Polypeptides having alkaline phosphatase activity for functional food

Abstract

The present invention relates to the use of polypeptides having alkaline phosphatase activity in functional foods, such as functional foods for infants.

Description

[0001] DETAILED DESCRIPTION OF THE INVENTION

[0002] Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6:240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.Gut integrity: The term “gut integrity” involves strengthening the gut lining, reducinginflammation, supporting the microbiome, and minimizing stressors to restore gut health and prevent systemic issues. Commented [JM1]: Needed ? Healthy gut: The term “healthy gut” is one that functions efficiently, with a strong intestinalbarrier, balanced microbiota, minimal inflammation, and optimal communication with other systems.Commented [JM2]: Check if really needed - added inHeterologous: The term "heterologous" means, with respect to a host cell, that aclaim ? polypeptide or nucleic acid does not naturally occur in the host cell. The term "heterologous" means, with respect to a polypeptide or nucleic acid, that a control sequence, e.g., promoter, of a polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide. Isolated: The term “isolated” means a polypeptide, nucleic acid, cell, or other specifiedmaterial or component that has been separated from at least one other material or component, including but not limited to, other proteins, nucleic acids, cells, etc. An isolated polypeptide, nucleic acid, cell or other material is thus in a form that does not occur in nature. An isolatedpolypeptide includes, but is not limited to, a culture broth containing the secreted polypeptideexpressed in a host cell. Mature polypeptide: The term “mature polypeptide” means a polypeptide in its matureform following N-terminal and / or C-terminal processing (e.g., removal of signal peptide). Native: The term "native" means a nucleic acid or polypeptide naturally occurring in a hostcell. Purified: The term “purified” means a nucleic acid, polypeptide or cell that is substantiallyfree from other components as determined by analytical techniques well known in the art (e.g., a purified polypeptide or nucleic acid may form a discrete band in an electrophoretic gel, chromatographic eluate, and / or a media subjected to density gradient centrifugation). A purified nucleic acid or polypeptide is at least about 50% pure, usually at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure (e.g., percent by weight or on a molar basis). In a related sense, a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique. The term "enriched" refers to a compound, polypeptide, cell, nucleic acid, amino acid, or other specified material or component that is present in a composition at a relative or absolute concentration that is higher than a starting composition. 5

[0003] 5 5

[0004] Table 4 Polypeptide pH 4 pH 5 pH 7 pH 9SEQ ID NO:3 76.31 79.19SEQ ID NO:5 66.75 70.88 76.194SEQ ID NO:11 57.12 62.04 80.34 77.26SEQ ID NO:14 56.63 66.72 76.367 66.43SEQ ID NO:16 70.59 77.76 74.85SEQ ID NO:17 67.83 73.28 79.74 73.20SEQ ID NO:19 54.92 69.26 76.86 66.31SEQ ID NO:21 71.32 73.79 75.07 69.18SEQ ID NO:27 68.11 75.64 78.30 67.23SEQ ID NO:30 68.54 73.19 71.83SEQ ID NO:40 76.22 81.51 84.56 78.33SEQ ID NO:42 77.67 83.58 84.98 81.70SEQ ID NO:43 68.31 74.03 75.63 69.64SEQ ID NO:44 67.36 70.57 70.47 63.54SEQ ID NO:45 62.61 68.39 72.42 67.73SEQ ID NO:58 52.88 68.05 80.22 68.10Table 5 Polypeptide pH 7SEQ ID NO:61 71.43SEQ ID NO:63 73.84SEQ ID NO:64 71.92SEQ ID NO:65 69.48SEQ ID NO:79 75.27SEQ ID NO:80 76.85SEQ ID NO:81 75.91SEQ ID NO:82 76.96SEQ ID NO:83 75.30SEQ ID NO:84 76.50SEQ ID NO:85 75.79SEQ ID NO:86 76.81SEQ ID NO:95 76.30SEQ ID NO:96 76.78SEQ ID NO:97 76.78SEQ ID NO:98 75.28 suppression of the secretion of IL-8. SEQ ID NO: 30 Thermochaetoides thermophila United Kingdom, CBS144.50SEQ ID NO: 31 Aspergillus sp. XZ2669 ChinaSEQ ID NO: 32 Colletotrichum sp-53045 ChinaTable 7 SEQ ID Donor scientific name Source countrySEQ ID NO: 40 Tolypocladium sp. XZ2657 ChinaSEQ ID NO: 41 Penicillium vasconiae ChinaSEQ ID NO: 42 Cladobotryum sp. ChinaSEQ ID NO: 43 Taifanglania sp. ZY039 ChinaSEQ ID NO: 44 Achaetomium sp. ZY150 ChinaSEQ ID NO: 45 Chaetomium sp. ZY474 China Aspergillus recombinant protein size: 70.5 kDA, observed: approx.85 kDa SEQ ID NO:19 ACACAACTGGGGATCCACCATGAACGTCAACAGCCTG (SEQ ID NO: 145)AGATCTCGAGAAGCTTATTAGTGATGGAAGTGAGTAAGA (SEQ ID NO: 146)PCR fragment size produced: 1.8 kb Aspergillus recombinant protein size: 53.3 kDA, observed: approx.55 kDa. Materials Assay Solution (AS, pH 8) 500 U / ml pepsin1.17 - 1.53 mM HCl10 mM Tris (5.8 mM base, 4.2 mM acid) 100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water Artificial gastric juice (AGJ, pH 3) 550 U / ml pepsin1.3 - 1.7 mM HCl100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water Neutralizing buffer (pH 8) 100 mM Tris 100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water 5 10

[0005] 5 10 15

[0006] SeqID1 Zn Ca Mg 45 70 78 80 67 61 49 .SeqID2 Zn Ca Mg 39 79 88 95 94 90 85 78SeqID3 Zn Ca Mg 31 80 87 92 93 91 87 82SeqID5 Zn Ca Mg 35 76 86 92 93 90 83 53SeqID6 none . . . 49 49 . . .SeqID6 Zn Ca Mg . 41 57 68 73 72 67 54SeqID8 none 42 55 67 71 66 59 54 48SeqID8 Zn Ca Mg 47 66 74 79 80 79 77 70SeqID10 Zn Ca Mg 31 33 54 64 68 67 61 47SeqID12 none . . . 35 34 31 30 29SeqID12 Zn Ca Mg . . . 32 35 32 29 28SeqID13 none . . 37 53 46 37 . .SeqID13 Zn Ca Mg . 43 53 66 69 67 61 49SeqID14 none . 47 60 68 63 56 55 44SeqID14 Zn Ca Mg . 72 80 80 74 68 60 58SeqID16 Zn Ca Mg . 57 71 78 81 81 80 76SeqID20 none . . 41 46 37 33 33 .SeqID20 Zn Ca Mg . 36 47 59 47 42 34 .SeqID21 none . 58 74 75 72 67 58 51SeqID21 Zn Ca Mg . 72 77 77 72 69 63 57SeqID25 Zn Ca Mg 39 . 52 52 44 43 41 39SeqID33 none . . . 38 36 33 33 .SeqID33 Zn Ca Mg . . . 42 43 40 35 33SeqID34 Zn Ca Mg 39 . 43 63 72 69 63 51SeqID35 none . 40 51 62 55 51 48 45SeqID35 Zn Ca Mg . 55 68 75 75 71 64 60SeqID36 none . 44 63 65 61 55 55 55SeqID36 Zn Ca Mg 35 60 63 69 69 65 64 64SeqID37 none . 48 62 70 63 55 54 31SeqID37 Zn Ca Mg 35 71 79 79 73 67 60 54SeqID38 none . 50 71 73 69 66 63 49SeqID38 Zn Ca Mg . 62 73 86 86 86 85 86SeqID39 none . 38 60 70 66 59 50 45SeqID39 Zn Ca Mg 35 63 71 71 65 58 51 46SeqID46 none . 34 57 60 54 50 41 31SeqID46 Zn Ca Mg . 52 62 70 71 68 61 51SeqID47 none 36 39 59 64 59 42 37 29SeqID47 Zn Ca Mg 35 49 62 72 71 70 65 55SeqID48 Zn Ca Mg 35 48 58 66 64 61 54 46SeqID49 Zn Ca Mg . 55 61 70 74 72 68 56SeqID51 none . 40 60 63 59 55 46 33SeqID51 Zn Ca Mg 35 55 66 75 73 71 66 56SeqID52 none . 37 53 53 48 45 . .SeqID52 Zn Ca Mg . 51 57 67 68 66 59 48SeqID55 none . 59 60 62 58 48 40 39SeqID55 Zn Ca Mg . 62 66 65 61 57 51 44SeqID56 none . . 52 65 64 62 60 57SeqID56 Zn Ca Mg . 63 73 76 75 . 66 61SeqID57 none . 54 67 81 75 65 61 51SeqID57 Zn Ca Mg 40 73 80 86 85 85 73 65SeqID58 none . 57 67 82 79 65 64 62SeqID58 Zn Ca Mg 44 73 80 86 85 79 74 70SeqID60 none . 52 66 71 69 65 63 58SeqID60 Zn Ca Mg 42 68 77 87 87 85 78 66SeqID61 none . 47 63 69 68 62 58 .SeqID61 Zn Ca Mg 37 63 73 79 79 78 74 67SeqID63 none . 43 67 70 68 62 54 43SeqID63 Zn Ca Mg 34 66 75 81 82 80 75 67SeqID79 none 35 52 67 69 61 56 56 50SeqID79 Zn Ca Mg . 66 75 81 81 80 76 70SeqID80 none 45 59 71 72 65 58 55 50SeqID80 Zn Ca Mg 48 69 75 82 82 81 78 71SeqID81 none 41 53 69 70 63 58 53 46SeqID81 Zn Ca Mg 46 68 75 81 82 81 77 69SeqID82 none 41 56 70 71 65 60 60 55SeqID82 Zn Ca Mg 47 69 76 82 82 80 78 71SeqID83 none . 52 64 67 62 53 50 37SeqID83 Zn Ca Mg 40 64 73 79 80 79 76 69 5

[0007] if node1 != node2: distance = t.get_distance(node1, node2) else: distance=0 node1list.append(node1) node2list.append(node2) distlist.append(distance) df = pd.DataFrame({'Node1':node1list, 'Node2':node2list, 'Distance':distlist}) df.to_excel("ancestral_distances.xlsx") Table 15 Node2 DistanceSWISSPROT_P09923 0SeqID55 1.42424974SeqID38 1.436704236SeqID21 1.440511836SeqID37 1.475842178SeqID56 1.489269113SeqID20 1.538002526SeqID14 1.543607617SeqID36 1.625634671SeqID35 1.628285091 SeqID16 0.63807SeqID8 0.63305SeqID23 0.63231SeqID24 0.62652SeqID22 0.60441SeqID25 0.59729SeqID26 0.58385SeqID33 0.57411

[0008] Table 18 TM score of ‘Variable Regions’ of ALPs vs SEQ ID NO SWISSPROT:P09923 SEQ ID NO:108 1SeqID37 0.94877SeqID20 0.94231SeqID14 0.93861SeqID38 0.92909SeqID56 0.91676SeqID12 0.91292SeqID35 0.91061SeqID36 0.90661 5

[0009] SeqID4 38.34SeqID5 37.93SeqID8 37.9SeqID1 37.86SeqID22 37.46SeqID10 37.24SeqID11 36.7SeqID46 36.45SeqID50 36.45SeqID23 36.39SeqID51 36.15SeqID24 35.96SeqID48 35.53SeqID47 35.39SeqID16 35.34SeqID49 34.99SeqID25 34.98SeqID57 34.56SeqID58 34.43SeqID59 34.38SeqID54 34.03SeqID15 33.93SeqID52 33.57SeqID33 33.55SeqID26 33.33SeqID53 33.17SeqID60 32.34

[0010] 5 10

[0011] Table 22 ALP ALPATP (mM) Bacterium Time (hours) Growth (%)(µg / mL)No ALP Ls33 24 100No ALP 20 Ls33 24 0No ALP 10 Ls33 24 100No ALP 5 Ls33 24 98CIAP 50 20 Ls33 24 115CIAP 50 10 Ls33 24 118CIAP 50 5 Ls33 24 114SEQ ID NO:21 1000 20 Ls33 24 132SEQ ID NO:21 1000 10 Ls33 24 131SEQ ID NO:21 1000 5 Ls33 24 140SEQ ID NO:21 250 20 Ls33 24 120SEQ ID NO:21 250 10 Ls33 24 127SEQ ID NO:21 250 5 Ls33 24 126SEQ ID NO:21 50 20 Ls33 24 120SEQ ID NO:21 50 10 Ls33 24 120SEQ ID NO:21 50 5 Ls33 24 114Table 23 ALP ATP ALPBacterium Time (hours) Growth (%)(µg / mL) (mM)No ALP S. aureus 24 100No ALP 20 S. aureus 24 10No ALP 10 S. aureus 24 10No ALP 5 S. aureus 24 10CIAP 50 20 S. aureus 24 112CIAP 50 10 S. aureus 24 111CIAP 50 5 S. aureus 24 110SEQ ID NO:21 1000 20 S. aureus 24 113SEQ ID NO:21 1000 10 S. aureus 24 117SEQ ID NO:21 1000 5 S. aureus 24 110SEQ ID NO:21 250 20 S. aureus 24 102 5 10

[0012] 5

[0013] Example 21: Reduction of heat stress adverse effects by ALP.Background Different stress factors inevitably influence the animal’s physiology and performance with varying degrees during the production period. High ambient temperature is one of the most common stressors in modern poultry production resulting in reduced feed intake, body weight gain, and increased mortality. Because of their physiological state and greater metabolic activity, broilers are more susceptible to temperature–associated environmental challenges. In addition to its effect on bird performance, the adverse effects of heat stress can range from minimal discomfort to multi-organ damage and failure, including alteration of gut permeability and function due to weakened tight junctions of the epithelial layer. Therefore, heat stress- induced disturbance of gut integrity may lead to leaky gut syndrome thus increasing the susceptibility of birds to enteric pathogens that may lead to systemic bacterial infections.510

[0014] 5

[0015] Table 30. Effect of feed additives on broiler performance between d 0-7 Treatment ControlLow T2&T6 Med T3&T7 High T4&T8 SEM P-valueGroups T1&T5BW (g), d 0 43.3 43.2 43.2 43.2 0.07 0.888BW (g), d 7 155.5 154.9 156.8 159.7 0.87 0.222BWG (g), d 0-7 112.1 111.7 113.6 116.5 0.85 0.186FI (g), d 0-7 177.1b 178.0ab 179.7ab 186.0a 1.14 0.022FCR, d 0-7 1.58 1.60 1.59 1.60 0.01 0.974Mortality, d 0-7,1.88 0.31 1.56 0.63 - 0.178% Table 31. Effect of feed additives on broiler performance between d 7-14 Treatment ControlLow T2&T6 Med T3&T7 High T4&T8 SEM P-valueGroups T1&T5 BW (g), d263.21b 268.16ab 276.71a 276.78a 1.76 0.0107-14 FI (g), d 7-404.36 401.42 403.71 421.36 3.34 0.12814 FCR, d 7-1.539 1.500 1.458 1.525 0.01 0.11614 Mortality,0.96 0.31 0.32 0.63 - 0.657d 7-14 Table 32. Effect of feed additives on broiler performance between d 0-27 Treatment ControlLow T2&T6 Med T3&T7 High SEM P-valueGroups T1&T5 T4&T8 BW (g) d1419.0 1443.2 1469.3 1454.8 6.96 0.06827 BW (g), d1375.7 1397.3 1422.9 1408.8 7.27 0.1270-27 FI (g), d 0-2133.5 2151.9 2169.3 2208.2 10.75 0.08327 FCR, d 0-1.55 1.54 1.53 1.57 0.01 0.19827 Mortality,3.11 1.25 2.19 2.19 - 0.452d 0-27 Table 33. Effect of feed additives on broiler performance between d 27-35Treatment Groups ControlLowMed T3&T7 High T4&T8 P-valueT1&T5 T2&T6BW (g), d 27-35 678.6 680.0 700.4 693.5 0.328FI (g), d 27-35 1197.1b 1218.9ab 1247.9a 1247.9a 0.004FCR, d 27-35 1.774 1.799 1.787 1.804 0.523Mortality, d 27-35 0.65 0.32 0.32 0.00 0.308Table 34. Effect oflsds feed additives on broiler performance between d 0-35Treatment ControlLow T2&T6 Med T3&T7 High T4&T8 P-valueGroups T1&T5BW (g) d 35 2097.6b 2123.3ab 2169.7a 2148.3ab 0.019BW (g), d 0- 2054.3b2080.0ab2126.5a2105.1ab0..018 35FI (g), d 0-35 3330.6b 3370.8ab 3417.3ab 3456.1a 0.005FCR, d 0-35 1.624 1.623 1.608 1.644 0.071Mortality, d3.75 1.56 2.50 2.19 0.3430-35^ ALP increased feed intake day 0-7 and significantly for the high dose ALP.^ ALP increased Body Weight Gain (BWG) significantly increased d 7-14 for medium and highALP dose groups.^ ALP increased BWG day 0-27 for ALP dose groups before heat stress.^ ALP increased BWG in broilers day 0-35 with a significant increase in the medium ALP dosegroup.^ ALP increased feed intake during heat stress for medium and high ALP dose groups^ General mortality was reduced in broilers fed with ALP additive and independently of heatstress.^ ALP significantly increased the expression of the Occludin gene on day 35 for birdssupplemented with the low dose of ALP, while the expression was numerically increased in the medium and high dose groups.^ ALP numerically increased ZO-1, Muc2, TFF-2 and decreased TNF-α in ALP supplementedbirds measured on day 35.Table 35. Effect of feed additives on jejunum gene expression on d 35 – Gene expression(Fold Change) Main NaP PepT SGLTSI IAP HSP7HSP9 Lysozy Occludi ZO- effect i-IIb 1 1 0 0 me n 1 diet Control0.97 1.15 1.30 1.21 1.16 3.22 2.01 1.09 1.11b 1.17(T1&T5) ALP low 1.21 1.27 1.29 1.44 1.08 2.52 1.85 1.10 1.44a 1.46(T2&T6) ALP med 1.10 1.48 1.49 1.28 1.18 3.81 2.01 1.03 1.18ab 1.53(T3&T7) ALP high 1.06 1.47 1.41 1.32 1.08 2.54 1.73 1.08 1.28ab 1.31(T4&T8) Conclusion ALP can alleviate the negative effects of heat stress to a certain extent and improve broiler performance during the overall experiment period of 35 days.Example 22: Reduction of E. coli challenge effects by ALPObjective To test if Alkaline Phosphatase (ALP) can reduce the severity of Escherichia coli (E. coli)challenge for weaned piglets. Recovery is compared to negative control (NC), and positivecontrol (PC) provided with Zink Oxide (ZnO).Experimental Unit 5 10

[0016] 551015510

[0017] ADFI, g Day 0-3 42 63 40 65 10.4 0.2095Day 3-7 152 161 123 140 19.1 0.5386Day 0-7 105 119 88 108 12.7 0.3908Day 7-14 322B 439A 307B 375AB 38.3 0.087Day 0-14 214B 279A 198B 242AB 22.8 0.085Day 14-21 489 680 550 510 60.0 0.1166Day 0-21 312 413 316 332 32.9 0.1134G:F ratio Day 0-3 -5.923 -1.828 -3.194 -2.472 1.4094 0.2041Day 3-7 -0.313 -0.006 -0.301 0.012 0.3882 0.8881Day 0-7 -0.731 -0.179 -0.717 -0.555 0.4325 0.7884Day 7-14 0.583B 0.946A 0.556B 0.725AB 0.1097 0.070Day 0-14 0.282b 0.753a 0.330b 0.411b 0.1145 0.0303Day 14-21 0.767b 0.853b 0.932ab 0.966a 0.0447 0.021Day 0-21 0.643B 0.802A 0.703B 0.713AB 0.0408 0.0677abWithin a row, means without a common superscript differ (P < 0.05). ABWithin a row, means without a common superscript differ (0.05≤ P < 0.10). Table 41. Fecal score (daily average value, 2 trained investigator) NC PC Low-High-SEM P-valueenzyme enzyme Fecal score* D0-3 0.52 0.44 0.46 0.21 0.138 0.4194D 3-7 2.07 1.82 1.52 1.62 0.311 0.6200D 0-7 1.89 1.14 0.99 0.91 0.203 0.5684D 7-14 2.18ab 0.53c 2.39a 1.53b 0.221 <0.0001D 0-14 1.73a 0.84c 1.66ab 1.11bc 0.192 0.0058D 14-21 1.26a 0.20b 1.13a 0.58ab 0.278 0.0395

[0018] 510 15

[0019] 510 15

[0020] comparison of catalytic efficiency and phosphate release among enzyme samples. These results show that CIAP and the microbial ALPs, SEQ ID 21, 37, 104 and 107, were able to release phosphate from AMP substrate. Conclusion

[0021] 5 10 15

[0022] by chromatographic separation and mass spectrometry detection to quantify adenosine release. Results showed varying levels of adenosine released depending on the substrate and ALP enzyme tested.

[0023] 510

[0024] 510 15

[0025] 51015

[0026] 5

Claims

CLAIMS1. A functional food comprising a polypeptide having alkaline phosphatase activity.

Images