Vaccine composition and use thereof

Abstract

A vaccine composition includes a glycoprotein E or an immunogenic fragment thereof of a varicella-zoster virus, a nucleic acid sensing toll-like receptor agonist selected from the group consisting of a toll-like receptor (7) agonist and a toll-like receptor (9) agonist, a stimulator of interferon genes agonist, and a pharmaceutically acceptable carrier. A method for inducing an immune response in a subject in need thereof includes administering an effective amount of the vaccine composition to the subject. A method for preventing an infectious disease includes administering an effective amount of the vaccine composition to a subject in need thereof.

Description

TITLEVACCINE COMPOSITION AND USE THEREOFCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 710,609, filed on October 23rd, 2024. The content of the application is incorporated herein by reference.BACKGROUND OF THE INVENTION

[0002] 1. FIELD OF THE INVENTION

[0003] The present disclosure relates to a vaccines and immunotherapy, and particularly to an adjuvant composition for enhancing the effect thereof.

[0004] Sequence Listing

[0005] The present application hereby incorporates by reference the entire contents of the text file named “NHR-P0037-PUS-Sequencing Listing.xml” in XML format. The text file containing the Sequencing Listing of the present application was created on 18 October, 2025 and is 13,406 bytes in size.

[0006] 2. DESCRIPTION OF THE PRIOR ART

[0007] Herpes zoster (shingles) is an infection caused by the varicella-zoster virus (VZV). It is estimated that approximately 33% of the population is infected with VZV during their lifetime. Primary infection with VZV causes chickenpox, after which the virus establishes latency in neurons. When immune function declines, VZV can reactivate, spreading along nerves and causing rashes, blisters, and severe pain, along with other complications. Middle-aged and older individuals are particularly susceptible due to age-related immune decline.

[0008] Currently, two licensed vaccines are available for herpes zoster. Zostavax is a live-attenuated vaccine containing a weakened VZV strain. However, Zostavax reduces the incidence of shingles in individuals aged over 50 years old with only an efficacy of 51.3%. Besides, Shingrix is a subunit vaccine without live virus, eliminating the risk of viral reactivation. Shingrix uses VZV glycoprotein E (gE) as its antigen and is formulated with the AS01B adjuvant system. Although Shingrix has demonstrated high protective efficacy, reaching 97.2% in individuals aged 50 to 59 and 91.3% in those over 70. However, Shingrix has a higher incidence of local and systemic side effects (i.e., reactogenicity) compared to Zostavax.

[0009] Intranasal vaccines offer several advantages over conventional intramuscular vaccines, including ease of administration, needle-free delivery, and enhanced patient compliance, particularly among needle-averse individuals. However, compared to conventional intramuscular vaccines, identification of effective adjuvants is crucial for the development of intranasal vaccines.

[0010] In view of the foregoing, it is necessary to provide a safe and a long-lasting immune response option of adjuvants in the art for intranasal vaccines and intramuscular vaccines overcoming the disadvantages of current vaccines, such as high reactogenicity, insufficient supply, and limited types of immune protection.SUMMARY OF THE INVENTION

[0011] To solve the aforementioned problems, the present disclosure provides a vaccine composition. The vaccine composition includes a glycoprotein E or an immunogenic fragment thereof of a varicella-zoster virus, a nucleic acid sensing toll-like receptor agonist selected from the group consisting of a toll-like receptor 7 agonist and a toll-like receptor 9 agonist, a stimulator of interferon genes agonist, and a pharmaceutically acceptable carrier.

[0012] The present disclosure further provides a method for inducing an immune response in a subject in need thereof. The method includes administering an effective amount of the vaccine composition of the present disclosure to the subject.

[0013] The present disclosure also provides a method for preventing an infectious disease. The method includes administering an effective amount of the vaccine composition of the present disclosure to a subject in need thereof.

[0014] In at least one embodiment of the present application, the vaccine composition may induce a potent, T helper 1 (Thl)-skewed, and long-lasting immune response (e.g., superior systemic and mucosal anti-VZV immune responses), highlighting the vaccine composition's potential as an effective alternative for herpes zoster vaccination.

[0015] These and other objectives of the present disclosure will no doubt become understandable to those of ordinary skill in the art after reading the following detailed description of the embodiments that are illustrated in the various figures and drawings.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1 illustrates cytokine gene induction by imiquimod, cyclic dinucleotides (CDNs), and combinations of imiquimod and cyclic dinucleotides in mouse splenocytes according to an embodiment of the present disclosure. Mouse splenocytes are treated with imiquimod (IMQ) (0.7pg / ml), CDNs (Ipg / ml), or combinations of imiquimod and CDNs for 8 hours. Total RNAis extracted and cytokine gene expression is analyzed by RT-qPCR, normalized to P-actin. Data are mean ±SEM (n = 3). *P < 0.05, **P < 0.01, ***p < 0.001 vs. PBS or as indicated.

[0017] FIG. 2 illustrates cytokine gene induction by CpG-2722, cyclic dinucleotides (CDNs), and combinations of CpG-2722 and cyclic dinucleotides in mouse splenocytes according to an embodiment of the present disclosure. Mouse splenocytes are treated for 8 hours with CpG-2722 (5 pg / ml), cyclic dinucleotides (1 pg / ml), or combinations of CpG-2722 and cyclic dinucleotides. Total RNA is isolated, and cytokine gene expression is assessed by RT-qPCR and normalized to P-actin. Data are mean ±SEM (n = 3). *P < 0.05, **P < 0.01, ***p < 0.001 vs. PBS or as indicated.

[0018] FIG. 3 illustrates effect of CpG-2722 only, imiquimod only, combinations of CpG-2722 and c-di-AM(PS)2, combinations of imiquimod and c-di-AM(PS)2 on cytokine gene expression in mouse splenocytes according to an embodiment of the present disclosure. Mouse splenocytes are treated for 8 hours with CpG-2722 (5 pg / ml), imiquimod (0.7 pg / ml), c-di-AM(PS)2 (1 pg / ml), or combinations of the TLR agonist and CDN. Total RNA is then isolated, and cytokine gene expression levels are analyzed by RT-qPCR and normalized to P-actin. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001 versus PBS control or as indicated. “CpG,” “IMQ,” and “AM(PS)2” refer to CpG-2722, imiquimod, and 2’3’-c-di-AM(PS)2, respectively.

[0019] FIG. 4 (1) illustrates the schematic of the experimental design of induction of antigen-specific IgG in mice intramuscularly immunized with Shingrix, imiquimod / c-di-AM(PS)2, or CpG-2722 / c-di-AM(PS)2 adjuvanted VZV vaccines according to an embodiment of the present disclosure. BALB / c mice in different groups are immunized intramuscularly on days 0 and 15 with PBS, 5 pg gE protein alone, or vaccines containing 10 pg CpG-2722 / 5 pg AM(PS)2 or 5 pg imiquimod / 5 pg AM(PS)2 combination. Shingrix group receives 1 / 10 of the standard dose of Shingrix (containing 5 pg gE).

[0020] FIG. 4 (2) and FIG. 4 (3) illustrate the anti-gE IgG and IgA titers measurement by ELISA according to an embodiment of the present disclosure. Data are presented as mean ± SEM (n = 5). *P < 0.05, **P < 0.01, and ***P < 0.001 compared to PBS or between indicated groups. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0021] FIG. 4 (4) illustrates the anti-gE IgG2a and IgGl titers measurement by ELISA according to an embodiment of the present disclosure. Data are presented as mean ± SEM (n = 5). *P < 0.05, **P < 0.01, and ***P < 0.001 compared to PBS or between indicated groups. “gE” and “IMQ” refer to glycoprotein E and imiquimod, respectively.

[0022] FIG. 4 (5) illustrates the IgG2a / IgGl ratio according to an embodiment of the present disclosure. Data are presented as mean ± SEM (n = 5). *P < 0.05, **P < 0.01, and ***P < 0.001 compared to PBS or between indicated groups. “gE” and “IMQ” refer to glycoprotein E and imiquimod, respectively.

[0023] FIG. 5 A (1) illustrates the schematic of the experimental design of antigen-specific antibody responses in mice intranasally immunized with combination of imiquimod and c-di-AM(PS)2, and combination of CpG-2722 / c-di-AM(PS)2 adjuvanted VZV vaccines according to an embodiment of the present disclosure. BALB / c mice in different groups are immunized intranasally on days 0 and 15 with PBS, 5 pg / ml gE or vaccines containing combination of 10 pg CpG-2722 and 5 pg AM(PS)2, or combination of 5 pg imiquimod and 5 pg AM(PS)2. Serum samples are collected on days 14 and 28.

[0024] FIG. 5 A (2) and FIG. 5 A (3) illustrate anti-gE IgG and IgA titers analysis according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0025] FIG. 5A (4) illustrates anti-gE IgG2a and IgGl titers analysis according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0026] FIG. 5A (5) illustrates IgG2a / IgGl ratio according to an embodiment of the presentdisclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***p < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0027] FIG. 5B illustrates anti-gE IgG and IgA titers measurement in BALF and NLF according to an embodiment of the present disclosure. Mice are euthanized on day 28. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0028] FIG. 6 (1) illustrates the H&E staining of nasal tissues from mice immunized with nasal imiquimod / c-di-AM(PS)2 and CpG-2722 / c-di-AM(PS)2 adjuvanted VZV vaccines according to an embodiment of the present disclosure. Mice are sacrificed on day 28. Nasal tissues are collected and stained with H&E. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0029] FIG. 6 (2) illustrates leukocytes in histological sections quantification according to an embodiment of the present disclosure. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0030] FIG. 7 illustrates T helper responses induced by nasal imiquimod / c-di-AM(PS)2 and CpG-2722 / c-di-AM(PS)2 adjuvanted VZV vaccines according to an embodiment of the present disclosure. Splenocytes are harvested on day 28 and re-stimulated with gE for 96 h. ELISA is used to assess cytokine levels for Thl (IFN-y), Thl7 (IL-17A), and Th2 (IL-4, IL-13). Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “IMQ,” “2722,” and “AM(PS)2” refer to glycoprotein E, imiquimod, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0031] FIG. 8 (1) illustrates schematic of the experimental design of induction of antigen-specific IgG in mice intranasally immunized with VZV vaccines adjuvanted with combinations of CpG-2722 and different CDN according to an embodiment of the present disclosure. BALB / c mice are immunized intranasally on days 0 and 15 with PBS, 5 pg gE controls or vaccines containing 5 pg gE, 10 pg CpG-2722 combined with 5 pg2’3’-c-di-AM(PS)2, 2’3’-cGAM(PS)2, 2’2’-cGAMP, or 3’3’-cGAMP. Serum is collected on days 14, 28, and 42.

[0032] FIG. 8 (2), FIG. 8 (3), and FIG. 8 (4) illustrate anti-gE IgG titers measurement according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “2722,” “GAM(PS)2,” and “AM(PS)2” refer to glycoprotein E, CpG-2722, 2’3’-cGAM(PS)2, and 2’3’-c-di-AM(PS)2, respectively.

[0033] FIG. 8 (5), FIG. 8 (6), and FIG. 8 (7) illustrate IgA titers measurement according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “2722,” “GAM(PS)2,” and “AM(PS)2” refer to glycoprotein E, CpG-2722, 2’3’-cGAM(PS)2, and 2’3’-c-di-AM(PS)2, respectively.

[0034] FIG. 9 (1) illustrates schematic of the experimental design of the long-term efficacy of nasal VZV vaccines adjuvanted with combination of CpG-2722 and c-di-AMP, or combination of CpG-2722 and c-di-AM(PS)2 according to an embodiment of the present disclosure. BALB / c mice are immunized intranasally on days 0 and 15 with PBS and 5 pg gE controls or vaccines containing 5 pg gE protein, 10 pg / 5pg of CpG-2722 / AMP or CpG-2722 / AM(PS)2. Serum is collected bi-weekly to day 98.

[0035] FIG. 9 (2) illustrates anti-gE IgG titers analysis by ELISA according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***p < 0.001 vs. PBS or as indicated. “gE,” “2722,” “AMP,” and “AM(PS)2” refer to glycoprotein E, CpG-2722, 2’ 3 ’-c-di-AMP, and 2’3’-c-di-AM(PS)2, respectively.

[0036] FIG. 10A (1) illustrates schematic of the experimental design of the dose-dependent and long-term effects of combination of CpG-2722 and 2’3’-c-di-AM(PS)2 as a nasal VZV vaccine adjuvant according to an embodiment of the present disclosure. BALB / c mice are immunized intranasally on days 0 and 15 with PBS 5 pg gE controls or vaccines containing 5 pg gE and CpG-2722 / AM(PS)2 at 10 pg / 5 pg, 5 pg / 2.5 pg, or 2.5 pg / 1.25 pg dose. Serum samples are collected bi-weekly until day 70.

[0037] FIG. 10A (2) illustrates anti-gE IgG titers determination by ELISA according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “2722,” and “AM(PS)2” refer to glycoprotein E,CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0038] FIG. 10B (1) illustrates anti-gE IgA titers determination by ELISA according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001 vs. PBS or as indicated. “gE,” “2722,” and “AM(PS)2” refer to glycoprotein E, CpG-2722, and 2’3’-c-di-AM(PS)2, respectively.

[0039] FIG. 10B (2) illustrates body weights monitoring weekly according to an embodiment of the present disclosure. Data are mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***p < 0.001 vs. PBS or as indicated. “gE” refers to glycoprotein E.

[0040] FIG. 11 illustrates schematic illustration of adjuvant activities of combination of CpG-2722 and 2’3’c-di-AM(PS)2 in nasal VZV according to an embodiment of the present disclosure.DETAILED DESCRIPTION

[0041] The following embodiments are provided to illustrate the present disclosure in detail. A person having ordinary skills in the art can easily understand the advantages and effects of the present disclosure after reading the disclosure of this specification, and also can implement or apply in other different embodiments. Therefore, it is possible to modify and / or alter the following embodiments for carrying out this disclosure without contravening its scope for different aspects and applications, and any element or method within the scope of the present disclosure disclosed herein can combine with any other element or method disclosed in any embodiments of the present disclosure.

[0042] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0043] As used herein, the singular forms “a,” “an,” and “the” include plural referents, unless expressly and unequivocally limited to one referent. For example, “an experiment” means one experiment or more than one experiment, e.g., a plurality of experiments. The term “or” is used interchangeably with the term “and / or” unless the context clearly indicates otherwise.

[0044] As used herein, the term “comprising,” “comprises” “include,” “including,” “have,” “having,” “contain,” “containing,” and any other variations thereof are intended to cover a non-exclusive inclusion. For example, when describing an object “comprises” a limitation, unless otherwise specified, it may additionally include other sequences, domains, ingredients, elements, components, structures, regions, parts, steps, or connections, etc., and should not exclude other limitations.

[0045] As used herein, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently, “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements).

[0046] The numeral ranges used herein are inclusive and combinable, any numeral value that falls within the numeral scope herein could be taken as a maximum or minimum value to derive the sub-ranges therefrom. For example, the numeral range “0.01 mg / kg body weight to 20 mg / kg body weight” includes any sub-ranges between the minimum value of 0.01 mg / kg body weight to the maximum value of 20 mg / kg body weight, such as the sub-ranges from 0.01 mg / kg body weight to 15 mg / kg body weight, from 5 mg / kg body weight to 20 mg / kg body weight, from 17 mg / kg body weight to 19 mg / kg body weight and so on. In addition, a plurality of numeral values used herein can be optionally selected as maximum and minimum values to derive numerical ranges. For instance, the numerical ranges of 0.01 mg / kg body weight to 15 mg / kg body weight, 0.01 mg / kg body weight to 20 mg / kg body weight, and 15 mg / kg body weight to 20 mg / kg body weight can be derived from the numeral values of 0.01 mg / kg body weight, 15 mg / kg body weight, and 20 mg / kg body weight.

[0047] As used here, the term “subject” includes human or other animals. In at least oneembodiment of the present disclosure, the subject may be a mammal, such as, but not limited to a human, non-human primate, canine, feline, murine, bovine, equine, porcine, sheep, deer, wolf, fox, and rabbit.

[0048] As used herein, the term “pharmaceutically acceptable carrier” maybe any and all solvents, dispersion media, diluents, excipients, antibacterial and antifungal agents, isotonic agents, absorption delaying agents, buffering agents, humectants, or other components that are suitable for the formulation and administration of the pharmaceutical composition described in the present disclosure. The carrier may be compatible with the active ingredients and may not produce an adverse biological reaction when administered. The term “pharmaceutically acceptable” indicates that the carrier is approved by a regulatory authority such as the U.S. Food and Drug Administration, or is listed in the United States Pharmacopeia or other recognized pharmacopeia for use in animals, particularly in humans. Examples of pharmaceutically acceptable carriers include, but are not limited to, saline, sterile water, aqueous dextrose, glycerol, ethanol, propylene glycol, and combinations thereof. Solid carriers may include starch, lactose, sucrose, gelatin, or talc. The choice of carrier will depend on the intended mode of administration, such as oral, intramuscular, subcutaneous, or intravenous routes. Suitable examples and formulations may be found in standard references such as Remington’s Pharmaceutical Sciences.

[0049] As used herein, the term “effective amount” refers to the amount of an active agent or a pharmaceutical composition that is sufficient to bring about an effect on treating, preventing, or ameliorating a disorder, disease, or condition of a subject in need thereof, such as but not limited to, inducing an immune response in a subject in need thereof. The effective amount may vary by a person ordinarily skilled in the art, depending on excipient usage, routes of administration, the possibility of co-usage with other therapeutic treatment, or the condition to be treated, but the present disclosure is not limited thereto.

[0050] As used herein, the term “administer,” “administering” or “administration” refer to the placement of an active ingredient into a subject by a method or route which results in at least partial localization of the active ingredient at a desired site to produce the desired effect. For example, the active ingredient of the present disclosure may be administered to a subject by oral administration, injection, subcutaneous administration, intramuscular administration, topical administration, or nasal administration, but the present disclosure is not limited thereto.

[0051] As used herein, the term “adjuvant” refers to a compound that, with a specific immunogen or antigen, will augment or otherwise alter or modify the resultant immune response. Modification of the immune response includes intensification or broadening the specificity of either or both antibody and cellular immune responses. Modification of the immune response can also mean decreasing or suppressing certain antigen-specific immune responses. In some embodiments of the present disclosure, the adjuvant may be a cyclic dinucleotide.

[0052] As used herein, the terms “CpG-oligodeoxynucleotide” refer to a short single-stranded DNA molecule which includes a 5’ C nucleotide connected to a 3’ G nucleotide through a phosphodiester intemucleotide linkage or a phosphodiester derivative internucleotide linkage.

[0053] As used herein, “immune response” refers to a response made by the immune system of an organism to a substance, which includes but is not limited to foreign proteins or self-proteins. Three general types of “immune response” include mucosal, humoral, and cellular immune responses. An immune response may include at least one of the following: antibody production, inflammation, developing immunity, developing hypersensitivity to an antigen, the response of antigen-specific lymphocytes to antigen, and transplant or graft rejection.

[0054] In at least one embodiment of the present disclosure, the toll-like receptor 7 agonist may be an imiquimod, and the toll-like receptor 9 agonist may be a CpG-oligodeoxynucleotide.

[0055] In at least one embodiment of the present disclosure, the nucleic acid sensing toll-like receptor agonist may be the toll-like receptor 9 agonist, and the CpG-oligodeoxynucleotide may be a CpG-2722.

[0056] In at least one embodiment of the present disclosure, the stimulator of interferon genes agonist may be a cyclic dinucleotide.

[0057] In at least one embodiment of the present disclosure, the cyclic dinucleotide may be at least one selected from the group consisting of 2’3’-cGAMP, 3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’3’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

[0058] In at least one embodiment of the present disclosure, the toll-like receptor 7 agonist may be an imiquimod; the toll-like receptor 9 agonist may be CpG-2722; and the stimulator of interferon genes agonist may be selected from the group consisting of 2’3’-cGAMP,3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’3’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

[0059] In at least one embodiment of the present disclosure, the vaccine composition is administered to the subject by intramuscular administration or nasal administration.

[0060] In at least one embodiment of the present disclosure, the infectious disease may be herpes zoster.

[0061] In at least one embodiment of the present disclosure, the effective amount may from 0.1 ng / kg body weight to 50 mg / kg body weight. In some embodiments of the present disclosure, the effective amount may from 0.1 ng / kg body weight to 50 mg / kg body weight. In some embodiments of the present disclosure, the effective amount may from 0.2 ng / kg body weight to 20 mg / kg body weight. In some embodiments of the present disclosure, the effective amount may from 0.2 ng / kg body weight to 10 mg / kg body weight. In some embodiments of the present disclosure, the effective amount may be 0.1 ng / kg body weight, 0.2 ng / kg body weight, 0.5 ng / kg body weight, 10 ng / kg body weight, 100 ng / kg body weight, 1000 ng / kg body weight, 10000 ng / kg body weight, 100000 ng / kg body weight, 1 mg / kg body weight, 5 mg / kg body weight, 10 mg / kg body weight, 15 mg / kg body weight, 20 mg / kg body weight, 25 mg / kg body weight, 30 mg / kg body weight, 35 mg / kg body weight, 40 mg / kg body weight, 45 mg / kg body weight, or 50 mg / kg body weight, but the present disclosure is not limited thereto.

[0062] In some embodiments of the present disclosure, VZV belongs to the Herpesviridae family and is classified under the Alphaherpesvirinae subfamily, and is an enveloped, double-stranded DNA virus with a linear genome of approximately 125 kilobase pairs (kbp), encoding around 70 open reading frames (ORFs) involved in viral replication, structural assembly, immune evasion, and latency. Among VZV’s structural proteins, glycoprotein E (gE) is the most abundant and plays a crucial role in VZV pathogenesis. This 623 -amino-acid transmembrane protein facilitates efficient cell-to-cell spread and promotes viral dissemination in epithelial and neuronal tissues. Due to gE’s immunogenicity and critical functional roles, gE is a primary target for antiviral strategies, including recombinant zoster vaccines.

[0063] In some embodiments of the present disclosure, distinct from Toll-like receptor (TLR) 4 which is located on the cell surface as a key receptor for detecting lipopolysaccharide structures, nucleic acid sensing TLRs including TLR7 and TLR9 detect microbial nucleic acidstructures, initiating cellular signaling for host immune responses from intracellular vesicles such as endosomes. Activation of nucleic acid sensing TLRs triggers NF-KB and interferon regulatory factors (IRFs), leading to the production of pro-inflammatory cytokines and interferons (IFNs). Due to the potent immunomodulatory properties, nucleic acid sensing TLRs’ agonists are explored for therapeutic applications, including vaccine adjuvants.

[0064] In some embodiments of the present disclosure, the stimulator of interferon genes (STING) pathway is a key component of the innate immune system, acting downstream of cyclic GMP-AMP synthase (cGAS). Upon activation, cGAS catalyzes the formation of cyclic GMP-AMP (cGAMP) from GTP and ATP, which in turn activates STING, leading to the transcription of type I IFNs and inflammatory genes. Natural cyclic-dinucleotide (CDN) STING agonists include mammalian 2'3 '-cGAMP and bacterial 3 '3 '-cGAMP, c-di-GMP, and c-di-AMP. Synthetic STING agonists, such as 2'3'-cGAM(PS)2 and 2'3'-c-di-AM(PS)2, incorporate phosphorothioate modifications to enhance structural stability and cellular permeability. Various STING agonists are being investigated for therapeutic applications, mostly focused on cancer immunotherapy and as adjuvant for vaccine development.

[0065] In some embodiments of the present disclosure, nasal immunization induces broader immune responses, stimulating both systemic and mucosal immunity, which is particularly advantageous for targeting pathogens that enter through mucosal surfaces. The efficacy of protein subunit vaccines depends significantly on the choice of adjuvant, which enhances immune responses.

[0066] In some embodiments of the present disclosure, the combination of TLR7 agonist or TLR9 agonist, and CDN-type of STING agonists is used as adjuvants for an intranasally administered herpes zoster vaccine. The CpG-2722 (TLR9 agonist) and 2'3'-c-di-AM(PS)2 (STING agonist) combination (CpG-2722 / 2'3'-c-di-AM(PS)2) induces a strong Thl-shifted, long-lasting immune response. Compared to intramuscular Shingrix, the intranasal CpG-2722 / 2'3'-c-di-AM(PS)2 adjuvanted vaccine elicits superior systemic and mucosal anti-VZV immune responses, supporting a potential as an effective alternative for herpes zoster vaccination.

[0067] At least one embodiment of the present disclosure provides a use of the vaccine composition in manufacture of a medicament for inducing an immune response in a subject in need thereof. At least one embodiment of the present disclosure provides a vaccine compositionfor use in inducing an immune response in a subject in need thereof.

[0068] At least one embodiment of the present disclosure provides a use of the vaccine composition in manufacture of a medicament for preventing an infectious disease in a subject in need thereof. At least one embodiment of the present disclosure provides a vaccine composition for use in preventing an infectious disease in a subject in need thereof.

[0069] EXAMPLES

[0070] Exemplary embodiments of the present disclosure are further described in the following examples, which should not be construed to limit the scope of the present disclosure.

[0071] Materials and Methods

[0072] Chemicals and reagents

[0073] Recombinant varicella-zoster virus (VZV) glycoprotein E (gE) protein (amino acid residues Metl-Tyr538) is purchased from Sino Biological (Catalog No. 40907-V08H). The STING ligand 2’2’-cGAMP (Catalog No. 22419) is obtained from Cayman, 2’3’-c-di-AMP (Catalog No. Cl 87) from Biolog, and 3’3’-cGAMP (Catalog No. tlrl-nacga) and 2’3’-c-di-AM(PS)2 (Catalog No. vac-nacda2r) from InvivoGen. Imiquimod (Catalog No. tlrl-imqs-1) is also purchased from InvivoGen. The SuperScriptTM IV kit, HRP-conjugated goat anti-mouse IgG, IgA, IgGl, IgG2a, and mouse IL-4, IL-5, IL-13, IL-17A, and IFN-y ELISA kits are obtained from Thermo Fisher Scientific. The TLR9 agonist CpG-2722 is synthesized by Integrated DNA Technologies. The illustra RNAspin Mini kit is purchased from GE Healthcare. All forward and reverse primers are synthesized by Protech Technology. The PowerTrack™ SYBR Green Master Mix and TMB substrate are also obtained from Thermo Fisher Scientific.

[0074] Cell culture and preparation

[0075] Mouse splenocytes are cultured in RPMI 1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 10 mM HEPES, and 1% antibiotic-antimycotic at 37°C in 5% CO2. To prepare splenocytes, spleens are collected, mashed through a 70-pm nylon cell strainer (Biologix), and centrifuged at 1200 rpm for 10 minutes. The cells are incubated with ACK lysis buffer for 5 minutes at room temperature to lyse erythrocytes, and the reaction is terminated byadding 5 ml of PBS. Splenocytes are washed with PBS and plated at 2.5 x io6cells / well in a 12-well plate for stimulation experiments.

[0076] Reverse transcription-quantitative PCR (RT-qPCR)

[0077] Total RNA is extracted from mouse splenocytes using the illustra RNAspin Mini Kit (GE Healthcare) following the manufacturer’s protocol. First-strand cDNA is synthesized from total RNA using the SuperScript IV First-Strand Synthesis System (Invitrogen). RT-qPCR is performed with the QuantiNova SYBR Green PCR Kit (Qiagen) on an Applied Biosystems ViiA 7 Real-Time PCR System. Specific primers for gene expression analysis are listed in Table 1. Primers are synthesized by Protech Technology (Taipei, Taiwan). Target gene expression is quantified using the comparative AA cycle threshold (Ct) method and normalized to ACTB expression.Table 1 : List of RT-qPCR primer utilized for gene expression analysis.Gene Forward primer Reverse primer AGAGCTTCAGGCAGGCAGTA (SEQ AGGTGCTCATGTCCTCATCC IL-ipID NO: 1) (SEQ ID NO: 2) CCGGAGAGGAGACTTCACAG (SEQ TTTCCACGATTTCCCAGAGA IL-6ID NO: 3) (SEQ ID NO: 4) ACGGCCAGAGAAAAACTGAA (SEQ CTACCAAGGCACAGGGTCAT IL-12AID NO: 5) (SEQ ID NO: 6) CACGCCTGAAGAAGATGACA (SEQ AGTCCCTTTGGTCCAGTGTG IL-12BID NO: 7) (SEQ ID NO: 8) ACGGCATGGATCTCAAAGAC (SEQ GTGGGTGAGGAGCACGTAG TNF-aID NO: 9) (SEQ ID NO: 10) ATCCAGAAGGCTCAAGCCATCC GGAGGGTTGTATTCCAAGCAG IFN-a(SEQ ID NO: 11) C (SEQ ID NO: 12) GCCTTTGCCATCCAAGAGATGC ACACTGTCTGCTGGTGGAGTT IFN-P(SEQ ID NO: 13) C (SEQ ID NO: 14) CAGCAACAGCAAGGCGAAAAAGG TTTCCGCTTCCTGAGGCTGGA IFN-y(SEQ ID NO: 15) T (SEQ ID NO: 16) CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAP-Actin(SEQ ID NO: 17) GG (SEQ ID NO: 18)

[0078] Animal care

[0079] All animal experiments are approved by the Institutional Animal Care and Use Committee (IACUC) of the National Health Research Institutes (NHRI), Taiwan. Mice are purchased from BioLASCO Taiwan (Taipei, Taiwan) or the National Laboratory Animal Center (Taipei, Taiwan) and housed at the NHRI Laboratory Animal Center. All mice are maintained and handled in accordance with the stated guidelines of the IACUC, NHRI.

[0080] Mouse immunization

[0081] Female BALB / c mice (6 to 8 weeks old) are randomly assigned to different experimental groups for immunogenicity studies. The vaccines are administered in two doses at 14-day intervals. Mice are immunized either intramuscularly or intranasally on days 0 and 15 with controls or the formulated combination of gE and adjuvant vaccines. The Shingrix herpes zoster vaccine (GSK Biologicals) is administered in two intramuscular doses. Control groups received PBS or gE. For intramuscular immunization, 50 pl of the control or formulated combination of gE and adjuvant vaccine or 1 / 10 of the Shingrix vaccine dose is injected into the right hind leg quadriceps muscle. For intranasal inoculation, 30 pl of the vaccine is administered dropwise into the nostrils (15 pl per nostril). Serum samples are collected every 14 days for humoral immune response analysis. Bronchoalveolar lavage fluid (BALF), nasal lavage fluid (NLF), and nasal tissues are collected at the end of the experiment.

[0082] ELISA for antibody responses

[0083] Anti-gE protein-specific antibody titers in serum, BALF, and NLF samples from immunized animals are detected using ELISA. Ninety-six-well plates are coated with 4 pg / ml recombinant VZV gE protein in PBS and incubated overnight at 4°C. Plates are washed with PBS containing 0.05% Tween-20 and blocked with 1% BSA in PBS for 1 hour at room temperature. Serially diluted samples are added and incubated for 2 hours at room temperature. After washing, plates are incubated with HRP-conjugated goat anti-mouse IgG or IgA for 1 hour. Signals are developed using TMB substrate for 15 minutes, and the reaction is stopped with 2 N H2SO4. Optical density is measured at 450 nm using a microplate reader.

[0084] Antigen-dependent cytokine production

[0085] Immunized mice are euthanized at the end of the vaccination experiment, and spleens are isolated to prepare splenocytes. Cells are plated at a density of 6 * 105cells / well in 96-well plates (Corning) and stimulated with 10 pg / ml glycoprotein E protein. After 96 hours, supernatants are collected for cytokine analysis using commercially available ELISA kits (Invitrogen) following the manufacturer’s protocol.

[0086] Hematoxylin and eosin (H&E) staining

[0087] Mice are sacrificed at the end of the vaccination experiment, and nasal tissues are collected and fixed in 10% buffered formalin. Paraffin-embedded tissues are sectioned into 5-pm slides and stained with H&E at the NHRI Pathology Core Laboratory for histological examination.

[0088] Statistical analysis

[0089] Statistical analysis is performed using an unpaired Student's t-test. Data are presented as mean ± SEM. A p-value of <0.05 was considered statistically significant. Graphs are generated using GraphPad Prism (GraphPad Software v.8.0.1).

[0090] Results

[0091] Activation of cytokine gene expression by TLR7, TLR9, STING agonists alone and in combination

[0092] TLRs 7, 8, and 9 are the most closely related members of the TLR family. TLR7 and TLR8 have overlapping ligand recognition profiles. Imiquimod, a TLR7 agonist, is approved for the treatment of genital warts, superficial basal cell carcinoma, and actinic keratosis. CpG-2722, a TLR9 agonist, has demonstrated potent immunostimulatory effects and tumor inhibition activity. The combination of CpG-2722 with a STING agonist has shown enhanced adjuvant and antitumor effects compared to the use of CpG-2722 or a STING agonist alone. STING agonists 2’2’-cGAMP and 3’3’-cGAMP are cyclic dinucleotides (CDNs) composed of two 2’5’ and two 3’5’ phosphodiester bonds, respectively. 2’3’-cGAM(PS)2 and 2’3’-c-di-AM(PS)2 are phosphorothioate analogs of 2’3’-cGAMP and 2’3’-c-di-AMP, respectively, with two phosphorothioate diester linkages, one at the 2’5’ position and the other at the 3’5’ position.

[0093] To evaluate the immunostimulatory activity of the TLR7 agonist, TLR9 agonist, and STING agonist for vaccine adjuvant use, cytokine-inducing profiles of TLR7 agonist, TLR9 agonist, and STING agonist alone and in combination are examined.

[0094] The effects of immunostimulatory activity induced by imiquimod only, CDN only (including 2’2’-cGAMP, 3’3’-cGAMP, 2’3’-cGAM(PS)2, or 2’3’-c-di-AM(PS)2), and combination of imiquimod with CDN are first analyzed in mouse splenocytes using RT-qPCR. These treatments induced varying levels of cytokine mRNA expressions including, TNF-a, IL-6, IL-12B, and IFN-y. Notably, the combination of imiquimod and 2’3’-c-di-AM(PS)2 exhibits a cooperative effect in cytokine induction (FIG. 1).

[0095] Next, cytokine gene expression following stimulation with CpG-2722 only, CDNs only, and combinations of CpG-2722 and CDNs are examined. Among individual treatments, CpG-2722 strongly induces TNF-a, IL-6, IL-12B, and IFN-y. The combination of CpG-2722 and 2’3’-c-di-AM(PS)2 shows a cooperative effect, significantly increasing expression of these cytokine genes (FIG. 2).

[0096] Combinations of imiquimod and 2’3’-c-di-AM(PS)2, and combinations of CpG-2722 and 2’3’-c-di-AM(PS)2 confirms the cooperative effect in inducing TNF-a, IL-6, IL-12B, and IFN-y. Additionally, the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 seems to be more effective in the inductions (FIG. 3). These results suggest that co-administration of TLR7 agonist or TLR9 agonist with 2’3’-c-di-AM(PS)2 enhances immunostimulatory effects and may improve adjuvant efficacy in vaccines.

[0097] Antigen-specific antibody responses to intramuscular imiquimod / 2’3’-c-di-AM(PS)2, CpG-2722 / 2’3’-c-di-AM(PS)2 adjuvanted VZV vaccines and Shingrix

[0098] Shingrix, a licensed intramuscular VZV vaccine, contains 50 pg of VZV gE protein per dose as the antigen, with AS01B as the adjuvant. One component of AS01B, monophosphoryl lipid A (MPL), functions as a TLR4 agonist. To assess the combined adjuvant activities of the combination of imiquimod and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-c-di-AM(PS)2 formulations, BALB / c mice are immunized intramuscularly with VZV vaccines containing 5 pg of gE and either aforementioned adjuvant combination. A 1 / 10 dose of Shingrix is used as a benchmark to evaluate the humoral immune response. Immunizations and blood sample collections are performed at two-week intervals (intramuscularly; total volume: 50ml; gE: 5 mg; CpG-2722: 10 mg; imiquimod: 5 mg; STING ligands: 5 mg; and Shingrix: 1 / 10 dose / mouse (5 mg VZV gE + 5 mg QS-21 / 5 mg MPL)) (FIG. 4 (1)). Following the first immunization, all three adjuvanted vaccines (i.e., Shingrix, combination of imiquimod and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-c-di-AM(PS)2) induced significantly higher gE-specific IgG titers than those observed in the PBS and gE-alone control groups. Both the CpG-2722 / 2’3’-c-di-AM(PS)2-adjuvanted vaccine and Shingrix elicited stronger anti-gE IgG responses than the imiquimod / 2’3’-c-di-AM(PS)2-adjuvanted vaccine. After the second immunization, anti-gE IgG titers continued to rise in all adjuvanted groups. The CpG-2722 / 2’3’-c-di-AM(PS)2 adjuvanted vaccine effectively induces higher gE-specific IgG responses than that induced by the Shingrix and imiquimod / 2’3’-c-di-AM(PS)2 adjuvanted vaccine. However, none of the intramuscularly administered vaccines induces detectable gE-specific IgA responses after two doses (FIG. 4 (2) and FIG. 4 (3)). The gE-specific IgG subclasses are measured after the second immunization. All three aforementioned adjuvanted vaccines induce higher levels of both IgGl and IgG2a compared to gE alone (FIG. 4 (4)). Among them, the CpG-2722 / 2’3’-c-di-AM(PS)2 group displays a notably higher IgG2a level and IgG2a / IgGl ratio, suggesting a more pronounced Th 1 -polarized immune response (FIG. 4 (4) and FIG. 4 (5)). These results suggest that the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 provides Thl adjuvant activity in an intramuscular VZV vaccine formulation.

[0099] Antigen-specific antibody responses to nasal imiquimod / 2’3’-c-di-AM(PS)2, CpG-2722 / 2’3’-c-di-AM(PS)2 adjuvanted VZV vaccines

[0100] Nasal vaccination offers several advantages, including improved patient compliance and the potential to enhance mucosal immune responses. To evaluate the adjuvant activity of combination of imiquimod and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-c-di-AM(PS)2 in nasal vaccine formulations, BALB / c mice are immunized intranasally with the aforementioned adjuvanted VZV vaccines. Mice receive two doses (prime on day 0 and boost on day 15), blood samples are collected on days 14 and 28, and mice are sacrificed at the end of the experiment (intranasal; total volume: 30 ml; gE: 5 mg; CpG-2722: 10 mg; imiquimod: 5 mg; and STING ligands: 5 mg) (FIG. 5A (1)). Both adjuvant combinations induce anti-VZV gE IgG responses after the first and second immunizations, with the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 formulation demonstrating higher efficacy. However, neither adjuvant combinations induce detectable gE-specific IgA after the first dose. Notably, the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 elicit a strong gE-specific IgA response following the second dose, whereas the combination of imiquimod and 2’3’-c-di-AM(PS)2 does not (FIG. 5A (2) andFIG. 5A (3)). The gE-specific IgG subclasses in the serum samples collected after two immunizations are further analyzed. Similar to the intramuscular immunization results, both combination of imiquimod and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-c-di-AM(PS)2 induce IgGl and IgG2a, with the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 group showing stronger induction (FIG. 5 A (4)). In addition, the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 group exhibits a significantly higher IgG2a / IgGl ratio than the others (FIG. 5A (5)), indicating an increased Thl immune response. To assess local mucosal immunity, bronchoalveolar lavage fluid (BALF) and nasal lavage fluid (NLF) are collected at the endpoint to measure antigen-specific IgG and IgA levels. Consistent with the serum data, the CpG-2722 / 2’3’-c-di-AM(PS)2-adjuvanted vaccine induced substantial amounts of gE-specific IgG and IgA in both BALF and NLF. The combination of imiquimod and 2’3’-c-di-AM(PS)2 formulation induce gE-specific IgG and minimal IgA in the nasal cavity (FIG. 5B).

[0101] To evaluate local inflammatory response, nasal tissues are collected and subjected to histological examination (H&E staining). No pathological tissue damage or inflammation is observed (FIG. 6 (1)), and leukocyte counts in the nasal tissue show no significant differences between control and vaccinated groups (FIG. 6 (2)). These findings highlight the potential of the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 as a safe and effective adjuvant for intranasal VZV vaccines.

[0102] T helper responses of the nasal imiquimod / 2’3’-c-di-AM(PS)2, CpG-2722 / 2’3’-c-di-AM(PS)2 adjuvanted VZV vaccines

[0103] To evaluate antigen-specific T helper (Th) cell responses induced by nasal vaccination, splenocytes are isolated from mice at the endpoint of the experiment described in FIG. 5A (1) to (5) and FIG. 5B. The splenocytes are re-stimulated ex vivo with the VZV gE antigen, and the levels of key cytokines representing Thl, Th2, and Th 17 responses are measured by ELISA. Specifically, IFN-y is measured as a marker of Thl, IL-17A for Thl7, and IL-4 and IL-13 for Th2 responses. Both the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 and combination of imiquimod and 2’3’-c-di-AM(PS)2 adjuvanted vaccines activated a Thl response, with the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 formulation inducing a significantly stronger IFN-y production. The CpG-2722 / 2’3’-c-di-AM(PS)2 group elicits a detectable Thl7 response, as indicated by increased IL-17A levels (FIG. 7). Since IFN-y and IL-4 are known to regulate IgG class switching toward IgG2a and IgGl, respectively, the higher IFN-y levels observed inthe CpG-2722 / 2’3’-c-di-AM(PS)2 group are consistent with the elevated IgG2a / IgGl ratio in serum from this group (lower right panel of FIG. 5A). Furthermore, these findings align with earlier data showing that the CpG-2722 / 2’3’-c-di-AM(PS)2 combination synergistically enhances Thl cytokine production, such as TNF-a and IFN-y (FIG. 3).

[0104] Adjuvant activities of different CpG-2722 and CDN combinations for intranasally administered VZV vaccine

[0105] To further evaluate the adjuvant potential of CpG-2722 in combination with other CDN-type of STING agonists, multiple formulations in the nasal VZV vaccine model is tested. In addition to 2’3’-c-di-AM(PS)2, the CDNs examined include 2’2’-cGAMP, 3’3’-cGAMP, and 2’3’-cGAM(PS)2. BALB / c mice are intranasally immunized with these vaccine formulations twice, at a two-week interval, and blood samples are collected bi-weekly at three time points to assess antibody responses (intranasal; total volume: 30 ml; gE: 5 mg; CpG-2722: 10 mg; and STING ligands: 5 mg) (FIG. 8 (1)). All combinations of CpG-2722 and CDN enhance anti-VZV gE IgG titers by day 14 following the first immunization. The combination of CpG-2722 and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-cGAM(PS)2 induce the higher IgG titers than that induced by combination of CpG-2722 and 2’2’-cGAMP and combination of CpG-2722 and 3’3’-cGAMP adjuvanted vaccines. After the second immunization, IgG levels further increase across all groups, and the titers induced by the combination of CpG-2722 and 3’3’-cGAMP formulations eventually reaches levels comparable to those induced by the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 and combination of CpG-2722 / 2’3’-cGAM(PS)2 formulations. These elevated IgG titers remained stable up to 28 days post-boost (day 42) without additional immunizations (FIG. 8 (2), FIG. 8 (3), and FIG. 8 (4)). In contrast, antigen-specific IgA is not detected after the first immunization in any group but becomes evident 14 days after the second dose (day 28). Similar to IgG, IgA levels remained stable through day 28 post-boost (day 42). Among the tested combinations, combination of CpG-2722 and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-cGAM(PS)2 induce the strongest gE-specific IgA responses, significantly outperforming combination of CpG-2722 and 2’2’-cGAMP, and combination CpG-2722 and 3’3’-cGAMP (FIG. 8 (5), FIG. 8 (6), and FIG.8 (7))-2’3’-c-di-AM(PS)2 is a phosphorothioate analog of 2’3’-c-di-AMP. To assess the impact of this chemical modification on adjuvant activity, the immune responses elicited by combination of CpG-2722 and 2’3’-c-di-AM(PS)2, and combination of CpG-2722 and 2’3’-c-di-AMP aredirectly compared. In addition, the long-term antibody responses induced by these adjuvanted vaccines are evaluated. BALB / c mice are intranasally immunized twice at a two-week interval, and serum samples are collected bi-weekly for up to 98 days. Both formulations induce robust gE-specific IgG responses, with titers exceeding a 106-fold dilution (Logl0>6) by two weeks after the second immunization (day 28). These high IgG levels are maintained through day 98 without additional boosts. Notably, combination of CpG-2722 and 2’3’-c-di-AM(PS)2 shows greater potency than combination of CpG-2722 and 2’3’-c-di-AMP in inducing IgG titers (intranasal (total volume: 30 pl); gE: 5 pg; CpG-2722: 10 pg; and STING ligands: 5 pg) (FIG. 9 (1) and FIG. 9 (2)). These results demonstrate that the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 not only enhances short-term responses but also supports long-lasting immunity when used as a nasal vaccine adjuvant.

[0106] Dose-dependent and long-term adjuvant effects of the combination of CpG-2722 and 2’3’-c-di-AM(PS)2 for nasal VZV vaccine

[0107] To determine the optimal dose for achieving effective and long-lasting adjuvant activity with the combination of CpG-2722 and 2’3’-c-di-AM(PS)2, various dose levels in a nasal VZV vaccine formulation are tested. VZV gE antigen is adjuvanted with three different doses: 10 pg / 5 pg, 5 pg / 2.5 pg, and 2.5 pg / 1.25 pg of CpG-2722 / 2’3’-c-di-AM(PS)2. BALB / c mice are intranasally immunized twice, at a two-week interval, and blood samples are collected bi-weekly for up to 70 days (intranasal; total volume: 30 ml; gE: 5 mg; CpG-2722: 2.5, 5, and 10 mg; and STING ligands: 1.25, 2.5, and 5 mg) (FIG. 10A (1)). After the first immunization, higher gE-specific IgG responses are observed in the 10 pg / 5 pg group than in the 5 pg / 2.5 pg and 2.5 pg / 1.25 pg groups. However, following the second immunization, IgG titers increase to similar levels across all three dose groups. These high levels of IgG (Logl0~ 6) are sustained through day 70 without the need for further boosting (FIG. 10A (2)). In contrast, antigen-specific IgA responses exhibited a clear dose-dependent pattern. The 10 pg / 5 pg dose elicited the highest IgA titers than that induced by the 5 pg / 2.5 pg and 2.5 pg / 1.25 pg doses. This pattern persists throughout the 70-day study period (FIG. 10B (1)), suggesting that higher doses are necessary for optimal mucosal IgA induction, even though lower doses are sufficient to generate strong systemic IgG responses. To assess the overall impact of these formulations on the health of the mice, body weight is monitored throughout the experiment. No significant differences are observed among the groups (FIG. 10B (2)), indicating that the tested doses are well tolerated and do not adversely affect the animals’ general health.

[0108] Taken together, these findings suggest that combination of CpG-2722 and 2’3’-c-di-AM(PS)2 as adjuvant for nasal VZV vaccine induce potent Thl-skewed and sustained systemic and mucosal immune responses. The combination of CpG-2722 and 2’3’-c-di-AM(PS)2 therefore has the potential to be a safe and effective adjuvant system for durable nasal VZV vaccine formulations (FIG. 11).

[0109] Discussion

[0110] Patients with herpes zoster suffer from intense pain and discomfort caused by the reactivation of VZV, which lies dormant in sensory neurons after a primary chickenpox infection. When the virus reactivates, it migrates along peripheral nerves and produces a painful, vesicular rash confined to the corresponding dermatome. This cutaneous eruption is frequently accompanied by persistent burning, pruritus, and pronounced hyperesthesia; in severe cases these sequelae evolve into post herpetic neuralgia that can last for months after the rash resolves. Collectively, these manifestations markedly diminish quality of life, especially in older adults and individuals with impaired immunity. Age related immunosenescence, which weakens immune surveillance, is a principal driver of VZV reactivation in the elderly. Although antivirals such as acyclovir and valacyclovir shorten the period of viral replication and shedding, they neither eradicate latent virus nor reliably prevent reactivation or chronic neural injury. Hence, there is an unmet need for VZV vaccine that can elicit robust, durable, and multipronged protective immunity.

[0111] Recombinant subunit vaccines are generally safer than live attenuated formulations, yet exhibiting limited immunogenicity because purified proteins lack strong innate stimulating activity. The deliberate selection and optimization of potent adjuvants is therefore essential. Pattern recognition receptors (PRRs) such as Toll like receptors (TLRs) and the stimulator of interferon genes (STING) act as innate sentinels that detect conserved microbial structures and initiate cascades bridging innate and adaptive immunity. Agonists of these receptors have potent immune stimulatory activities to enhance vaccine performance and thus represent attractive scaffolds for next generation adjuvant design.

[0112] In conclusion, the present disclosure identifies combination of CpG-2722 and 2’3’-c-di-AM(PS)2 as a safe, scalable, and highly potent intranasal adjuvant for VZV subunit vaccines. The combination elicits vigorous and durable systemic IgG alongside robust mucosal IgA, driven by synergistic engagement of TLR9 and STING that fosters Thl polarization.Compared with the benchmark intramuscular Shingrix, this needle free strategy simplifies administration thus could markedly improve user acceptance. The CpG-2722 and 2’3’-c-di-AM(PS)2 are chemically synthesized, and are low cost and easy to produce. The strong immunogenicity, favourable safety profile, and mucosal targeting capability of CpG-2722 and 2’3’-c-di-AM(PS)2 warrant continued development as a next generation platform for preventing herpes zoster and other viral infections.

[0113] Those skilled in the art will readily observe that numerous modifications and alterations of the embodiments may be made while retaining the teachings of the disclosure. Accordingly, the above disclosure should be construed as limited only by the metes and bounds of the appended claims.

Claims

CLAIMSWhat is claimed is:

1. A vaccine composition, comprising:a glycoprotein E or an immunogenic fragment thereof of a varicella-zoster virus;a nucleic acid sensing toll-like receptor agonist selected from the group consisting of a toll-like receptor 7 agonist and a toll-like receptor 9 agonist;a stimulator of interferon genes agonist; anda pharmaceutically acceptable carrier.

2. The vaccine composition of claim 1, wherein the toll-like receptor 7 agonist is an imiquimod, and the toll-like receptor 9 agonist is a CpG-oligodeoxynucleotide.

3. The vaccine composition of claim 2, wherein the nucleic acid sensing toll-like receptor agonist is the toll-like receptor 9 agonist, and the CpG-oligodeoxynucleotide is a CpG-2722.

4. The vaccine composition of claim 1, wherein the stimulator of interferon genes agonist is a cyclic dinucleotide.

5. The vaccine composition of claim 4, wherein the cyclic dinucleotide is at least one selected from the group consisting of 2’3’-cGAMP, 3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’3’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

6. The vaccine composition of claim 1, whereinthe toll-like receptor 7 agonist is an imiquimod;the toll-like receptor 9 agonist is CpG-2722; andthe stimulator of interferon genes agonist is selected from the group consisting of 2’3’-cGAMP, 3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’3’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

7. A method for inducing an immune response in a subject in need thereof, comprising administering an effective amount of a vaccine composition of claim 1 to the subject.

8. The method of claim 7, wherein the toll-like receptor 7 agonist is an imiquimod, and the toll-like receptor 9 agonist is a CpG-oligodeoxynucleotide.

9. The method of claim 8, wherein the nucleic acid sensing toll-like receptor agonist is the toll-like receptor 9 agonist, and the CpG-oligodeoxynucleotide is a CpG-2722.

10. The method of claim 7, wherein the stimulator of interferon genes agonist is a cyclic dinucleotide.

11. The method of claim 10, wherein the cyclic dinucleotide is at least one selected from the group consisting of 2’3’-cGAMP, 3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’3’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

12. The method of claim 7, wherein the vaccine composition is administered to the subject by intramuscular administration or nasal administration.

13. A method for preventing an infectious disease, comprising administering an effective amount of a vaccine composition of claim 1 to a subject in need thereof.

14. The method of claim 13, wherein the toll-like receptor 7 agonist is an imiquimod, and the toll-like receptor 9 agonist is a CpG-oligodeoxynucleotide.

15. The method of claim 14, wherein the nucleic acid sensing toll-like receptor agonist is the toll-like receptor 9 agonist, and the CpG-oligodeoxynucleotide is a CpG-2722.

16. The method of claim 13, wherein the stimulator of interferon genes agonist is a cyclic dinucleotide.

17. The method of claim 16, wherein the cyclic dinucleotide is at least one selected from the group consisting of 2’3’-cGAMP, 3’3’-cGAMP, c-di-GMP, c-di-AMP, 2’ 3 ’-c-di-AMP, 2’3’-cGAM(PS)2, c-di-AM(PS)2, 2’2’-cGAMP, and 2’3’-c-di-AM(PS)2.

18. The method of claim 13, wherein the vaccine composition is administered to the subject by intramuscular administration or nasal administration.

19. The method of claim 13, wherein the infectious disease is herpes zoster.

Images