AAV-mediated repair and replace gene therapy for charcot marie tooth type 2e
AAV expression vectors targeting NEFL mutations in CMT2E provide a therapeutic approach by knocking down mutant NEFL and replacing it with wildtype, effectively improving motor function and axonal health in CMT2E models.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
There are no approved therapeutics for Charcot-Marie-Tooth disease type 2E (CMT2E), which is caused by neurofilament light (NEFL) mutations leading to severe motor and sensory defects, impacting patient quality of life and caregiver burden.
Adeno-associated virus (AAV) expression vectors are developed to target and knockdown mutant NEFL using shRNA, while replacing it with wildtype NEFL cDNA, utilizing promoters like U6 and CBA to achieve 'knockdown and replace' therapy.
The AAV vectors effectively reduce mutant NEFL expression, improving motor function and axonal health in CMT2E models, delaying disease progression and enhancing quality of life.
Smart Images

Figure US2025048192_02042026_PF_FP_ABST
Abstract
Description
PATENT APPLICATION Docket No. P14899WO00 TITLE: AAV-MEDIATED REPAIR AND REPLACE GENE THERAPY FOR CHARCOT MARIE TOOTH TYPE 2E CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. § 119 to provisional patent application U.S. Serial No.63 / 699,401, filed September 26, 2024. The provisional patent application is herein incorporated by reference in its entirety, including without limitation, the specification, claims, and abstract, as well as any figures, tables, appendices, or drawings thereof. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is herein incorporated by reference in its entirety. Said XML copy, created on September 25, 2025, is named “P14899WO00_SequenceListing.xml” and is 28,445 bytes in size. TECHNICAL FIELD
[0003] The present disclosure relates generally to the use of adeno-associated virus vectors for the treatment of Charcot-Marie-Tooth disease. BACKGROUND
[0004] Charcot Marie Tooth (CMT) is one of the most common inherited neurological disorders with a prevalence of ~1:2,500. While there are clinical trials for several forms of CMT, there are no currently approved CMT therapeutics. CMT2, a type of CMT, is caused by mutations in multiple genes that give rise to defects in peripheral axons and is clinically classified as an axonopathy. CMT2 patients typically present with near-normal motor nerve conduction velocities but with reduced compound muscle action potentials (CMAP). CMT2E is a result of neurofilament light (NEFL) mutations and clinical symptoms include: muscle weakness and atrophy, sensory defects, decreased reflexes and gait abnormalities, resulting in severe and debilitating symptoms that significantly impact patient quality of life. From a socio-economic perspective, CMT family members are typically responsible for the majority of homecare, resulting in lost productivity for the patient and the caregiver.
[0005] CMT2E is a result of mutations in the NEFL gene, which encodes the NF-L protein. Numerous NEFL missense mutations (and a few deletion mutations) have been linked to CMT2E. NF-L mutations are located throughout the functional domains of the NF-L protein (the head, rodPATENT APPLICATION Docket No. P14899WO00 and tail domains). NF-L, along with other intermediate filaments (IF) including neurofilament medium and heavy (NF-M and NF-H, respectively) are involved in the structural stability of neurons, transport and radial growth of axons. Consistent with their importance, NF-L has also been implicated in other neurodegenerative diseases (including Alzheimer’s disease, Parkinson’s disease, Spinal muscular atrophy, Amyotrophic lateral sclerosis) as a result of neurofilament aggregation. Expression of NF-LP8Rand NF-LQ333Pproteins in primary cells acted in a dominant manner, disrupted the endogenous neurofilament network and reduced the transport of neurofilaments and mitochondria throughout axons. To date, no approved therapeutics exist for any form of CMT2E.
[0006] Thus, there exists a need in the art for therapeutic methods for the treatment of CMT2E. SUMMARY
[0007] Adeno-associated virus (AAV) expression vectors are provided. In some embodiments, the AAV expression vector comprises at least one neurofilament light chain gene (NEFL)- targeting shRNA operably linked to a first promoter and a NEFL cDNA operably linked to a second promoter. In some embodiments, the vector further comprises a 5’ AAV inverted terminal repeat (ITR) and a 3’ AAV ITR. In some embodiments, the vector comprises two or more, three or more, or four or more NEFL-targeting shRNAs. In some embodiments, the NEFL-targeting shRNA comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-3, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto. In some embodiments, the NEFL cDNA comprises a nucleic acid sequence having one or more mutations as compared to the wildtype human NEFL gene. In some embodiments, these one or more mutations decrease and / or prevent shRNA targeting of the NEFL cDNA.
[0008] Pharmaceutical compositions comprising the AAV expression vectors are also provided. In some embodiments, the pharmaceutical composition comprises the AAV expression vector and a pharmaceutically acceptable carrier.
[0009] Methods of treating Charcot-Marie-Tooth disease type 2E (CMT2E) are also provided. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of the AAV expression vector or a pharmaceutical composition comprising the expression vector to the subject.
[0010] Also provided are genetically modified mouse models comprising a mutation to the endogenous neurofilament light (N-FL) protein, wherein said mutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14.PATENT APPLICATION Docket No. P14899WO00
[0011] These and / or other objects, features, advantages, aspects, and / or embodiments will become apparent to those skilled in the art after reviewing the following brief and detailed descriptions of the drawings. The present disclosure encompasses (a) combinations of disclosed aspects and / or embodiments and / or (b) reasonable modifications not shown or described. BRIEF DESCRIPTION OF DRAWINGS
[0012] FIGS. 1A-B: Tissue culture validation of NEFL-targeting shRNAs. 1A: RT-PCR of HEK293 total RNA transfected with NEFL-targeting shRNA-expressing plasmids.1B: Western blot showing NF-L protein reduction in HEK293 cells. Each experiment was performed 4 (RT- PCR) or 3 (Western) separate times. ImageJ analysis showed a ~90% reduction with shRNA 3, 5 and 6.
[0013] FIGS.2A-2B: 2A: shRNA#3 efficiently knocks-down mouse and human (Nefl and NEFL, respectively) mRNA in N2a (mouse) or HEK293 (human) cells. 2B: Construction of the AAV recombinant vector for “knockdown and replace” of NEFL. shRNA#3 was cloned into the vector backbone (pMU2) driven by a U6 promoter. A downstream promoter for robust expression (CBA) is utilized to drive expression of human NEFL.
[0014] FIGS. 3A-C: Nefl E397K CMT2E-model mice. 3A-3C: Homozygous (NeflE397K / E397K) mice; Heterozygous (NeflWT / E397K) mice; and WT mice performing on a dowel beam. The E397K model(s) show dowel scores (time, slips, tail positioning) consistent with a strong and quantitative phenotype within the first 3 months of life.
[0015] FIGS. 4A-D: CMT2E model mice exhibit motor function / balance-related defects. Mice were placed at one end of a 22 mm (diameter) dowel rod (26 inches long) and allowed to walk across. Recorded videos were blinded and assessed for time, tail score (4A), tail grabs (4B), foot slips (4C), and gait (4D). Differences are visible (compared to WT) for both the heterozygous and homozygous CMT2E E397K mouse models. Statistical significance achieved at ~6 months, highlighting a delay in motor skill decline compared to e-phys and axon pathology (Dunnett’s multiple comparisons test).
[0016] FIGS. 5A-B: Rotarod (5A) and all-limb grip strength (5B) assessments. Decreased grip strength is observed in hetero- and homozygous NEFL E397K CMT2E-model mice. Homozygous CMT2E model mice consistently show a decrease in grip over the 360-day analysis time frame (compared to WT mice).
[0017] FIGS.6A-C: Nef l mutant mice showed chronic axonal neuropathy. The sciatic nerve was harvested from wild type (N = 16) Nef l+ / E397K(N = 17) and Nef lE397K / E397K(N = 16) mice at three weeks, twelve weeks, six months, and twelve months of age. (6A) Representative images of axonsPATENT APPLICATION Docket No. P14899WO00 from wild type, Nef l+ / E397Kand Nef lE397K / E397Kmice at three weeks, twelve weeks, six months and twelve months of age. (6B) Sciatic nerve at three weeks were evaluated in wild type (N = 5), NefTwelve weeks axon area for wild type (0.0280μm2, 759 axons), Nef l+ / E397K(0.0150μm2, P < 0.0001, 1090 axons) and Nef lE397K / E397K(0.0110μm2, P < 0.0001, 795 axons) mice. Twelve weeks axon diameter for wild type (0.1724 μm, 759 axons), Nef l+ / E397K(0.1281 μm, P < 0.0001, 1090 axons) and Nef lE397K / E397K(0.1117 μm, P < 0.0001, 795 axons) mice. Twelve weeks G-ratio for wild type (0.6596, 653 axons), Nef l+ / E397K(0.5981, P < 0.0001, 992 axons) and Nef lE397K / E397K(0.5578, P < 0.0001, 644 axons) mice. (6C) Sciatic nerve at six months were evaluated in wild type (N = 4), Nef l+ / E397K(N = 3) and Nef lE397K / E397K(N = 4). Six months axon area for wild type (0.0250μm2, 704 axons), Nef l+ / E397K(0.0131μm2, P < 0.0001, 553 axons) and Nef lE397K / E397K(0.0076μm2, P < 0.0001, 769 axons) mice. Six months axon diameter for wild type (0.1670 μm, 704 axons), Nef l+ / E397K(0.1215 μm, P < 0.0001, 553 axons) and Nef lE397K / E397K(0.0915 μm, P < 0.0001, 769 axons) mice. Six months G-ratio for wild type (0.6386, 622 axons), Nef l+ / E397K(0.5751, P < 0.0001, 464 axons) and Nef lE397K / E397K(0.5093, P < 0.0001, 635 axons) mice. Sciatic nerve at twelve months were evaluated in wild type (N = 3), Nef l+ / E397K(N = 4) and Nef lE397K / E397K(N = 3). Twelve months axon area for wild type (0.0314μm2, 542 axons), Nef l+ / E397K(0.0148μm2, P < 0.0001, 719 axons) and Nef lE397K / E397K(0.0098μm2, P < 0.0001, 627 axons) mice. Twelve months axon diameter for wild type (0.1802 μm, 542 axons), Nef l+ / E397K(0.1302 μm, P < 0.0001, 719 axons) and Nef lE397K / E397K(0.1049 μm, P < 0.0001, 627 axons) mice. Twelve months G-ratio for wild type (0.6415, 480 axons), Nef l+ / E397K(0.5557, P < 0.0001, 636 axons) and Nef lE397K / E397K(0.5515, P < 0.0001, 465 axons) mice. Statistics were determined using one-way ANOVA with Dunnett’s multiple comparison test. N = number of mice evaluated.
[0018] FIGS. 7A-C: Muscle and neuromuscular junction (NMJ) pathology for wild type, Nefl+ / E397Kand NeflE397K / E397Kmice. (7A) Twelve weeks muscle fiber area, (7B) 12 months muscle fiber area, (7C) NMJ innervation status at 12 months for full innervated, partially innervated, and fully denervated.PATENT APPLICATION Docket No. P14899WO00
[0019] FIGS. 8A-B: Electrophysiology showed an early clinically relevant phenotype. Distal latency, CMAP amplitude and negative area were measured following stimulation of the sciatic nerve and recordings from the lower right leg region (including the gastrocnemius and tibialis anterior). Wild type, Nef l+ / E397Kand Nef lE397K / E397Kmice were evaluated at three weeks, twelve weeks, six months, and twelve months. (8A) Electrophysiology recordings at three weeks, wild type (N = 17), Nef l+ / E397K(N = 23) and Nef lE397K / E397K(N = 8). Distal latency for wild type (mean = 0.5271), Nef l+ / E397K(mean = 0.7586, P = 0.0026) and Nef lE397K / E397K(mean = 0.7963, P = 0.0085) mice. CMAP amplitude for wild type (mean = 68.13), Nef l+ / E397K(mean = 57.82, P = 0.0037) and Nef lE397K / E397K(mean = 42.23, P < 0.0001) mice. Negative area for wild type (mean = 25.89), Nef l+ / E397K(mean = 22.30, P = 0.0341) and Nef lE397K / E397K(mean = 19.65, P = 0.0051) mice. Electrophysiology recordings at twelve weeks, wild type (N = 13), Nef l+ / E397K(N = 19) and + / E397KDistal latency for wild type (mean = 0.5208), Nef l (mean = 0.7532, P = 0.0008) and Nef lE397K / E397K(mean = 0.9213, P < 0.0001) mice. CMAP amplitude for wild type (mean = 84.15), Nef l+ / E397K(mean = 71.43, P = 0.0224) and Nef lE397K / E397K(mean = 59.93, P = 0.0005) mice. Negative area for wild type (mean = 31.63), Nef l+ / E397K(mean = 28.08, NS) and Nef lE397K / 397K(mean = 23.34, P = 0.0240) mice. (8B) Electrophysiology recordings at six months, wild type (N = 16), Nef l+ / E397K(N = 23) and Nef lE397K / E397K(N = 15). Distal latency for wild type (mean = 0.4338), Nef l+ / E397K(mean = 0.4983, NS) and Nef lE397K / E397K(mean = 0.5727, P = 0.0007) mice. CMAP amplitude and negative area were not statistically significant between genotypes. Electrophysiology recordings at twelve months, wild type (N = 10), Nef l+ / E397K(N = + / E397KDistal latency for wild type (mean = 0.4920), Nef l (mean = 0.6900, P = 0.0065) and Nef lE397K / E397K(mean = 0.7922, P < 0.0001) mice. CMAP amplitude and negative area were not statistically significant between genotypes. Statistical significance was determined using ordinary one-way ANOVA and Dunnett’s multiple comparisons test. Ms = milliseconds, mV = millivolts, CMAP = compound muscle action potential, NS = not significant, N = number of mice evaluated.
[0020] FIGS.9A-C: 9A: ICV delivery of the ssAAV9 dual cargo vector significantly improves electrophysiology distal latency. (9A) distal latency at P30, P45, and P120 (9B) distal latency at P150 and P180. (9C) distal latency over time. Sciatic nerve stimulated and gastrocnemius response measured.
[0021] FIG. 10: PCR detection of AAV9-shRNA / NEFL genome. Sciatic nerve tissue was isolated from injected and non-injected animals. The 369 bp fragment was specifically detected in injected extracts.PATENT APPLICATION Docket No. P14899WO00
[0022] FIGS.11A-B: ICV delivery of the ssAAV9 dual cargo vector significantly improves axon pathology. (11A) sciatic nerve axons. (11B) Axon area and diameter at 6 months.
[0023] FIG. 12: ICV delivery of the ssAAV9 dual cargo vector significantly improves rotarod assessment at 6 months. DETAILED DESCRIPTION
[0024] The present disclosure is not to be limited to that described herein. Mechanical, electrical, chemical, procedural, and / or other changes can be made without departing from the spirit and scope of the present disclosure. No features shown or described are essential to permit basic operation of the present disclosure unless otherwise indicated.
[0025] So that the present invention may be more readily understood, certain terms are first defined. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments of the invention pertain. Many methods and materials similar, modified, or equivalent to those described herein can be used in the practice of the embodiments of the present invention without undue experimentation; the preferred materials and methods are described herein. In describing and claiming the embodiments of the present invention, the following terminology will be used in accordance with the definitions set out below.
[0026] It is to be understood that all terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting in any manner or scope. For example, as used in this specification and the appended claims, the singular forms “a,” “an” and “the” can include plural referents unless the content clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicate otherwise. The word “or” means any one member of a particular list and also includes any combination of members of that list. Further, all units, prefixes, and symbols may be denoted in its SI accepted form.
[0027] Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range. Throughout this disclosure, various aspects of this invention are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges, fractions, and individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers withinPATENT APPLICATION Docket No. P14899WO00 that range, for example, 1, 2, 3, 4, 5, and 6, and decimals and fractions, for example, 1.2, 3.8, 1½, and 4¾. This applies regardless of the breadth of the range.
[0028] The term “about”, as used herein, refers to variation in the numerical quantity that can occur, for example, through typical measuring techniques and equipment, with respect to any quantifiable variable, including, but not limited to, mass, volume, time, and temperature. Further, given solid and liquid handling procedures used in the real world, there is certain inadvertent error and variation that is likely through differences in the manufacture, source, or purity of the ingredients used to make the compositions or carry out the methods and the like. The term “about” also encompasses these variations. Whether or not modified by the term “about,” the claims include equivalents to the quantities.
[0029] The term "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0030] The phrase “allelic variant” as used herein refers to a polynucleotide sequence variant that occurs in a different strain, variety, or isolate of a given organism. It would be understood that there is natural variation in the sequences of genes from different cell lines or genetic backgrounds. The allelic variants are readily recognizable by the skilled artisan on the basis of genome synteny and sequence similarity.
[0031] As used herein, the term “exemplary” refers to an example, an instance, or an illustration, and does not indicate a preferred embodiment unless otherwise stated.
[0032] The term “heterologous” as used herein with regards to a DNA molecule, nucleotides, or polynucleotides inserted into a genome refer to any DNA molecule, nucleotide, or polynucleotide that is synthetic or that has been removed from its native location and that has been inserted into a new genomic location.
[0033] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.
[0034] As used herein, the term “mutant protein” refers to a protein that is distinguished from the wild type form of the protein on the basis of the presence of amino acid modifications, such as, for example, amino acid substitutions, insertions and / or deletions. The term “mutant gene” refers to a gene that is distinguished from the wild type form of the gene on the basis of the presence ofPATENT APPLICATION Docket No. P14899WO00 nucleic acid modifications, such as, for example, nucleic acid substitutions, insertions and / or deletions. In some embodiments, the mutant gene encodes a mutant protein.
[0035] As used herein, the phrase "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression.
[0036] The term “polynucleotide” as used herein is a nucleic acid molecule comprising a plurality of polymerized nucleotides, e.g., at least about five consecutive polymerized nucleotides. A polynucleotide may be a nucleic acid, oligonucleotide, nucleotide, or any fragment thereof. In many instances, a polynucleotide comprises a nucleotide sequence encoding a polypeptide (or protein) or a domain or fragment thereof. Additionally, the polynucleotide may comprise a promoter, an intron, an enhancer region, a polyadenylation site, a translation initiation site, 5' or 3' untranslated regions, a reporter gene, a selectable marker, or the like. The polynucleotide can be single-stranded or double-stranded DNA or RNA. The polynucleotide optionally comprises modified bases or a modified backbone. The polynucleotide can be, e.g., genomic DNA or RNA, a transcript (such as an mRNA), a cDNA, a PCR product, a cloned DNA, a synthetic DNA or RNA, or the like. The polynucleotide can be combined with carbohydrate, lipids, protein, or other materials to perform a particular activity such as transformation or form a useful composition such as a peptide nucleic acid (PNA). The polynucleotide can comprise a sequence in either sense or antisense orientations. “Oligonucleotide” is substantially equivalent to the terms amplimer, amplicon, primer, oligomer, element, target, and probe and in some embodiments is single- stranded.
[0037] As used herein “promoter” includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, or seeds. Such promoters are referred to as “tissue preferred”. Promoters that initiate transcription only in certain tissue are referred to as “tissue specific”. A “cell type” specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An “inducible” or “repressible” promoter is a promoter that is under environmental control. Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions or the presence of light. Tissue specific, tissue preferred, cell type specific, and inducible promoters constitute the class of “non-constitutive” promoters. A “constitutive” promoter is a promoter that is active under most environmental conditions.PATENT APPLICATION Docket No. P14899WO00
[0038] As used herein, the term “percent sequence identity” or “% sequence identity” refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or polypeptide sequence of a reference (“query”) sequence (or its complementary strand) as compared to a test (“subject”) sequence (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide or amino acid insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison). Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the Sequence Analysis software package of the GCG®Wisconsin Package®(Accelrys Inc., San Diego, Calif.), MEGAlign (DNAStar Inc., Madison, Wis.), and MUSCLE (version 3.6) (Edgar, “MUSCLE: multiple sequence alignment with high accuracy and high throughput” Nucleic Acids Research 32(5):1792-7 (2004)) for instance with default parameters. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components that are shared by the two aligned sequences divided by the total number of components in the portion of the reference sequence segment being aligned, that is, the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more sequences may be to a full-length sequence or a portion thereof, or to a longer sequence.
[0039] As used herein, “a pharmaceutically acceptable carrier” or “pharmaceutical carrier” includes any and all excipients, solvents, growth media, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, inactivating agents, antimicrobial, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Such ingredients also include those that are safe and appropriate for use in medical or veterinary applications. Pharmaceutically acceptable carriers are typically non-toxic, inert, solid or liquid carriers.
[0040] Pharmaceutical compositions can contain a “therapeutically effective amount” of the active ingredient. As used herein, “therapeutically effective amount” refers to the amount of a compound or pharmaceutical composition administered to improve, inhibit, or ameliorate a condition of a subject, or a symptom of a disorder or disease, in a clinically relevant manner. Any improvement in the subject is considered sufficient to achieve treatment. In some embodiments, a therapeutically effective amount is an amount that prevents or reduces the occurrence or one or more symptoms of a pathology, or is an amount that reduces the severity of, or the length of timePATENT APPLICATION Docket No. P14899WO00 during which a subject suffers from, one or more symptoms of the pathology (for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more, relative to a control subject that is not treated with the compound or pharmaceutical composition). Moreover, the “therapeutically effective amount” will vary depending on the particular compound or pharmaceutical composition administered, on the severity of the condition being treated, individual patient parameters including age, physical condition, size and weight, concurrent treatment, frequency of treatment, and the mode of administration. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation.
[0041] As used herein, “recombinant,” when referring to nucleic acid or polypeptide, indicates that such material has been altered as a result of human application of a recombinant technique, such as by polynucleotide restriction and ligation, by polynucleotide overlap-extension, or by genomic insertion or transformation. A gene sequence open reading frame is recombinant if that nucleotide sequence has been removed from its natural context and cloned into any type of artificial nucleic acid vector. The term recombinant also can refer to an organism having a recombinant material.
[0042] As used herein, the term “subject” refers to the target of administration, e.g., a human. Thus the subject of the disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). In one aspect, a subject is a mammal. In another aspect, a subject is a human. The term does not denote a particular age or sex. Thus, adult, child, adolescent and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0043] A “sequence” means a sequential arrangement of nucleotides or amino acids. The boundaries of a protein-coding sequence may be determined by a translation start codon at the 5′- terminus and a translation stop codon at the 3′-terminus. In certain embodiments, a protein-coding molecule may comprise a DNA sequence encoding a protein sequence. In certain embodiments, a protein-coding molecule may comprise a RNA sequence encoding a protein sequence.
[0044] The term “vector” or “construct” refers to a nucleic acid sequence capable of transporting into a cell another nucleic acid to which the vector sequence has been linked. The term “expression vector” includes any vector, (e.g., a plasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e.g., linked to a transcriptional control element).PATENT APPLICATION Docket No. P14899WO00
[0045] The term "weight percent," "wt. %," "percent by weight," "% by weight," and variations thereof, as used herein, refer to the concentration of a substance as the weight of that substance divided by the total weight of the composition and multiplied by 100. It is understood that, as used here, "percent," "%," and the like are intended to be synonymous with "weight percent," "wt. %," etc.
[0046] The term “wild type”, as used herein, refers to the typical form of an organism, strain, gene, protein, or characteristic as it occurs in nature as distinguished from mutant or variant forms. For example, a wild type protein is the typical form of that protein as it occurs in nature without any mutations, natural or otherwise.
[0047] The methods and compositions may comprise, consist essentially of, or consist of the components and ingredients as well as other ingredients described herein. As used herein, "consisting essentially of" means that the methods and compositions may include additional steps, components or ingredients, but only if the additional steps, components or ingredients do not materially alter the basic and novel characteristics of the claimed methods and compositions. Adeno-associated Virus (AAV) Expression Vectors
[0048] The present disclosure provides for adeno-associated virus (AAV) expression vectors and compositions and methods using same. In embodiments, the AAV expression vectors comprise at least one neurofilament light chain gene (NEFL)-targeting shRNA operably linked to a first promoter and a NEFL cDNA operably linked to a second promoter. AAV expression vectors of the present disclosure function as “knockdown and replace” vectors. The shRNA reduces the mutant NEFL present in the subject and replaces the mutant NEFL with an NEFL gene that is both protected from targeting by the shRNA and that produces a wildtype N-FL protein.
[0049] The AAV expression vectors of the present disclosure are mutation agnostic vectors and can thus be designed to target and knockdown any mutation in the NF-L protein, particularly disease causing mutations. Mutations can include, but are not limited to, the N98S mutation, the E396K mutation, the P8R mutation, and the P22S / P22R mutation, all of which are associated with CMT2E in humans. However, the present disclosure is not limited to these mutations and the described AAV expression vectors can be designed to target any NEFL mutation.
[0050] In certain embodiments, AAV expression vectors of the present disclosure target the human E396K mutation, which is homologous to the E397K mutation in mice. In embodiments, the human NF-LE396Kmutation comprises a glutamic acid to lysine substitution corresponding to position 396 of SEQ ID NO: 15, or an allelic variant thereof. In embodiments, the mouse NF- LE397Kmutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.PATENT APPLICATION Docket No. P14899WO00
[0051] In embodiments, the NEFL-targeting shRNA comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-6, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto. In certain embodiments, the NEFL-targeting shRNA comprises an shRNA3 (SEQ ID NO: 1). In certain embodiments, the vector can comprise, two, three, four, five, or more NEFL- targeting shRNAs within a single vector.
[0052] In embodiments, the NEFL cDNA comprises a nucleic acid sequence having one or more mutations as compared to the wildtype human NEFL gene. In certain embodiments, the mutations decrease and / or prevent shRNA from targeting the NEFL cDNA. Mutations can comprise nucleic acid substitutions, insertions and / or deletions. In embodiments, the mutations comprise the addition of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 50, 75, or more nucleotides. The mutations can comprise, alternatively or additionally, the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 50, 75, or more nucleotides. In embodiments, the NEFL cDNA encodes a wildtype (i.e. not mutated) human NF-L protein. In embodiments, the wildtype human NF-L protein comprises the amino acid sequence of SEQ ID NO: 15, or an allelic variant thereof. Thus, in embodiments, the nucleotide mutations decrease and / or prevent shRNA targeting but still encode a wildtype protein. In certain embodiments, the NEFL cDNA comprises the nucleic acid sequence of SEQ ID NO: 8, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0053] In certain embodiments, the first promoter driving expression of the shRNA is a U6 promoter. In certain embodiments, the first promoter is comprised of the human Histone 1 (H1) promoter. In certain embodiments, the second promoter driving expression of the NF-L protein is a chicken β-actin (CBA) promoter or a human synapsin 1 (hSYN) promoter. In embodiments, the second promoter comprises the nucleic acid sequence of SEQ ID NO: 12 or 13, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0054] In certain embodiments, the expression vector is a single-stranded AAV expression vector. The AAV vector may be a vector of serotype 9 (AAV9). In embodiments, the vector comprises a 5’ AAV inverted terminal repeat (ITR) and / or a 3’ AAV ITR. In certain embodiments, the vector comprises the nucleic acid sequence of SEQ ID NO: 9, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.PATENT APPLICATION Docket No. P14899WO00 Pharmaceutical Compositions and Methods of Use
[0055] According to an embodiment, a pharmaceutical composition is provided. A pharmaceutical composition according to the present disclosure can comprise a therapeutically effective amount of an AAV expression vector and a pharmaceutically acceptable carrier.
[0056] By “pharmaceutical composition” the AAV expression vector of the present disclosure provide the therapeutically or biologically active agent for formulation into a suitable delivery means for administration to a subject. For the purposes of this disclosure, pharmaceutical compositions suitable for delivering the AAV expression vector can include, e.g., tablets, gel caps, capsules, pills, powders, granulates, suspensions, emulsions, solutions, gels, hydrogels, oral gels, pastes, eye drops, ointments, creams, plasters, drenches, delivery devices, suppositories, enemas, injectables, implants, sprays, or aerosols. Any of the aforementioned formulations can be prepared by well-known and accepted methods of art.
[0057] In an aspect, the pharmaceutical compositions comprise AAV expression vector and a pharmaceutically acceptable carrier or excipient. Examples of suitable pharmaceutically acceptable carriers or excipients that can be used in said pharmaceutical compositions include, but are not limited to, sugars (e.g., lactose, glucose or sucrose), starches (e.g., corn starch or potato starch), cellulose or its derivatives (e.g., sodium carboxymethyl cellulose, ethyl cellulose or cellulose acetate), oils (e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil or soybean oil), glycols (e.g., propylene glycol), buffering agents (e.g., magnesium hydroxide or aluminum hydroxide), agar, alginic acid, powdered tragacanth, malt, gelatin, talc, cocoa butter, pyrogen-free water, isotonic saline, Ringer's solution, ethanol, phosphate buffer solutions, lubricants, coloring agents, releasing agents, coating agents, sweetening, flavoring or perfuming agents, preservatives, or antioxidants.
[0058] The term “excipient” refers to additives and stabilizers typically employed in the art (all of which are termed “excipients”), including for example, buffering agents, stabilizing agents, preservatives, isotonifiers, non-ionic detergents, antioxidants and / or other miscellaneous additives. Stabilizers refer to a broad category of excipients which can range in function from a bulking agent to an additive which solubilizes the AAV expression vector or helps to prevent denaturation of the same. Additional conventional excipients include, for example, fillers (e.g., starch), chelating agents (e.g., EDTA), antioxidants (e.g., ascorbic acid, methionine, vitamin E) and cosolvents.
[0059] The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical carriers are illustratively sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin,PATENT APPLICATION Docket No. P14899WO00 such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water may be a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are optionally employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain wetting or emulsifying agents, or pH buffering agents. These compositions optionally take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations and the like. The composition may be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include, for example, standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
[0060] Pharmaceutical compositions according to the disclosure may be formulated to release the composition immediately upon administration (e.g., targeted delivery) or at any predetermined time period after administration using controlled or extended release formulations. Administration of the pharmaceutical composition in controlled or extended release formulations is useful where the composition, either alone or in combination, has (i) a narrow therapeutic index (e.g., the difference between the plasma concentration leading to harmful side effects or toxic reactions and the plasma concentration leading to a therapeutic effect is small; generally, the therapeutic index, TI, is defined as the ratio of median lethal dose (LD50) to median effective dose (ED50)); (ii) a narrow absorption window in the gastro-intestinal tract; or (iii) a short biological half-life, so that frequent dosing during a day is required in order to sustain a therapeutic level. One skilled in the art will ascertain compositions for controlled or extended release of the pharmaceutical composition. In an aspect, controlled release can be obtained by controlled release compositions and coatings which are known to those of skill in the art.
[0061] Methods of treating Charcot-Marie-Tooth disease type 2E (CMT2E) are provided. The method can comprise administering to a subject a therapeutically effective amount of the AAV expression vector or a pharmaceutical composition comprising the AAV expression vector.
[0062] Pharmaceutical compositions comprising an AAV expression vector of the present disclosure can be formulated to be suitable for oral, intravenous, muscular, and subcutaneous administration, for example as discrete dosage forms, such as, but not limited to, tablets (including without limitation scored or coated tablets), pills, caplets, capsules, chewable tablets, powder packets, cachets, troches, wafers, aerosol sprays, or liquids, such as but not limited to, syrups,PATENT APPLICATION Docket No. P14899WO00 elixirs, solutions or suspensions in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion, or a water-in-oil emulsion. Such compositions contain a predetermined amount of the disclosed compounds, and may be prepared by methods of pharmacy well known to those skilled in the art. See generally, Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams, and Wilkins, Philadelphia, Pa. (2005).
[0063] The compositions of the present disclosure may be administered by any suitable route, in the form of a pharmaceutical composition adapted to such a route, and in a dose effective for the treatment intended. The compositions may, for example, be administered orally, parenterally, e.g., intravascularly, intraperitoneally, intrathecally, subcutaneously, or intramuscularly. For parenteral administration, saline solution, dextrose solution, or water may be used as a suitable carrier. In an embodiment of the invention, the therapeutic composition containing the recombinant microbial cells may be administered intrarectally. A rectal administration preferably takes place in the form of a suppository, enema, or foam.
[0064] In embodiments, the compositions comprise a pharmaceutically acceptable carrier or adjuvant, such as standard buffers, stabilizers, diluents, preservatives, and / or solubilizers, and can also be formulated to facilitate sustained release. Diluents include water, saline, dextrose, ethanol, glycerol, and the like. Additives for isotonicity include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others.
[0065] The compositions and methods described herein can be administered to a subject in need of treatment. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein in order to alleviate a symptom, including diminishing the severity of, delaying the onset or progression of, and / or eliminating at least one symptom of CMT2E. Symptoms of CMT2E can include, but are not limited to, muscle weakness, muscle atrophy, sensory defects, gait abnormalities, and / or decreased reflexes. As compared with an equivalent untreated control, such reduction in symptom(s) can be by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique.
[0066] In certain embodiments, an effective dose of an AAV expression vector or pharmaceutical composition comprising an AAV expression vector as described herein can be administered to a patient once. In certain embodiments, an effective dose of a composition comprising an AAV expression vector can be administered to a subject repeatedly. A composition comprising an AAV expression vector can be administered over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, 25 minute, 30 minute, 40 minute, 50 minute, 1 hour, 2 hour, or more, period. The administration can be repeated, for example, on a regular basis, such as hourly for 3 hours, 6 hours, 12 hours, daily (i.e. one a day), every other day (i.e. on alternate days), or longer or such asPATENT APPLICATION Docket No. P14899WO00 once a week, or biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer.
[0067] In certain embodiments, the AAV expression vector or pharmaceutical composition is administered to the subject at the time of birth or shortly after birth, such as within the first day of birth (i.e., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours of birth). In certain embodiments, the AAV expression vector or pharmaceutical composition is administered to the subject within 5, within 10, within 15, within 20, within 25, within 30, within 35, within 40, within 50, within 60, within 70, within 80, within 90, or more days of birth, or any range or integer therein.
[0068] The dosage of a composition as described herein can be determined by a physician or one having ordinary skill in the art and adjusted, as necessary, to suit observed effects of the treatment. With respect to duration and frequency of treatment, it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment, or make other alterations to the treatment regimen. The dosing schedule can vary from once a week to daily, or more or less frequently, depending on a number of clinical factors, such as the subject's sensitivity to the AAV expression vector.
[0069] The desired dose or amount of activation can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the day or other appropriate schedule. In some embodiments, administration can be chronic, e.g., one or more doses and / or treatments daily over a period of weeks or months. Examples of dosing and / or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more.
[0070] The dosage ranges for the administration of AAV expression vectors, according to the methods described herein depend upon, for example, the form of the compound and its potency, and the extent to which symptoms, markers, or indicators of a condition described herein are desired to be reduced, for example the percentage reduction desired. The dosage should not be so large as to cause adverse side effects. Generally, the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art. The dosage can also be adjusted by the individual physician in the event of any complication.
[0071] A composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. ThePATENT APPLICATION Docket No. P14899WO00 amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
[0072] The efficacy of the AAV expression vector in, e.g. the treatment of a condition described herein can be determined by the skilled clinician. However, a treatment is considered “effective treatment,” as the term is used herein, if any one or all of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and / or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy can be assessed in animal models of a condition described herein. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed.
[0073] The methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g. as part of a combinatorial therapy. In certain embodiments of the present invention, the AAV expression vector can be used in combination therapy with at least one other therapeutic agent. CMT2E Mouse Models
[0074] Genetically modified mouse models capable of replicating the CMT2E phenotype are also provided. In embodiments, the mouse model comprises a mutation to the endogenous neurofilament light (N-FL) protein. In certain embodiments, this mutation replicates the human E396K mutation, which is homologous to the E397K mutation in mice. In some embodiments,PATENT APPLICATION Docket No. P14899WO00 this mutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.
[0075] The mutation can be introduced by genome editing. In embodiments, said genome editing comprises introducing a Cas9 nuclease and a guide RNA targeting the NEFL gene.
[0076] Genome editing methods can produce site-specific mutants in a genome. Genome editing uses engineered nucleases such as RNA guided DNA endonucleases or nucleases composed of sequence specific DNA binding domains fused to a non-specific DNA cleavage module. These engineered nucleases enable efficient and precise genetic modifications by inducing targeted DNA double stranded breaks that stimulate the cell's endogenous cellular DNA repair mechanisms to repair the induced break. Such mechanisms include, for example, error prone non-homologous end joining (NHEJ) and homology directed repair (HDR).
[0077] In the presence of donor plasmid with extended homology arms, HDR can lead to the introduction of single or multiple transgenes to correct or replace existing genes. In the absence of donor plasmid, NHEJ-mediated repair yields small insertion or deletion mutations of the target that cause gene disruption. Engineered nucleases useful in the methods of the present disclosure include zinc finger nucleases (ZFNs), transcription activator-like (TAL) effector nucleases (TALEN) and CRISPR / Cas9 type nucleases.
[0078] A zinc finger nuclease (ZFN) comprises a DNA-binding domain and a DNA-cleavage domain, wherein the DNA binding domain is comprised of at least one zinc finger and is operatively linked to a DNA-cleavage domain. The zinc finger DNA-binding domain is at the N- terminus of the protein and the DNA-cleavage domain is located at the C-terminus of said protein.
[0079] A ZFN must have at least one zinc finger. In embodiments, a ZFN would have at least three zinc fingers in order to have sufficient specificity to be useful for targeted genetic recombination in a host cell or organism. Typically, a ZFN having more than three zinc fingers would have progressively greater specificity with each additional zinc finger.
[0080] The zinc finger domain can be derived from any class or type of zinc finger. In a particular embodiment, the zinc finger domain comprises the Cis2His2 type of zinc finger that is very generally represented, for example, by the zinc finger transcription factors TFIIIA or Sp1. In embodiments, the zinc finger domain comprises three Cis2His2 type zinc fingers. The DNA recognition and / or the binding specificity of a ZFN can be altered in order to accomplish targeted genetic recombination at any chosen site in cellular DNA. Such modification can be accomplished using known molecular biology and / or chemical synthesis techniques (see, for example, Bibikova et al., 2002).PATENT APPLICATION Docket No. P14899WO00
[0081] The ZFN DNA-cleavage domain is derived from a class of non-specific DNA cleavage domains, for example the DNA-cleavage domain of a Type II restriction enzyme such as Fold (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI.
[0082] A transcription activator-like (TAL) effector nuclease (TALEN) comprises a TAL effector DNA binding domain and an endonuclease domain. TAL effectors are proteins that are injected into the cell, where they travel to the nucleus and function as transcription factors to turn on specific genes. The primary amino acid sequence of a TAL effector dictates the nucleotide sequence to which it binds. Thus, target sites can be predicted for TAL effectors, and TAL effectors can be engineered and generated for the purpose of binding to particular nucleotide sequences.
[0083] Fused to the TAL effector-encoding nucleic acid sequences are sequences encoding a nuclease or a portion of a nuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as FokI (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AhvI. The fact that some endonucleases (e.g., FokI) only function as dimers can be capitalized upon to enhance the target specificity of the TAL effector. For example, in some cases each FokI monomer can be fused to a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are in close proximity do the inactive monomers come together to create a functional enzyme. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created.
[0084] A sequence-specific TALEN can recognize a particular sequence within a preselected target nucleotide sequence present in a cell. Thus, in some embodiments, a target nucleotide sequence can be scanned for nuclease recognition sites, and a particular nuclease can be selected based on the target sequence. In other cases, a TALEN can be engineered to target a particular cellular sequence.
[0085] Distinct from the site-specific nucleases described above, the clustered regulatory interspaced short palindromic repeats (CRISPR) / Cas system provides an alternative to ZFNs and TALENs for inducing targeted genetic alterations, via RNA-guided DNA cleavage.
[0086] CRISPR systems rely on CRISPR RNA (crRNA) and transactivating chimeric RNA (tracrRNA) for sequence-specific cleavage of DNA. Three types of CRISPR / Cas systems exist: in type II systems, Cas9 serves as an RNA-guided DNA endonuclease that cleaves DNA upon crRNA-tracrRNA target recognition. CRISPR RNA base pairs with tracrRNA to form a two-RNA structure that guides the Cas9 endonuclease to complementary DNA sites for cleavage.PATENT APPLICATION Docket No. P14899WO00
[0087] The CRISPR system can be portable to animal cells by co-delivery of plasmids expressing the Cas endonuclease and the necessary crRNA components. The Cas endonuclease may be converted into a nickase to provide additional control over the mechanism of DNA repair (Cong et al., 2013).
[0088] CRISPRs are typically short partially palindromic sequences of 24-40 bp containing inner and terminal inverted repeats of up to 11 bp. Although isolated elements have been detected, they are generally arranged in clusters (up to about 20 or more per genome) of repeated units spaced by unique intervening 20-58 bp sequences. CRISPRs are generally homogenous within a given genome with most of them being identical. However, there are examples of heterogeneity in, for example, the Archaea (Mojica et al., 2000). Numbered Embodiments
[0089] The following numbered embodiments also form part of the present disclosure:
[0090] 1. An adeno-associated virus (AAV) expression vector, comprising: at least one neurofilament light chain gene (NEFL)-targeting shRNA operably linked to a first promoter; and a NEFL cDNA operably linked to a second promoter.
[0091] 2. The AAV expression vector of embodiment 1, wherein the NEFL cDNA comprises a nucleic acid sequence having one or more mutations as compared to the wildtype human NEFL gene.
[0092] 3. The AAV expression vector of embodiment 1 or 2, wherein the NEFL cDNA encodes a wildtype human NF-L protein.
[0093] 4. The AAV expression vector of embodiment 3, wherein the wildtype human NF-L protein comprises the amino acid sequence of SEQ ID NO: 15 or an allelic variant thereof.
[0094] 5. The AAV expression vector of any one of embodiments 1-4, wherein the one or more mutations decrease and / or prevent shRNA targeting of the NEFL cDNA.
[0095] 6. The AAV expression vector of any one of embodiments 1-5, wherein the first promoter is a U6 promoter or a Histone 1 (H1) promoter.
[0096] 7. The AAV expression vector of any one of embodiments 1-6, wherein the second promoter is a chicken β-actin (CBA) promoter or a human synapsin 1 (hSYN) promoter.
[0097] 8. The AAV expression vector of any one of embodiments 1-7, further comprising a 5’ AAV inverted terminal repeat (ITR) and a 3’ AAV ITR.
[0098] 9. The AAV expression vector of any one of embodiments 1-8, wherein the expression vector comprises two or more, three or more, or four or more NEFL-targeting shRNAs.PATENT APPLICATION Docket No. P14899WO00
[0099] 10. The AAV expression vector of any one of embodiments 1-9, wherein the NEFL- targeting shRNA comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-6, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0100] 11. The AAV expression vector of any one of embodiments 1-10, wherein the NEFL cDNA comprises the nucleic acid sequence of SEQ ID NO: 8, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0101] 12. The AAV expression vector of any one of embodiments 1-11, wherein the second promoter comprises the nucleic acid sequence of SEQ ID NO: 12 or 13, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0102] 13. The AAV expression vector of any one of embodiments 1-12, wherein the vector is a single-stranded AAV expression vector.
[0103] 14. The AAV expression vector of any one of embodiments 1-13, wherein the vector is an AAV vector of serotype 9 (AAV9).
[0104] 15. The AAV expression vector of any one of embodiments 1-14, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 9, or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
[0105] 16. The AAV expression vector of any one of embodiments 1-15, wherein the vector targets a human NF-LE396Kmutation or a mouse NF-LE397Kmutation.
[0106] 17. The AAV expression vector of embodiment 16, wherein the human NF-LE396Kmutation comprises a glutamic acid to lysine substitution corresponding to position 396 of SEQ ID NO: 15, or an allelic variant thereof.
[0107] 18. The AAV expression vector of embodiment 16, wherein the mouse NF-LE397Kmutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.
[0108] 19. A cell comprising the AAV expression vector of any one of embodiments 1-18.
[0109] 20. A pharmaceutical composition comprising a therapeutically effective amount of the AAV expression vector of any one of embodiments 1-18 and a pharmaceutically acceptable carrier.
[0110] 21. A method of treating Charcot-Marie-Tooth disease type 2E (CMT2E) in a subject, comprising: administering to the subject a therapeutically effective amount of the AAVPATENT APPLICATION Docket No. P14899WO00 expression vector of any one of embodiments 1-18 or a pharmaceutical composition comprising the AAV expression vector.
[0111] 22. The method of embodiment 21, wherein the subject is human.
[0112] 23. The method of embodiment 21 or 22, wherein the subject has one or more mutations in the NF-L protein as compared to a wildtype NF-L protein.
[0113] 24. The method of embodiment 23, wherein the mutation comprises an NF-LE367Kmutation.
[0114] 25. The method of any one of embodiments 21-24, wherein the method diminishes the severity of, delays the onset or progression of, and / or eliminates at least one symptom of CMT2E in the subject.
[0115] 26. The method of embodiment 25, wherein the symptom of CMT2E comprises muscle weakness, muscle atrophy, sensory defects, gait abnormalities, and / or decreased reflexes.
[0116] 27. The method of any one of embodiments 21-26, wherein the expression vector or pharmaceutical composition is administered to the subject within the first day of birth.
[0117] 28. The method of any one of embodiments 21-27, wherein the expression vector or pharmaceutical composition is administered to the subject within 20, within 30, within 60, or within 90 days of birth
[0118] 29. A genetically modified mouse model comprising a mutation to the endogenous neurofilament light (N-FL) protein, wherein said mutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.
[0119] 30. The mouse model of embodiment 29, wherein the mutation is introduced by genome editing.
[0120] 31. The mouse model of embodiment 30, wherein the genome editing comprises introducing a Cas9 nuclease and a guide RNA targeting the NEFL gene. EXAMPLES Example 1. Overview
[0121] The present disclosure provides insight into CMT2E disease pathology and demonstrates development into a mutation-agnostic gene therapy-based approach for CMT2E to address essentially all NEFL-encoding missense mutations. The objectives for this CMT2E precision medicine-based project were threefold: 1) to characterize a novel mouse model of CMT2E generated in the lab for the primary purpose of examining therapeutic efficacy. The model expresses a patient-derived mutation within the endogenous murine Nefl gene: mouse NeflE397K, which is homologous to the highly prevalent human NEFLE396Kmutation. The E396K mutation isPATENT APPLICATION Docket No. P14899WO00 the most common NEFL mutation, represents as a NEFL dominant mutation, and in CMT2E patients presents with early onset and clinical symptoms; 2) to develop a “mutation agnostic” gene therapy-based vector approach to address the breadth of the CMT2E-NEFL mutation spectrum and 3) to demonstrate that this dual cargo vector-based gene therapy approach is efficacious. For these studies, it is important to examine efficacy in the context of the least invasive mode of delivery that results in wide neuronal distribution while using a clinically relevant dosage. Importantly, the genomic context of the NeflE397Kmouse model allows detection of changes in endogenous mouse Nefl expression from the native Nefl promoter and expression of human NEFL as a measure of therapeutic efficacy.
[0122] The new NeflE397Kmouse model was developed in the lab and multiple generations of Nefl+ / E397Kand NeflE397K / E397Kanimals produced the preliminary data. The E397K model is significant for a variety of reasons, including that it recapitulates clinically relevant CMT2E symptoms and it can be used to quantitate electrophysiological deficits (CMAP) early (P21) in the lifespan of E397K mice. Electrophysiology serves as a clinically translatable biomarker that can be quantitatively measured over time in a relatively non-invasive manner for critical assessments of therapeutic efficacy in a longitudinal manner. Electrophysiology measurements are routinely used in the clinic to access CMT disease; therefore, the Examples herein apply an important bench-to-bedside transition measurement of disease and therapeutic efficacy. Motor function assessments in Nefl E397K mice have identified several deficits that develop later and become progressively more severe. Data from these assessments support the electrophysiology studies and become more significant as disease progresses. As detailed below, extensive preliminary data are provided detailing the CMT2E phenotype (gait abnormalities, motor function / coordination deficits, etc) and efficacy of the gene therapy vector.
[0123] In the following Examples, extensive preliminary data are provided. A panel of shRNAs in cell culture was screened and several were identified that efficiently reduce both mouse Nefl and human NEFL expression. Additionally, the first AAV9 vector was designed and produced. The initial proof-of-concept study demonstrates that the vector efficiently enters the peripheral nervous system (sciatic nerve) and decreases disease severity based upon significant improvements in electrophysiological measurements in a longitudinal study of vector-treated and untreated CMT2E mice. Additionally, the new CMT2E model mice, Nefl+ / E397Kand NeflE397K / E397K, were produced and a large colony was generated and characterized. The initial studies with these animals identified a robust phenotype consistent with CMT2E symptoms, including early electrophysiology deficits, gait abnormalities, coordination deficits, hindlimb strength, and neuropathology.PATENT APPLICATION Docket No. P14899WO00 Example 2. Identification of Nefl / NEFL-targeting shRNAs
[0124] The objectives were to leverage the E397K mouse model to provide mechanistic insight into CMT2E pathology and to validate the vector-based approach to “knock-down and replace” NF-L within the context of most disease-causing mutations, including NF-LE397K(homologous to NF-LE396Kin humans). In essence, this would be a “mutation-agnostic” strategy. Six shRNAs that target endogenous mouse Nefl expression were screened, significantly reducing expression of any pathogenic alleles. Importantly, these shRNA sequences are conserved with human NEFL, and reduce human NEFL RNA and NF-L protein in HEK293T cells. These candidates demonstrate varied reduction in NEFL RNA and NF-L protein. The lead candidates, shRNAs #3, #5, and #6 resulted in efficient knockdown of human NEFL RNA (FIG.1A). While the shRNA mechanism of action is to reduce the abundance of the cognate RNAs, mRNA levels do not necessarily correlate with protein levels, as a variety of compensatory mechanisms can be activated that allow for protein levels to remain unchanged, or even increased, despite significant reductions in mRNA. Similar to the RT-PCR analyses, several, but not all, shRNAs significantly reduced NF-L expression. shRNAs #3, #5, and #6 significantly reduced protein expression (FIG. 1B), further providing evidence that each of these shRNAs can reduce NEFL mRNA and NF-L protein. These initial observations were done in the context of the shRNA alone.
[0125] The reduction of mRNA and protein was a critical first step as the ultimate goal is to have a clinically relevant shRNA. shRNA#3 was selected as the initial lead candidate; however, the other shRNAs (#5, #6) could also easily move forward. While the primary focus was the development of a vector that expresses a single shRNA (+ the human NEFL cDNA), the vector was developed such that it can easily include expression cassettes for multiple shRNAs (e.g., SEQ ID NOs: 1-6). It is important to stress that the human NEFL gene that is co-expressed from the AAV9 recombinant vector (SEQ ID NO: 8) is resistant to these shRNAs as the primary nucleotide sequence of the cDNA was modified without changing the overlapping amino acid sequence.
[0126] In separate experiments using N2a (mouse) tissue culture cells, transient expression of the shRNA#3 expressing vector resulted in efficient reduction of mouse Nefl (FIG.2A). Collectively, these experiments identified a lead shRNA candidate that can be validated in CMT2E pre-clinical models while maintaining clinically relevance as this shRNA efficiently reduces mouse Nefl and human NEFL. Additionally, there are multiple shRNA sequences that are 100% matches to human NEFL that efficiently knock-down NF-L expression at the mRNA level and protein level. Based upon these results, a recombinant single stranded (ss) AAV viral vector was designed to express the shRNA of interest using the U6 promoter and the expression of the human NEFL cDNA that is resistant to shRNAs #3, #5, #6 using the CBA promoter (FIG.2B). The CBA is a ubiquitouslyPATENT APPLICATION Docket No. P14899WO00 expressing promoter and provides immediate robust expression. This was the initial promoter selected; however, an aim is to address tissue-restricted promoters to minimalize potential off- target effects. The modified CBA promoter promotes robust expression of the cDNA of interest for multiple gene therapy applications including SMA, and SMARD1. For CMT2E viral gene therapy delivery, viral particles were packaged using AAV9 serotype. AAV9 was chosen as it provides broad-based tissue distribution and strong neuronal uptake.
[0127] shRNA activity was examined in the context of the CMT2E gene therapy vector. The shRNA will be co-expressed within the same vector that expresses the human NEFL cDNA encoding for wild type human NF-L protein. The critical distinction is that the vector-derived human NEFL cDNA has been modified within the DNA sequence (SEQ ID NO: 8) such that the amino acid coding sequence and subsequent protein is 100% wild type, but resistant to shRNA repression due to significant non-coding mismatches placed within the human NEFL cDNA. Importantly, the focus was upon developing a therapeutic for humans, not mice; therefore, the research design was to identify shRNAs that efficiently reduced human NF-L, but also reduced mouse Nefl as a means of validating the therapeutic approach. shRNA#3 was successfully identified, as this shRNA reduces NEFL expression in human and mouse cells (FIGS.1,2). Example 3. Novel CMT2E mouse model: E397K
[0128] A handful of CMT2E mouse models exist, including the knock-in Nefl N98S and P8R models where the mouse Nefl gene was mutated to mimic a CMT2E patient allele and an inducible transgenic model expressing NF-L P22S. A transgenic overexpressing E397K model was created where the cDNA encoding the mutant human transgene for NEFL-E397K was randomly integrated into the mouse genome while maintaining full expression from the endogenous (wild type) Nefl alleles. These models recapitulate important aspects of the CMT2E phenotype, including hindlimb clasping, tremors, protein aggregates, cerebellar abnormalities, and a variety of neuronal histopathology.
[0129] Within the context of gene therapy, important considerations include the ability of the model to recapitulate clinical symptoms, the relative onset of the disease phenotypes and the variability and severity of the disease symptoms. For this project, the NEFL E397K mutation was selected as it represents a NEFL dominant mutation that in patients presents with early onset and clinical symptoms consistent with most CMT2E patients. A “humanized” transgenic E397K mouse model previously existed; however, not all transgenic E397K mutant mice demonstrated complete CMT2E-like phenotypes and most mutant mice demonstrated very mild phenotypes that developed only after 6 months. The late disease onset and the variability of disease symptoms and severity suggested this model would be difficult to effectively analyze therapeutic efficacy. As aPATENT APPLICATION Docket No. P14899WO00 result, a new E397K mouse model was generated within the context of the endogenous mouse Nefl gene. The new model contains the E397K mutation within the context of the endogenous mouse Nefl gene on a pure C57 / Bl6 background: Nefl+ / E397Kand neflE397K / E397K. An important aspect of the novel model is that a quantifiable phenotype can be observed at an early age (the neurological phenotype is quantifiable within 2-3 weeks of age) prior to other overt signs of disease.
[0130] While CMT2E is primarily a result of dominant mutations within NEFL, a goal was to determine whether there were any differences in disease onset and severity between Nefl+ / E397Kand NeflE397K / E397Kmice. Homozygous recessive mutations in NEFL, while rare, have been reported to cause CMT2E due to consanguineous parents. These homozygous patients presented a severe, progressive neuropathy with early childhood onset. As a result, these initial evaluations of the disease phenotypes include Nefl+ / E397Kand NeflE397K / E397Kmice. In the initial characterization of the new Nefl E397K mouse model, several motor function and coordination assessments routinely used in the lab were used to evaluate the Spinal muscular atrophy (SMA), Spinal muscular atrophy with respiratory distress (SMARD1), CMT2S and CMT1A mouse models. These assessments included dowel traverse, grip strength (FIGS. 3-5), time-to-right, hindlimb splay, rotarod, catwalk / digitized gate analysis, lifespan and weight (data not shown). For motor skills assessment, E397K mutant mice were relatively normal early; hindlimb splay, rotarod, catwalk and time-to-right were not statistically different than wild type (data not shown). Grip strength assessments revealed significant differences at ~P50 and throughout the 360-day testing period (FIG.5). The results from these assays are consistent with the clinical symptoms associated with CMT2E patients. The dowel rod assay was used to assess disease progression from P21 onward. In this assay, a circular wooden dowel (22 mm in diameter) is used as a balance beam to assess motor function and coordination (FIGS.3,4). Mice are placed on one end of the dowel and allowed to traverse 26 inches across the dowel to the other end. The entire process is video recorded for subsequent analyses. The time to transverse, number of foot slips, walking pauses, tail “grabs” and tail positioning are recorded. Wild type mice easily traversed the dowel with their feet positioned on top of the dowel and their tail held upward while walking with rare foot slips, tail grabs or gait deficiencies. The Nefl-E397K mice tended to place feet around the rod, use their tails for balance, had an increased number of foot slips and tail grabs, and gait deficits (FIG.4). The reduced tail score, increased tail grabs and increased foot slips likely compensate for balance / coordination deficits that increased over time (FIG. 4). Gait (steps / second) was also disrupted in the Nefl-E397K mice. Interestingly, the time it takes to traverse the dowel was not statistically different but trended towards E397K mutant mice being faster (data not shown). InPATENT APPLICATION Docket No. P14899WO00 analysis of the videos, wild type animals appear very comfortable on the beam, while “comfortable” is admittedly challenging to quantitate, it was clear that their balance is excellent and they have no difficulties stopping, pausing, speeding up or slowing down. Conversely, the CMT2E E397K mice are more “anxious” and attempt to quickly scamper across, typically slipping and tail grabbing yet still moving forward. This data was unexpected, but the “slips” and “tail grabs” track well with the electrophysiology data (FIG.8).
[0131] In contrast to the motor skills assessments, electrophysiology measurements, which measure motor unit function, revealed early and significant deficits by 21 days (FIG. 8). A Cadwell electrophysiology system was used that has a dedicated room immediately adjacent to the primary lab. NeflE397K / E397Kand Nefl+ / E397Kanimals were assessed by electrophysiology at 3 and 6 weeks and 6 and 12 months with tissue harvested at each time point. A 1-year longitudinal electrophysiology study was performed to further validate these studies. Multiple parameters were assessed, and three measurements are shown here: Distal latency measures the time it takes for the nerve impulse to travel to the muscle (sciatic nerve to gastrocnemius in this instance). The P- P CMAP measures how well the axon is activating muscle and negative area roughly measures how many muscle fibers are responding to the stimulation. Importantly, at 3 weeks the Nefl- E397K mutants already demonstrated significant differences in all three parameters. Significant prolonged distal latency was present from 21-360 days for the Nefl-E397K mutants suggesting axonal defects (FIG.8). P-P CMAP and negative area improved from 6M-12M, and our axonal and muscle pathology suggests compensatory mechanisms might result in improved CMAP and negative area measurements (FIG.8).
[0132] CMT2E is an axonal neuropathy, and our electrophysiology findings showed that there were measurable differences in the Nefl-E397K mutants, suggesting alterations in the axon. To determine if these functional defects correlated with axon pathology, we examined the histopathology of the sciatic nerve at P21, P84, P180, and P360 (FIG.6A). Cross-sectional images of the sciatic nerve showed significant changesand NeflE397K / E397Kmice axon area and perimeter at all time points analyzed. The differences in G-ratio were largely attributed to changes in axon area as there were no significant differences in myelination. In Nefl mutants, a reduced number of axons per field was observed from twelve weeks to six months (FIG.6A). In Nefl mutants, some regeneration occurred from 6-12 months as there is a substantial increase in the number of axons / field from 6-12 months in Nefl+ / E397Kand NeflE397K / E397Kmice and those axons were significantly smaller. Importantly, the chronic axonal neuropathy observed in Nefl+ / E397Kand NeflE397K / E397Kmice was consistent with the reduced distal latency measured by electrophysiology. For all phenotypic parameters, results were also examined by sex to determine if there were anyPATENT APPLICATION Docket No. P14899WO00 sex-based differences. None of the parameters examined were influenced by the sex of the animal (data not shown).
[0133] To evaluate muscle pathology in Nefl-E397K mice, forelimb muscles (biceps brachii and triceps brachii) and hindlimb muscles (tibialis anterior and gastrocnemius) were analyzed at 3 and 12 weeks and 6 and 12 months (FIG.7A-C). Alterations in muscle fiber area and minimal Feret diameter were observed at 3 weeks with variability observed between muscle groups. The biceps brachii and the gastrocnemius muscles had the most significant alterations in all time points analyzed. The improved electrophysiology P-P CMAP and negative area at 12 months could be attributed to the muscle hypertrophy (gastrocnemius) and increased number of axons (sciatic) acting in a compensatory manner. When neuromuscular junction (NMJ) innervation status was examined, there was a significant increase in partially innervated NMJs at 12 weeks in NeflE397K / E397Kmice with both Nefl mutants demonstrating increased partially innervated and fully denervated endplates at 12 months (FIG.7A-C).
[0134] Importantly, quantifiable motor function changes and axon and muscle pathology are demonstrated within the new CMT2E models, particularly at later time points. Collectively, these results establish a shRNA that reduces human and mouse NEFL expression; and validate a novel patient-based CMT2E model of disease that possess important disease characteristics, including electrophysiology deficits by 3 weeks of age (consistent with axon and muscle pathology), along with a series of slower developing parameters. Example 4: 360 Day Study of E397K Mouse Model and Extended Data
[0135] One of the hallmarks of CMT2E disease is the presence of distinct electrophysiological abnormalities, which can also be assessed in mice. While there is variability within the patient population, CMT2E patients have relatively preserved MNCV values with reduced amplitudes of sensory and CMAP responses. However, a subset of CMT2E patients have reduced MNCV that is attributed to a decrease in axon caliber and not myelination.
[0136] An initial electrophysiology study was conducted on four cohorts of animals at three weeks, twelve weeks, six months and twelve months of age. At each time point, animals were sacrificed and tissues were collected. Electrophysiological measurements were recorded from the right rear leg (including the gastrocnemius and tibialis anterior) and included distal latency, CMAP amplitude (measured peak-to-peak), and negative peak area. At three weeks, distal latency was significantly prolonged in Nefl+ / E397K(0.7586 ms, P = 0.0026) and NeflE397K / E397K(0.7963 ms, P = 0.0085) mice when compared to wild type (0.5271 ms) (FIG.8, top row). CMAP amplitude and negative area were also significantly different in the Nefl mutants when compared to the wild type cohort (FIG.8, top row). At twelve weeks, the distal latency of Nefl+ / E397K(0.7532 ms, P =PATENT APPLICATION Docket No. P14899WO00 0.0008) and NeflE397K / E397K(0.9213 ms, P < 0.0001) mice was prolonged compared to wild type mice (0.5208 ms) with significant worsening in NeflE397K / E397Kmice (FIG.8, second row). CMAP amplitude also remained significantly different between the Nefl mutants and the wild type cohort at twelve weeks (FIG.8, second row).
[0137] Interestingly, at twelve weeks there was improvement in the negative area of Nefl+ / E397Kmice but NeflE397K / E397Kmice remained significantly reduced from wild type mice (FIG.8, second row). At six and twelve months, there remained significant differences between wild type and Nefl mutants in distal latency; however, CMAP amplitude and negative area values were similar between all cohorts (FIG. 8, third and bottom rows). These results show that Nefl+ / E397Kand NeflE397K / E397Kmice have significant defects in distal latency starting at P21 and continuing throughout the study (P360). The initial electrophysiology study showed prolonged distal latency from three weeks to twelve months in the Nefl mutants; however, CMAP amplitude and negative area differences improved from P21 to P360. To determine whether these changes reflected disease progression, a twelve-month longitudinal study was performed on a cohort of wild type, Nefl+ / E397Kand NeflE397K / E397Kmice. The longitudinal assessments showed that the NeflE397K / E397Kpresented with prolonged distal latency as early as P21, while Nefl+ / E397Kdistal latency became statistically different from wild type mice at P90. The mean distal latency between wild type (0.4630 ms) and Nefl+ / E397Kmice (0.6545 ms) was statistically different (P = 0.0002), as well as between NeflE397K / E397Kmice (0.8745 ms, P < 0.0001). There was also a statistical significance in distal latency between Nefl+ / E397Kand NeflE397K / E397Kmice (P = 0.0010). NeflE397K / E397Kdistal latency was statistically different from wild type mice throughout the study (P21-P360) suggesting, like some CMT2E patients, there is a reduction in axon caliber. Interestingly, P21- P60 NeflE397K / E397KCMAP amplitude values were statistically different from wild type mice; however, for the remainder of the study differences varied. There was a statistical difference between the mean CMAP amplitude values for wild type (81.12 mV) and Nefl+ / E397Kmice (76.41 mV, P = 0.0319) and NeflE397K / E397Kmice (66.39 mV, P = 0.0001). As well, there were CMAP amplitude differences between Nefl+ / E397Kand NeflE397K / E397Kmice (P = 0.0012). The same trends were observed for negative area measurements in NeflE397K / E397Kmice. There was no statistical difference between the mean negative area values for wild type (26.55) and Nefl+ / E397Kmice (26.51) and NeflE397K / E397Kmice (23.93). Importantly, results of the longitudinal study were consistent with the mixed cohort electrophysiology study; distal latency was severely impacted early in NeflE397K / E397Kmice with differences occurring later in Nefl+ / E397Kmice. In NeflE397K / E397Kand Nefl+ / E397Kmice, CMAP amplitude and negative area differences were apparent early;PATENT APPLICATION Docket No. P14899WO00 however, measurable differences were not observed later in the disease. The subtle differences between the two studies were likely attributed to disease variation between the cohorts.
[0138] To determine whether there was variability between individual mice in the longitudinal study, consistent with the CMT2E patient population, we analyzed the longitudinal electrophysiology data from P21 to P360 per mouse. When measurements were followed for each mouse, there was little variability between P21 wild type mice in distal latency (0.560 ms ±0.14); however, there was measurable variability between Nefl+ / E397K(0.870 ms ±0.495) and NeflE397K / E397Kmice (0.844 ms ±0.306). The variability between Nefl mutant mice diminished by P180 (wild type 0.444 ms ±0.044; + / E397K 0.740 ms ±0.119; E397K / E397K mice 0.731 ms ±0.173); however, distal latency variability was increased in the Nefl mutants compared to wild type mice at all timepoints measured. However, CMAP amplitude values for NeflE397K / E397Kmice (66.49 mV ±3.98, P < 0.0001) trended lower at all timepoints when compared to wild type mice (81.12 mV ±2.85). Nefl Mutant Mice Showed Chronic Axonal Neuropathy
[0139] Electrophysiology findings showed that there were measurable differences in Nefl mutants. To further quantify these deficits, the histopathology of the sciatic nerve was examined at P21, P84, P180, and P360 (FIGS.6A and B). Axon area, axon diameter and G-ratio (ratio of the inner axonal diameter to the total outer diameter) were measured. Cross-sectional images of the sciatic nerve showed significant changes in Nefl+ / E397Kand NeflE397K / E397Kmice at all time points analyzed. As shown in FIG. 6B, at P21, significant changes in axon area were apparent in Nefl+ / E397K(0.0047μm2, P < 0.0001) and NeflE397K / E397K(0.0035μm2, P < 0.0001) compared to wild type mice (0.0122μm2). Throughout the analyses, axon area was consistently smaller in Nefl+ / E397K(P360, 0.0148μm2, P < 0.0001) and NeflE397K / E397K(P360, 0.0098μm2, P < 0.0001) mice when compared to wild type mice (P360, 0.0314μm2). Axon diameter was also significantly reduced in Nefl+ / E397Kand NeflE397K / E397Kmice at all time points analyzed. The G-ratio was also reduced in Nefl+ / E397K(P360 0.5557, P < 0.0001) and NeflE397K / E397Kmice (P360 0.5515, P < 0.0001) compared to wild type mice (P3600.6415). From three weeks to twelve months, differences in axon area, diameter and G-ratio were more apparent in NeflE397K / E397Kmice as compared to Nefl+ / E397Kmice. The reduced axon number / field from twelve weeks to six months in Nefl E397K / E397K (P = 0.0266) largely is not a result of increased number of axons with larger caliber but is attributed to loss of axons. From six months to twelve months, some regeneration is likely occurring. There is a substantial increase in the number of axons / field from six months to twelve months in NeflE397K / E397Kand Nefl+ / E397Kmice and those axons represent smaller axons.PATENT APPLICATION Docket No. P14899WO00 Importantly, the chronic axonal neuropathy observed in NeflE397K / E397Kand Nefl+ / E397Kmice was consistent with the impaired distal latency measured by electrophysiology.
[0140] When axonal area was analyzed from three weeks to twelve months in Nefl+ / E397Kand NeflE397K / E397Kmice there was a distribution towards more smaller axon calibers with NeflE397K / E397Kdemonstrating more smaller caliber axons than Nefl+ / E397Kmice. These results are consistent with the electrophysiology studies and axonal pathology. Neuromuscular Junction Denervation Was Present As Disease Progressed In Nefl Mutant Mice
[0141] To investigate whether neuromuscular junction (NMJ) innervation status was altered in Nefl mutant mice, biceps brachii, triceps brachii, gastrocnemius, and tibialis anterior (TA) muscles were analyzed at three weeks, twelve weeks, and twelve months. At three weeks, there were no significant differences between wild type and Nefl mutant mice in any of the muscles examined; how- ever, at twelve weeks the percentage of fully innervated endplates decreased, and partially and fully denervated endplates increased with differences observed between the muscles. At twelve weeks, the most significant differences were observed in the TA muscle. TA fully innervated endplates in Nefl+ / E397Kmice were 88% with 12% partially innervated endplates. NeflE397K / E397Kmice had 73% fully innervated endplates (P = 0.0039) with 9% partially innervated and 18% fully denervated endplates in the TA muscle. The differences in innervation status between wild type and Nefl mutants became more apparent at twelve months across all muscles with the greatest differences observed in the TA muscle. TA fully innervated endplates in Nefl+ / E397Kmice were 70% (P = 0.0448) with 24% partially innervated endplates and 6% fully denervated endplates. NeflE397K / E397Kmice had 56% fully innervated endplates (P = 0.0013) with 32% partially innervated (P = 0.0239) and 12% fully denervated endplates in the TA muscle.
[0142] Total axon number per field and total NMJ numbers per field were also examined in the gastrocnemius muscle, where electrophysiology measures were recorded. In wild type mice, the total number of axons per field decreased as the axons grew in area at P84 (436.0, NS), P180 (306.3, P = 0.0020) and P360 (285.0, P = 0019) compared to P21 (528.6). Additionally, total axons numbers per field was significantly increased in Nefl+ / E397K(744.6, P = 0.0232) and NeflE397K / E397K(731.4, P = 0.0321) compared to wild type mice (528.6) at P21, but not significant at later timepoints, potentially due to a developmental delay in the mutant mice. From P21 through P360 there was a con- sistent decrease in total axons / field in both Nefl mutants but did not show significant differences between genotypes. Nefl+ / E397Kpresented a significant decrease in the total number of axons / - field at P84 (420.8, P < 0.0001), P180 (353.5, P < 0.0001), and P360 (409.3, P < 0.0001) compared to P21(744.6). Similarly, NeflE397K / E397Kpresented a significant decrease in total number of axons / field at P84 (548.3, P = 0.0260), P180 (245.8, P < 0.0001), and P360 (424.3,PATENT APPLICATION Docket No. P14899WO00 P < 0.0001) compared to P21 (731.4). However, starting at P84 there was an increase in total number of NMJ / field consistent with wild type mice while there were no significant changes between NeflE397K animals and wild type controls. At P360, NeflE397K / E397Kaxon area was 69% smaller and Nefl+ / E397Kaxon area was 53% smaller than wild type with 33% and 30% more axons / field, respectively. At P360, the average total number of NMJ / field was 47 for wild type mice, 46 for Nefl+ / E397Kmice, and 40 for NeflE397K / E397Kmice, which did not show significant differences, but the innervation status was significantly changed. Nefl Mutants Show Respiratory Differences in Erratic Breathing, Apneas, and Tidal Volume
[0143] A subset of CMT2E patients have reported respiratory complications, likely associated with respiratory muscle weakness. To determine if respiratory deficits were present in the Nefl+ / E397Kand NeflE397K / E397Kmice, whole-body plethysmography was performed to assess respiration under normal and challenge conditions at twelve weeks and twelve months. Mice were evaluated under three experimental conditions: normoxia (normal, 21% O2), hypercapnia (high CO2, 7% CO2, 21% O2) and maximum challenge high CO2, low O2, 7% CO2, 10.5% O2). Frequency (respiratory rate in breaths / minute), tidal volume (amount of air inspired), minute ventilation (rate of ventilation, frequency x tidal volume) and mean inspiratory flow (tidal volume / inspiratory time) were recorded. The total number of apneas (paused breathing) and time spent in erratic breathing (irregular breathing patterns) were also measured.
[0144] At twelve weeks there were no significant differences between Nefl mutant mice and wild type mice in frequency, tidal volume, minute ventilation and mean inspiratory flow during normoxia, hypercapnia or max challenge (not shown). Of note, there was significant variability between mice consistent with the patient population. There were differences between Nefl mutant and wild type mice at twelve-weeks in the percent time spent in erratic breathing. Under hypercapnia conditions, wild type mice spent 5.0% of the recorded time in erratic breathing while Nefl+ / E397Kmice spent 12.7% and NeflE397K / E397Kmice spent 23.3% time in erratic breathing. Erratic breathing was increased further under maximum respiratory challenge conditions where wild type mice spent 9.1% of the recorded time in erratic breathing while Nefl+ / E397Kmice spent 21.0% and NeflE397K / E397Kmice spent 39.0% time in erratic breathing. In Nefl mutant mice there was more variation between mice suggesting some mice had deficits more than others. When apneas were evaluated at twelve weeks significant differences were not noted; however, under normoxia wild type mice recorded 20.8 apneas while Nefl+ / E397Kmice recorded 55.2 apneas and NeflE397K / E397Kmice recorded 61.1 apneas. Concerning apneas, there was more variation between Nefl mutant mice suggesting some mice had deficits more than others.PATENT APPLICATION Docket No. P14899WO00
[0145] At twelve months, Nefl mutant mice continued to show increased number of apneas under normoxia conditions. Wild type mice recorded 20.6 apneas under normoxia conditions while Nefl+ / E397Kmice recorded 27.8 apneas and NeflE397K / E397Kmice recorded 55.4 apneas. There was more variation between Nefl mutant mice suggesting some mice had deficits more than others with NeflE397K / E397Kmice experiencing the most apneas as observed at 12 weeks. The total number of sighs, frequency and minute ventilation did not show significant differences between wild type and Nefl mutant mice; however, Nefl+ / E397Kmice had
[0146] increased minute ventilation under all respiratory conditions. Interestingly, NeflE397K / E397Kmice demonstrated differences in tidal volume under all conditions; tidal volume was significantly different from wild type and Nefl+ / E397Kmice. Tidal volume under hypercapnia conditions was 0.018 ml / gram for wild type mice while Nefl+ / E397Kmice recorded a tidal volume of 0.019 ml / gram and NeflE397K / E397Kmice 0.026 ml / gram. Tidal volume under maximum challenge conditions was 0.019 ml / gram for wild type mice while Nefl+ / E397Kmice recorded a tidal volume of 0.018 ml / gram and NeflE397K / E397Kmice 0.025 ml / gram. The increased tidal volume suggests some compensatory mechanism in NeflE397K / E397Kmice under challenged respiratory conditions. There were also differences in mean inspiratory flow between Nefl+ / E397Kand NeflE397K / E397Kmice. Together, these results suggest that NeflE397K / E397Kmice have increased respiratory differences when compared to wild type and Nefl+ / E397Kmice that worsen with disease. Discussion
[0147] Here, two Nefl-E397K mouse models are reported that present with early electrophysiology differences and axon pathology that persisted throughout the lifespan of the mice. Additionally, in the characterization of Nefl+ / E397Kor NeflE397K / E397Kmice we found that NeflE397K / E397Kmice demonstrate disease pathology earlier than Nefl+ / E397Kmice and in most instances disease pathology was more severe. Consistent with CMT2E patients, there was not a reduction in lifespan for Nefl+ / E397Kor NeflE397K / E397Kmice; however, weight for Nefl+ / E397Kmice trended upward while weight for NeflE397K / E397Kmice trended downward. These differences might be reflected by the mobility of the mice, any associated neuropathic pain and disease severity.
[0148] Electrophysiology measurements recorded with individual cohorts or within the longitudinal study were consistent demonstrated significant differences as early as P21, revealing an early, quantifiable phenotype. Distal latency was significantly prolonged throughout the 360 days while CMAP amplitude was consistently lower in the Nefl mutants. At three weeks, electrophysiology measurements (distal latency, CMAP amplitude and negative area) demonstrated significant differences from wild type cohorts. A possible interpretation of the prolonged distal latency includes reduction of action potential propagation rates along motorPATENT APPLICATION Docket No. P14899WO00 axons due to reduced axonal size as previously shown in other Nef l models, though some contribution of NMJ transmission cannot be excluded. Furthermore, reduction of CMAP amplitude and area could reflect muscle fiber denervation causing loss of muscle fiber excitation and / or reduced muscle fiber size. The distal latency was consistent with the significant decrease in axon area and diameter observed in Nefl+ / E397Kand NeflE397K / E397Kmice. At three weeks, there was no NMJ denervation present in the forelimb nor hindlimb muscles examined in Nefl mutants. Significantly reduced muscle fiber area in Nefl mutants further supports the electrophysiology findings.
[0149] Interestingly, from three to twelve weeks distal latency was further prolonged in Nefl mutant mice with NeflE397K / E397Kmore severe than Nefl+ / E397Kmice. There was some improvement in CMAP amplitude and negative area at twelve weeks; however, both remained statistically different from the wild type cohort. Nefl mutant axonal growth continued, but axon area remained significantly smaller than wild type axons contributing to the prolonged distal latency. For NeflE397K / E397Kmice from three weeks to twelve weeks, there was a three-fold increase in axon area; however, axons were 39% the size of wild type axons. Nefl+ / E397Kmice presented with more, larger axons than NeflE397K / E397Kmice. Overall, NMJ innervation was largely preserved in Nefl+ / E397Kmice with increased partial and full denervated endplates observed in NeflE397K / E397Kmice. The increased axon caliber, ‘maintenance’ of NMJ innervation and potential for sprouting likely stabilized CMAP and negative area in the Nefl mutants.
[0150] From twelve weeks to six months, axon degeneration persisted in the Nefl mutants, most notably in NeflE397K / E397Kmice. Nefl+ / E397Kdemonstrated a 13% reduction in axon caliber with a 16% reduction in the number of axons per field (smaller axons and fewer axons counted). NeflE397K / E397Kmice demonstrated a 31% reduction in axon caliber with a 55% reduction in the number of axons (much smaller axons and significantly fewer axons counted). Additionally, there was an increase in the absence of axons within the fields scored at six months, indicating axon loss. NeflE397K / E397Kmice had 70% smaller axon area than wild type mice at six months and a 20% reduction in the number of axons. Notably, Nefl mutant mice increased total NMJs consistent with wild type mice suggesting compensatory mechanisms such as sprouting were occurring. Together, these results support the electrophysiology: distal latency was prolonged due to the small axons. CMAP and negative area were largely preserved due to compensatory mechanisms that maintained NMJ innervation and facilitated sprouting as well as muscle fiber hypertrophy in Nefl mutant mice.
[0151] Nefl+ / E397Kand NeflE397K / E397Kmouse models of CMT2E present with important, progressive features of this disease, including motor func- tion deficits, and skeletal muscle fiberPATENT APPLICATION Docket No. P14899WO00 pathology. Additionally, these mice also show respiratory apneas and erratic breathing differences similar to those reported in CMT patients. This model is an important addition to the CMT2E collection of animal models as it has a robust and early (at least by P21) phenotype that is progressive, but not so severe that the animals cannot be studied over an extended period (at least up to P360).
[0152] When evaluating motor function assessments, NeflE397K / E397Kmice often performed worse than Nefl+ / lE397Kmice. Consistent with the CMT2E patient population, variability among Nefl mutants was noted and this variability often masked the true significance of the motor function deficits. Interestingly, deficiencies were observed earliest in assessments that required the most motor coordination (rotarod and dowel rod) and these deficits became progressively worse. The deterioration of motor control was also observed in how Nefl mutant mice completed the motor function assessments. Gait was reduced while the number of tail grabs and foot slips increased. Tail and foot positioning while traversing the dowel rod also indicated that Nefl mutant mice experienced motor control deficits. Catwalk analyses provided further insight into the gait disturbances observed in the hind paws maximal contact area and print width as well as the left and right print positions. These motor coordination deficits were consistent with the electrophysiological findings observed at three weeks through twelve months.
[0153] Nefl mutant mice demonstrated dynamic changes in muscle fiber area and diameter as disease progressed that varied not only between forelimbs and hindlimbs but within forelimbs and hindlimbs. The forelimb biceps brachii and hindlimb gastrocnemius demonstrated the most significantly changes in muscle fibers. At twelve weeks, the biceps and gastrocnemius muscles showed significant atrophy in Nefl+ / lE397Kand NeflE397K / E397Kmice. In contrast, at twelve months hypertrophy was observed in the biceps and gastrocnemius of Nefl+ / lE397Kand NeflE397K / E397Kmice. Atrophy of the biceps and gastrocnemius is likely attributed to the significant axonal degeneration observed and is supported by the electrophysiology findings. Additionally, neuromuscular junction denervation was increased in Nefl mutants when compared to three weeks. While some inflammation was observed within the gastrocnemius, inflammation was likely not the primary contributor to hypertrophy observed but rather some compensatory mechanisms. Axonal area and diameter and the number of axons / field all increased from six months to twelve months supporting compensatory mechanisms at play (companion manuscript). Interestingly, Nefl mutants showed significant differences between the muscles. These differences are likely attributed to differences in muscle composition and function or differences in axonal degeneration.
[0154] Muscle fiber type within the biceps brachii, triceps brachii, gastrocnemius and tibialis anterior demonstrated alterations between wild type or Nefl mutant mice. Changes in fiber typePATENT APPLICATION Docket No. P14899WO00 composition could lead to changes in muscle function, muscle weakness and reduced motor function observed in the Nefl mutant mice. At twelve weeks, the distribution of biceps brachii muscle fibers shifted to more, smaller fibers in both Nefl mutants.
[0155] At twelve months, Nefl+ / E397Kmice showed decreased Type IIb fibers and a switch to increased Type IIx fibers in the biceps brachii. This alteration could be attributed to a change in motor units as a compensatory mechanism towards regeneration as muscle fiber area and diameter were either similar to or greater in the Nefl mutants when compared to wild type. The gastrocnemius, a primarily fast twitch muscle with a high proportion of Type IIb fibers, showed decreased muscle fiber area and diameter as well.
[0156] From six months to twelve months, axon caliber slightly increased in Nefl mutant mice; however, wild type mice demonstrated a decrease in the number of axons / field (consistent with increased caliber) while Nefl mutants demonstrated increased axon number (Nefl+ / E397K13%, NeflE397K / E397K42%) suggesting regeneration was occurring. More, smaller axons were present at twelve months in comparison to six months in Nefl mutants. The increased but smaller axons resulted in significantly prolonged distal latency. While there was not a significant difference in P–P CMAP amplitude and negative area, Nefl mutants consistently had lower measurements than their wild type cohort. The maintenance of NMJ numbers could serve as a compensatory mechanism for the changes in NMJ innervation status. Materials and Methods
[0157] Nefl mice were generated on a C57BL / 6 J background using CRISPR technology. An enhanced-specificity Cas9 (eSPCas9) protein was used to reduce off-target effects. Any predicted off-target site with less than a 2 bp mismatch (including DNA or RNA bulges) or with less than 3 bp mismatches if no mismatches are in the 12 bp seed region of the sgRNA was PCR amplified and sequenced to ensure no erroneous edits were made. The sgRNA was ordered as chemically modified synthetic sgRNA. The repair template was chemically synthesized as a 199 bp single stranded DNA oligo (ssODN) (IDT). The ssODN was complementary to the non-target strand and contained symmetrical homology arms.
[0158] sgRNA sequence: 5’- TCTTGGAAGGCGAAGAGACC-3’ (SEQ ID NO: 10)
[0159] Repair template sequence (sgRNA sequence disrupted by the desired mutation) 5’- GAGGAAAGTAATGAATGTGGGCTTAGAGCAATGAACACATCCAGCCTTGCTCTAAC TGTACTCTTCATTCCCTCTCCACCAGAAAACTCTTGGAAGGCAAAGAGACCAGACTC AGTTTCACCAGCGTGGGTAGCATAACCAGCGGCTACTCTCAGAGCTCGCAGGTCTTC GGCCGTTCTGCTTACAGTGGCTTGCAGAGC -3’ (SEQ ID NO: 11).PATENT APPLICATION Docket No. P14899WO00 Example 5: AAV9 Dual Cargo Vector Efficacy
[0160] A recombinant single stranded (ss) AAV viral vector was designed to express the “lead” shRNA (shRNA#3) expressed from the U6 promoter and the human NEFL cDNA driven by the CBA promoter. The CBA promoter provides immediate robust expression and is ubiquitously expressed. This was the initial promoter selected, however, tissue-restricted promoters may be used to minimalize potential off-target effects. Viral particles were packaged using the AAV9 serotype. AAV9 was chosen as it provides broad-based tissue distribution and strong neuronal uptake.
[0161] As established in Examples 1-4, novel Nefl+ / E397Kand NeflE397K / E397Kmice serve as excellent models of CMT2E, accurately recapitulating important disease hallmarks, including electrophysiological defects, axonal and muscle pathology, and motor coordination abnormalities. These Nefl-E397K mice were used in a proof-of-concept study to assess gene therapy vector efficacy. Nefl+ / E397K, NeflE397K / E397Kand control mice were injected at P0 and P1 (1x1012total viral genomes). Untreated Nefl-E397K mice served as controls. Delivery and expression of the ssAAV9 dual cargo vector did not impact survival nor weight (data not shown). Electrophysiology recordings were taken at P21, P30, P45, P120, P150 and P180 (FIG. 9). Distal latency (or how fast the sciatic nerve transmits the electronic impulse to the gastrocnemius muscle) was one of several parameters recorded. At P21 (note: injection was immediately after birth), Nefl-E397K mutant mice (treated and untreated cohorts) were not statistically different from each other and showed a prolonged distal latency compared to the wild type mice (FIG.9). This was anticipated as the vector is a single-stranded AAV vector and full expression single-stranded AAV vectors take 14-21 days post-injection. Importantly, at P45-P180 when robust expression of the vector has been achieved, the ssAAV9 treated Nefl+ / E397Kand NeflE397K / E397Kmice showed significant improvements in distal latency over untreated controls (FIG.9), suggesting that the shRNA and human NEFL are being expressed and improving electrophysiology parameters. This is a longitudinal study; therefore, the data points represent the same mice over time, showing that there is a consistent and sustained improvement once vector expression occurred.
[0162] In support of these observations, the ssAAV9 vector was examined to determine if it efficiently entered the peripheral nervous system. The recombinant vector was detected within the sciatic nerve of only vector-treated mice (FIG.10). Sciatic axon and muscle pathology were also examined in Nefl+ / E397Kand NeflE397K / E397Ktreated and untreated mice (FIG. 11). Significant improvements in axon area, perimeter and g-ratio were observed only in vector-treated mice and not in the untreated mice. Significant improvements in muscle fiber area and diameter were detected only in the Nefl-E397K vector injected mice and not in the untreated mice (data notPATENT APPLICATION Docket No. P14899WO00 shown). Lastly, improvements in motor function in Nefl-E397K mutant mice injected with the ssAAV9 dual cargo vector were demonstrated, in contrast to untreated Nefl-E397K mutant mice. Treated mice showed significantly improved rotarod activity at 6 months post-injection (FIG.12). Collectively, these results provide an excellent foundation for the success of this disclosure based upon proof-of-concept efficacy and in-hand novel animal models. Example 6: Vector Optimization- shRNA and Promoter Selection
[0163] The ssAAV9 vector has a U6 promoter driven shRNA (recognizes mouse Nefl and human NEFL) and the CBA promoter driven human NEFL cDNA (“resistant” to shRNA#3, #5, #6). Tissue culture studies suggested shRNAs #3, #5, #6 were similarly effective at reducing NF-L expression. The in vivo proof-of-concept studies described above examine shRNA #3. Studies to determine whether shRNA #3, #5 or #6 is most effective in vivo can be performed, although all are expected to perform.
[0164] To optimize the shRNA, the ssAAV9-shRNA-NEFL dual cargo vector will be examined in vivo in wild type mice to determine how efficiently the vector (shRNA) reduces mouse Nefl expression. C57BL / 6J wild type mice will be used for these studies (the same background as the NeflE397K / E397Kand Nefl+ / E397Kmice). shRNAs #5, and #6 will be cloned into the ssAAV9-shRNA- NEFL vector. Untreated animals and a vector without shRNA will be controls. 1x1012vector genomes will be tested as this concentration demonstrated significant efficacy in the preliminary studies. This vector amount is based upon our previous work delivering cDNA and “functional” RNAs such as shRNAs, miRNAs, etc. Vector administration will be done via intracerebroventricular (ICV) injection at P0 / P1. Tissues will be collected at P20 and P50. These time points were chosen as they allow for expression from the vector. ddRT-PCR will be used to determine the relative reduction of Nefl from sciatic and other peripheral nerve lysates using primers that are specific to the Nefl gene (do not recognize expression from the human NEFL). Primers were designed that anneal to the Nefl cDNA sequences, including the 3’ UTR which is (expectedly) very degenerate compared to the human sequence. Brain and spinal cord will also be collected and analyzed as Nefl expression is high in these tissues. Skeletal muscle (gastrocnemius) will be collected and analyzed as a negative control since Nefl expression is negligible in skeletal muscle. The same tissues will also be analyzed by Western blot. 12 mice / group and 6 mice / timepoint will be used for these studies. The lead shRNA (#3, #5 or #6) will be the one that most efficiently reduces Nefl expression.
[0165] The promoter will be optimized for the dual cargo ssAAV9 vector. The current vector, used in the preliminary studies, contains the ubiquitously expressing CBA promoter. To reduce the potential for off-target expression and resultant downstream consequences, a neuronal-specificPATENT APPLICATION Docket No. P14899WO00 human synapsin (hSYN) promoter will be cloned into the dual cargo ssAAV9 vector. The hSYN promoter was selected due to its broad neuronal tropism / specificity, its relatively small size (~449 bp), and its suitability for such purposes. The lead shRNA (#3, #5 or #6), the one that most efficiently reduces Nefl expression, will be the candidate shRNA used for these studies. C57BL / 6J wild type mice will be used for these studies and 1x1012vector genomes will initially be tested. Administration will be done via icv injection at P0 / P1. Untreated animals and a vector without shRNA will be controls along with the original ssAAV9 dual cargo vector used in the preliminary studies. Tissues will be collected at P20 and P50. ddRT-PCR will be used to determine the relative reduction of Nefl from sciatic and other peripheral nerve lysates using primers that are specific to the Nefl gene (do not recognize expression from the human NEFL). Brain and spinal cord will also be collected and analyzed as Nefl expression is high in these tissues. Skeletal muscle (gastrocnemius) will be collected and analyzed as a negative control since Nefl expression is negligible in skeletal muscle. The same tissues will also be analyzed by Western blot. 12 mice / group and 6 mice / timepoint will be used for these studies. We want to determine that the shRNA lead candidate is efficiently reducing Nefl expression and that human NEFL cDNA driven by the hSYN promoter delivers robust human NEFL expression. The lead candidate will be the vector that most efficiently reduces Nefl expression and delivers robust NEFL expression.
[0166] Interpretations, limitations, and alternative strategies: An essential aspect of the ssAAV9 dual cargo vector is that the shRNA does not recognize the vector-derived human NEFL transgene because the NEFL primary nucleotide sequence that is targeted by the shRNA was altered, thereby making the vector-encoded NEFL resistant to the shRNA. Each of the 3 shRNAs targets a different sequence within Nefl / NEFL; therefore, a NEFL cDNA was created that includes alterations in the primary nucleotide sequence where each of the shRNAs target (the appropriate amino acids encoded at each position are identical to wild type NF-L protein). It is anticipated that the three shRNAs identified in cell culture will perform similarly in vivo. Thus, there is no intrinsic preference towards any of the shRNAs (#3, #5, #6) as each of them contains the same number of mismatches with the modified “resistant” cDNA. A possible expansion of this approach could be to include 2 of the shRNAs (e.g. shRNA#3 and shRNA#5) to improve in vivo shRNA activity if it is not as robust as the in vitro activity. The ssAAV9 vector would accommodate this modification and restriction nuclease sites have been engineered that allow for a straightforward cloning step to add / modify the current vector backbone. Monitoring will also occur for any potential impact with the other neurofilament factors (e.g. NF-M, NF-H, Int) in terms of expression or relative composition of neurofilament structure. While it is believed that the hSYN promoter is the appropriate choice for neuronal expression, other options exist and could bePATENT APPLICATION Docket No. P14899WO00 examined. The native Hb9 promoter, which is neuronal specific, is too large for AAV vectors, however, modified / truncated Hb9 promoters exist and have been shown to express exclusively in neuronal cells from AAV vectors and could be examined if an additional neuron promoter was desired.
[0167] For these vector optimization studies, intracerebroventricular (ICV) delivery was chosen because broad AAV9 distribution can be easily achieved, and virus enters the PNS. AAV9 can enter the PNS from a variety of injection sites in older (adult) animals, including from intravenous (IV) and intrathecal (IT) delivery. For treatments beyond ~P10 ICV delivery is not practical, therefore, an intravenous (IV) delivery will be used for later the therapeutic window studies in Aim 3.
[0168] Examples 1-5 demonstrate that an effective dual cargo vector has been developed. An excellent shRNA #3 candidate meets the criteria of inhibiting human and mouse NEFL expression and the shRNA-resistant NEFL cDNA provides robust expression of human NEFL. While shRNA#3 was the initial choice, 2 additional shRNAs meet the same criteria and can be easily shuttled into the vector system. Regarding vector selection, ssAAV is being used to fit the constraints of a dual-cargo cassette (shRNA + cDNA with separate promoters and spacing elements). ssAAV-shRNA-NEFL is predicted to be an excellent vector for delivering shRNA / cDNA cassette. Example 7: Further Efficacy Studies in A Novel CMT2E Model of Disease
[0169] The lead candidate identified in Example 6 for the ssAAV-shRNA-NEFL vector expressing the dual-cargo of shRNA and “resistant” human NEFL will be delivered via ICV injection at P0 / P1 tomice (including wild type and untreated controls).1x1012vector genomes will be used as this was determined an efficacious dose. Seven cohorts will be examined. These cohorts will examine the impact of ssAAV-shRNA-NEFL delivery upon important aspects of the CMT2E phenotype including lifespan, weight, motor function, disease pathology and electrophysiology. Assessments include those most significant in the proof-of-concept study: all-limb grip strength, rotarod, dowel rod analyses (time, tail grabs, foot slips), and electrophysiology. Motor function assessments will occur weekly from P21-P150. Electrophysiology will be evaluated at P21, P45, P90, P120 and P150. Survival and weight will also be assessed. Axon (sciatic), muscle (gastrocnemius and biceps brachii) and NMJ pathology (gastrocnemius and biceps brachii) will be examined.
[0170] Experimental Cohort #1 (Nefl+ / E397K): 50 mice (25M / 25F) Nefl+ / E397Kwill be treated at P0 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 24 animalsPATENT APPLICATION Docket No. P14899WO00 for pathology at P21, P60, P120 and P150 (6 animals / timepoint).12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0171] Experimental Cohort #2 (NeflE397K / E397K): 50 mice (25M / 25F) NeflE397K / E397Kwill be treated at P0 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 24 animals for pathology at P21, P60, P120 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0172] Control Cohort #3 (Nefl+ / E397K): 50 mice (25M / 25F) Nefl+ / E397Kwill be untreated. 14 animals for longitudinal assessments through P150.24 animals for pathology at P21, P60, P120 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0173] Control Cohort #4 (NeflE397K / E397K): 50 mice (25M / 25F) NeflE397K / E397Kwill be untreated. 14 animals for longitudinal assessments through P150.24 animals for pathology at P21, P60, P120 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0174] Control Cohort #5 (wild type): 50 mice (25M / 25F) 14 animals for longitudinal assessments through P150. 24 animals for pathology at P21, P60, P120 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0175] Control Cohort #6 (NeflE397K / E397K): 32 mice (16M / 16F) NeflE397K / E397Kwill be treated at P0 with ssAAV-shRNA (NEFL has been deleted).8 animals for longitudinal assessments through P150. 12 animals for pathology at P21 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0176] Control Cohort #7 (NeflE397K / E397K): 32 mice (16M / 16F) NeflE397K / E397Kwill be treated at P0 with ssAAV-NEFL (shRNA has been deleted).8 animals for longitudinal assessments through P150. 12 animals for pathology at P21 and P150 (6 animals / timepoint). 12 animals for transcriptomics at P21, and P150 (6 animals / timepoint).
[0177] P0 delivery is an early time point; however, from a proof-of-concept perspective, delivering as early as possible likely provides the greatest opportunity to identify an efficacious vector. Further studies can evaluate outcomes when the vector is delivered at various stages of disease progression. Motor function assessments are performed as described below:
[0178] i) Motor Function Assessments (based upon analysis of the CMT2E phenotype):
[0179] 1) All-limb grip strength: grasping response to wire mesh grid (with electronic gauge for resistance measuring) is recorded in grams. During each test, three trials are performed. Measurements taken weekly following training initiated at P21.PATENT APPLICATION Docket No. P14899WO00
[0180] 2) Dowel test: animals will be video recorded and examined for tail grabs, tail positioning, foot slips, pauses / stops, and total traversing time using the 22 mm (diameter) dowel as described (Preliminary Results). Measurements taken weekly following training initiated at P21, two trials are performed.
[0181] 3) Rotarod: Mice are placed on a rotating wheel that incrementally increases speed over time. Measurements taken weekly following training initiated at P21.
[0182] 4) Electrophysiology: A series of in vivo electrophysiological parameters routinely used in assessing SMA, SMARD1, CMT2S and CMT2E (described in Examples above) mouse models of disease will be applied. Importantly, these measures were applied longitudinally in the Nefl- E397K mice from P21 to 1 year. These measures mirror those routinely applied in patients. Measurements include: CMAP (output of motor unit pool from a muscle) responses will be recorded from the gastrocnemius muscles to assess total electromyographic output. MUNE (# of functional motor neurons innervating a muscle) will be used to estimate the number of functional motor units innervating the gastrocnemius. In vivo assessment in mouse models was observed to have good to excellent reliability (ICC=0.760 (95% CI: 0.455-894). Electromyography (EMG) will be performed to investigate fibrillations, a typical finding in various forms of SMA and other diseases. Repetitive Nerve Stimulation (RNS) (NMJ transmission). RNS is a technique that involves recording the CMAP response following a train of stimuli, and if endplate potentials are of insufficient amplitude to trigger muscle fiber action potential generation, CMAP amplitude will decrease. Muscle contractility measurements in vivo and ex vivo: As demonstrated in the Examples above, muscle contractility via nerve stimulation is a sensitive measure of muscle function in mice. Assessment of plantar flexion torque (twitch, maximum tetanic, and force-frequency curve) will be performed utilizing a whole mouse testing system with a force transducer and nerve stimulation in vivo. Force measurements will be obtained in vivo for the benefits of being a physiological comparison to the electrophysiological recordings. These in vivo experiments will allow >80% power to detect 20% change in muscle contractility, motor unit number, and neuromuscular junction transmission failure.
[0183] 5) Muscle, NMJ and nerve pathology: Muscle fiber area and composition, microtubule structure, aggregation, and other structural pathologies will be quantitated consistent with those used in the characterization of the Nefl-E397K mouse models. NMJ analysis and H&E staining of skeletal muscle will be performed. While the sciatic nerve and the gastrocnemius muscle were used as surrogates for the CMT2E phenotype, multiple motor units, muscles and nerves can be examined as CMT2E affects more than just the sciatic and gastrocnemius muscles.PATENT APPLICATION Docket No. P14899WO00
[0184] No change in life span is expected as the CMT2E models do not experience premature death; however, lifespan will be recorded for all cohorts. Weight, as a measurement of fitness, will also be collected daily. Nefl mRNA and protein will be quantitated as described in Example 6 in the same tissues to confirm the reduction of the endogenous mRNA and protein.
[0185] ii) Single cell transcriptomic analysis at P21 and P150 as a measure of “molecular efficacy.” AAV-treated CMT2E mice, untreated and wild type motor and sensory neurons (soma) will be collected at P21 and P150. 6 mice per cohort will be used at each time point. Treated Nefl+ / E397Kand NeflE397K / E397Kcohorts will be compared to untreated Nefl+ / E397K, NeflE397K / E397Kand wild type cohorts. Data will be generated using the Illumna NovaSeq 6000. This 10x Genomics single-cell sequencing experiment will provide valuable insights into molecular pathways involved in disease progression. These results will aid in the identification of therapeutic targets as disease-modifiers or druggable pathways. For example, lead candidates that are specifically decreased in CMT2E can be engineered into AAV vectors and delivered to CMT2E model mice. Additionally, RNAseq data will allow for the determination of mRNA transcripts from the endogenous Nefl gene as well as transcripts from the vector-derived (shRNA “resistant”) NF-L gene, providing a quantitative measure of the mode-of-action for our vector. This will serve as a complementary approach to the ddRT-PCR analysis.
[0186] iii) Evaluating “mutation agnostic” activity in the N98S CMT2E mouse model. To confirm the mutation agnostic activity of the lead vector, the well-characterized Nefl-N98S mouse model will be used (Jackson Labs: Strain #029744). This model has electrophysiological defects as well as muscle and nerve pathologies. A similar series of phenotypic assessments will be performed as described above (not including the RNAseq).
[0187] Experimental Cohort #1 (N98S): 26 mice (13M / 13F) NeflN98S / +will be treated at P0 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P21 and P150 (6 animals / timepoint).
[0188] Experimental Cohort #2 (N98S): 26 mice (13M / 13F) NeflN98S / +will be untreated. 14 animals for longitudinal assessments through P150.12 animals for pathology at P21 and P150 (6 animals / timepoint).
[0189] Control Cohort #3 (wild type): 26 mice (13M / 13F) wild type mice. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P21 and P150 (6 animals / timepoint).
[0190] Interpretations, limitations, and alternative strategies: Example 6 focuses on vector optimization; therefore, those studies use readily available wild type mice. This Example uses the optimized dual cargo vector and evaluates efficacy in the Nefl-E397K mouse models of CMT2EPATENT APPLICATION Docket No. P14899WO00 disease. Nefl+ / E397Kand NeflE397K / E397Kwere used to determine the extent that all phenotypes and pathology are improved in both models. It is expected that there is a connection between a shRNA- mediated reduction in NeflE397Kexpression and improvements in disease severity from wild type NEFL vector expression. Early (P0) vector delivery should lead to a significant correction in the CMT2E phenotype. Importantly, the proof-of-concept studies demonstrated remarkable efficacy with respect to improving axon / muscle pathology and electrophysiological deficits. P0 / neonatal delivery likely overcomes these deficits. Building upon these observations towards a clinical application, this Example will examine the temporal requirements and identify the latest time point where a therapy could remain effective.
[0191] There are several important controls that will be run in parallel with these studies. For example, a vector that only expresses the shRNA will be used; similarly, a vector only expressing the shRNA-resistant NEFL cDNA will be included.
[0192] Alternatives: Similar AAV vectors that only express GFP will be built to confirm that appropriate expression will be achieved in the target tissues. All indications are that the AAV9- hSYN construct will provide robust neuronal expression (with limited off-target expression). Alternative promoters could also be used, including synthetic Hb9, NSE, mCaMKII or PGK to modulate neuronal-specific expression if needed. Example 8: Determining the therapeutic window for ssAAV-shRNA-NEFL
[0193] To mimic a clinic context, the vector will be delivered to CMT2E model mice at 3 different time points via intravenous (IV) injection: 1) early / pre-symptomatic (P10); 2) symptomatic (P30); and 3) late-stage disease (P90) to determine the relative efficacy of the vector and the restoration of wild type NEFL expression. The same assessments will be examined in Nefl+ / E397Kmice and control cohorts as in the Examples above. The focus will be upon the Nefl+ / E397Kmice as these are representative of the majority of CMT2E patients (not the homozygous state).
[0194] In the preceding Examples characterizing the Nefl-E397K mice, it was concluded that the CMT2E phenotype was progressive and that by ~P85, the disease was at an advanced stage, especially based upon the electrophysiology and axon pathology. Cohorts of Nefl+ / E397Kmice will be treated at P10, P30 and P90 to determine the therapeutic window and the extent that disease pathology can be improved, stopped or reversed at any of the time points analyzed. The optimized dose paradigm will be used based upon the prior findings.
[0195] Experimental Cohort #1 (P10): 26 mice (13M / 13F) Nefl+ / E397Kwill be treated at P10 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P100 and P150 (6 animals / timepoint).PATENT APPLICATION Docket No. P14899WO00
[0196] Experimental Cohort #3 (P30): 26 mice (13M / 13F) Nefl+ / E397Kwill be treated at P30 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P100 and P150 (6 animals / timepoint).
[0197] Experimental Cohort #5 (P90): 26 mice (13M / 13F) Nefl+ / E397Kwill be treated at P90 with ssAAV-shRNA-NEFL. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P100 and P150 (6 animals / timepoint).
[0198] Control Cohort #7 (Nefl+ / E397Kuntreated): 26 mice (13M / 13F) Nefl+ / E397Kwill be untreated. 14 animals for longitudinal assessments through P150.12 animals for pathology at P100 and P150 (6 animals / timepoint).
[0199] Control Cohort #5 (wild type): 26 mice (13M / 13F) wild type mice. 14 animals for longitudinal assessments through P150. 12 animals for pathology at P100 and P150 (6 animals / timepoint).
[0200] AAV9 is a remarkably versatile vector as it can enter the peripheral nervous system from a variety of routes. Thus, although IV administration is mentioned here, there are alternative delivery routes that could be used, include intrathecal (IT) administration. Themice were selected for this study because the heterozygous genetic context represents the majority of CMT2E patients but there is a very robust alternative with theE397K / E397Kmice. Thus, the NeflE397K / E397Kmice could be used in a confirmatory study of a more robust CMT2E phenotype.
[0201] It is expected that the CMT2E phenotype will allow the AAV9 vector to improve the condition even at the later time points than P0, such as P30 or P90. Example 9. Sequences Table 1PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00PATENT APPLICATION Docket No. P14899WO00
Claims
PATENT APPLICATION Docket No. P14899WO00 CLAIMS What is claimed is:
1. An adeno-associated virus (AAV) expression vector, comprising: at least one neurofilament light chain gene (NEFL)-targeting shRNA operably linked to a first promoter; and a NEFL cDNA operably linked to a second promoter. 2 The AAV expression vector of claim 1, wherein the NEFL cDNA comprises a nucleic acid sequence having one or more mutations as compared to the wildtype human NEFL gene. 3 The AAV expression vector of claim 1, wherein the NEFL cDNA encodes a wildtype human NF-L protein. 4 The AAV expression vector of claim 3, wherein the wildtype human NF-L protein comprises the amino acid sequence of SEQ ID NO: 15 or an allelic variant thereof. 5 The AAV expression vector of claim 2, wherein the one or more mutations decrease and / or prevent shRNA targeting of the NEFL cDNA. 6 The AAV expression vector of claim 1, wherein the first promoter is a U6 promoter or a Histone 1 (H1) promoter. 7 The AAV expression vector of claim 1, wherein the second promoter is a chicken β-actin (CBA) promoter or a human synapsin 1 (hSYN) promoter. 8 The AAV expression vector of claim 1, further comprising a 5’ AAV inverted terminal repeat (ITR) and a 3’ AAV ITR. 9 The AAV expression vector of claim 1, wherein the expression vector comprises two or more, three or more, or four or more NEFL-targeting shRNAs. 10 The AAV expression vector of claim 1, wherein the NEFL-targeting shRNA comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-6, or a sequence having at least 90%, atPATENT APPLICATION Docket No. P14899WO00 least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
11. The AAV expression vector of claim 1, wherein the NEFL cDNA comprises the nucleic acid sequence of SEQ ID NO: 8, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
12. The AAV expression vector of claim 1, wherein the second promoter comprises the nucleic acid sequence of SEQ ID NO: 12 or 13, or a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
13. The AAV expression vector of claim 1, wherein the vector is a single-stranded AAV expression vector.
14. The AAV expression vector of claim 1, wherein the vector is an AAV vector of serotype 9 (AAV9).
15. The AAV expression vector of claim 1, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 9, or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity thereto.
16. The AAV expression vector of any one of claims 1-15, wherein the vector targets a human NF-LE396Kmutation or a mouse NF-LE397Kmutation.
17. The AAV expression vector of claim 16, wherein the human NF-LE396Kmutation comprises a glutamic acid to lysine substitution corresponding to position 396 of SEQ ID NO: 15, or an allelic variant thereof.
18. The AAV expression vector of claim 16, wherein the mouse NF-LE397Kmutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.
19. A cell comprising the AAV expression vector of any one of claims 1-15.PATENT APPLICATION Docket No. P14899WO00 20. A pharmaceutical composition comprising a therapeutically effective amount of the AAV expression vector of any one of claims 1-15 and a pharmaceutically acceptable carrier.
21. A method of treating Charcot-Marie-Tooth disease type 2E (CMT2E) in a subject, comprising: administering to the subject a therapeutically effective amount of the AAV expression vector of any one of claims 1-15 or a pharmaceutical composition comprising the AAV expression vector.
22. The method of claim 21, wherein the subject is human.
23. The method of claim 21, wherein the subject has one or more mutations in the NF-L protein as compared to a wildtype NF-L protein.
24. The method of claim 23, wherein the mutation comprises an NF-LE396Kmutation.
25. The method of claim 21, wherein the method diminishes the severity of, delays the onset or progression of, and / or eliminates at least one symptom of CMT2E in the subject.
26. The method of claim 25, wherein the symptom of CMT2E comprises muscle weakness, muscle atrophy, sensory defects, gait abnormalities, and / or decreased reflexes.
27. The method of claim 21, wherein the expression vector or pharmaceutical composition is administered to the subject within the first day of birth.
28. The method of claim 21, wherein the expression vector or pharmaceutical composition is administered to the subject within 20, within 30, within 60, or within 90 days of birth 29. A genetically modified mouse model comprising a mutation to the endogenous neurofilament light (N-FL) protein, wherein said mutation comprises a glutamic acid to lysine substitution corresponding to position 397 of SEQ ID NO: 14, or an allelic variant thereof.
30. The mouse model of claim 29, wherein the mutation is introduced by genome editing.PATENT APPLICATION Docket No. P14899WO00 31. The mouse model of claim 30, wherein the genome editing comprises introducing a Cas9 nuclease and a guide RNA targeting the NEFL gene.