An antifungal composition and its uses

Abstract

A fungicide comprising 2-Pyrrolidone-5-Carboxylic Acid.

Description

[0001] Title

[0002] An antifungal composition and its uses

[0003] Field of the Invention

[0004] This invention relates to an antifungal composition and its use in treating plants. Specifically, the invention relates to the use of 2-Pyrrolidone-5-carboxylic acid (2Py-5CA) as an antifungal and biofungicide.

[0005] Background to the Invention

[0006] Despite the use of chemical fungicides, global crop production suffers significant losses (23%) due to disease caused by fungal pathogens. This poses a major threat to food security. The United Nations Food and Agriculture Organization (FAO) estimates that growers must produce 70% more food by 2050 to meet the demands of the anticipated population increase. Initiatives such as the EU Green Deal and the Farm to Fork strategy aim to reduce pesticide use by 50% by 2030. Therefore, to achieve these ambitious targets, sustainable alternatives to chemical control is essential.

[0007] Cereal and horticultural crops are important food and feed crops. For example, barley (Hordeum vulgare), is the fourth largest cereal crop globally and is primarily used in the feed and brewing industry. However, barley is susceptible to fungal pathogens that can cause up to 30% yield losses and impair quality. The reliance on chemical fungicides not only raises concerns about resistance to crop pathogens but also has negative consequences for global food security. Ramularia collo-cygni (RCC), the causative agent of Ramularia leaf spot (RLS) in barley, leads to significant reductions in grain yield and quality by up to 70% across Europe and beyond. Whereas, net blotch caused by Pyrenophora teres can cause up to 40% barley losses. Barley grains are rich in dietary fibre, for example B-glucan and tocols, which are beneficial to human health provide protection against hypertension, cardiovascular disease, and diabetes. Wheat (Triticum aestivum L) is the most widely grown cereal crop globally. This staple crop, also faces disease threats for example, from Septoria tritici blotch (STB) which can reduce yields up to 50%. STB is caused by the fungal pathogen Zymoseptoria tritici. The main strategy for controlling RLS, STB and Net blotch is via chemical fungicide application, and this accounts for >70% of fungicide usage in the EU annually.

[0008] Spraying of barley and wheat crops with the following fungicides are typically performed throughout the growth season: Elatus™ Era (contains 75 g / l benzovindiflupyr and 150 g / l prothioconazole), Fandango® (contains prothioconazole and fluoxastrobin), Macfare® Xpro (contains bixafen, fluopyram, prothioconazole, and N,N-Dimethyl decanamide), Mandarin® Xpro (contains bixafen, prothioconazole, and N,N, -Dimethyl decanamide), Revystar® XL (contains fluxapyroxad and mefentrifluconazole), Variano® Xpro (contains bixafen, prothioconazole and fluoxastrobin), and Siltra® Xpro (contains bixafen, prothioconazole, and N,N, -dimethyl decanamide), or mixtures containing prothioconazole and a succinate dehydrogenase inhibitor (SDHI) or a strobilurin. However, control with fungicides is increasingly difficult due to rapid emergence of resistance in Ramularia collo-cygni. For example, Ramularia collo-cygni and Pyrenophora teres have developed resistance to prothioconazole quinone outside inhibitors (Qol), strobilurins, and demethylation and succinate dehydrogenase inhibitors (DMIs / SDHIs). Chlorothalonil has been banned by the European Food Safety Authority (EFSA) since 2020 due to concerns about environmental safety and health hazards. Given these challenges, there is a vital need to explore environmentally friendly alternatives to enhance crop production by controlling plant pathogens without yield loss.

[0009] Horticultural pathogens, such as Botrytis cinera Be) (also known as grey mould), can have a devastating effect on protein crops, fibre crops, oil crops, and horticultural crops. Horticultural crops most severely affected and devastated by Be include small fruit crops (examples are tomato, grape, gooseberry, strawberry, raspberry, and blackberry) and vegetables (examples are chickpeas, lettuce, broccoli, and beans). No fungicides are approved for use against grey mould by gardeners. Botrytis cinerea, also causes major postharvest losses in a wide range of fruit and vegetable crops. Such postharvest crop storage requires antifungal agents for example fumigation using sulfur dioxide to control post harvest decay, application of which can cause residues. One promising approach is the use of biological control agents, including microbes and their bioactive metabolites, as natural biofungicides.

[0010] It is an object of the present invention to overcome at least one of the above-mentioned problems.

[0011] Summary of the Invention

[0012] There is a growing need for new horticultural and cereal crop fungicides to tackle the growing number of fungicide-resistance diseases such as grey mould, RLS, STB and net blotch diseases. The rise of fungicide resistance in the RCC and P. teres pathogens underscores the critical demand for discovering alternative methods of control. Here an antifungal compound was identified from the culture filtrate of the endophytic fungi Penicillium oxalicum, which was previously isolated from wild barley, Hordeum secalinum. The culture filtrate of Penicillium oxalicum was found to reduce the symptoms of RLS in barley seedlings when applied by spraying. 2-Pyrolidione-5-Caroboxylic acid (2Py-5CA) was identified as an antifungal present in the culture filtrate using a metabolomic liquid chromatography with tandem mass spectrometry (LC-MS / MS) approach. Previously 2Py-5CA was reported as produced by Burkhloderia sp. and lactic acid bacteria, where it was shown to have inhibitory anti-oomycete and antibacterial effects. Here it has been demonstrated that 2Py-5CA, whether in synthetic form or present in the culture filtrate isolated from the endophytic fungi Penicillium oxalicum, has potent antifungal activity against a range of cereal pathogens (R. collo-cygni, Zymoseptoria tritici, Pyrenophora teres and Fusarium graminearum) and the grey mould pathogen (Botrytis cinerea), which attacks ~200 mainly dicotyledonous crop species, under in vitro conditions using plate assays. Induced morphological changes were observed in fungal hyphae and also in spore morphology using 2Py-5CA in vitro. Finally, in planta assays confirmed that the foliar application of 2Py-5CA effectively reduced RLS disease progression in barley. The antifungal metabolite of the claimed invention has the potential to act as an alternative control strategy for grey mould control in horticultural crops, STB and FHB in wheat and RLS and net blotch in cereal crops such as barley.

[0013] According to the description provided herein, there is provided, as set out in the appended claims, a fungicidal composition comprising 2-Pyrrolidone-5-Carboxylic Acid, or a derivative thereof, as an active ingredient.

[0014] In one aspect, there is provided fungicidal composition comprising 2-Pyrrolidone-5- Carboxylic Acid as an active ingredient, wherein the 2-Pyrrolidone-5-Carboxylic Acid is isolated from an endophyte characterised as being PenicilHum oxalicum or is synthetic. Preferably, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) defined by SEQ ID NOs: 3 and 4.

[0015] In one aspect, there is provided a fungicidal composition for use in treating a disease caused by a fungal infection affecting cereal crops and / or non-cereal crops, the composition comprising 2-Pyrrolidone-5-Carboxylic Acid, or a derivative thereof.

[0016] In one aspect, the disease is selected from grey mould, Ramularia Leaf Spot, Septoria tritici blotch, Fusarium Head Blight, net blotch, Fusarium wilt, basal rot and root rot, early blight, Black Rot, Black Spot, Cercospora leaf spot, Cercospora leaf blight, maize leaf blight, root rot, leaf spots, kernel infections and seedling blight, brown spot disease, tan spot, Anthracnose, blackleg disease, Septoria nodorum blotch, apple scab disease, Take-all, powdery mildew, Asian soybean rust, soybean rust, leaf / brown rust, stem rust, and yellow / stripe rust.

[0017] In one aspect, the fungal infection is caused by a fungus selected from R. collo-cygni (Ramularia Leaf Spot), Pyrenophora teres (net blotch), Fusarium graminearum (Fusarium Head Blight), Fusarium oxysporum (Fusarium wilt, basal rot and root rot), Zymoseptoria tritici (Septoria tritici blotch), Botrytis cinerea (Grey mould), Alternaria solan! (early blight), Alternaria alternata (Black Rot, Black Spot), Blumeria graminis (powdery mildew of grasses), Cercospora beticola (Cercospora leaf spot), Cercospora kikuchii (Cercospora leaf blight), Drechslera maydis (Maize leaf blight), Cochliobolus sativus (root rot, leaf spots, kernel infections and seedling blight), Cochliobolus miyabeanus (brown spot disease), Drechslera teres (net blotch), Drechslera tritici- repentis (tan spot), Elsinoe ampelina (Anthracnose), Gaeumannomyces tritici (Take-all), Leptosphaeria maculans (blackleg disease), Mycosphaerella graminicola (Septoria tritici blotch), Parastagonospora nodorum (Septoria nodorum blotch), Phakopsora pachyrhizi (Asian Soybean Rust), Phakopsora meibomiae (Soybean Rust), Puccinia coronata (crown rust), Puccinia horde!, (Leaf rust), Puccinia triticina (Leaf / Brown rust), Puccinia graminis (Stem Rust), Puccinia striiformis (Yellow / Stripe Rust), Stagonospora nodorum (Septoria nodorum blotch) and Venturia inaequalis (apple scab disease). Note that the fungal disease follows the fungus species in brackets.

[0018] In one aspect, the cereal is selected from barley (Hordeum vulgare), wheat (Triticum aestivum), oats Avena sativa), maize (Zea mays), rye (Secale cereaie), spelt (Triticum spelta), rice (Oryza sativa), millet (Panicum miliaceum, Eleusine coracana, Setaria italica, Pennisetum glaucum), sorghum (Sorghum bicolor), triticale (x Triticosecale), teff (Eragrostistef), fonio (Digitaria exilis), wild rice (Zizania spp.), and canary grass (Phalaris sp.).

[0019] In one aspect, the non-cereal crop is a horticultural crop. In one aspect, the horticultural crop is selected from tomato, grape, gooseberry, strawberry, raspberry, blackberry, loganberry, blackcurrant, redcurrant, grape, apple, banana, orange, lemon, lime, pear, plum, nectarine, cucurbits, cotton, coffee, potatoes, corn, soybeans, ornamental plants, sugar cane, sugar beet, oilseed rape, lettuce, chickpeas, broccoli, beans, asparagus, and other vegetable-bearing species.

[0020] In one aspect, the 2-Pyrrolidone-5-Carboxylic Acid, or derivative thereof, is isolated from an endophyte or is synthetic. In one aspect, the endophyte is characterised as being Penicillium oxalicum. Preferably, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) defined by SEQ ID NOs: 3 or 4.

[0021] In one aspect, the 2-Pyrrolidone-5-Carboxylic Acid, or derivative thereof, is a systemic fungicide.

[0022] In one aspect, there is provided a method for treating, inhibiting, and controlling plant fungal disease comprising contacting a plant with the fungicidal composition described above.

[0023] In one aspect, the fungicidal composition is applied to the foliage of the plant.

[0024] In one aspect, the fungicidal composition is applied to the plant’s root system either before, during, or after planting the plant in a growth medium.

[0025] In one aspect, the fungicidal composition is applied to a growth medium that the plant is contained in.

[0026] In one aspect, the fungicidal composition is applied to the plant, the growth medium, or the vicinity of the plant at a dose of about 0.25 kg to about 5.0 kg per hectare. For example, 0.25, 0.4, 0.5, 0.6, 0.75, 0.8, 0.9, 1.0, 1.25, 1.50, 1.65, 1.75, 1.80, 1.85, 1.90, 1.95, 2.0, 2.25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, or 5.0 kg / hectare, Preferably, the fungicidal composition is applied to the plant, the growth medium, or the vicinity of the plant at a dose of about 0.5, 1.0, 1.5, 1 .8 or 2.0 kg per hectare.

[0027] In one aspect, the fungicidal composition comprises between about 0.0005% (w / v) to 1% (w / v) of the active 2-Pyrrolidone-5-Carboxylic Acid, or a derivative thereof. Preferably, the fungicidal composition comprises between about 0.001% (w / v) to 0.1% (w / v) of the active 2-Pyrrolidone-5-Carboxylic Acid, or a derivative thereof. In one aspect, the 2-Pyrrolidone-5-Carboxylic Acid derivative is an acid halide, an anhydride, an ester, an amide, a thioester and / or an acylphosphate derivative.

[0028] In one aspect, the fungicidal composition is applied to fruit on, or harvested from, the plant.

[0029] In one aspect, the plant is a grass or a horticultural crop or plant.

[0030] In one aspect, the grass is a cereal crop selected from barley (Hordeum vulgare), wheat (Triticum aestivum), oats (Avena sativa), maize (Zea mays), rye (Secale cereale), spelt (Triticum spelta), rice (Oryza sativa), millet (Panicum miliaceum, Eleusine coracana, Setaria italica, Pennisetum glaucum), sorghum (Sorghum bicolor), triticale (x Triticosecale), teff (Eragrostis tef), fonio (Digitaria exilis), wild rice (Zizania spp.), and canary grass (Phalaris sp.).

[0031] In one aspect, the horticultural plant is a fruit-bearing plant that bears fruit selected from strawberry, raspberry, cherry, gooseberry, blackberry, cranberry, blueberry, loganberry, blackcurrant, redcurrant, fig, grape, apple, banana, orange, lemon, lime, pear, plum, nectarine, pomegranate, peach, and tomato.

[0032] In one aspect, the horticultural plant is selected from cotton, coffee, potatoes, peanut, corn, soybeans, rapeseed, sunflower, pepper, onion, leeks, carrot, eggplant, spinach, brassicas (e.g. broccoli, brussels sprouts, cabbage, cauliflower, collard greens, kale, and turnips), courgette, asparagus, ornamental plants (e.g. roses, petunias, dahlias (Dahlia spp.) and poinsettias), sugar cane, sugar beet, oilseed rape, lettuce, and vegetablebearing species (e.g., chickpeas, common bean, pea, lupine, faba bean, lentil, grass pea, cowpea, pigeon pea, beans and cucurbits (such as squash, pumpkin, melon, watermelon, courgette, cucumbers, some gourds) and medicinal plants (chamomile, geraniums, aloe vera, ginseng and mint), and herbs.

[0033] In one aspect, the fungicidal composition is advantageously suitable for controlling the following plant diseases:

[0034] ■ Alternaria species on vegetable species, oilseed rape, sugar beet and fruit and rice, such as, for example, A. solani or A. alternata on potatoes and tomatoes.

[0035] ■ Ascochyta species on cereals and vegetable species. ■ Bipolaris and Drechslera species on corn, cereals, rice and lawn, such as, for example, D. maydis on corn.

[0036] Blumeria graminis on grasses.

[0037] Botrytis cinerea (gray mold) on strawberries, vegetable species, flowers and grape-vines.

[0038] Cercospora species on corn, soybeans, rice and sugar beet.

[0039] Cochlibolus species on corn, cereals, rice, such as, for example, Cochliobolus sativus on cereals, Cochliobolus miyabeanus on rice.

[0040] Colletotricum species on soybeans and cotton.

[0041] Drechslera species, Pyrenophora species on corn, cereals, rice and lawn, such as, for example, D. teres on barley or D. tritici-repentis on wheat.

[0042] Elsinoe ampelina on grapevines.

[0043] Gaeumannomyces tritici on of the roots of wheat and other cereals.

[0044] Leptosphaeria maculans on oilseed rape.

[0045] Fusarium species on various plants, such as, for example, F. graminearum or F. culmorum on cereals or F. oxysporum on a large number of plants, such as, for example, tomatoes.

[0046] Gibberella species on cereals and rice (for example Gibberella fufikuroi on rice), Guignardia bidwelli on grapevines.

[0047] Helminthosporium species on corn and rice.

[0048] Isariopsis clavispora on grapevines.

[0049] Mycosphaerella species on cereals, bananas and peanuts, such as, for example, M. graminicola on wheat or M. fijiensis on bananas.

[0050] Parastagonospora nodorum on wheat.

[0051] Phakopsora pachyrhizi and Phakopsora meibomiae on legumes.

[0052] Puccinia coronata, Puccinia hordei, Puccinia triticina, Puccinia graminis, and Puccinia striiformis on cereals.

[0053] Pseudocercosporella spp. on cereals and banana.

[0054] Pyrenophora spp. on cereals.

[0055] Septoria tritici and Stagonospora nodorum on wheat.

[0056] Setospaeria species on corn and lawn.

[0057] Sphaerulina spp. on poplar.

[0058] Venturia species (scab) on apples and pears, such as, for example, V. inaequalis on apple.

[0059] Zymoseptoria spp. on wheat, cereals and grasses. Definitions

[0060] In the specification, the term “cereal crop” should be understood to mean a grass cultivated for its edible grain. They include rice, wheat, rye, oats, barley, sorghum, millet, and corn (maize).

[0061] In the specification, the term “non-cereal crop” should be understood to mean a horticultural crop or plant. Examples of horticultural crops are provided above.

[0062] In the specification, the term “ornamental plant” should be understood to mean plants that are primarily grown for their beauty but also for qualities such as scent or how they shape physical space, rather than for functional or other reasons. Examples include trees, shrubs, climbers, ornamental grasses, succulents, aquatic plants, herbaceous perennials and annual plants. Non-botanical classifications include houseplants, bedding plants, hedges, plants for cut flowers and foliage plants. Essentially, garden and indoor plants.

[0063] In the specification, the term “growth medium” should be understood to mean the medium in which a plant will grow. Examples of growth medium for plants include soil and compost. The term “fungal growth medium” should be understood to mean the medium on which a fungus will grow, for example, potato dextrose broth and potato dextrose agar.

[0064] In the specification, the term "systemic fungicide" refers to a fungicide that is absorbed by leaves and roots and transferred inward and upward from the plant through the xylem. The systemic fungicide can be a biofungicide or an antifungal agent (fungicide) that is typically synthesised.

[0065] In the specification, the term “antifungal” should be understood to mean to prevents fungal growth, while the term “biofungicide” should be understood to mean a natural compound from a living microorganism that protects against pathogenic fungi.

[0066] Brief Description of the Drawings

[0067] The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which:- FIG. 1 Phylogenetic placement of endophytes EF20, EF30 and EF65 in relation to known Penicillium spp. Phylogeny was reconstructed based on the ITS gene sequence using the Maximum Likelihood method with the PhyML programme under the GTR substitution model. Maximum Likelihood bootstrap support values are displayed above branches. Values >70% are considered significant. The tree was rooted with sequences from Aspergillus spp.

[0068] FIG. 2 illustrates direct confrontation assays on potato dextrose agar (PDA) between fungal endophytes Penicillium oxalicum Ef20, Ef30 and Ef65 against three fungal pathogens of barley, (a) PDA with the fungal pathogens (R. collo-cygni, P. teres and F. graminearum) with and without the endophytic fungi are shown after 7 days, (b) The percentage of P. teres and F. graminearum inhibition induced by each strain compared to the control; for R. collo-cygni the width of the zone of inhibition measured in diameter (mm). The data in the figure is mean ± SD; different letters represents statistical significant differences ( p < 0.001).

[0069] FIG. 3 illustrates the confrontation and interaction between fungal endophytic fungi with R.collo-cygni (RCC), P. teres (Pt), F. graminearum (Fg) on PDA. Light micrographs show (a) smooth hyphal growth (black full arrow, (a,e,i), new hyphal buds (dashed arrow, (a,e,i)) in the pathogen only (R. collo-cygni, P. teres and F. graminearum) panels (left). Hyphae of all the fungal pathogens (R. collo-cygni, P. teres and F. graminearum) are shrunken, and distorted where conidia of Ef30 are intertwined on the hyphae (arrowhead, (b,f,j) treated with endophytic fungal isolates. Scale bar = 100pm.

[0070] FIG. 4 illustrates the antifungal activity of culture filtrate (OF) of endophytic fungal isolates Ef20, Ef30 and Ef65 against R. collo-cygni (RCC). RCC growth on (a) PDA control, (b) OF of Ef30, (c) OF of Ef20, and (d) OF of Ef65. OF of Ef30 showed strong inhibition of RCC colonies, OF of Ef20 moderate inhibition and OF of Ef65 no inhibitory effect.

[0071] FIG. 5 illustrates the percentage of leaf area covered in spots associated with RLS symptoms; (a) at 21 dpi; (b) at 22 dpi and (c) 17 dpi. (c) Penicillium oxalicum Ef 30 culture filtrate (OF) protects barley plants from RLS disease symptoms at 21 days post infection (dpi) with R. collo-cygni or RCC + Ef30 CF.

[0072] FIG. 6 illustrates biocontrol efficacy of Ef30 aqueous extract against Ramularia collo cygni (RCC) in plate disc assay, (a) Inhibitory effect (clear zone) observed on the growth of RCC by Ef30 aqueous extract on a filter disc compared to (b) control with RCC only and (c) RCC growth in the presence of the Ef30 ethyl acetate phase on a filter disc.

[0073] FIG. 7 illustrates (a) Mass spectra of 5-Pyrollidone-2-carboxylic acid (2Py-5CA) and corresponding adducts detected in the endophytic fungal extract isolate Penicillium oxalicum Ef30. The detection was monitored at MS-ESI (+) spectroscopy at a probe temperature of 350 °C. The fragments of 2Py-5CA and standard matched with MELTIN database at 130.0526 m / z in positive mode, (b) 3D- structure retrieved from NCBI of 2Py- 5CA with a chemical formula of C5H7NO3, an exact mass of 129.0444, and a molecular weight of 129.11.

[0074] FIG. 8 illustrates the antifungal effect of 2Py-5CA on the growth of R. collo cygni (RCC) and Z. tritici. (a) PDA with 10 pg / ml-1-100 / zg / ml-1 of 2Py-5CA after 6 days of incubation, 0.5% DMSO served as a control, (b) Percent (%) surface area covered by growth of RCC and Z. tritici was measured using Imaged (https: / / imagej.net). The data in the figure is the mean ± SD; different letters represents statistical significant differences ( p < 0.001).

[0075] FIG. 9 illustrates the antifungal effect of 2Py-5CA on growth of F. graminearum, B. cinerea and P. teres, (a) PDA with 0.5% DMSO served as a control (top left), a reduction in fungal growth when treated with increasing concentrations (1 pg / ml-1-100 pg / ml ) of 2Py-5CA is observed, (b) Percent (%) inhibition of radial growth of mycelia of fungal pathogens of F. graminearum, B. cinerea and P. teres. The data in the figure was mean ± SD; different letters represents statistical significant differences one way ANOVA followed by Tukey’s tests oc= 0.05 and p < 0.001 .

[0076] FIG. 10 illustrates effects of 2Py-5CA on hyphae of R. collo-cygni, Z. tritici , F graminearum and P. teres. In the controls (0.5% DMSO) pathogen hyphae are undisrupted, smooth, (a-c) and have a high density of Z. tritici blastospores (d) (full black arrow); whereas the plate treated with 2Py-5CA (80 pg / ml-1) show hyphal deformation, swelling, conglobate structure and round projections of the hyphal tip (e-h) (dashed arrow head). Inset images showed bulging type morphology of hyphae (e, f, h) and broken macroconidia (g) suggesting a fungicidal mode of action. Scale bar= 100 and 50 pm.

[0077] FIG. 11 illustrates the toxicity of 2Py-5CA dosage on Fusarium graminearum (Fg) spores, (a) Macroconidia of Fg on 0.5% DMSO controls are elongated, smooth, uniform with a remarkable septa (b-e); a distorted morphology with tortuous growth, evident swelling and broken macroconidia was observed in Fg macroconidia treated with different at different dosage of 2Py-5CA (20 pg / ml-1 - 100 pg / ml-1).

[0078] FIG. 12 illustrates the reduction of Ramularia leaf spot (RLS) lesion severity (necrotic leaf area) on barley leaves treated with 2Py-5CA. (a) Relative % necrotic leaf area of barley plants pre-treated with pathogen RCC and 48 hrs, thereafter, treated with different doses (10 - 80 pg / ml-1) of 2Py-5CA. Necrotic symptoms were assessed from 8 dpi up to 21 dpi. DMSO 0.5% served as mock and DMSO (0.5%) with RCC as a positive control. Different letters (a-f) indicate significant differences among different treatments one way ANOVA followed by Tukey’s tests oc= o.O5 and p < 0.001 compared to mock. Two independent experiment with two replications, (b) Images of RLS disease reduction after post treatment with 2Py-5CA dosage at 10 - 80 pg / ml-1. Pretreatment with RCC 48 hours prior to 2Py-5CA, mock inoculation with DMS0 (0.5%) as negative control and DMS0 (0.5%) with RCC as a positive control.

[0079] Detailed Description of the Drawings

[0080] Materials and Methods

[0081] Endophytic Fungal isolates.

[0082] Using an in vitro confrontation assay 64 fungal endophytes were screened for inhibition of R. collo-cygni growth. Two isolates showed strong inhibition against R. collo-cygni (Ef20 and Ef30) and one inhibited R. collo-cygni moderately (Ef65). The endophytic fungal isolates were grown on potato dextrose agar (PDA). All petri dishes with the endophytic fungal isolates were incubated at 24°C for 7 days and further sub-cultured under the same conditions. Then, the fresh-grown culture from the edge of each endophytic fungal isolate was grown in 100 mL of potato dextrose broth (PDB) and incubated on a rotatory shaker for 4 days at 150rpm, 24°C. Stocks of endophytic fungal isolates were preserved in 50% v / v glycerol and stored at -80°C.

[0083] Fungal Pathogen Isolates

[0084] Fungal pathogens used in this study; Ramularia collo-cygni from Stephen Kildea, Teagasc, Crops Research Centre, Oak Park, Carlow. Pyrenophora teres and Botrytis cinerea from the School of Natural Sciences and Trinity Centre for Biodiversity Research, Trinity College Dublin. Fusarium graminearum from Fiona Doohan UCD School of Biology and Environmental Science, University College Dublin. Zymoseptoria tritici. These phytopathogens were used for assessing the antifungal ability of endophytic fungal isolates and the 2Py-5CA metabolite isolated from Penicillium oxalicum Ef20 and Ef30. The fungal pathogens were grown on PDA fungal growth medium. The petri dishes were incubated at 21 °C for R. collo-cygni or Z.tritici, and for F. graminearum, B. cinerea, and P. teres for 7 days at 24°C. The fungal mycelia were aseptically inoculated into potato dextrose broth (PDB) and were incubated at 21 °C and 24°C at 150 rpm for 4 days. The stocks of the fungal pathogens were maintained in glycerol 50% (v / v) and stored at -80°C. DNA Extraction

[0085] To identify endophytic fungi at the genus level, the internal transcribed spacer (ITS) regions of the rDNA were analyzed. Endophytic fungal isolates were cultured on Potato Dextrose Broth (PDB; Himedia) at 24°C for 3 days. Genomic DNA was extracted from these isolates using the DNeasy PowerSoil Pro Kit (QIAGEN) following the manufacturer's protocol. The quality and quantity of the extracted DNA were assessed using a NanoDrop spectrophotometer.

[0086] ITS & Phylogenetic analysis.

[0087] The ITS regions were amplified using the ITS1 (SEQ ID NO. 1 5’-TCCGTAGGTGAAC- 3’) and ITS4 (SEQ ID NO. 2 5’-TCCTCCGCTTATTGATATGC-3’) primers in a ProFlex PCR System (Applied Biosystems). The PCR conditions were as follows: initial denaturation at 95°C for 2 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 4 minutes, and a final extension at 72°C for 4 minutes. The PCR products were visualized on a 0.8% agarose gel and further purified using the QIAquick Gel Extraction Kit (QIAGEN) prior to sequencing by Macrogen, Europe. The forward and reverse sequences were aligned using the BioEdit Sequence Alignment Editor. The assembled consensus sequences were subjected to Nucleotide BLAST for comparison with sequences in the GenBank database. Multiple sequence alignments were performed using Clustal W. Phylogeny was reconstructed based on the ITS gene sequence using the Maximum Likelihood method with the PhyML programme under the General Time Reversible (GTR) substitution model. The tree was rooted with sequences from Aspergillus.

[0088] In vitro confrontation dual plate against fungal pathogens

[0089] The antifungal activity of selected endophytic fungal isolates was evaluated against the barley phytopathogens Ramularia collo-cygni, Pyrenophora teres, and Fusarium graminearum. To conduct the antifungal bioassays, the confrontation dual culture method was used on petri dishes containing PDA. Fungal plugs (5 mm) of the actively growing pathogens and agar plugs (2 mm) of the endophytic fungi were placed 3 cm apart from each other. All petri dishes were incubated in the dark at 24°C for 7 days. Control plates contained only the fungal pathogens. Following 7 days of incubation for R. collo-cygni and 3 days for F. graminearum and P. teres, the progression of fungal growth was measured. The experiment was repeated three times with three replicates each time. Growth inhibition of the fungal pathogen was calculated using the formula:

[0090] % Mycelium inhibition = (C - T) / C * 100 (Eq. 1) where ‘C’ is the radial growth of the test pathogens in the control petri dish (mm), and T is radial growth of the test pathogen in the treatment petri dish (with endophytic fungi).

[0091] Light Microscopic

[0092] Interactions between endophytic fungal isolates and fungal pathogens (R. collo-cygni, Zymoseptoria tritici, F. graminearum and P. teres) were observed using light microscopy. To investigate the interactions between endophytic fungal isolates and fungal pathogens, samples were collected from the inhibition zone periphery, placed onto sterile glass coverslips, and stained with lactophenol cotton blue (Sigma-Aldrich). The stained hyphae were then observed under a light microscope (Leica microsystem).

[0093] RLS disease assay

[0094] Barley (Hordeum vulgare) seeds cv. Planet were sown directly into plastic pots with John Innes Compost No.2 potting soil from Westland Horticulture, UK. The growth chamber was set to a 16 / 8 h light / dark photoperiod, with relative humidity maintained at 80-100% and a temperature of 20°C to create optimal fungal growth conditions. To assess the biocontrol efficacy of the pure compound 2-Pyrrolidone-5-carboxylic acid (2Py-5CA) and P. oxalicum (Ef30) culture filtrate against Ramularia collo-cygni (RCC) in planta, a foliar spray application was employed.

[0095] Fourteen-day-old barley seedlings were inoculated by spraying barley seedlings at GS12 with 5 mL of an R. collo-cygni spore suspension. The fungal hyphae of R. collo-cygni cultured in potato dextrose broth (PDB) were centrifuged (4000 rpm, 21°C, 5 minutes), washed, filtered using J-cloth, resuspended in distilled water (ddH2O), and sonicated. 5 mL of the resulting R. collo-cygni suspension was applied to each plant until runoff using hand-held spray bottles. Immediately after inoculation, plants were covered with transparent plastic bags to maintain high relative humidity (80-100%) for 48 hours. After 48 hours, the bags were removed following by treatment with culture filtrate or 2Py-5CA. Disease scoring was performed on the second leaf by recording the relative area covered by spots (black, brown spots, and necrotic lesions) to evaluate the treatment effects. Scoring was conducted at multiple time points post-infection (8, 10, 13, 15, 17, and 21 days post-inoculation [dpi]). Disease severity (DS) was assessed using a visual 5-level scale: 0 = no visible symptoms; 1 = <10% of leaf area infected (necrotic lesions and chlorosis present); 2 = >10%- <2 5% infected area; 3 = >25%-<50% infected area; 4 = >50%-<75% infected area; and 5 = >75%-100% infected area. Three independent experiments were conducted, each with two replicates per treatment, and 10 leaves from individual seedlings were assessed per replicate.

[0096] Application of culture filtrate of P. oxalicum Ef30

[0097] Fourteen-day old barley were spray-inoculated with the R.collo-cygni suspension until run-off. Control plants were sprayed with water and Tween® 20 solution (1 pl / ml). After spraying, plants were covered with clear plastic bags to maintain high relative humidity (80 to 100%) for 48 h. After 48 h the bags were removed, and plants were sprayed with the culture filtrate of P. oxalicum Ef30 supplemented with Tween® 20 (1 pl / ml) until runoff.

[0098] Application of foliar spray of pure compound 2Py-5CA

[0099] After R.collo-cygni inoculation and the removal of plastic bags after 48 hours the barley plants were sprayed with varying concentrations of 2Py-5CA (10 pg / mL, 20 pg / mL, 40 pg / mL, and 80 pg / mL). Control plants were sprayed with the same volume of a 0.5% DMSO solution

[0100] Discovery of antifungal metabolites in culture filtrate of endophytic fungi Penicillium oxalicum Ef30

[0101] Evaluation of antifungal activity in culture filtrate of P. oxalicum Ef30

[0102] Penicillium oxalicum Ef30, which exhibited strong inhibitory activity against Ramularia collo-cygni, Pyrenophora teres, and Fusarium graminearum in dual culture assays, was cultured in PDB on an incubator shaker at 150 rpm and 24°C for 7 days. After incubation, the culture was centrifuged at 4000 rpm for 10 minutes at 21°C, and the fungal mycelia were discarded. The resulting culture filtrate was pooled and tested for its ability to inhibit the growth of R. collo-cygni in vitro.

[0103] Fermentation and metabolite extraction from P. oxalicum Ef30.

[0104] The P. oxalicum Ef30 strain was grown using liquid shake flask fermentation. For metabolite extraction, P. oxalicum Ef30 was inoculated into PDB and incubated for 7 days at 150 rpm and 24°C in a rotary shaker. After incubation, the fungal mycelium mat, contained within a cellophane layer, was discarded, and the remaining culture filtrate was extracted with an equal volume of ethyl acetate (1 :1). This process resulted in two layers: the upper organic phase (ethyl acetate) and the lower aqueous phase. Each phase was collected separately into individual falcon tubes and lyophilized. Post-lyophilization, the ethyl acetate phase was resuspended in 2 mL of methanol, and the aqueous phase was resuspended in 2 mL of sterile deionized water. Both extracts were then evaluated for their antifungal activity against R. collo-cygni.

[0105] Antifungal agar disc diffusion assays

[0106] The antifungal activity of the ethyl acetate and aqueous extracts were assessed using a disc diffusion assay. The R. collo-cygni culture was grown on a rotatory shaker for 7 days at 21 °C, 150 rpm in potato dextrose broth. 100 pl of R. collo-cygni inoculum was spread evenly with the help of a spreader on the PDA plates and allowed to dry for 5 minutes. The ethyl acetate phase was resuspended in methanol (based on solubility) and the aqueous phase re-suspended in sterile deionized water. Each extract (50 pl) were applied to a filter disc to evaluate antifungal activity. The discs were applied to the R. collo-cygni inoculated plates and were assessed for any clearing / inhibition of R. collo- cygni growth around the disc. Each assay in these experiments was repeated three times with three plates per replication.

[0107] Metabolomics (LC-MS / MS) based identification of bioactive compounds present in the aqueous extract.

[0108] Samples of endophytic fungal isolates (P. oxalicum Ef20, P. oxalicum Ef30, P. virgatum Ef65 and Talaromyces verculosis Ef39 as negative control) were dissolved in methanol, centrifuged at 1800 g for 5 mins, and filtered through a 0.22-pm filter. Compound analysis was conducted on an Agilent LC-QTOF-MS, which consists of a 1290 Infinity II LC system and an Agilent Jetstream Electrospray Ionization (ESI) source coupled to a 6545 QTOF mass spectrometer. Liquid chromatography was performed on a Zorbax eclipse plus C18 column (2.1 x 50 mm, 1.8 pm) coupled to a Zorbax eclipse plus C18 guard column (2.1 x 5 mm, 1.8 pm). The column temperature was set at 30°C, and the injection volume was 5 pL. The mobile phase A was water and B was 80% of acetonitrile, both with 0.1% formic acid. The flow rate was 0.4 mL / min, and gradient conditions were set as follows: 1% B (0-1.5 min), 11% B (1.5-9 min), 25% B (9-15 min), 50% B (15-18 min), 99% B (18-18.05min), 99% B (18.05-21 min), 1% B (21-21.05 min) and 1% B (21.05- 23 min). The MS parameters used for the analysis: drying gas temperature, 325°C; drying gas flow rate, 10 L / min; sheath gas temperature, 350°C; sheath gas flow rate,11 L / min; nebulizer pressure, 45 gauge pressure (pounds per square inch); capillary voltage, 3500 V; nozzle voltage, 1000 V; fragmentor voltage, 100 V; skimmer, 45 V. The mass-to-charge ratio (m / z) range was between 50 and 1600. Samples were run in both positive and negative ionization modes. MSI data was generated by Agilent Mass Hunter qualitative analysis software. Metabolomics Data Processing

[0109] In this study, data was acquired using MassHunter acquisition B.08.00 software (B.08.00.8058.3 SplAgilent Technologies) and was further processed in MassHunter qualitative analysis software (B.07.00 Sp2 Agilent Technologies). Molecular features were extracted using the molecular feature extractor (MFE) algorithm, and a list of features was generated with retention time, m / z, adducts or isotopes of compounds, signal intensity and accurate mass. MS / MS compound identification efforts included the fragment matches with the Human Metabolome Database (HMDB) and METLIN. Furthermore, the first 18 interesting features with high variable importance of projection (VIP) scores were generated. The exported data from Mass Profiler were analysed in SIMCA-P software (version 13.0.3; Umetrics) to calculate the retention time, m / z value, molecular mass and generate a list of compounds. Compounds were compared between the endophytic fungi P. oxalicum Ef20, P. oxalicum Ef30, both of which inhibit R. collo- cygni growth, P. virgatum Ef65 which moderately inhibits R. collo-cygni, and Talaromyces verculosis Ef39 which acts as a negative control. Eighteen shared compounds present in the aqueous fraction of Ef20 and Ef30 using LC-MS / MS were identified (see Table 1). Five of these, commercially available (see Table 2) were tested for inhibition of R. collo-cygni in vitro.

[0110] Inhibition of fungal pathogen mycelial diameter by 2Py-5CA

[0111] Different concentrations (10, 20, 40, 80 and 100 pg / ml-1) of 2Py-5CA were dissolved in DMSO 0.5% to prepare a stock solution. 1 ml of each concentration of the compound was added onto the potato dextrose plate (PDA). Activity was assessed against the fungal pathogens Ramularia collo-cygni, Pyrenophora teres, Fusarium graminearum, Zymoseptoria tritici and Botrytis cinerea.

[0112] 100 pl of R. collo-cygni culture and 5 x 10-6blastospores spore suspension of Z. tritici was spotted onto a PDA plate and spread evenly and the plates were allowed to stand for 10-15 minutes. For other fungal pathogens, a mycelial plug (5 mm), from the perimeter of a six-day-old actively expanding colony of P. teres, F. graminearum and B. cinerea was placed on the centre of the PDA plate. The fungal culture medium with DMSO 0.5% was used as a control. Plates were incubated at 21 °C for 5-7 days for the growth of R. collo-cygni and Z. tritici and for P. teres, F. graminearum and B. cinerea plates were incubated at 24°C for 3 days. The growth of the R. collo-cygni and Z. tritici colonies was observed to evaluate the effects of different dosages of the compound. By monitoring the percent radial growth of fungal pathogen (P. teres, F. graminearum and B. cinerea) hyphae on plates with 2Py-5CA (10, 20, 40, 80, and 100 pg / ml-1) and control (DMSO 0.5%), the percentage radial growth inhibition (PRGI%) was recorded. The experiment was repeated three times independently with three replications. The PRGI% was calculated as:

[0113] Percent radial growth inhibition of the hyphal diameter (PRGI%) = (hyphal growth diameter of the control group - hyphal growth diameter of the treatment group) / (hyphal growth diameter of the control group) * 100%. (Eq, 2)

[0114] Statistical Analysis

[0115] All statistical analyses were performed using GraphPad Prism software (Version 8). Data are expressed as mean ± SD. Statistical significance was calculated using a one-way analysis of variance, followed by Tukey’s multiple tests. A p-value of <0.05 was considered statistically significant.

[0116] Results

[0117] Screening endophytic fungi against Ramularia collo cyqni (RCC)

[0118] Using an in vitro confrontation assay 64 fungal endophytes were screened for inhibition of R. collo-cygni growth. These were from a previous endophyte collection ((a) Murphy, B.R., Doohan, F.M. and Hodkinson, T.R., 2018. From concept to commerce: developing a successful fungal endophyte inoculant for agricultural crops. Journal of Fungi, 4(1), p.24.; and (b) Murphy, B.R., Jadwiszczak, M.J., Soldi, E. and Hodkinson, T.R., 2018. Endophytes from the crop wild relative Hordeum secalinum L. improve agronomic traits in unstressed and salt-stressed barley. Cogent Food & Agriculture, 4(1), p.1549195). Ten isolates that showed strong inhibition of R. collo-cygni were identified. Two which inhibit R. collo-cygni strongly (Ef20 & Ef30) were selected for further characterisation together with one which showed weak inhibition of R. collo-cygni growth (Ef65).

[0119] Morphological and molecular identification of endophytic fungi

[0120] After 7 days of growth at 28°C on potato dextrose agar (PDA), the colony morphology of the three selected endophytic fungal isolates were investigated using light microscopy. Microscopic observation of fungal isolates Ef20, Ef30 and Ef65 revealed oval shaped conidia, conidiophore, and hyphae. To identify the endophytic fungi Ef20, Ef30 and Ef65 ribosomal internal transcribed spacer (ITS) sequencing (using ITS1 forward (SEQ ID NO. 1) and ITS4 reverse (SEQ ID NO. 2) primers) was performed. Phylogeny was reconstructed based on the ITS gene sequence using the Maximum Likelihood method with the PhyML programme under the General Time Reversible (GTR) substitution model. The tree was rooted with sequences from Aspergillus. All the sequences retrieved from the NCBI GenBank database were aligned through “Cluster W” using MEGA 11 software. The phylogenetic analysis sequence comparison of Ef20 and Ef30 isolates indicates these isolates are Penicillium oxalicum while Ef65 shares similarity with P. virgatum (Figure 1).

[0121] The ITS nucleotide sequences of the endophytic fungal isolates of Ef20, Ef30 and Ef65 are as follows:

[0122] Ef20 (SEQ ID NO. 3) ACTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCCACCCGTGTTTAT CGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCATCCGCCCCCGGGCCC GCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGATTGCAGTCTGAGTACTTGACTA AATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAA ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGC GCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTT GTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCG CGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCC GGCGAACACCATCAATCTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT AAGCATATCAAT

[0123] Ef30 (SEQ ID NO. 4) CCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGG GGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACACAAACGAACTCTTGTCTGAAGA TTGCAGTCTGAGTACTTGACTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGGAATCATC GAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCAT TGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCTCGCCCCCCGCTTCCGGGGGCGGGCCCG AAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTA GGCCCGGCCGGCGCCCGCCGGCGAACACCATCAATC

[0124] >Ef65 (SEQ ID NO. 5) - control TGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCCACCCATGTTTATTG TACCTTGTTGCTTCGGCGGGCCCGCCTTTGTGGCCGCCGGGGGGTTCTGCCCCCGGGCCCGC GCCCGCCGAAGACACCTAGAACTCTGTCTGAAGATTGCAGTCTGAGTGAAAATATAAATTAT TTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGA TACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATGGCCCTCTG GTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGCTTGTGTGTTGG GCCCCGTCCTCCGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCC TCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAA ACTTTT

[0125] Confrontation assay of the endophytic fungal isolates in dual culture against fungal phytopathogens.

[0126] The antagonistic potential of the three selected endophytic fungal isolates (P. oxalicum Ef20 and Ef30, and P. virgatum Ef65) were tested against phytopathogenic fungi of barley (R. collo-cygni), Pyrenophora teres (P. teres) and Fusarium graminearum (F. graminearum). Ef30 was found to have a strong inhibitory effect against R. collo-cygni growth with an inhibition zone of 27 ± 1.47 mm which as significantly higher inhibition than with Ef20 (20 ± 1 .70 mm), and Ef65 (3.00 ± 0.58 mm). Further, Ef30 showed strong radial mycelia inhibition of P. teres (79 ± 1.57 %) and F. graminearum (57.14 ± 1.65 %) which was significantly higher than the radial growth inhibition with Ef20 against P. teres (72 ± 1 .73 %) and F graminearum (52.10 ± 0.89 %). Both Ef20 and Ef30 had significantly higher inhibition of radial growth compared to Ef65 for P. teres (40.0 ± 1 .65 %) and F. graminearum (39.5 ± 1.37 %) (Figure 2).

[0127] Interaction pattern between endophytic fungi (Ef20, Ef30 and Ef65) and fungal pathogens of barley.

[0128] To study the interaction pattern between the endophytic fungi Ef20, Ef30 and Ef 65 and the fungal pathogens of barley, samples were taken from the boundary zone of inhibition (area around the fungi in which the hyphae do not grow). In the control plates without the endophytic fungi (Ef20, Ef30 or Ef65) the hyphae of R. collo-cygni , P teres and F graminearum were smooth, undisrupted, uniform and arising from new hyphal buds (Figure 3. On the contrary, the hyphae of R. collo-cygni, P. teres and F graminearum near the inhibition zone underwent several morphological changes. Microscopic examination indicated irregular, swollen distorted, shrivelled and deformed hyphae (Figure 3) in the presence of endophytic fungal isolates. Also, the conidia of Ef30 and Ef20 covered the fungal hyphae of P. teres and F graminearum thereby limiting the growth of hyphae (Figure 3).

[0129] Antifungal metabolites are present in the culture filtrate of the endophytic fungal isolates Ef20, Ef30 and Ef65

[0130] The endophytic fungal isolates were grown in potato dextrose broth for 7 days followed by centrifugation to remove the fungal biomass. The culture filtrate was collected and filtered aseptically through a 0.45 pm pore size membrane filter. The resulting culture filtrate obtained from endophytic fungal isolates was tested for antifungal activity via the ability to inhibit growth of R. collo-cygni in vitro. R. collo-cygni growth was significantly inhibited by the culture filtrate of Penicillium oxalicum Ef30, moderately by Ef20, while no inhibitory effect was found with P. virgatum Ef65 (Figure 4).

[0131] The endophyte culture filtrate can protect barley plants from RLS symptoms under controlled growth conditions.

[0132] Based on strong inhibitory effect of the culture filtrate against the various fungal pathogens of barley using in vitro assays the potential to inhibit Ramularia Leaf Spot in planta caused by the fungal pathogen R. collo-cygni was investigated. Barley seedlings were inoculated with R. collo-cygni and after 48 hrs subsequently sprayed with the culture filtrate of P. oxalicum Ef30. The following conditions were tested: (i) R. collo-cygni infected only (ii) R. collo-cygni + culture filtrate, (iii) culture filtrate only, (iv) negative control (Tween®). Barley seedlings that had not been sprayed with the culture filtrate (condition (i)) had significantly higher Ramularia leaf spot (RLS) disease symptoms than barley plants sprayed with the culture filtrate (condition (ii)) (P<0.05). On average, the culture filtrate resulted in 40-70% decrease of RLS disease symptoms (Figure 5). By comparison, plants that were not inoculated with R. collo-cygni did not exhibit disease symptoms. These results indicate that spraying with the endophyte culture filtrate protects barley plants from RLS disease symptoms.

[0133] Extraction of antifungal compound from endophyte culture filtrates.

[0134] P. oxalicum Ef20 and Ef30, P. virgatum Ef65 and a control endophyte isolate Ef39 which exhibited no inhibition of R. collo-cygni in the disc assay were grown in potato dextrose broth for 7 days. The fungal mycelium was discarded and the remaining culture filtrate was extracted using an equal volume of ethyl acetate (1 :1). The organic phase (ethyl acetate upper phase) and water extract (lower phase) were separated and lyophilized. The ethyl acetate phase was resuspended in methanol (based on solubility) and the aqueous phase re-suspended in sterile deionised water. Both the ethyl-acetate and aqueous extract were evaluated for antifungal activity against R. collo-cygni. Only the aqueous phase of Ef30 on a filter disc demonstrated antifungal activity against R. collo- cygni (Figure 6). The ethyl acetate and aqueous extract of endophytic fungus Ef39 was used as a negative control, as it does not show any inhibitory effect against R. collo- cygni. Metabolomics (LC-MS / MS) based identification of bioactive compounds present in the aqueous phase

[0135] A metabolomic approach using LC-MS / MS was performed to elucidate the composition of the active antifungal compounds present in the aqueous extract of P oxalicum Ef30 and Ef20 by comparison with Ef39 and Ef65.ln the current study, LC-MS / MS based approach was carried out to identify secondary metabolites present in the aqueous extract of the culture filtrates from Ef20, Ef30, Ef39 and Ef65. The water extract of culture filtrate was analysed using LC-MS / MS in both the negative and positive mode of ionization of the mass spectrometer. A list of metabolites was generated and compound mass compared to the MELTIN database for each culture filtrate. Based on the content mass and the retention time, eighteen metabolites were identified in the aqueous phase as shared by Ef20 and Ef30 that were not present in Ef65 and Ef39 (Table 1).

[0136] Table 1. Aqueous fraction shared compounds identified between Ef20 & Ef30 that inhibit Rcc growth

[0137] 2-Pyrrolidone-5-carboxylic acid, 3-Methyl-2-oxovaleric acid, L,L-Cyclo(leucylprolyl), Mevalonolactone, and Pyridoxine were identified as possible antifungal agents. These five secondary metabolites were evaluated for their antifungal efficacy against R collo- cygni in vitro. Only 2Py-5CA had a strong inhibitory effect against R. collo-cygni (Table 2).

[0138] Table 2. Aqueous fraction metabolites from Ef20 & Ef30 tested against fungal pathogens

[0139] Further, by comparing the mass spectra with the MS spectral database (MELTIN database), the chemical compound was confirmed as 2Py-5CA based on the data of molecular formula, exact molecular mass, and the retention time (Figure 7). The 2Py- 5CA (tR= 1.14) displayed molecular ion [M+] protonated molecule [M+H]+at m / z 80.04 and 130.05, respectively. Pyrolodione-5-Carboxylic acid (2Py-5CA) inhibits fungal pathogen growth (Ramularia collo-cygni, Pyrenophora teres. Fusarium graminearum, Zymoseptoria trifid and Botrytis cinerea).

[0140] Different concentrations (10, 20, 40, 80 and 100 pg / ml-1) of compound 2Py-5CA were investigated by adding each concentration to PDA. R. collo-cygni culture (100 pl) and blastospore suspension of Z. tritici (5 x 10-6) were spread evenly and both cultured for 7 days. The culture medium with DMSO 0.5% was used as a control. The percent surface area covered by R. collo-cygni grown on 20 pg / ml-12Py-5CA was 36.61 ± 3.10 % compared to 19.92 ± 3.42 % when grown on 80 pg / ml-12Py-5CA (Figure 8). Following inoculation of Z. tritici on 2Py-5CA (20 pg / ml-1) the surface area covered by Z. tritici was 43.48 ± 3.23 % compared to 26.64 ± 2.93 % on 80 pg / ml-12Py-5CA (Figure 8).

[0141] The impact of 2Py-5CA on the hyphal growth of the pathogens F. graminearum, P. teres and 8. cinerea at different concentrations (10 - 100 pg / ml- 1) was also examined compared to 0.5% DMSO as a control. The results are shown as the percentage radial growth inhibition (PRGI) of the pathogen cultured on PDA. A mycelial plug (5 mm), from the perimeter of a six day old actively expanding colony of P. teres, F. graminearum and Botrytis cinerea was placed on the centre of the PDA plate. All the petri dishes were incubated for 3-7 days at 28°C. The results show that 2Py-5CA inhibited the hyphal growth of the phytopathogens F. graminearum, P. teres and B. cinerea by reducing the radial hyphal diameter. At 20 pg / ml-1, the inhibition of radial growth for F. graminearum was 31 ± 1.99 %, compared to a maximum inhibition of growth of 56 ± 2.00 % at 80 pg / ml-1(Figure 9). For the fungal pathogen P. teres, 2Py-5CA showed an antifungal effect at 1 pg / ml-1, where the inhibition of hyphal growth was 22 ± 1.00 %, whereas 76.3 ± 1 .53 % inhibition of hyphal growth was found for 2Py-5CA at 20 pg / ml-1(Figure 9).

[0142] The impact of 2Py-5CA on the hyphal growth of the pathogen Botrytis cinerea (infects soft fruit e.g. strawberry and raspberries) at different concentrations (10 - 100 pg / ml-1) was also examined. The results are shown as the percentage inhibition in radial growth (PIRG) of the pathogen cultured on PDA with different doses of the compound (2Py- 5CA). Similarly, Botrytis cinerea radial mycelial growth was inhibited on 20 pg / ml-1and 80 pg / ml-12Py-5CA by 23.31 ± 1.13 % and 46.65 ± 1.92 %, respectively, compared to the 0.5% DMSO control (Figure 9).

[0143] These results demonstrate a broad spectrum biofungicidal nature of 2Py-5CA which is produced by P. oxalicum Ef30 to combat fungal pathogens. Morphological alterations of hyphae and spores of fungal pathogens caused by antifungal 2Py-5CA in vitro

[0144] Light microscopy was used to visualize the impact of 2Py-5CA on the morphology of R. collo-cygni, P. teres, Z. tritici, and F. graminearum. 2Py-5CAwas responsible for aberrant morphological changes and induced morphological anomalies of the pathogenic fungal hyphae and spores. The hyphae in the untreated control group have a regular length, smooth surface and have the Z. tritici have a high density of blastospores (Figure 10). By contrast, the fungal pathogen mycelia treated with metabolite 2Py-5CA are associated with deformed, expanded and disintegrated hyphae, the ends of the mycelia were swollen, with round hyphal tips and conglobate structureswhich are possibly chlamydospores (Figure 10). Furthermore, deformation of F. graminearum macroconidia morphology, bending, tortuous growth and evident swelling following treatments with 2Py-5CA were observed, whereas in control untreated plates smooth, uniform and remarkable septa was observed in macroconidia (Figure 11). Thus, 2Py-5CA changes the morphology of hyphae and spores thereby impeding the growth of the fungal pathogens tested in vitro.

[0145] Biocontrol efficacy of barley plants from RLS symptoms by 2-Pyroldione-5-carboxylic acid (2PV-5CA).

[0146] The biocontrol efficacy of 2Py-5CA against Ramularia Leaf Spot (RLS) was investigated in planta. Barley seedlings were sprayed with a R. collo-cygni suspension and then with different concentrations of 2Py-5CA (10 pg / ml-1, 20 pg / ml-1, 40 pg / ml-1, and 80 pg / ml-1) 48 hours post infection (hpi). In parallel, for the control, barley plants were sprayed with the same DMSO (0.5%) solution. Disease scoring was performed on the second leaf recording the relative area of the leaf covered in symptoms up until 22 days post infection (dpi). The disease severity (DS) was estimated on the basis of a visual 5-level scale from 1 (no disease) to 5 (serious disease).

[0147] The control barley plants sprayed with 0.5% DMSO had significantly higher RLS disease symptoms than plants sprayed with 2Py-5CA. According to the results, plants sprayed with the 2Py-5CA compound could reduce the severity of RLS symptoms. The results indicate that spraying barley with 2Py-5CA at a moderate concentration (20 pg / ml-1) can protect the plants from RLS symptoms (Figure 12). At 80 pg / ml-12Py-5CA, the results showed a high severity of RLS symptoms of 74.6%. In contrast, at the moderate concentration of 20 pg / ml-12Py-5CA, leaves had a significant reduction of RLS symptoms (50.6%) compared to the control R. collo-cygni infection with 0.5% DMSO alone (99.6%) (Figure 12). In planta assays suggest that moderate concentration of 2Py- 5CA is effective at reducing RLS in barley. In this study, an antifungal was identified from the endophytic fungi P oxalicum Ef20 and Ef30, which could be used as a biofungicide.

[0148] DISCUSSION

[0149] Endophytic fungal isolates exhibit resistance mechanisms against host pathogenic fungi. As shown herein, P. oxalicum Ef20 and P. oxalicum Ef30 were found to be antifungal against phytopathogens of barley including R. collo-cygni, Pyrenophora teres and Fusarium graminearum in vitro and to a lesser extent P. virgatum Ef65 was also antifungal.

[0150] The Applicant has identified a novel acidic antifungal compound, isolated for the first time from Penicillium oxalicum, which exhibits a broad spectrum of antifungal activity and inhibits hyphal morphology. This compound demonstrated efficacy against a range of cereal pathogens Ramularia collo-cygni, Fusarium graminearum, Zymoseptoria tritici, and the horticultural pathogen Botrytis cinerea in vitro. Through a metabolomics-based approach, 2Py-5CA was identified which exhibited strong antifungal effects against all tested fungal pathogens in vitro.

[0151] The results of the in planta assay confirmed that treating barley plants with a moderate concentration (20 pg / ml-1) of 2PY-5CA can reduce the progression of Ramularia leaf spot under controlled conditions compared to the plants treated with the control (DMSO 0.5%). Therefore, 2PY-5CA inhibits the devastating fungal pathogen Ramularia collo- cygni, the causal organism of Ramularia leaf spot in barley. Consequently, 2Py-5CA shows promise as a candidate for the development of novel biofungicides in the future.

[0152] In the specification the terms "comprise, comprises, comprised and comprising" or any variation thereof and the terms “include, includes, included and including" or any variation thereof are considered to be totally interchangeable and they should all be afforded the widest possible interpretation and vice versa.

[0153] The invention is not limited to the embodiments hereinbefore described but may be varied in both construction and detail.

Claims

27Claims1. A fungicidal composition comprising 2-Pyrrolidone-5-Carboxylic Acid as an active ingredient.

2. A fungicidal composition for use in treating a disease caused by a fungal infection affecting cereal crops and / or non-cereal crops, the composition comprising 2- Pyrrolidone-5-Carboxylic Acid.

3. The fungicidal composition of Claim 2, wherein the disease is selected from grey mould, Ramularia Leaf Spot, Septoria tritici blotch, Fusarium Head Blight, net blotch, Fusarium wilt, basal rot and root rot, early blight, Black Rot, Black Spot, Cercospora leaf spot, Cercospora leaf blight, maize leaf blight, root rot, leaf spots, kernel infections and seedling blight, brown spot disease, tan spot, Anthracnose, blackleg disease, Septoria nodorum blotch, and apple scab disease.

4. The fungicidal composition according to Claim 2 or Claim 3, wherein the fungal infection is caused by a fungus selected from R. collo-cygni (Ramularia Leaf Spot), Pyrenophora teres (net blotch), Fusarium graminearum (Fusarium Head Blight), Fusarium oxysporum (Fusarium wilt, basal rot and root rot), Zymoseptoria tritici (Septoria tritici blotch), Botrytis cinerea (Grey mould), Alternaria solan! (early blight), Alternaria alternata (Black Rot, Black Spot), Blumeria graminis (powdery mildew of grasses), Cercospora beticola (Cercospora leaf spot), Cercospora kikuchii (Cercospora leaf blight), Drechslera maydis (Maize leaf blight), Cochliobolus sativus (root rot, leaf spots, kernel infections and seedling blight), Cochliobolus miyabeanus (brown spot disease), Drechslera teres (net blotch), Drechslera tritici-repentis (tan spot), Elsinoe ampelina (Anthracnose), Gaeumannomyces tritici (Take-all), Leptosphaeria maculans (blackleg disease), Mycosphaerella graminicola (Septoria tritici blotch), Parastagonospora nodorum (Septoria nodorum blotch), Phakopsora pachyrhizi (Asian Soybean Rust), Phakopsora meibomiae (Soybean Rust), Puccinia coronata (crown rust), Puccinia horde!, (Leaf rust), Puccinia triticina (Leaf / Brown rust), Puccinia graminis (Stem Rust), Puccinia striiformis (Yellow / Stripe Rust), Stagonospora nodorum (Septoria nodorum blotch) and Venturia inaequalis (apple scab disease).

5. The fungicidal composition according to any one of Claims 2 to 4, wherein the cereal is selected from barley (Hordeum vulgare), wheat (Triticum aestivum), oats Avenasativa), maize (Zea mays), rye (Secale cereale), spelt (Triticum spelta), rice (Oryza sativa), millet (Panicum miliaceum, Eleusine coracana, Setaria italica, Pennisetum glaucum), sorghum (Sorghum bicolor), triticale (x Triticosecale), teff (Eragrostistef), fonio (Digitaria exilis), wild rice (Zizania spp.), and canary grass (Phalaris sp.).

6. The fungicidal composition according to any one of Claims 2 to 5, wherein the noncereal crop is a horticultural crop.

7. The fungicidal composition according to Claim 6, wherein the horticultural crop is selected from tomato, grape, gooseberry, strawberry, raspberry, blackberry, loganberry, blackcurrant, redcurrant, grape, apple, banana, orange, lemon, lime, pear, plum, nectarine, cucurbits, cotton, coffee, potatoes, corn, soybeans, ornamental plants, sugar cane, sugar beet, oilseed rape, lettuce, chickpeas, broccoli, beans, asparagus, and other vegetable-bearing species.

8. The fungicidal composition according to any one of Claims 1 to 7, wherein the 2- Pyrrolidone-5-Carboxylic Acid is isolated from an endophyte or is synthetic.

9. The fungicidal composition according to Claim 8, in which the endophyte is characterised as being Penicillium oxalicum.

10. The fungicidal composition according to Claim 8 or Claim 9, in which the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) defined by SEQ ID NOs: 3 and 4.

11. The fungicidal composition according to any one of the preceding claims, wherein the 2-Pyrrolidone-5-Carboxylic Acid is a systemic fungicide.

12. The fungicidal composition according to any one of the preceding claims, wherein the composition comprises between about 0.0005% (w / v) to 1% (w / v) of 2-Pyrrolidone- 5-Carboxylic Acid.

13. A fungicidal composition comprising 2-Pyrrolidone-5-Carboxylic Acid as an active ingredient, wherein the 2-Pyrrolidone-5-Carboxylic Acid is isolated from an endophyte characterised as being Penicillium oxalicum or is synthetic.14.The fungicidal composition according to Claim 13, in which the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) defined by SEQ ID NOs: 3 and 4.

15. The fungicidal composition of any one of the preceding claims, wherein the 2- Pyrrolidone-5-Carboxylic Acid is a derivative selected from an acid halide, an anhydride, an ester, an amide, a thioester and / or an acylphosphate derivative.

16. A method for treating, inhibiting, and controlling plant fungal disease comprising contacting a plant with the fungicidal composition of Claim 1 .

17. The method of Claim 16, wherein the fungicidal composition is applied to the foliage of the plant.

18. The method of Claim 16 or Claim 17, wherein the fungicidal composition is applied to the plant’s root system either before, during, or after planting the plant in a growth medium.

19. The method of any one of Claims 16 to 18, wherein the fungicidal composition is applied to a growth medium that the plant is contained in.

20. The method of any one of Claims 16 to 19, wherein the fungicidal composition is applied to the plant, the growth medium, or the vicinity of the plant at a dose of about 0.25 kg to about 5.00 kg per hectare.

21. The method of any one of Claims 16 to 20, wherein the fungicidal composition is applied to fruit on, or harvested from, the plant.

22. The method of Claim 21 , wherein fruit is selected from strawberry, raspberry, cherry, gooseberry, blackberry, cranberry, blueberry, loganberry, blackcurrant, redcurrant, fig, grape, apple, banana, orange, lemon, lime, pear, plum, nectarine, pomegranate, peach, and tomato.

23. The method of any one of Claims 16 to 21 , wherein the plant is a grass or a horticultural crop or plant.

24. The method of Claim 23, wherein the grass is a cereal crop selected from barley (Hordeum vulgare), wheat (Triticum aestivum), oats (Avena sativa), maize (Zea mays), rye (Secale cereale), spelt (Triticum spelta), rice (Oryza sativa), millet (Panicummiliaceum, Eleusine coracana, Setaria italica, Pennisetum glaucum), sorghum (Sorghum bicolor), triticale (x Triticosecale), teff (Eragrostis tef), fonio (Digitaria exilis), wild rice (Zizania spp.), and canary grass (Phalaris sp.).

25. The method of Claim 23, wherein the horticultural plant is selected from cotton, coffee, potatoes, peanut, corn, soybeans, rapeseed, sunflower, pepper, onion, leeks, carrot, eggplant, spinach, brassicas, courgette, asparagus, ornamental plants, sugar cane, sugar beet, oilseed rape, lettuce, vegetable-bearing species, and herbs.

Images