the nucleotide database at NCBI Nucleotide (www.ncbi.nlm.nih.gov / ). The search term was txid11128[Organism:exp] AND ("27000"[SLEN] : "33000"[SLEN]). This restricts results to bovine coronaviruses, and those with a sequence length of 27,000-33,000 bases. The aim of this is to retain only complete or almost complete genomes, which in our experience more often have high quality sequences. The search was performed on and yielded 291 sequences.

[0350] The target from Xpert Respiratory Panel was then compared to the novel target in Xpert Pan Coronavirus. The input sequences were the full target sequence from the OC43 reference genome KX344031.1. The target sequences were used as search string against the 291 bovine coronaviruses. To allow for mismatches, the threshold was set to >90% identity. For example, the Respiratory Panel OC43 target is 103 bases, where 93 identical characters (i.e., 10 mismatches) equal 90.3% identity. The target sequence was therefore used as search string to the 291 bovine coronavirus genomes with a search attribute to allow for 10-character differences.

[0351] The results are shown in Table 17. For the Respiratory Panel target, 100% of bovine coronaviruses meet the criteria, whereas the number for the Pan Coronavirus target is only 1%. The 1% of sequences are very close to >90%, as highlighted in Table 18, where the number goes to 0% when increasing the criteria to just >91%. In contrast, the Respiratory Panel target continues with 100% even when the criterion is more stringent at >95% (Table 19).Docket No. P2024-0535-WO (68634WO01) Table 17. Target specificity of OC43 designs to 291 bovine coronavirus genomes SEQ ID NO >90% identity to % of bovine Target bovine coronavirus coronavirus genomes tyTable 18. Target specificity of OC43 designs to 291 bovine coronavirus genomes SEQ ID NO >91% identity to % of bovine Target bovine coronavirus coronavirus genomes tyTable 19. Target specificity of OC43 designs to 291 bovine coronavirus genomes SEQ ID NO >95% identity to % of bovine Target bovine coronavirus coronavirus genomes ty

[0352] Bovine coronavirus strain Mebus was tested at 1E5 PFU / mL and compared to human OC43 virus. Figure 9 shows that bovine coronavirus (purple lines) only has residual fluorescence, and the replicates are NOT DETECTED for seasonal coronavirus. Bovine coronavirus strain Mebus was also tested with Xpert Respiratory Panel cartridges (Figure 10), where all replicates were “Coronavirus POSITIVE”, and with BioFireDocket No. P2024-0535-WO (68634WO01) Respiratory Panel 2.1 plus (Figure 11), where all replicates were “Coronavirus OC43 DETECTED”. 3. Seasonal 229E

[0353] Human coronavirus 229E share high sequence homology to alpha coronaviruses, mainly from bat and camel origin. Some of them are “229E-related bat coronavirus,” that are included in “Human coronavirus 229E (taxid:11137).” In this case, it was easier to perform a BLAST search and exclude human seasonal coronaviruses. Note that while this results in a set number of viruses that meet the criteria, there will not be any percentage, since the total number of viruses in the group is not calculated. To assess the cross-reactivity, a BLAST search with the “Somewhat similar sequences (blastn)” algorithm was performed without excluding any organisms. The Description Table (CSV) was retrieved with the Taxid column activated. Then, all rows with Taxid 11137 or 277944 were excluded (seasonal 229E and NL63, respectively). NL63 is excluded because it is also a human seasonal coronavirus and would be detected together in the same optical channel as 229E. Since BLAST is a local alignment, there might be sequences with >90% identity that do not cover the entire target region. In these cases, the % identity was manually calculated using the entire target region.

[0354] The results are shown in Table 5. Whereas 31 coronaviruses met the criteria for the Xpert Respiratory Panel target, only 1 coronavirus did for the Xpert Pan Corona target. Table 20. Target specificity of 229E designs to non-229E coronavirus genomes Target SEQ ID NO >90% identity to non-229E i

[0355] The single hit with >90% identity for Xpert Pan Corona is FJ710056.1. Synthetic DNA covering this region was ordered and tested at 1E6 cp / mL, either with the FJ710056.1 sequence or with human 229E sequence. Figure 12 shows that the FJ710056.1Docket No. P2024-0535-WO (68634WO01) DNA (see shading along the right-hand portion of the x-axis) only has residual fluorescence, and the replicates are NOT DETECTED for seasonal coronavirus.

Claims

Docket No. P2024-0535-WO (68634WO01) CLAIMS What is claimed is:

1. A set of primers and / or probes for detecting the presence of coronavirus in a sample, the set comprising: at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of β-coronavirus C (Merbecovirus), comprising an oligonucleotide sequence conserved across β-coronavirus C; at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of β-coronavirus B (Sarbecovirus), comprising an oligonucleotide sequence conserved across β-coronavirus B; and at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of SARS-CoV-2, comprising an oligonucleotide sequence that is not conserved across Sarbecovirus.

2. The set of claim 1, comprising: the at least one primer pair and / or probe specific for the ORF gene of β-coronavirus C (Merbecovirus), which is specific for the ORF1ab gene of β-coronavirus C; the at least one primer pair and / or probe specific for the E gene of β- coronavirus B (Sarbecovirus); and an additional primer pair and / or probe specific for two or more of the N gene, ORF gene, and the RdRp gene of SARS-CoV-2, comprising oligonucleotide sequences that are not conserved across Sarbecovirus.

3. The set of claim 2, wherein: the at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:4, 5, and 24-30; the at least one primer pair and / or probe specific for the E gene of β- coronavirus B (Sarbecovirus) comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:12, 13, and 43-46; and the additional primer pair and / or probe specific for two or more of the N gene, ORF gene, and the RdRp gene of SARS-CoV-2, comprising oligonucleotideDocket No. P2024-0535-WO (68634WO01) sequences that are not conserved across Sarbecovirus, comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs: 105, 106, and 110-129.

4. The set of claim 1, comprising: the at least one primer pair and / or probe specific for the ORF gene of β-coronavirus C (Merbecovirus), which is specific for the ORF1ab gene of β-coronavirus C; the at least one primer pair and / or probe specific for the E gene of β- coronavirus B (Sarbecovirus); at least one primer pair and / or probe specific for an oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus), wherein the oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus) is conserved across β-coronavirus B; the at least one primer pair and / or probe specific for one or more of the N gene, E gene, S gene, ORF gene, and RdRp gene of SARS-CoV-2, which is specific for the ORF1ab gene of SARS-CoV-2, wherein the primer pair and / or probe specific for the ORF1ab gene of SARS-CoV-2 comprise an oligonucleotide sequence that is not conserved across Sarbecovirus.

5. The set of claim 4, wherein: the at least one primer pair and / or probe specific for ORF1ab gene of β-coronavirus C comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:4, 5, and 24-30; the at least one primer pair and / or probe specific for the E gene of β- coronavirus B (Sarbecovirus) comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:12, 13, and 43-46; the at least one primer pair and / or probe specific for an oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus), wherein the oligonucleotide sequence between the N gene and the 3’ UTR of β-coronavirus B (Sarbecovirus) is conserved across β-coronavirus B, comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:107 and 130-138;Docket No. P2024-0535-WO (68634WO01) the at least one primer pair and / or probe specific for the ORF1ab gene of SARS-CoV-2 comprising an oligonucleotide sequence that is not conserved across Sarbecovirus comprises a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NOs:105, 106, and 110-129.

6. The set of any one of claims 1-5, further comprising a pancoronavirus set of primers and / or probes for detecting the presence of pancoronavirus in the sample, the pancoronavirus set comprising: at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus; and at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of all three of β-coronavirus, γ-coronavirus, and δ- coronavirus.

7. The set of any one of claims 1-5, further comprising a pancoronavirus set of primers and probes for detecting the presence of pancoronavirus in the sample, the pancoronavirus set comprising: at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus, and δ- coronavirus; at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus; and at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus.

8. The set of any one of claims 1-7, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C.

9. The set of any one of claims 1-8, wherein the pancoronavirus set additionally comprises:Docket No. P2024-0535-WO (68634WO01) at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2, preferably all three of the E gene, N gene, and RDRP gene of SARS-CoV-2.

10. The set of any one of claims 1-9, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the N gene of β- coronavirus C.

11. The set of any one of claims 1-10, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1a gene, S2 gene, or a combination thereof, of SARS-CoV-1.

12. The set of any one of claims 1-11, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A.

13. The set of any one of claims 1-12, wherein the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the S gene of α- coronavirus.

14. The set of any one of claims 1-5, further comprising a pancoronavirus set of primers and / or probes for detecting the presence of pancoronavirus in a sample, the pancoronavirus set comprising: at least one primer pair and / or probe specific for the N gene of β- coronavirus C; at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C; at least one primer pair and / or probe specific for the ORF1a gene, S gene, or a combination thereof, of SARS-CoV-1;Docket No. P2024-0535-WO (68634WO01) at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2; at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A; and at least one primer pair and / or probe specific for the S gene of α- coronavirus.

15. The set of claim 14, wherein the pancoronavirus set additionally comprises: at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ-coronavirus; at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus; and at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus.

16. The set of any one of claims 6-15, wherein, when present: the at least one primer pair and / or probe specific for the N gene of β- coronavirus C comprises an oligonucleotide sequence present in MERS-CoV but not conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C comprises an oligonucleotide sequence conserved across Merbecovirus; the at least one primer pair and / or probe specific for the E gene of SARS-CoV-2 comprises an oligonucleotide sequence conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A comprises an oligonucleotide sequence present in CoV-OC43 and CoV- HKU1; and / or the at least one primer pair and / or probe specific for the S gene of α- coronavirus A comprises an oligonucleotide sequence present in CoV-229E and CoV- NL63.

17. The set of claim 16, wherein:Docket No. P2024-0535-WO (68634WO01) the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A is not conserved across β-coronavirus A; and the at least one primer pair and / or probe specific for the S gene of α- coronavirus A is not conserved across α-coronavirus A.

18. The set of claim 16, wherein the pancoronavirus set comprises the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A, which comprises: at least one primer pair and / or probe specific for the ORF1a gene of CoV-OC43; and / or at least one primer pair and / or probe specific for the ORF1a gene of CoV-HKU1.

19. The set of claim 18, wherein the at least one primer pair specific for the ORF1a gene of CoV-OC43 and the at least one primer pair specific for the ORF1a gene of CoV-HKU1 have greater than 85% homology.

20. The set of claim 16 or claim 18, wherein the pancoronavirus set comprises at least one primer pair and / or probe specific for the S gene of α-coronavirus, which comprises: at least one primer pair and / or probe specific for the S gene of CoV- 229E; and / or at least one primer pair and / or probe specific for the S gene of CoV- NL63.

21. The set of claim 20, wherein the at least one primer pair specific for the S gene of CoV-229E and the at least one primer pair specific for the S gene of CoV- NL63 have greater than 85% homology.

22. The set of any one of claims 6-13, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus comprises an oligonucleotide sequence conserved across α-coronavirus; andDocket No. P2024-0535-WO (68634WO01) the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus, γ-coronavirus, and δ- coronavirus comprises an oligonucleotide sequence present in β-coronavirus A, β- coronavirus D, γ-coronavirus, and δ-coronavirus but not conserved in Merbecovirus (β- coronavirus C) and / or not in Sarbecovirus (β-coronavirus B).

23. The set of any one of claims 6-13, wherein: the at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ- coronavirus comprises an oligonucleotide sequence conserved across all α-coronavirus, γ- coronavirus, β-coronavirus and δ-coronavirus; the at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus comprises at least one oligonucleotide sequence present in α-coronavirus, and at least one oligonucleotide sequence present in γ-coronavirus; and the at least one probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus comprises at least one oligonucleotide sequence present in β-coronavirus, and at least one oligonucleotide sequence present in δ-coronavirus, wherein the at least one oligonucleotide sequence present in β- coronavirus is not conserved in Merbecovirus (β-coronavirus C) and / or in Sarbecovirus (β- coronavirus B).

24. The set of claim 14, wherein: the at least one primer pair and / or probe specific for the N gene of β- coronavirus C comprises at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1ab gene of β-coronavirus C comprises at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene, S gene, or a combination thereof, of SARS-CoV-1 comprises:Docket No. P2024-0535-WO (68634WO01) at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the E gene, N gene, RDRP gene, or a combination thereof, of SARS-CoV-2 comprises: at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene is conserved across Sarbecovirus; and at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; the at least one primer pair and / or probe specific for the ORF1a gene of β-coronavirus A comprises: at least one primer pair and / or probe specific for the ORF1a gene of CoV-OC43, wherein the ORF1a gene is not conserved across β-coronavirus A; and at least one primer pair and / or probe specific for the ORF1a gene of CoV-HKU1, wherein the ORF1a gene is not conserved across β-coronavirus A; and the at least one primer pair and / or probe specific for the S gene of α- coronavirus comprises: at least one primer pair and / or probe specific for the S gene of CoV-229E, wherein the S gene is not conserved across α-coronavirus; and at least one primer pair and / or probe specific for the S gene of CoV-NL63, wherein the S gene is not conserved across α-coronavirus.

25. The set of any one of claims 6-13, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene or an ORF1ab gene that is conserved across α- coronavirus;Docket No. P2024-0535-WO (68634WO01) the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus, γ-coronavirus, and δ- coronavirus comprises at least one primer pair and / or probe specific for a RdRP gene or an ORF1ab gene that is conserved across β-coronavirus A, β-coronavirus D, γ-coronavirus, and δ-coronavirus, but not conserved in Merbecovirus (β-coronavirus C) and / or not in Sarbecovirus (β-coronavirus B); and the pancoronavirus set additionally comprises: at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the E gene of SARS-CoV-2, wherein the E gene is conserved across Sarbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of CoV-OC43, wherein the ORF1a gene is not conserved across β-coronavirus A; at least one primer pair and / or probe specific for the ORF1a gene of CoV-HKU1, wherein the ORF1a gene is not conserved across β-coronavirus A; at least one primer pair and / or probe specific for the S gene of CoV-229E, wherein the S gene is not conserved across α-coronavirus; and at least one primer pair and / or probe specific for the S gene of CoV-NL63, wherein the S gene is not conserved across α-coronavirus.Docket No. P2024-0535-WO (68634WO01) 26. The set of claim 6, wherein: at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, β-coronavirus, γ-coronavirus, and δ-coronavirus, wherein the at least one primer pair and / or probe is conserved across α- coronavirus, β-coronavirus A, β-coronavirus D, γ-coronavirus, and δ-coronavirus, but not conserved in Merbecovirus (β-coronavirus C) and in Sarbecovirus (β-coronavirus B); at least one primer pair and / or probe specific for the N gene of MERS-CoV, wherein the N gene is not conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1ab gene of MERS-CoV, wherein the ORF1ab gene is conserved across Merbecovirus; at least one primer pair and / or probe specific for the ORF1a gene of SARS-CoV-1, wherein the ORF1a gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the S gene of SARS-CoV-1, wherein the S gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the N gene of SARS-CoV-2, wherein the N gene is not conserved across Sarbecovirus; and / or at least one primer pair and / or probe specific for the RDRP gene of SARS-CoV-2, wherein the RDRP gene is not conserved across Sarbecovirus; at least one primer pair and / or probe specific for the E gene of SARS- CoV-2, wherein the E gene is conserved across Sarbecovirus.

27. The set of claim 7, wherein: the at least one primer pair specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ- coronavirus comprise at least one nucleotide sequence having at least about 60% homology to an identical or complementary sequence of SEQ ID NO:61 and / or SEQ ID NO:

74.

28. The set of claim 7, wherein: the at least one primer pair and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, β-coronavirus, γ-coronavirus, and δ-coronavirus, comprise a degenerate nucleotide sequence.

29. The set of any one of claims 6-28, wherein:Docket No. P2024-0535-WO (68634WO01) the at least one primer pair and / or probe specific for the ORF1ab gene of Merbecovirus, comprise a degenerate nucleotide sequence.

30. The set of any one of claims 24-26, wherein, when present, the primers and / or probe specific for the N gene of MERS- CoV comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 1, 21, 22, and 23; the primers and / or probe specific for the ORF1ab gene of β- coronavirus C (Merbecovirus) comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 4, 5, 24, 25, 26, 27, 28, 29, and 30; the primers and / or probe specific for the ORF1a gene of SARS-CoV-1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 9, 31, 32, and 33; the primers and / or probe specific for the S gene of SARS- CoV-1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 6, 7, 34, 35, and 36; the primers and / or probe specific for the N gene of SARS- CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 10, 37, 38, and 39; the primers and / or probe specific for the RDRP gene of SARS-CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 11, 40, 41, and 42; the primers and / or probe specific for the E gene of SARS- CoV-2 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 12, 13, 43, 44, 45, and 46; the primers and / or probe specific for the ORF1a gene of CoV- OC43 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 16, 47, 48, 49, and 50; the primers and / or probe specific for the ORF1a gene of CoV- HKU1 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 17, 51, 52, 53, and 54;Docket No. P2024-0535-WO (68634WO01) the primers and / or probe specific for the S gene of CoV-229E comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 14, 58, 59, and 60; the primers and / or probe specific for the S gene of CoV-NL63 comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 15, 555, 56, and 57; the primers and / or probe specific for the RdRP gene conserved across α-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 61, 62, 63, 64, 65, 74, 75, 76, 80, 81, 82, 83, and 89; the primers and / or probe specific for the RdRP gene conserved in β-coronavirus, γ-coronavirus, and δ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, and 90-104 ; the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus, γ-coronavirus, β-coronavirus and δ- coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, and 61-77; the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of α-coronavirus and γ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 80, 81, 82, 83, 84, and 85; and the primers and / or probe specific for the RdRP gene, the ORF1a gene, or a combination thereof, of β-coronavirus and δ-coronavirus comprise a sequence that is identical or complementary to at least 15 contiguous nucleotides of one or more of SEQ ID NO: 18, 19, 20, 78, 79, 86, 87, and 88.

31. The set of any one of claims 1-30, wherein at least one of the primers and / or probes comprises a detectable label.

32. The set of any one of claims 1-31, wherein the set comprises at least one probe comprising a fluorescent dye and a quencher molecule.Docket No. P2024-0535-WO (68634WO01) 33. The set of any one of claims 1-32, further comprises a primer pair specific for an exogenous control and / or an endogenous control, wherein the exogenous control is a sample processing control, and wherein the endogenous control is a sample adequacy control.

34. The set of any one of claims 1-33, wherein the set is contained within one or more cartridge(s).

35. The set of claim 34, wherein the set is contained in one cartridge.

36. The set of claim 35, wherein the cartridge comprises: a cartridge body having a plurality of chambers defined therein, wherein the plurality of chambers is in fluidic communication through a fluidic path of the cartridge; a reaction vessel comprising one or more reaction chambers and configured for amplification of the nucleic acid, wherein each reaction chamber is configured for detection of a plurality of amplification products, wherein the reaction vessel is attached to the cartridge body and fluidically coupled to the fluidic path of the cartridge; and a filter disposed in the fluidic path between the plurality of chambers and the reaction vessel.

37. The set of any one of claims 34-36, wherein the at least one of the plurality of chambers comprises the set of primers and / or probes, or subset thereof, and at least one different chamber of the plurality of chambers comprises one or more lysis reagents for releasing nucleic acid from a sample.

38. A cartridge for detecting coronaviruses in a biological sample, the cartridge comprising: a cartridge body comprising a plurality of chambers therein, wherein the plurality of chambers includes: a sample chamber having at least a fluid outlet in fluid communication with another chamber of the plurality; andDocket No. P2024-0535-WO (68634WO01) a lysis chamber in fluidic communication with the sample chamber, the lysis chamber comprising one or more lysis reagents for releasing nucleic acid, optionally wherein the sample chamber and lysis chamber are the same; a reaction vessel fluidically coupled to the plurality of chambers of the cartridge body and configured for i) amplification of nucleic acid and ii) detection of a plurality of amplification products; a filter disposed in a fluidic path between the lysis chamber and the reaction vessel; and a set of primers and / or probes according to any one of claims 1-33, the set disposed in one or more chambers of the plurality of chambers and / or in the reaction vessel for detection of nucleic acid sequences characteristic of β-coronavirus C, β- coronavirus A, α-coronavirus, SARS-CoV-1, and / or SARS-CoV-2.

39. The cartridge of claim 38, wherein the sample chamber and the lysis chamber are the same.

40. A cartridge for detecting coronaviruses in a biological sample, the cartridge comprising: a first body having a plurality of chambers; a second body fluidically coupled to the first body; a valve assembly configured to rotate and having at least one port fluidically coupled to the second body; a reaction vessel fluidically coupled to the first body or the second body and configured for i) amplification of nucleic acid and ii) detection of a plurality of amplification products; and a set of primers and / or probes according to any one of claims 1-33, the set disposed in one or more chambers of the plurality of chambers and / or in the reaction vessel for detection of nucleic acid sequences characteristic of β-coronavirus C, β- coronavirus A, α-coronavirus, SARS-CoV-1, and / or SARS-CoV-2.Docket No. P2024-0535-WO (68634WO01) 41. The cartridge of claim 40, wherein the cartridge comprises a plurality of flow paths formed on the upper region of the second body, one end overlapping the port of the piston and the other end overlapping the port of the first body.

42. The cartridge of any one of claims 38-41, wherein the reaction vessel comprises one or more reaction chambers for detection of the plurality of amplification products.

43. The cartridge of claim 42, wherein each reaction chamber is configured to detect a single amplification product.

44. The cartridge of claim 42 or claim 43, wherein each reaction chamber is configured to detect a plurality of amplification products.

45. The cartridge of claim 44, wherein the cartridge is configured to detect simultaneously a plurality of amplification products present in solution in a single reaction chamber.

46. The cartridge of any one of claims 38-44, wherein the cartridge is a Clinical Laboratory Improvement Amendments (CLIA)-compliant cartridge.

47. The cartridge of any one of claims 38-46, wherein the cartridge is configured to carry our isothermal amplification.

48. The cartridge of any one of claims 38-46, wherein the cartridge is configured to carry out non-isothermal, optionally by thermal cycling or temperature oscillation.

49. A kit comprising a set according to any one of claims 1-37 or a cartridge according to any one of claims 38-48.

50. A method for detecting coronaviruses in a biological sample, the method comprising: a) contacting nucleic acid from the sample with a set of primers and optional probes according to any one of claims 1-33;Docket No. P2024-0535-WO (68634WO01) b) subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions; c) detecting the presence of amplification product(s), optionally via real-time PCR, melt curve analysis, or a combination thereof, and d) detecting the presence of a coronavirus in the sample based on detection of the amplification products.

51. The method of claim 50, wherein the method comprises administering a treatment regimen to a subject based on detecting the presence of a coronavirus in the sample.

52. The method of claim 50 or claim 51, wherein detecting the presence of amplification product(s) comprises: performing melt assay of the amplification products; and conducting melt curve analysis to detect the presence of one or more amplification products in the reaction vessel.

53. The method of claim 50 or claim 51, wherein detecting the presence of amplification product(s) comprises both real-time PCR and melt curve analysis.

54. The method of any one of claims 50-53, wherein: a) said contacting nucleic acid from the sample with the set of primers and optional probes comprises: placing the sample in a cartridge comprising a cartridge body having a plurality of chambers in fluidic communication, a reaction vessel having one or more reaction chambers and configured for amplification of the nucleic acid, a fluidic path between the plurality of chambers and the reaction vessel, and a filter in the fluidic path; and if the sample comprises cells, lysing cells in the sample with one or more lysis reagents present within at least one of the plurality of chambers; b) said subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions comprises amplifying the nucleic acid with primers and probes present in solution within at least one of the plurality of chambers; andDocket No. P2024-0535-WO (68634WO01) c) said subjecting the nucleic acid, primer pairs, and optional probes to amplification conditions comprises amplifying the nucleic acid with primers and probes present in solution within at least one of the plurality of chambers.

55. The method of claims 54, wherein the filter is configured to bind nucleic acid and allow unwanted material to pass through.

56. The method of claim 54 or claim 55, wherein amplification is isothermal.

57. The method of claim 54 or claim 55, wherein amplification is non- isothermal, preferably by thermal cycling or temperature oscillation.

58. The method of claim 57, wherein said detecting the presence of a coronavirus comprises real-time PCR, melt curve analysis, or a combination thereof.

59. The method of any one of claims 54-58, wherein said detecting is carried out in a single reaction chamber.

60. The method of any one of claims 50-59, wherein the biological sample is a respiratory sample selected from a nasopharyngeal swab (NP), oral-pharyngeal swab (OP), nasal swab (NS), respiratory mucus sample, respiratory tissue sample, respiratory cell sample, saliva sample, sputum sample, or combination thereof.

61. The method of any of claims 50-59, wherein the biological sample is a wastewater sample.

62. The method of any one of claims 50-59, wherein said detecting and is done at the same facility where the biological sample was collected from a subject.

63. The method of any one of claims 50-62, wherein the method is a point-of-care method.

64. The method of any one of claims 50-63, wherein the method is carried out in a hospital, an urgent care center, an emergency room, a physician’s office, a health clinic, or a home.Docket No. P2024-0535-WO (68634WO01) 65. The method of any one of claims 50-64, wherein the method is a Clinical Laboratory Improvement Amendments (CLIA)-waived test.

66. The method of any one of claims 54-64, wherein the cartridge is a Clinical Laboratory Improvement Amendments (CLIA)-compliant cartridge, is operated in compliance with CLIA, is operated by a CLIA-compliant laboratory, or is operated in a CLIA-compliant location.

67. The method of any one of claims 54-66, wherein the method is carried out to facilitate a response to a pandemic, epidemic, and / or endemic pathogen.

68. The method of any one of claims 54-67, wherein the method is carried out to distinguish between a virulent pathogen and a less virulent pathogen.

69. The method of any one of claims 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying MERS-CoV, β-coronavirus C (Merbecovirus), SARS-CoV-1, SARS-CoV-2, β-coronavirus B (Sarbecovirus), CoV-OC43 or CoV-HKU1, CoV-229E or CoV-NL63, α-coronavirus or γ-coronavirus, and β- coronavirus or δ-coronavirus.

70. The method of any one of claims 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying MERS-CoV, β-coronavirus C (Merbecovirus), SARS-CoV-1, SARS-CoV-2, β-coronavirus B (Sarbecovirus), CoV-OC43, CoV-HKU1, CoV-229E, CoV-NL63, α-coronavirus, β-coronavirus, γ-coronavirus, and δ- coronavirus.

71. The method of any one of claims 54-68, wherein detecting the presence of a coronavirus comprises differentially identifying β-coronavirus C (Merbecovirus), SARS-CoV-2, and β-coronavirus B (Sarbecovirus).

72. The set of claim 36 or claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-66, wherein the cartridge facilitates and / or the method comprises detection of coronaviruses within the biological sample within 60 minutes, within 45 minutes, or within 30 minutes of collecting the sample from the subject.Docket No. P2024-0535-WO (68634WO01) 73. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-72, wherein the one or more lysis reagents comprise a chaotropic agent, a chelating agent, a buffer, and a detergent.

74. The set, cartridge, or method of claim 73, wherein the chaotropic agent is selected from guanidinium thiocyanate, guanidinium hydrochloride, alkali perchlorate, alkali iodide, urea, formamide, or a combination thereof.

75. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-72, wherein the one or more lysis reagents comprise a guanidinium compound, sodium hydroxide, EDTA, a buffer, and a detergent.

76. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-75, wherein the filter is configured to bind the nucleic acid to be analyzed.

77. The set, cartridge, or method of claim 76, wherein the filter comprises glass fibers and optionally a polymeric binder, or the glass fibers are optionally modified with a DNA binding ligand such as an alkylamine, a cycloalkylamine, an alkyloxy amine, a polyamine moiety, an arylamine, an intercalating agent, a DNA groove binder, a peptide, an amino acid, a protein, or a combination thereof.

78. The set, cartridge, or method of claim 77, wherein the filter comprises a 500 micron to 2000 microns thick glass fiber disk having a pore size of 0.2 microns to 1 micron.

79. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-75, wherein the filter is configured to bind unwanted material and allow the nucleic acid to pass through.

80. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-79, wherein the cartridge further comprises a binding reagent, wash reagent, eluting reagent, or a combination thereof.Docket No. P2024-0535-WO (68634WO01) 81. The set, cartridge, or method of claim 80, wherein the eluting reagent comprises ammonia or an alkali metal hydroxide.

82. The set, cartridge, or method of claim 80 or claim 81, wherein the eluting reagent has a pH above about 9, above about 10, or above about 11.

83. The set, cartridge, or method of any one of claims 80-82, wherein the eluting reagent comprises a polyanion, optionally a carrageenan, a carrier nucleic acid, or i- carrageenan and KOH.

84. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-83, wherein the reaction vessel comprises up to 4 reaction chambers.

85. The set, cartridge, or method of claim 84, wherein the reaction vessel comprises one reaction chamber.

86. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-85, wherein at least one of the plurality of chambers comprises one or more lyophilized reagents.

87. The set, cartridge, or method of claim 86, wherein the one or more lyophilized reagents is / are in the form of one or more beads.

88. The set, cartridge, or method of claim 87, wherein the one or more lyophilized reagents are selected from primers, probes, a salt, dNTPs, a thermostable polymerase, a reverse transcriptase, or a combination thereof.

89. The set, cartridge, or method of claim 88, wherein the one or more lyophilized reagents comprise lyophilized primers and probes.

90. The set of claim 37, the cartridge of claim 38 or claim 46, or the method of any one of claims 54-85, reagents and components in the reaction vessel are in solution.Docket No. P2024-0535-WO (68634WO01) 91. A system for detecting pathogens in a biological sample, the system comprising: a module having a receiving bay for receiving the cartridge of claim 38 or claim 46, wherein the module includes one or more mechansims within the receiving bay for manipulating a fluid sample within the cartridge, and an instrument that interfaces with the reaction vessel; and a memory having programmable instructions recorded thereon, that are specially configured to operate the module according to a pancoronavirus assay protocol to determine nucleic acid sequence characteristics of α-coronavirus, β-coronavirus, γ- coronavirus, or δ-coronavirus.

92. The system of claim 91, wherein the module and / or system further comprises: a scanner or reader configured to read an identifier on the cartridge; wherein the instructions are configured to determine an applicable protocol based on reading or scanning of the identifier; and wherein the system operates the module according to the applicable protocol based on an input from the scanner or reader.

93. The system of claim 91 or claim 92, wherein the module and / or system further comprises: an enclosure; a plurality of modules that includes said module, wherein modules are substantially identical and configured to concurrently perform assays on cartridges received therein.

94. The system of any one of claims 91-93, further comprising a networking platform for transmitting results derived from module operation.

Citation Information

Patent Citations

  • Integrated molecular diagnosis system and application thereof in tracing animal source of beta coronavirus

    CN111534635A

  • Coronavirus detection

    US20240209460A1

  • Pancoronavirus biomarker panel

    WO2025006633A1