Methods of treatment of metabolic diseases

Abstract

This disclosure relates to methods and compositions for inhibiting expression and / or activity levels of nuclear receptor corepressor 1 (NC0R1) and / or myostatin (MSTN) to treat various diseases or disorders.

Description

[0001] METHODS OF TREATMENT OF METABOLIC DISEASES

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application is entitled to priority pursuant to 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 711,756, filed on October 25, 2024. The content of the application is incorporated herein by reference in its entirety.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (365636.00006SeqList.xml; Size: 93,461 bytes; and Date of Creation: October 23, 2025) is herein incorporated by reference in its entirety.

[0006] FIELD OF THE INVENTION

[0007] The present invention relates generally to methods and compositions that are useful for treating various diseases and disorders.

[0008] BACKGROUND OF THE INVENTION

[0009] Obesity affects over 650 million people globally. Notably, obesity is associated with various health risks and complications. Approximately 30% of those suffering from obesity have type II diabetes and about 21% have an increased risk of heart attack. Additionally, over 90% of people with obesity have non-alcoholic fatty liver disease (NAFLD). Consequently, there remains a need for effective obesity treatments. In recent years, several pharmacological treatments have been introduced to address obesity and type II diabetes, with GLP-1 receptor agonists being among the most prominent. Drugs such as semaglutide and liraglutide have shown efficacy in reducing body weight and improving glycemic control. These agents work by decreasing appetite and delaying gastric emptying, leading to weight loss and improved metabolic parameters. While effective in managing the symptoms of metabolic disorders, these drugs often require chronic administration and do not fully replicate the benefits of regular physical activity, particularly in enhancing energy expenditure, muscle function, and long-term metabolic health.

[0010] Additionally, therapies aimed at preserving muscle mass and metabolic function in obesity-related conditions, such as myostatin inhibitors and selective androgen receptor modulators (SARMs), have shown promise in maintaining muscle mass during periods of caloric restriction or muscle wasting. However, these drugs focus primarily on muscle preservation and hypertrophy, without addressing the comprehensive metabolic improvements driven by exercise, such as increased mitochondrial function, enhanced fat oxidation, and glucose uptake in skeletal muscle.

[0011] Despite the availability of pharmacological treatments for obesity and type II diabetes, several significant limitations remain, which include, but are not limited to (i) incomplete replication of exercise benefits, (ii) chronic administration and compliance issues, (iii) limited impact on energy expenditure, and (iv) variable patient response: (a) incomplete replication of exercise benefits: While GLP-1 receptor agonists and other metabolic drugs improve weight loss and glycemic control, they do not fully replicate the systemic benefits of regular physical exercise. Exercise exerts profound effects on muscle tissue, improving insulin sensitivity, enhancing mitochondrial biogenesis, increasing fatty acid oxidation, and promoting an anti-inflammatory environment. These benefits are critical for long-term metabolic health, yet are not adequately achieved through current therapies; (b) chronic administration and compliance issues: Most pharmacological treatments, including GLP-1 receptor agonists, require long-term, repeated administration to maintain efficacy. This can result in reduced patient adherence, increased costs, and potential for adverse side effects over time. Patients often struggle with the burden of daily or weekly injections, and long-term commitment to such therapies can diminish the overall therapeutic impact; (c) limited impact on energy expenditure: Current drug therapies are generally focused on appetite suppression or insulin modulation, without significantly enhancing energy expenditure at the cellular level. Exercise induces a significant increase in basal metabolic rate through mitochondrial activation and improved muscle function, which is not fully achieved by existing pharmacotherapies; and (d) variable patient response: Not all patients respond equally to current treatments for obesity and type II diabetes. Some individuals experience only modest weight loss or glycemic improvement, and the sustainability of these effects often diminishes over time. There is a need for more targeted and effective treatments that provide durable metabolic benefits for a broader range of patients.

[0012] Given the limitations of existing therapies, there is an urgent need for a modernized medical approach that leverages novel technologies that can mimic the comprehensive metabolic benefits of physical exercise, providing long-lasting improvements in the treatment of obesity, type II diabetes, and related metabolic disorders. SUMMARY OF THE INVENTION

[0013] This disclosure relates to a method of treating a disease or disorder in subject in need thereof. In particular, provided is a method that targets and upregulates key metabolic pathways that are naturally activated during physical exercise with the goal of increasing energy expenditure, enhancing glucose uptake, and promoting fat oxidation in skeletal muscle and adipose tissue, without the need for repeated administration or adherence to challenging lifestyle interventions. In some embodiments, the method comprises administering to the subject a combination of a first agent that decreases the activity or expression of nuclear receptor corepressor 1 (NC0R1) and / or a second agent that decreases the activity or expression of myostatin (MSTN) in a cell of the subject.

[0014] In some embodiments, the disorder or disease is type I diabetes, type II diabetes, nonalcoholic fatty liver disease (NAFLD), obesity, insulin resistance, dementia, cardiovascular disease, chronic kidney disease, heart failure, a mitochondrial disease, or Barth syndrome. In some embodiments, the disorder or disease is associated with muscle atrophy, weakness and / or degeneration. In some embodiments, the disorder or disease is muscular dystrophy, myotonic dystrophy (DM), amyotrophy, sarcopenia, sarcopenic obesity, myalgias, hypotonia, or cachexia.

[0015] In some embodiments, the first or second agent is an antibody, an aptamer, a protein, a peptide, a nucleic acid, or a small molecule. In some embodiments, the first or second agent is carried on a viral vector or a non-viral vector. In one embodiment, the first and second agents are carried on the same vectors.

[0016] In some embodiments, the first agent comprises a shRNA that inhibits the expression or activity of NC0R1. In some embodiments, the second agent comprises a shRNA that inhibits the expression or activity of MSTN.

[0017] In some embodiments, the viral vector is selected from the group consisting of adenoviral vector, adeno-associated virus (AAV) vector, and lentiviral vector. In some embodiments, the viral vector is an AAV vector.

[0018] In some embodiments, the AAV vector comprises a first cassette comprising a first promoter operably linked to an shRNA that targets NC0R1, the first cassette being linked to a second cassette, wherein the second cassette comprises a second promoter operably linked to an shRNA that targets MSTN. In some embodiments, the shRNA that targets NCOR1 comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-12 and 20, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-12 and 20. In some embodiments, the shRNA that targets MSTN comprises a polynucleotide sequence of any one of SEQ ID NOs: 21-31, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 21-31.

[0019] In some embodiments, the first or second promoter comprises a polymerase 11 or a polymerase III promoter. In some embodiments, the first or second promoter comprises a polynucleotide sequence of any one of SEQ ID NOs: 40-42, or comprises a polynucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 40-42. In some embodiments, the first cassette comprises the polynucleotide sequence of SEQ ID NO: 43 or 44, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 43 or 44, and the second cassette comprises the polynucleotide sequence of SEQ ID NO: 45 or 46, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 45 or 46. In some embodiments, the first and second cassettes comprise different or the same promoters.

[0020] In some embodiments, the vector further comprises a spacer element positioned between the first cassette and the second cassette. In some embodiments, the spacer element has a length of 25-2,500 base pairs (bp).

[0021] In some embodiments, the vector comprises a pair of inverted terminal repeats (ITRs) respectively positioned upstream of the first cassette and downstream of the second cassette. In some embodiments, the ITRs are derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13. In some embodiments, the ITRs are mutated.

[0022] In some embodiments, the AAV vector further comprises at least one post transcriptional regulatory element. In some embodiments, the AAV vector comprises a genome derived from AAV serotype AAV1, AAV6, AAV6.2FF, AAV8, AAV9, AAVrh74, or MYOAAV.

[0023] In some embodiments, the AAV vector is administered at a dose ranging from about 1.0 x 1010to about 4.0 x 1014vector genomes (vg). In some embodiments, the method further comprises administering to the subject an agent that modulates the activity or expression of DMN2 (Dynamin-2), IGF1 (Tnsulin-like growth factor 1), FGF-21 (Fibroblast growth factor 21), PGC-la (Peroxisome proliferator-activated receptor-gamma coactivator- 1 alpha), HDAC3 (Histone deacetylase 3), HDAC11 (Histone deacetylase 11), HDAC1 (Histone deacetylase 1), MYMK (myomaker, myoblast fusion factor), F0X01 (Forkhead box 01), FOXO4 (Forkhead box 04), NRF1 (Nuclear respiratory factor 1), NRF2 (Nuclear factor erythroid 2-related factor 2), ERRa (Estrogen-related receptor alpha), MuRF (Muscle Ring-Finger Protein, which includes all variants- MuRFl, MuRF2, and MuRF3), MyoD (myogenic differentiation 1), MEF2A (Myocyte enhancer factor 2A), SMAD2 / 3 (Mothers against decapentaplegic homolog 2 / Mothers against decapentaplegic homolog 3), mTORCl (Mammalian target of rapamycin complex 1), RICTOR (RPTOR independent companion of MTOR complex 2), RAPTOR, GLUT4 (Glucose transporter type 4 ), GLUT2 (Glucose transporter 2 ), IRS1 (Insulin receptor substrate 1), IRS4 (Insulin receptor substrate 4), PI3k (Phosphatidylinositol-3 kinase), SIRT1 (Sirtuin 1), MAPK (Mitogen-activated protein kinase), or solute carrier family 22 member 5 (0CTN2 or SLC22A5).

[0024] In some embodiments, the agents are administered to the subject intravenously, subcutaneously, regionally, or intramuscularly.

[0025] In some embodiments, the subject is a human. In some embodiments, the cell is a skeletal muscle cell. In one embodiment, the cell is an autologous cell.

[0026] In one aspect, provided is a polynucleotide comprising a first cassette comprising a first promoter operably linked to an shRNA that targets NC0R1, and a second cassette comprising a second promoter operably linked to an shRNA that targets MSTN.

[0027] In some embodiments, provided is a recombinant vector comprising the polynucleotide as described herein. In one embodiment, provided is a viral particle comprising the polynucleotide as described herein or the vector as described herein. In one embodiment, provided is a nanoparticle comprising the polynucleotide as described herein or the vector as described herein.

[0028] In some embodiments, provided is a cell comprising the vector or the polynucleotide as described herein. In one embodiment, provided is an animal model comprising the vector or the cell as described herein.

[0029] In one embodiment, provided is a pharmaceutical composition comprising the cell or the vector (e.g., AAV vector) as described herein and a pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. 1 is a graph of the difference between body weight of Diet-Induced Obesity (DIO) mice or DIO rats on a high fat diet treated with vehicle control, AAV6 (SEQ ID NO: 48) or AAV8 (SEQ ID NO: 48) in the indicated studies.

[0031] FIG. 2 is a graph of the difference between body fat percentage of DIO mice or DIO rats on a high fat diet treated with vehicle control, AAV6 (SEQ ID NO: 48) or AAV8 (SEQ ID NO: 48) in the indicated studies.

[0032] FIG. 3 is a graph of the difference between lean muscle mass percentage of DIO mice or DIO rats on a high fat diet treated with vehicle control, AAV6 (SEQ ID NO: 48) or AAV8 (SEQ ID NO: 47) in the indicated studies.

[0033] FIG. 4 is a graph of plasma insulin levels over time during an oral glucose challenge test in DIO rats or mice treated with vehicle control, AAV6 (SEQ ID NO: 48) or AAV8 (SEQ ID NO: 48) in the indicated studies. OGTT indicates Oral Glucose Tolerance Testing.

[0034] FIG. 5 is a graph of the area under the curve of FIG. 4. * p<0.05.

[0035] FIGS.6A and 6B illustrate that STK-AVi does not result in signs of chronic toxicity. FIG.

[0036] 6A is a graph of AST (aspartate aminotransferase) levels in DIO mice treated with AAV8 (SEQ ID NO: 47) or vehicle control. FIG. 6B is a graph of ALT (alanine transaminase) levels in DIO mice treated with AAV8 (SEQ ID NO: 47) or vehicle control. X-axes in both FIGS. 6A and 6B depicts weeks post-injection.

[0037] FIG. 7 is a schematic of the pscAAV-tMCK-MSTN-shmir-NCORlshmir vector (SEQ ID NO: 49).

[0038] FIG.8 is a schematic of the pscAAV-U6-Mstn-shRNA-U6-Ncorl-shRNA vector (SEQ ID NO: 48).

[0039] FIG. 9 is a schematic of the pscAAV-STK-AVi-Mk3 vector (SEQ ID NO: 47).

[0040] FIG. 10 is a graph of the expression level of MSTN of human LHCN-M2 and mouse C2C12 skeletal muscle cell lines that were transfected with AAV plasmid DNA containing a multispecies shRNA targeting MSTN. qPCR expression was normalized to GAPDH and reported as fold change using the 2A-AACt method. Cells were transfected with pscAAV-CMV-GFP-P2A- NLuc-Hl-mh-MSTN-shRNAlO (SEQ ID NO: 29). Bars show mean ± SEM (n = 3 biological replicates per group; technical replicates averaged). Two-way ANOVA showed a large main effect of treatment (F(l,8) = 458, p < 0.0001), with no effect of cell type (F(l,8) = 0.47, p =0.511) and no interaction (F(l,8) = 0.47, p = 0.511); treatment explained 98.1% of total variance. Sidak’s post-hoc (within rows) confirmed RNAi < Mock in both cell types: Cell Type 1 : 1.000 vs 0.1967, mean diff = 0.8033 (95% CI 0.6623-0.9444), adjusted p < 0.0001; Cell Type 2: 1.000 vs 0.2467, mean diff = 0.7533 (95% CI 0.6123-0.8944), adjusted p < 0.0001. (=80% and =75% knockdown, respectively). ****p < 0.0001.

[0041] FIG. 11 is a graph of the expression level of NCOR1 of human LHCN-M2 and mouse C2C12 skeletal muscle cell lines that were transfected with AAV plasmid DNA containing a multispecies shRNA targeting NCOR1. Cells were transfected with pscAAV -CMV-GFP-P2A-NLuc-Hl-mh-NCORl-shRNA10-mir-d30-loop (SEQ ID NO: 56). qPCR expression was normalized to GAPDH and reported as fold change using the 2A-AACt method. Bars show mean ± SEM (n = 3 biological replicates per group; technical wells averaged). Two-way ANOVA showed a main effect of treatment (F( 1,8) = 23.2, p = 0.0013; 68.3% of variance explained), with no effect of cell type (F(l,8) = 1.12, p = 0.3196) and no interaction (F(l,8) = 1.65, p = 0.2349). Sidak’s within-row comparisons confirmed RNAi < Mock in Cell Type 1 (Mock 1.020 vs RNAi 0.4733; mean diff = 0.5467, 95% CI 0.1994-0.8940, adjusted p = 0.0051) and showed a similar but nonsignificant reduction in Cell Type 2 (Mock 1.000 vs RNAi 0.6833; mean diff = 0.3167, 95% CI - 0.0306-0.6640, adjusted p = 0.0724). (=53% and =32% knockdown, respectively). **p < 0.01; ns, not significant.

[0042] DETAILED DESCRIPTION OF THE INVENTION

[0043] This disclosure is based at least in part on an unexpected discovery associated with inhibition of the activity or expression of both nuclear receptor corepressor 1 (NC0R1) and myostatin (MSTN or growth differentiation factor 8 (GDF8)). Such inhibition can serve as a therapeutic for treating a variety of diseases or disorders, including metabolic diseases such as diabetes (type I and type II), insulin resistance, Non-Alcoholic Fatty Liver Disease (NAFLD), and Non-Alcoholic Steatohepatitis (NASH). Also provided are agents inhibiting NC0R1 and MSTN and methods of using such agents. NC0R1 is a scaffolding basis for a large corepressor complex that comprises protein deacetylases, transducin beta-like 1 (TBL1) and TBLR1, two highly related F box / WD40-containing factors, and the G-protein-pathway suppressor 2 (GPS2). NC0R1 comprises N-terminal Silencing Domains (SDs) that recruit proteins to form the larger corepressor complex, and C-terminal Receptor Interaction Domains (RIDs) that tether these complexes to their nuclear receptor partners on target genes. Different variants of NC0R1 exist due to alternative splicing. NC0R1 regulates immunometabolic processes and negatively affects muscle mass (Verbrugge et al. Front Physiol. 2018. 9: 553). It has also been shown that NC0R1 is a negative transcriptional regulator of fatty acid oxidation (see, e.g., International Publication No. WO2012153191, which is herein incorporated by reference in its entirety).

[0044] MSTN is a negative regulator of skeletal muscle growth and a member of the transforming growth factor (TGF) family. The MSTN protein comprises a secretion signal sequence, a proteolytic processing site, and a carboxy-terminal region with a conserved pattern of nine cysteine residues. MSTN is translated as a precursor protein, which undergoes proteolytic processing events to form active MSTN. MSTN activates the JNK / Erk 1 / 2 (c-Jun N-terminal kinase / Erk 1 / 2) signaling pathway. MSTN also is involved in regulating protein synthesis and degradation. For example, MSTN suppresses the AKT pathway and signals through FOXO transcription factors to increase protein degradation. MSTN can also alter the activity of the protein kinase AKT, which ultimately inhibits protein synthesis.

[0045] A combination of a NC0R1 inhibitor and a MSTN inhibitor (collectively “NC0R1 and MSTN inhibitors”) may be used in a subject in need thereof, for example, to treat or prevent (i) a metabolic disease or disorder (such as obesity, diabetes (type I and type II), insulin resistance, NASH, NAFLD, Barth syndrome, etc.), (ii) a disease or disorder associated with muscle atrophy, weakness and / or degeneration, or (iii) a muscle injury or a spinal cord injury.

[0046] In some embodiments, the NC0R1 and MSTN inhibitors decrease body fat by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, or any value in-between.

[0047] In some embodiments, the NC0R1 and MSTN inhibitors increase insulin sensitivity. In some embodiments, the NCOR1 and MSTN inhibitors increase lean muscle mass by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70% or any value in-between.

[0048] In some embodiments, the NCOR1 and MSTN inhibitors increase energy expenditure, as measured by various methods known in the art such as VO2 max, by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75% or any value in-between. In some embodiments, the NCOR1 and MSTN inhibitors increase fatty oxidation and decrease fat accumulation.

[0049] In some embodiments, the NCOR1 and MSTN inhibitors target NCOR1 and MSTN in skeletal muscle. In some embodiments, the NCOR1 and MSTN inhibitors target NCOR1 and MSTN in the liver. In some embodiments, the NCOR1 and MSTN inhibitors target NCOR1 and MSTN in the heart. In some embodiments, the NCOR1 and MSTN inhibitors target NCOR1 and MSTN in adipose tissue.

[0050] NCOR1 and MSTN Inhibitors

[0051] In some embodiments, the agents comprise both NCOR1 and MSTN inhibitors. In one embodiment, the agents individually comprise an MSTN inhibitor or an NCOR1 inhibitor.

[0052] In some embodiments, the NCOR1 and MSTN inhibitor comprises an antibody or antigenbinding fragment thereof, an aptamer, a protein, a peptide, a nucleic acid, or a small molecule. In some embodiments, the NCOR1 and MSTN inhibitors are different agents selected from an antibody or antigen-binding fragment thereof, an aptamer, a protein, a peptide, a nucleic acid, and a small molecule.

[0053] In some embodiments, the NCOR1 and MSTN inhibitors cause complete or partial inhibition. In some embodiments, the NCOR1 inhibitors result in at least about 5% reduction in NCOR1 expression levels or activity such as at least about 5%, about 10%, about 15%, about 20%„ about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any amount in-between. In some embodiments, the MSTN inhibitors cause at least about 5%, about 10%, about 15%, about 20% reduction in MSTN expression levels or activity such as at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or any amount in-between.

[0054] In some embodiments, the AAV vector comprises a first cassette comprising a first promoter operably linked to an shRNA that targets NCOR1, the first cassette being linked to a second cassette, wherein the second cassette comprises a second promoter operably linked to an shRNA that targets MSTN.

[0055] In some embodiments, the shRNA that targets NCOR1 comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-12 and 20, or comprises a polynucleotide sequence having at least 70% (e.g, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to any one of SEQ ID NOs: 1-12 and 20.

[0056] In some embodiments, the shRNA that targets MSTN comprises a polynucleotide sequence of any one of SEQ ID NOs: 21-31, or comprises a polynucleotide sequence having at least 70% (e.g., 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to any one of SEQ ID NOs: 21-31.

[0057] Vector

[0058] “Vector,” as used herein, refers to a vehicle that comprises a polynucleotide to be delivered into a host cell, either in vitro, ex vivo or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle, or a virus (including virus derived sequences). A vector may also refer to a virion comprising a nucleic acid to be delivered into a host cell, either in vitro, ex vivo or in vivo. Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, comprising expression cassettes that express the agents of interest can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells. Other methods for delivering the vector to cells include hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery systems for gene delivery see Nayerossadat, N. et al. (Adv Biomed Res.

[0059] 2012; 1:27) incorporated herein by reference.

[0060] In some embodiments, a vector refers to a virion comprising a recombinant viral genome, wherein the viral genome comprises one or more inverted terminal repeats (ITRs) and an shRNA that targets at least one of NCOR1 or MSTN. In some embodiments, the ITRs are derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13. ITRs are symmetrical 145 nucleotide sequences that flank the ends of the DNA genome of a viral genome (such as that of AAV). ITRs comprise a nucleotide Rep binding element (RBE), a terminal resolution site (trs) site, and three palindromic sequences (A-A’ , B-B’, and C-C’ regions). In some embodiments, the ITRs are mutated. Examples of ITR mutations include, but are not limited to mutations in the trs site or the RBE site. In some embodiments, the ITRs comprise deletion of one or multiple (or a combination) of the A, B, C, RBE, or trs sites. In some embodiments, the deletion of an ITR can be replaced by an artificial ITR. In some embodiments, the ITRs are mutated to allow the vectors to be self-complementary or single-stranded. In some embodiments, the ITRs are comprised of nucleotide sequences that allow for the generation of artificial ITRs.

[0061] In some embodiments, the AAV vector further comprises at least one post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Examples of WPRE include, but are not limited to WPRE2, WPRE3, and WPRE6. In some embodiments, a WPRE sequence described in Zanta-Boussif et al., Validation of a mutated PRE sequence allowing high and sustained transgene expression while abrogating WHV-X protein synthesis: application to the gene therapy of WAS. Gene Ther. 2009 May;16(5):605-19 is used. In one embodiment, the WPRE comprises the sequence of SEQ ID NO: 50.

[0062] SEQ ID NO: 50 (WPRE):

[0063] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTT GCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTT CCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAG GAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCA ACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTT TCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGA CAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGT CCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTG CTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCT CTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGG CCGCCTCCCCGC

[0064] In some embodiments, the post-transcriptional regulatory element is an Internal Ribosome Entry Site (IRES), a polyadenylation signal (pA) (such as bovine growth hormone (BGH) pA or SV403’ polyadenylation signal) as known in the art.

[0065] In some embodiments, the AAV vector further comprises one or more enhancers. Enhancers are sequences that increase the transcription of genes.

[0066] In some embodiments, the AAV vector comprises a genome derived from AAV serotype AAV1, AAV6, AAV6.2FF, AAV8, AAV9, AAVrh74, or MYO AAV. In some embodiments, the AAV vector comprises a sequence with at least 90% identity to a sequence shown in Table 7 such as at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount in-between as long as the vector retains its ability to inhibit NCOR1 and / or MSTN.

[0067] In some embodiments, the AAV vector comprises a sequence as shown in Table 7.

[0068] In some embodiments, the vector described herein comprises two shRNA sequences where one shRNA targets NCOR1 and the other shRNA targets MSTN. In some embodiments, the shRNA sequences are 21-22 base pairs in length. In some embodiments, the shRNA sequences comprise any one of the sequences shown in Tables 1-4.

[0069] In some embodiments, the recombinant vector is a viral vector or a combination of multiple viral vectors. In one aspect, provided is a vector comprising any of the expression constructs disclosed herein.

[0070] A “recombinant viral genome” refers to a viral genome produced by recombinant DNA techniques, i.e., produced from cells transformed by an exogenous DNA construct encoding the desired genome. The term “recombinant” when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.

[0071] In some embodiments, the vector comprises a polynucleotide sequence described herein. In some embodiments, the vector is a viral vector is selected from the group consisting of adenoviral vector, adeno-associated virus (AAV) vector, and lentiviral vector. In one embodiment, viral vector is an AAV vector.

[0072] In some embodiments, the vector comprises a polynucleotide comprising a first cassette comprising a first promoter operably linked to an shRNA that targets NC0R1; and a second cassette comprising a second promoter operably linked to an shRNA that targets MSTN. In some embodiments, the first or second promoter comprises a polymerase II or a polymerase III promoter. Examples of a polymerase III (Pol III) promoter include, 7SK, Hl and U6. In some embodiments, the promoter comprises a sequence as shown in Table 5. The polymerase II promoter is known in the art (Juven-Gershon et al. Curr Opin Cell Biol. 2008. 20(3): 253-259).

[0073] In some embodiments, the first cassette comprises the polynucleotide sequence of SEQ ID NO: 43 or 44, or comprises a polynucleotide sequence having at least 75% (e.g., 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 43 or 44. In some embodiments, the second cassette comprises the polynucleotide sequence of SEQ ID NO: 45 or 46, or comprises a polynucleotide sequence having at least 75% (e.g., 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 45 or 46.

[0074] In some embodiments, the first cassette comprises the polynucleotide sequence of SEQ ID NO: 43 or comprises a polynucleotide sequence having at least 75% (e.g, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 43, and the second cassette comprises the polynucleotide sequence of SEQ ID NO: 45 or comprises a polynucleotide sequence having at least 75% (e.g., 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 45. In some embodiments, the first cassette comprises the polynucleotide sequence of SEQ ID NO: 44 or comprises a polynucleotide sequence having at least 75% (e.g, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 44 and the second cassette comprises the polynucleotide sequence of SEQ ID NO: 46 or comprises a polynucleotide sequence having at least 75% (e.g., 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NO: 46.

[0075] In some embodiments, the cassettes comprise different or the same promoters. In one embodiment, the cassettes further comprise a polyA termination sequence.

[0076] In some embodiments, the vector comprises a spacer element between a termination sequence operably linked to the cassette. In one embodiment, the vector further comprises a spacer element having a length of 25-2,500 bp (e.g., 25 bp, 75 bp, 125 bp, 175 bp, 225 bp, 275 bp, 325 bp, 375 bp, 425 bp, 475 bp, 525 bp, 575 bp, 625 bp, 675 bp, 725 bp, 775 bp, 825 bp, 875 bp, 925 bp, 975 bp, 1025 bp, 1075 bp, 1125 bp, 1175 bp, 1225 bp, 1275 bp, 1325 bp, 1375 bp, 1425 bp, 1475 bp, 1525 bp, 1575 bp, 1625 bp, 1675 bp, 1725 bp, 1775 bp, 1825 bp, 1875 bp, 1925 bp, 1975 bp, 2025 bp, 2075 bp, 2125 bp, 2175 bp, 2225 bp, 2275 bp, 2325 bp, 2375 bp, 2425 bp, 2475 bp, 2500 bp, or any intermediate values therebetween) between a termination sequence operably linked to the cassette comprising the MSTN shRNA and the promoter region for NCOR1. In one embodiment, the cassette comprising the MSTN shRNA is before the spacer element. In one embodiment, the cassette comprising the promoter region for NCOR1 is before the spacer element.

[0077] Nucleic Acid

[0078] In one embodiment, provided is a nucleic acid that inhibits MSTN and / or NCOR1. As used herein, the term “nucleic acid” refers to two strands comprising nucleotides that are able to interfere with gene expression of MSTN and / or NCOR1. The resulting inhibition of MSTN and / or NCOR1 can be complete or partial.

[0079] In one embodiment, the nucleic acid encodes an shRNA that inhibits the expression or activity ofNCORl. In some embodiments, the shRNA that inhibits the expression or activity of NCOR1 comprises a sequence as shown in Table 1 or Table 2. In some embodiments, the shRNA has at least 80% identity to a sequence as shown in Table 1 or Table 2 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between.

[0080] In some embodiments, the nucleic acid targeting sequence for NCOR1 has at least 80% identity to SEQ ID NO: 85 (GCTCTCAAAGTTCAGACTCTT) such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between.

[0081] Table 1. Representative shRNA sequences targeting human NCOR1.

[0082] SEQ ID shRNA Sequence

[0083] NO:

[0084] 1 ACCGCAGGAGAATAATGAGAAACACTCGAGTGTTTCTCATTATTCTCCT GCTTT

[0085] 2 ACCGGAAGGAAATATAAAGCAAGGCTCGAGCCTTGCTTTATATTTCCTT CCTTT

[0086] 3 ACCGCTGATATGCCGAGCATTACCCTCGAGGGTAATGCTCGGCATATCA GCTTT

[0087] 4 ACCGCATTTGAAGGTGCCATTACCCTCGAGGGTAATGGCACCTTCAAAT GCTTT

[0088] 5 ACCGGTCGTAACTGGGCAGCAATTCTCGAGAATTGCTGCCCAGTTACGA CCTTT

[0089] 6 ACCGCTCCACATCAAGTGATAACTCTCGAGAGTTATCACTTGATGTGGA GCTTT

[0090] 7 ACCGCTACTTGCCTTCATTCTTCACTCGAGTGAAGAATGAAGGCAAGTA GCTTT

[0091] 8 ACCGCTCTCAAAGTTCAGACTCTTCTCGAGAAGAGTCTGAACTTTGAGA GCTTT

[0092] 9 ACCGCCATCAGATACCAAGGTGTACTCGAGTACACCTTGGTATCTGATG GCTTT

[0093] 10 ACCGCTAGGAGTGAGCATGAGATTCTCGAGAATCTCATGCTCACTCCTA GCTTT

[0094] 11 GCATGAAGCTGCCAGGTTAGACCTCTCAACACTGGTCTAACCTGGCAGC TTCATGC

[0095] 12 GCATGAAGCTGCCAGGTTAGACCTCTCAACACTGGTCTAACCTGGCAGC TTCATGC

[0096] 20 ACCGCCACTCTATAACCAGCCATCCTCGAGGATGGCTGGTTATAGAGTG

[0097]

[0098] GCTTT Table 2. Representative shRNA sequences targeting murine NC0R1.

[0099] SEQ ID shRNA Sequence

[0100] NO:

[0101] 13 ACCGCACAGAGCAAAGTCGTTATCCTCGAGGATAACGACTTTGCTCTGT GCTTT

[0102] 14 ACCGCAAAGTCGTTATCCTTCACACTCGAGTGTGAAGGATAACGACTTT GCTTT

[0103] 15 ACCGCAGGAATTTGCAGTTCCTGACTCGAGTCAGGAACTGCAAATTCCT GCTTT

[0104] 16 ACCGAAGCTCCATCCTCTCCTTTGCTCGAGCAAAGGAGAGGATGGAGCT TCTTT

[0105] 17 ACCGCAACCATGTGGAGATGACCACTCGAGTGGTCATCTCCACATGGTT GCTTT

[0106] 18 ACCGCTTCACCTTCAAAGCTTTCACTCGAGTGAAAGCTTTGAAGGTGAA GCTTT

[0107] 19 ACCGCTTTCAAAGGAGGAGTTAATCTCGAGATTAACTCCTCCTTTGAAA GCTTT

[0108] 20 ACCGCCACTCTATAACCAGCCATCCTCGAGGATGGCTGGTTATAGAGTG GCTTT

[0109] 8 ACCGCTCTCAAAGTTCAGACTCTTCTCGAGAAGAGTCTGAACTTTGAGA GCTTT

[0110] 9 ACCGCCATCAGATACCAAGGTGTACTCGAGTACACCTTGGTATCTGATG GCTTT

[0111] 10 ACCGCTAGGAGTGAGCATGAGATTCTCGAGAATCTCATGCTCACTCCTA GCTTT

[0112] 55 ACCGAAGCTCCATCCCTCCTTTGCTCGAGCAAAGGAGAGGATGGAGCTT

[0113]

[0114] CTTT

[0115] SEQ ID NOs: 8, 10, and 20 target both human and murine NCOR1.

[0116] In one embodiment, the nucleic acid encodes an shRNA that inhibits the expression or activity of MSTN. In some embodiments, the shRNA that inhibits the expression or activity of MSTN comprises a sequence as shown in Table 3 or Table 4. In some embodiments, the shRNA has at least 80% identity to a sequence as shown in Table 3 or Table 4 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between.

[0117] In some embodiments, the nucleic acid targeting sequence for MSTN has at least 80% identity to SEQ ID NO: 84 (GATTGGATTATCGCTCCTAAA) such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between. Table 3. Representative shRNA sequences targeting human MSTN.

[0118] SEQ ID shRNA Sequence

[0119] NO:

[0120] 21 ACCGCTGGTCCAGTGGATCTAAATCTCGAGATTTAGATCCACTGGACC AGCTTT

[0121] 22 ACCGGTCATGATCTTGCTGTAACCCTCGAGGGTTACAGCAAGATCATG ACCTTT

[0122] 23 ACCGCTCTGGAGAGTGTGAATTTGCTCGAGCAAATTCACACTCTCCAG AGCTTT

[0123] 24 ACCGCCCAACTATGGATATATTTGCTCGAGCAAATATATCCATAGTTG GGCTTT

[0124] 25 ACCGGCAGAGCATTGATGTGAAGACTCGAGTCTTCACATCAATGCTCT GCCTTT

[0125] 26 ACCGGAACTGATTGATCAGTATGACTCGAGTCATACTGATCAATCAGT TCCTTT

[0126] 27 ACCGCTACAACGGAAACAATCATTCTCGAGAATGATTGTTTCCGTTGT AGCTTT

[0127] 28 ACCGCTCCTAACATCAGCAAAGATCTCGAGATCTTTGCTGATGTTAGG AGCTTT

[0128] 29 ACCGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAG TGCTTT

[0129] 30 GGAGTGACTGCTGCATCTTAACCTCTCAACACTGGTTAAGATGCAGCA GTCACTCC

[0130] 31 GGCTCTTTGGAAGATGACGATTATTCAAGAGATAATCGTCATCTTCCA

[0131]

[0132] AAGAGCC

[0133] Table 4. Representative shRNA sequences targeting murine MSTN.

[0134] SEQ ID shRNA Sequence

[0135] NO:

[0136] 32 ACCGCTGGCCCAGTGGATCTAAATCTCGAGATTTAGATCCACTGGGCC AGCTTT

[0137] 33 ACCGCATTGAAATCAAAGCTTTGGCTCGAGCCAAAGCTTTGATTTCAA TGCTTT

[0138] 34 ACCGGATGAGAATGGCCATGATCTCTCGAGAGATCATGGCCATTCTCA TCCTTT

[0139] 35 ACCGCTCAGGAGAGTGTGAATTTGCTCGAGCAAATTCACACTCTCCTG AGCTTT

[0140] 36 ACCGCCTACAGAGTCTGACTTTCTCTCGAGAGAAAGTCAGACTCTGTA GGCTTT

[0141] 37 ACCGGCCATGATCTTGCTGTAACCCTCGAGGGTTACAGCAAGATCATG

[0142]

[0143] GCCTTT 38 ACCGGCAGAGTATTGATGTGAAGACTCGAGTCTTCACATCAATACTCT GCCTTT

[0144] 28 ACCGCTCCTAACATCAGCAAAGATCTCGAGATCTTTGCTGATGTTAGG AGCTTT

[0145] 39 ACCGCAGATTAAATAGTGGTCTTACTCGAGTAAGACCACTATTTAATCT GCTTT

[0146] 29 ACCGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAG TGCTTT

[0147] 51 ACCGCTGGCCCAGTGGATCTAAATCTGAGATTTAGATCCACTGGGCCA GCTTT

[0148] 52 ACCGCATTGAAATCAAGCTTGGCTCGAGCCAAAGCTATTTCAATGCTTT 53 ACCGCTCAGGAGAGTGTGAATTTGCTGAGCAAATTCACACTCTCCTGA GCTTT

[0149] 54 ACCGCAGATTAAATAGTGGTCTTACTGAGTAAGACCACTATTTAATCT

[0150]

[0151] GCTTT

[0152] SEQ ID NOs: 28 and 29 target both human and murine MSTN.

[0153] Table 5. Representative promoter sequences.

[0154] Promoter SEQ ID Sequence

[0155] Name NO:

[0156] Hl 40 GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCG GGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGT GCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGA GTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCT GGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGG GAATCTTATAAGTTCTGTATGAGACCAC

[0157] U6 41 GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATA CGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTT GACTGTAAACACAAAGATATTAGTACAAAATACGTGA CGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCG TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCT TGTGGAAAGGAC

[0158] U6 (G67 42 GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATA mutation) CGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTT GACTGTAAACACAAAGATATTAGTACAAAATACGTGA CGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCG TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCT

[0159]

[0160] TGTGGAAAGGAC Table 6. Representative cassette sequences.

[0161] Cassette Name SEQID Sequence

[0162] NO:

[0163] NC0R1 shRNA 43 GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATAT (positions 169- ACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT 478) of TTGACTGTAAACACAAAGATATTAGTACAAAATACGT pscAAV-U6- GACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT NC0R1- TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTA shRNA-U6- CCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATAT MSTN-shRNA ATCTTGTGGAAAGGACGAAACACCGCATGAAGCTGCC AGGTTAGACCTCTCAACACTGGTCTAACCTGGCAGCT TCATGCTTTTTT MSTN shRNA 44 GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATAT (positions 169- ACGATACAAGGCTGTTAGAGAGATAATTGGAATTAAT 478) of TTGACTGTAAACACAAAGATATTAGTACAAAATACGT pscAAV-STK- GACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT Avi- TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTA MK3 / pscAAV- CCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATAT U6-MSTN- ATCTTGTGGAAAGGACGAAACACCggctctttggaagatgacgatt shRNA-Hl- atTCAAGAGataatcgtcatcttccaaagagccTTTTTT

[0164] NC0R1- shRNA

[0165] MSTN shRNA 45 GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATAT (positions 523- ACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT 833) of TTGACTGTAAACACAAAGATATTAGTACAAAATACGT pscAAV-U6- GACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT NC0R1- TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTA shRNA-U6- CCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATAT MSTN-shRNA ATCTTGTGGAAAGGACGAAACACCGGAGTGACTGCTG CATCTTAACCTCTCAACACTGGTTAAGATGCAGCAGT CACTCCTTTTTT NC0R1 shRNA 46 GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCG (positions 614- GGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGT 897) of GCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGG pscAAV-STK- AGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTC Avi- TGGGAAATCACCATAAACGTGAAATGTCTTTGGATTT MK3 / pscAAV- GGGAATCTTATAAGTTCTGTATGAGACCACAGATCCC U6-MSTN- GCATGAAGCTGCCAGGTTAGACCTCTCAACACTGGTC shRNA-Hl- TAACCTGGCAGCTTCATGCTTTTTT

[0166] NC0R1-

[0167]

[0168] shRNA Table 7. Representative vector sequences.

[0169] Vector Name SEQID Sequence

[0170] NO:

[0171] pscAAV-STK- 47 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCC AVi-Mk3 GCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTC GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGG AGTGGACGCGTAGGCCTAAGCTTGGTACCGGATCCCTC GAGAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGA TTCCTTCATATTTGCATATACGATACAAGGCTGTTAGA GAGATAATTGGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTC TTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATG GACTATCATATGCTTACCGTAACTTGAAAGTATTTCGA TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGGCTCTTTGGAAGATGACGATTATTCAAGAGATAAT CGTCATCTTCCAAAGAGCCTTTTTTACGCGTAAGCTTCT CGGATACCCTTACTCTGTTGAAAACGAATAGATAGGTT AGGTTCTGTTAAGTAACTGAACCCAATGTCGTTAGTGA CGCTTACCTCTTAAGAGGTCACTGACCTAACAACTAGT GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGG AATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAG CGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGA CAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTAT GTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTG GATTTGGGAATCTTATAAGTTCTGTATGAGACCACAGA TCCCGCATGAAGCTGCCAGGTTAGACCTCTCAACACTG GTCTAACCTGGCAGCTTCATGCTTTTTTGAATTAGCTTG GTACCGGATCCCTCGAGAAGGTCGGGCAGGAACACCG GTTAATCGATAATCAACCTCTGGATTACAAAATTTGTG AAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTA CGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATG CTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGT ATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGG CCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTT TGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCA CCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCC CTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCC CGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACA ATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTT GGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGG ACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGC GGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGC CTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGG ATCTCCCTTTGGGCCGCCTCCCCGCATCGAAACCCGCT

[0172]

[0173] GATCAGCCGGTCATCATCACCATCACCATTGAGTTTAA ACCCGCTGATCAGCCTCGACTTCTGAGGCTTAATTAAG GGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCC TCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCT CAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCG CCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTAT TTCACACCGCATACGTCAAAGCAACCATAGTACGCGCC CTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA CGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCG CCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGT TCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTC CCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGA CCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTG GGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACG TTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAA ACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTT TGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTT AAAAAATGAGCTGATTTAACAAAAATTTAACGCGAAT TTTAACAAAATATTAACGTTTACAATTTTATGGTGCAC TCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCC AGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTG ACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAG CTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTT TCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCC TCGTGATACGCCTATTTTTATAGGTTAATGTCATGATA ATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAAT ACATTCAAATATGTATCCGCTCATGAGACAATAACCCT GATAAATGCTTCAATAATATTGAAAAAGGAAGAGTAT GAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTT TGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAAC GCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGT GCACGAGTGGGTTACATCGAACTGGATCTCAACAGCG GTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTT CCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGC GGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCG GTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAG TACTCACCAGTCACAGAAAAGCATCTTACGGATGGCAT GACAGTAAGAGAATTATGCAGTGCTGCCATAACCATG AGTGATAACACTGCGGCCAACTTACTTCTGACAACGAT CGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAAC ATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACC GGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCA AACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGG

[0174]

[0175] CAACAATTAATAGACTGGATGGAGGCGGATAAAGTTG CAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG TTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTC TCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG GCAACTATGGATGAACGAAATAGACAGATCGCTGAGA TAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGAC CAAGTTTACTCATATATACTTTAGATTGATTTAAAACTT CATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTT GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTC GTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAA GGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGC TGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGG TTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATAC TGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCA AGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTA ATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTC GTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGG ATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTG CACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGT AAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGA GCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTG TCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGC CAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTG GCCTTTTGCTCACATGT

[0176] pscAAV-U6- 48 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCC MSTN-shRNA- GCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTC U6-NC0R1- GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGG shRNA AGTGGACGCGTAGGCCTAAGCTTGGTACCGGATCCCTC GAGAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGA TTCCTTCATATTTGCATATACGATACAAGGCTGTTAGA GAGATAATTAGAATTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTC TTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATG GACTATCATATGCTTACCGTAACTTGAAAGTATTTCGA TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGCATGAAGCTGCCAGGTTAGACCTCTCAACACTGGT CTAACCTGGCAGCTTCATGCTTTTTTGAATTAGCTTGGT ACCGGATCCCTCGAGAAGGTCGGGCAGGAAGAGGGCC TATTTCCCATGATTCCTTCATATTTGCATATACGATACA AGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTA AACACAAAGATATTAGTACAAAATACGTGACGTAGAA

[0177]

[0178] AGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTAT GTTTTAAAATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAA GGACGAAACACCGGAGTGACTGCTGCATCTTAACCTCT CAACACTGGTTAAGATGCAGCAGTCACTCCTTTTTTGA ATTTCGACACCGGTTAATCGATAATCAACCTCTGGATT ACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTAT GTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATG CCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATT TTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGT GTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGG GCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTC GCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGC CGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGT TGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCA TCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGG ATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGC CGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTC AGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCAT CGAAACCCGCTGATCAGCCGGTCATCATCACCATCACC ATTGAGTTTAAACCCGCTGATCAGCCTCGACTGTGCCT TCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTG CCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTT TCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAG TAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGC ATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCT TAATTAAGGGCCGCAGGAACCCCTAGTGATGGAGTTG GCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGC CGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCC CGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCC TGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCAT CTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCA TAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGG GTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCC AGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCC TTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTA AATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTT ACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATG GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTT CGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGG ACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCT CGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT CGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAA

[0179]

[0180] TTTAACGCGAATTTTAACAAAATATTAACGTTTACAAT TTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCG CATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGC TTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGT GTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGA CGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAA TGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCA CTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTA TTTTTCTAAATACATTCAAATATGTATCCGCTCATGAG ACAATAACCCTGATAAATGCTTCAATAATATTGAAAAA GGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTT ATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGA TCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATC TCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCT ATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAG AGCAACTCGGTCGCCGCATACACTATTCTCAGAATGAC TTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTAC GGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCC ATAACCATGAGTGATAACACTGCGGCCAACTTACTTCT GACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCG TTGGGAACCGGAGCTGAATGAAGCCATACCAAACGAC GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAA CGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTA GCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGG ATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCG GCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGA GCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAG ATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACG GGGAGTCAGGCAACTATGGATGAACGAAATAGACAGA TCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGA TTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAA CGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGA AAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGC GCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTA CCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAAC TCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGA TACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGC CACCACTTCAAGAACTCTGTAGCACCGCCTACATACCT CGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTG GCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA

[0181]

[0182] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGG GGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGAC CTACACCGAACTGAGATACCTACAGCGTGAGCTATGA GAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCG CACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTT ATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGT CGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATG GAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGG CCTTTTGCTGGCCTTTTGCTCACATGT

[0183] pscAAV- 49 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCC tMCK- GCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTC MSTNshmir- GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGG NCORlshmir AGTGGACGCGTAGGCCTAAGCTTGGTACCTACGCGCTC TCTTAAGGTAGCCCCGGGACGCGTCAATTGGCCACTAC GGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGG GACACCCGAGATGCCTGGTTATAATTAACCCCAACACC TGCTGCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTG AGCGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCT GTACACCATGGAGGAGAAGCTCGCTCTAAAAATAACC CTGTCCCTGGTGGATCGCCACTACGGGTCTAGGCTGCC CATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGC CTGGTTATAATTAACCCCAACACCTGCTGCCCCCCCCC CCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCAC CCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGG AGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTGGAT CGCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCA AGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAAC CCCAACACCTGCTGCCCCCCCCCCCCAACACCTGCTGC CTGAGCCTGAGCGGTTACCCCACCCCGGTGCCTGGGTC TTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAA AAATAACCCTGTCCCTGGTGGATCCCTCCCTGGGGACA GCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTAT ATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCACCG CTAGCGTTTAAACTTAAGAGATCTGGATCCTGTTTGAA TGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACAT CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAAC CCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACA GTGAGCGAGCAAGCCCAAATGTTGCTTTATAGTGAAGC CACAGATGTATAAAGCAACATTTGGGCTTGCCTGCCTA CTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTA TCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGA TACATTTTTACAAAGCTGAATTAAAATGGTATAAATTA AATCACTTTACGCGGCCGCAATGGATCCTGTTTGAATG AGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCT TGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCC

[0184]

[0185] AACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGT GAGCGAGAGGAGTTAATACAGAGTATATAGTGAAGCC ACAGATGTATATACTCTGTATTAACTCCTCCTGCCTACT GCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATC TTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATA CATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAA TCACTTTACGCGATCCACGTGGTTTAAACCCGCTGATC AGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT TTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTG CCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATT GCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGG GGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG GGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGC TCTATGGCTTCTGAGGCTTAATTAAGGGCCGCAGGAAC CCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCT CGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCC GACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGA GCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGG TATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGC ATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGG CGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGC GTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCC TTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGG CTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAG GGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAA AAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATC GCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGT CCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGA ACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTA TAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAA TGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACA AAATATTAACGTTTACAATTTTATGGTGCACTCTCAGT ACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCG ACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTT GTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACC GTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTC ATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTT TCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCG CGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAA TATGTATCCGCTCATGAGACAATAACCCTGATAAATGC TTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCA ACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATT TTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGT GGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCC

[0186]

[0187] TTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATG AGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATC CCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGC ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACC AGTCACAGAAAAGCATCTTACGGATGGCATGACAGTA AGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGA CCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGA TCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGA ATGAAGCCATACCAAACGACGAGCGTGACACCACGAT GCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAA CTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTA ATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCAC TTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTG ATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATC ATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTAT CGTAGTTATCTACACGACGGGGAGTCAGGCAACTATG GATGAACGAAATAGACAGATCGCTGAGATAGGTGCCT CACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTAC TCATATATACTTTAGATTGATTTAAAACTTCATTTTTAA TTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCT CATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACT GAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTC TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCA AACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGC CGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACT GGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCT AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTG TAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTAC CGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGC CCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA CCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCG AAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAG GGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGG GGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCG CCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTC AGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG GCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCT

[0188]

[0189] CACATGT

[0190] In one embodiment, the nucleic acid encodes a miRNA (microRNA) that inhibits the expression or activity of NCOR1. In some embodiments, the miRNA that inhibits the expression or activity of NCOR1 comprises a sequence as shown in Tables 8-11. In some embodiments, the shRNA has at least 80% identity to a sequence as shown in Tables 8-11 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between.

[0191] In one embodiment, the nucleic acid encodes a miRNA that inhibits the expression or activity of MSTN. In some embodiments, the miRNA that inhibits the expression or activity of MSTN comprises a sequence as shown in Tables 8-11. In some embodiments, the shRNA has at least 80% identity to a sequence as shown in Tables 8-11 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value in-between.

[0192] In some embodiments, the mRNA has a loop structure as shown in Table 12.

[0193] Table 8. Representative MIR-25 sequences.

[0194] Name SEQ ID Sequence

[0195] NO:

[0196] MIR-25-NCOR1- 57 ACCGCTAGGAGTGAGCATGAGATTCCTCTCAACACT shRNAlO GGAATCTCATGCTCACTCCTAGCTTT

[0197] MIR-25-NCOR1- 58 ACCGCCATCAGATACCAAGGTGTACCTCTCAACACT h-shRNA9 GGTACACCTTGGTATCTGATGGCTTT

[0198] MIR-25-NCOR1- 59 ACCGCTTTCAAAGGAGGAGTTAATCCTCTCAACACT m-shRNA7 GGATTAACTCCTCCTTTGAAAGCTTT

[0199] MIR-25-MSTN- 60 ACCGCACTGGTATTTGGCAGAGTACCTCTCAACACT shRNAlO GGTACTCTGCCAAATACCAGTGCTTT

[0200] MIR-25-MSTN-h- 61 ACCGCTCCTAACATCAGCAAAGATCCTCTCAACACT shRNA9 GGATCTTTGCTGATGTTAGGAGCTTT

[0201] MIR-25-MSTN- 62 ACCGGCAGAGTATTGATGTGAAGACCTCTCAACACT m-shRNA7 GGTCTTCACATCAATACTCTGCCTTT

[0202]

[0203] Table 9. Representative MIR-17 sequences.

[0204] Name SEQ ID Sequence

[0205] NO:

[0206] MIR-17-NCOR1- 63 ACCGCTAGGAGTGAGCATGAGATTTGATATGTGCAA shRNAlO ATCTCATGCTCACTCCTAGCTTT

[0207] MIR-17-NCOR1- 64 ACCGCCATCAGATACCAAGGTGTATGATATGTGCAT h-shRNA9 ACACCTTGGTATCTGATGGCTTT

[0208]

[0209] MIR-17-NCOR1- 65 ACCGCTTTCAAAGGAGGAGTTAATTGATATGTGCAA m-shRNA7 TTAACTCCTCCTTTGAAAGCTTT

[0210] MIR-17-MSTN- 66 ACCGCACTGGTATTTGGCAGAGTATGATATGTGCAT shRNAlO ACTCTGCCAAATACCAGTGCTTT

[0211] MIR-17-MSTN-h- 67 ACCGCTCCTAACATCAGCAAAGATTGATATGTGCAA shRNA9 TCTTTGCTGATGTTAGGAGCTTT

[0212] MIR-17-MSTN- 68 ACCGGCAGAGTATTGATGTGAAGATGATATGTGCAT m-shRNA7 CTTCACATCAATACTCTGCCTTT

[0213]

[0214] Table 10. Representative MIR-A30 sequences.

[0215] Name SEQ ID Sequence

[0216] NO:

[0217] MIR- A30- 56 ACCGCTAGGAGTGAGCATGAGATTACCCTGACCCAG NCORl-shRNAlO TAATCTCATGCTCACTCCTAGCTTT

[0218] MIR-A30- 69 ACCGCCATCAGATACCAAGGTGTAACCCTGACCCAG NCORl-h- TTACACCTTGGTATCTGATGGCTTT

[0219] shRNA9

[0220] MIR-A30- 70 ACCGCTTTCAAAGGAGGAGTTAATACCCTGACCCAG NCORl-m- TATTAACTCCTCCTTTGAAAGCTTT

[0221] shRNA7

[0222] MIR-A30-MSTN- 71 ACCGCACTGGTATTTGGCAGAGTAACCCTGACCCAG shRNAlO TTACTCTGCCAAATACCAGTGCTTT

[0223] MIR-A30-MSTN- 72 ACCGCTCCTAACATCAGCAAAGATACCCTGACCCAG h-shRNA9 TATCTTTGCTGATGTTAGGAGCTTT

[0224] MIR-A30-MSTN- 73 ACCGGCAGAGTATTGATGTGAAGAACCCTGACCCAG m-shRNA7 TTCTTCACATCAATACTCTGCCTTT

[0225]

[0226] Table 11. Representative ALR-A30 sequences.

[0227] Name SEQ ID Sequence

[0228] NO:

[0229] ALR-A30- 74 ACCGCTAGGAGTGAGCATGAGATTCTCCTGCTACCC NCORl-shRNAlO TGACCCAGTAGCCCAAGAATCTCATGCTCACTCCTA

[0230] GCTTT

[0231]

[0232] ALR-A30- 75 ACCGCCATCAGATACCAAGGTGTACTCCTGCTACCC NCORl-h- TGACCCAGTAGCCCAAGTACACCTTGGTATCTGATG shRNA9 GCTTT

[0233] ALR-A30- 76 ACCGCTTTCAAAGGAGGAGTTAATCTCCTGCTACCC NCORl-m- TGACCCAGTAGCCCAAGATTAACTCCTCCTTTGAAA shRNA7 GCTTT

[0234] ALR-A30-MSTN- 77 ACCGCACTGGTATTTGGCAGAGTACTCCTGCTACCCT shRNAlO GACCCAGTAGCCCAAGTACTCTGCCAAATACCAGTG CTTT ALR-A30-MSTN- 78 ACCGCTCCTAACATCAGCAAAGATCTCCTGCTACCC h-shRNA9 TGACCCAGTAGCCCAAGATCTTTGCTGATGTTAGGA GCTTT ALR-A30-MSTN- 79 ACCGGCAGAGTATTGATGTGAAGACTCCTGCTACCC m-shRNA7 TGACCCAGTAGCCCAAGTCTTCACATCAATACTCTG

[0235] CCTTT

[0236]

[0237] Table 12. Representative loop sequences.

[0238] Name SEQ ID Sequence

[0239] NO:

[0240] ALR-A30 80 CACTCCTGCTACCCTGACCCAGTAGCCCAAGTG MIR- A30 81 ACCCTGACCCAGT

[0241] MIR- 17 82 TGATATGTGCA

[0242] MIR-25 83 CCTCTCAACACTGG

[0243]

[0244] As used herein, the term, “nucleic acid” refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term can include single-stranded and doublestranded polynucleotides.

[0245] In some embodiments, the nucleic acid comprises a chemical modification. In some embodiments, the chemical modification comprises one or more N-acetyl galactosamine (GalNAc) moieties or derivatives thereof conjugated to the nucleic acid, directly or indirectly via a linker.

[0246] In some embodiments, the nucleic acid described herein is an siRNA. In further embodiments, the nucleic acid is a GalNAc-siRNA conjugate. As used herein, the term “GalNAc” refers to 2-(Acetylamino)-2-deoxy-D-galactopyranose, also referred as N-acetyl galactosamine. The terms “GalNAc” or “N-acetyl galactosamine” includes both the P-form: 2-( Acetyl amino)-2-deoxy- -D-galactopyranose and the a-form: 2-(Acetylamino)-2-deoxy-a-D-galactopyranose. Both the P-form: 2-(Acetylamino)-2-deoxy-P-D-galactopyranose and a-form: 2-(Acetylamino)-2-deoxy-a-D-galactopyranose may be used interchangeably.

[0247] As used herein, the term “RNAi molecule” refers to a RNA or DNA molecule that plays a role in RNA interference. Specifically, an RNAi molecule refers to a shRNA, siRNA, or dsRNA as disclosed herein. A small hairpin RNA (shRNA) is a RNA sequence that forms a tight hairpin turn that can be used to silence gene expression by RNA interference. shRNAs can be delivered to target cells using DNA plasmids, viral vectors, or bacterial vectors. As used herein, shRNA can be delivered to cells using DNA cassettes.

[0248] As used herein, an “shRNA molecule” includes a conventional stem-loop shRNA, which forms a precursor miRNA (pre-miRNA). “shRNA” also includes micro-RNA embedded shRNAs (miRNA-based shRNAs), wherein the guide strand and the passenger strand of the miRNA duplex are incorporated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA. When transcribed, a conventional shRNA (z.e., not a miR-451 shRNA mimic) forms a primary miRNA (pri-miRNA) or a structure very similar to a natural pri-miRNA. The pri-miRNA is subsequently processed by Drosha and its cofactors into pre-miRNA. Therefore, the term “shRNA” includes pri-miRNA (shRNA-mir) molecules and pre-miRNA molecules.

[0249] In some embodiments, the shRNA is chemically or structurally modified to improve its stability, potency, cellular uptake, or resistance to nuclease degradation. The modifications may be introduced in one or both strands of the shRNA and can occur in the backbone, sugar, or base portions of the nucleotides, or at the termini of the molecule. Exemplary modifications include, but are not limited to, phosphorothioate, phosphorodithioate, boranophosphate, methylphosphonate, or peptide nucleic acid (PNA) backbone linkages; sugar modifications such as 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl substitutions; and base modifications such as pseudouridine, 5-methylcytosine, 5-propynyl-uridine, or 7-deazaguanine. The shRNA may further comprise terminal capping modifications such as inverted deoxythymidine (idT), biotin, or conjugation to polyethylene glycol (PEG), cholesterol, or other lipophilic moieties to enhance pharmacokinetic properties. In certain embodiments, the loop region connecting the sense and antisense sequences is modified to increase nuclease resistance or to optimize processing efficiency. The duplex region of the shRNA may include one or more stabilizing mismatches or overhangs, such as 2-nucleotide 3' overhangs, to facilitate incorporation into the RNA-induced silencing complex (RISC). In some embodiments, the shRNA is expressed from a nucleic acid vector, including but not limited to plasmids, viral vectors (e.g., lentiviral, adenoviral, or adeno-associated viral vectors), or synthetic DNA constructs. The shRNA may be operably linked to an RNA polymerase III promoter such as a U6 or Hl promoter, or to an RNA polymerase II promoter suitable for expression in mammalian cells. In other embodiments, the shRNA is delivered as a synthetic RNA molecule, optionally formulated with a delivery system such as a lipid nanoparticle, liposome, exosome, polymeric carrier, or viral-like particle.

[0250] In some embodiments, the shRNA targets both human and murine NC0R1 or MSTN (z.e., has cross-species targeting).

[0251] The modified shRNA molecules of the present disclosure are designed to hybridize specifically to a target nucleic acid sequence of MSTN or NC0R1, thereby reducing or inhibiting expression of the target gene via RNA interference. In some embodiments, the modified shRNA exhibits increased serum stability, an extended biological half-life, enhanced potency, reduced immunogenicity, or improved delivery efficiency relative to unmodified shRNA molecules.

[0252] In some embodiments, the modified shRNA molecules may include any shRNA, derivative, analog, or variant thereof that retains the ability to hybridize under physiological conditions to an mRNA encoding MSTN or NC0R1 or a fragment thereof, thereby decreasing the expression level of MSTN or NC0R1 in a cell, tissue, or organism. Such shRNA molecules may be chemically synthesized, enzymatically transcribed, or recombinantly expressed, and may comprise one or more nucleotide modifications as described herein.

[0253] As used herein, the terms “miRNA” and “microRNA” refer to 21-25 nt non-coding RNAs derived from endogenous genes. They are processed from longer (about. 75 nt) hairpin-like precursors termed pre-miRNAs. MicroRNAs assemble in complexes termed miRNPs and recognize their targets by antisense complementarity. If the microRNAs match 100% their target, i.e., the complementarity is complete, the target mRNA is cleaved, and the miRNA acts like a siRNA. If the match is incomplete, z.e., the complementarity is partial, then the translation of the target mRNA is blocked. In some embodiments, the first or second agent is an antibody or antigen-binding fragment thereof that targets NC0R1 and / or MSTN. In some embodiments, the antibody is bimagrumab (monoclonal antibody directed against both activin type 2 receptor subtypes), apitegromab (anti-MSTN), SRK-439 (anti-MSTN), taldefgrobep alfa (BHV-2000; anti-MSTN), or trevogrumab (REGN1033, SAR391786; anti-MSTN).

[0254] The term “antibody” as used herein is used in the broadest sense and specifically may include any immunoglobulin, whether natural or partly or wholly synthetically produced, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (for example, bispecific antibodies and polyreactive antibodies), and antibody fragments.

[0255] The term “bispecific antibody” refers to artificial immunoglobulin constructs that are comprised of fragments of two different monoclonal antibodies that bind to two different antigens. There are several distinct types of bispecific antibodies, including but not limited to trifunctional antibodies and chemically linked Fabs. The antibodies as described herein may comprise bispecific antibodies, and include fragments of one or more different anti-NCORl or anti-MSTN antibodies, including one or more different antibodies described herein. Methods of making and using bispecific antibodies thereof are described in, e.g., PCT / US 16 / 64713, hereby incorporated by reference.

[0256] The term "antigen-binding fragment or portion" of an antibody (or simply "antibody fragment or portion"), as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., MSTN or NC0R1). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding fragment or portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fab' fragment, which is essentially an Fab with part of the hinge region (see, FUNDAMENTAL IMMUNOLOGY (Paul ed., 3rd ed.

[0257] 1993)); (iv) a Fd fragment consisting of the VH and CHI domains; (v) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (vi) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; (vii) an isolated CDR; and (viii) a nanobody, a heavy chain variable region containing a single variable domain and two constant domains. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv or scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment or portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

[0258] In some embodiments, the first and second agent is an aptamer. As known in the art, aptamers are single stranded RNA or DNA molecules that bind to protein targets. In one embodiment, the first aptamer targets NC0R1 and the second aptamer targets MSTN.

[0259] In some embodiments, the first and second agent is a small molecule. In one embodiment, the first small molecule targets NC0R1 and the second small molecule targets MSTN. In some embodiments, the small molecule is talditercept alfa (RG-6206).

[0260] Pharmaceutical Compositions

[0261] Provided herein are pharmaceutical compositions comprising a vector as disclosed herein and a pharmaceutically acceptable carrier. The vector disclosed herein is assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0262] Formulations of the vectors disclosed herein disclosed herein involve the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly one suitable for injection, such as buffered saline or other buffers, e.g., PBS or HEPES, to maintain pH at appropriate physiological levels. These compositions may comprise, in addition to the vector, a pharmaceutically and / or physiologically acceptable excipient, carrier, buffer, stabilizer, antioxidants, preservative, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration. The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, incorporated herein by reference. Physiological saline solution, magnesium chloride, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. In some cases, a surfactant, such as pluronic acid (PF68) 0.001% may be used. In some cases, Ringer’s Injection, Lactated Ringer’s Injection, or Hartmann’s solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included, as required.

[0263] A “pharmaceutically acceptable carrier,” after administered to or upon a subject, does not cause undesirable physiological effects. The carrier in the composition must be “acceptable” also in the sense that it is compatible with the active ingredient and can be capable of stabilizing it. One or more solubilizing agents can be utilized as pharmaceutical carriers for the delivery of the above-described composition. Examples of a pharmaceutically acceptable carrier include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition usable as a dosage form. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate.

[0264] Pharmaceutical compositions comprising a vector disclosed herein may formulated with one or more pharmaceutically-acceptable excipients, which can be a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid fdler, diluent, carrier, manufacturing aid (e. ., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent or encapsulating material, involved in carrying or transporting the therapeutic compound for administration to the subject, bulking agent, salt, surfactant and / or a preservative. Some examples of materials which can serve as pharmaceutically-acceptable excipients include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. A bulking agent is a compound which adds mass to a pharmaceutical formulation and contributes to the physical structure of the formulation in lyophilized form. Suitable bulking agents according to the present invention include mannitol, glycine, polyethylene glycol and sorbitol.

[0265] The use of a surfactant can reduce aggregation of the reconstituted protein and / or reduce the formation of particulates in the reconstituted formulation. The amount of surfactant added is such that it reduces aggregation of the reconstituted protein and minimizes the formation of particulates after reconstitution. Suitable surfactants according to the present invention include polysorbates (e.g., polysorbates 20 or 80); pol oxamers (e.g., pol oxamer 188); Triton; sodium dodecyl sulfate (SDS); sodium laurel sulfate; sodium octyl glycoside; lauryl-, myristyl-, linoleyl-, or stearyl-sulfobetaine; lauryl-, myristyl-, linoleyl-or stearyl-sarcosine; linoleyl-, myristyl-, or cetyl-betaine; lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-betaine (e.g., lauroamidopropyl); myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-dimethylamine; sodium methyl cocoyl-, or disodium methyl oleyl-taurate; and polyethyl glycol, polypropyl glycol, and copolymers of ethylene and propylene glycol (e.g., Pluronics, PF68, etc.).

[0266] Preservatives may be used in formulations of invention. Suitable preservatives for use in the formulation of the invention include octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyl-dimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other types of preservatives include aromatic alcohols such as phenol, butyl and benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3 -pentanol, and m-cresol. Other suitable excipients can be found in standard pharmaceutical texts, e.g., in “Remington’s Pharmaceutical Sciences”, The Science and Practice of Pharmacy, 19th Ed. Mack Publishing Company, Easton, Pa., (1995).

[0267] For delayed release, the vector disclosed herein may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.

[0268] If a vector is to be stored long-term, it may be frozen in the presence of glycerol. Cells and Animal Models

[0269] In some embodiments, the vectors disclosed herein are used to stably inhibit the expression levels and / or activity of NC0R1 and MSTN in a cell. In one embodiment, the cells are autologous cells (i.e., derived from the patient). The term “autologous” refers to any material derived from the same subject or individual to which it is later to be re-introduced.

[0270] In some embodiments, the cells are skeletal muscle cells. In some embodiments, the cells are hepatic cells. In some embodiments, the cells are cardiac cells. In some embodiments, the cells are lipocytes. In one embodiment, the cells are from a mammal such as a human. In some embodiments, the cells are cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat, dog, rat, or mouse cells. In some embodiments, the cells are non-human primate cells. The non-human primate may be, for example, a monkey, such as a cynomolgus monkey, chimpanzee, etc.

[0271] In some embodiments, the vectors disclosed herein used to stably inhibit the expression levels and / or activity of NC0R1 and MSTN in the cells of an animal model. The animal model can be used to study the treatment of a disease or disorder of interest as indicated herein. In some embodiments, the animal model includes, but is not limited to Diet-Induced Obesity (DIO) mice or DIO rats.

[0272] Methods of Treatment

[0273] Provided are methods of treating or preventing a disease or disorder using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject in need thereof.

[0274] In some embodiments, the disorder or disease is type I diabetes, type II diabetes, insulin resistance, non-alcoholic fatty liver disease (NAFLD), obesity, dementia, cardiovascular disease, chronic kidney disease (CKD), heart failure, a mitochondrial disease, or Barth syndrome. Examples of mitochondrial diseases include, but are not limited to Leber Hereditary Optic Neuropathy (LHON), Leigh syndrome, Kearns-Sayre syndrome (KSS), mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome.

[0275] In some embodiments, the disorder or disease is associated with muscle atrophy, weakness and / or degeneration. In some embodiments, the disorder or disease is muscular dystrophy, myotonic dystrophy (DM), amyotrophy (such as microgravity induced muscle atrophy), sarcopenia, sarcopenic obesity, myalgias, hypotonia, or cachexia.

[0276] In some embodiments, the disorder or disease is muscular atrophy, muscle weakness, muscle dysfunction, or muscle destruction, including, but not limited to myotonic dystrophy, myotonia congenita, poliomyelitis, amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), Guillain-Barre syndrome (GBS), muscle wasting, and myopathies.

[0277] In some embodiments, provided are methods of treating or preventing a muscle injury or a spinal cord injury (SCI) using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject in need thereof. In some embodiments, the SCI is an incomplete SCI or a complete SCI. In some embodiments, the muscle injury is an age-related muscle decline.

[0278] In some embodiments, provided are methods of increasing muscle strength, athleticism, or bodybuilding, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject.

[0279] In some embodiments, provided are methods of regaining weight after weight loss or bariatric surgery as maintenance, using the agents or pharmaceutical compositions described herein (e.g, the vectors) to inhibit NC0R1 and MSTN in a subject.

[0280] In some embodiments, provided are methods of treating prediabetes including impaired fasting glucose and impaired glucose tolerance, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject.

[0281] In some embodiments, provided are methods of treating any of the following indications or conditions, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NCOR1 and MSTN in a subject: metabolic syndrome encompassing abdominal obesity; TG and HDL dyslipidemia; hypertension and hyperglycemia; hypertriglyceridemia of primary or secondary origin; atherogenic dyslipidemia and low HDL; combined dyslipidemia and familial combined hyperlipidemia; nonalcoholic fatty liver disease (NAFLD); nonalcoholic steatohepatitis (NASH); polycystic ovary syndrome; Cushing’s syndrome or glucocorticoid-induced metabolic derangements; antipsychotic-associated weight gain such as with clozapine or olanzapine; hypothalamic obesity including post-craniopharyngioma states; generalized or partial lipodystrophy including HIV-associated lipodystrophy; insulin resistance of chronic inflammation such as rheumatoid arthritis; systemic lupus erythematosus and inflammatory bowel disease; steroid-induced diabetes; type 1 diabetes as an adjunct; gestational weight retention along the postpartum obesity trajectory; menopause-associated adiposity and insulin resistance; the adult growth-hormone deficiency metabolic phenotype; rare monogenic obesity syndromes as an adjunct for weight such as Prader-Willi syndrome, Bardet-Biedl syndrome, and Alstrbm syndrome; hyperuricemia and gout in the context of metabolic syndrome; obesity hypoventilation syndrome; obstructive sleep apnea when weight-responsive; and hypertriglyceridemia-induced pancreatitis with a focus on recurrence prevention. Pregnancy use is typically excluded for gene therapy and the methods provided herein target post-partum trajectories.

[0282] Across the indications described herein, the provided methods elevate oxidative metabolism, improve insulin action and shift energy balance toward durable leanness. Within hepatic and gastrointestinal settings, applications comprise hepatic insulin resistance, diabetic fatty liver or double diabetes steatosis, cirrhosis with sarcopenia in compensated patients, pre-bariatric prehabilitation, post-bariatric sarcopenia prevention, hypertriglyceridemia liver disease, inflammatory bowel disease including Crohn’s disease and ulcerative colitis with sarcopenia and chronic pancreatitis with malnutrition or cachexia.

[0283] In some embodiments, provided are methods of treating various cardiovascular indications, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary cardiovascular indications include, but are not limited to atherosclerotic cardiovascular disease risk reduction, coronary artery disease across stable angina and post-myocardial infarction rehabilitation support, carotid atherosclerosis and cerebrovascular disease risk, peripheral artery disease with claudication, heart failure with reduced ejection fraction, heart failure with preserved ejection fraction, diabetic cardiomyopathy, hypertension that is metabolic or weight-responsive, cardiac cachexia, familial hypercholesterolemia as an adjunct for residual risk and venous insufficiency or chronic edema in a supportive role.

[0284] In some embodiments, provided are methods of treating various renal and electrolyte conditions, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary renal and electrolyte conditions include, but are not limited to chronic kidney disease stages 3 through 5 with protein- energy wasting, dialysis on hemodialysis or peritoneal modalities, post-kidney transplant steroid-related weight gain, diabetic kidney disease, polycystic kidney disease with a metabolic phenotype and metabolic acidosis-associated sarcopenia in chronic kidney disease. Benefits align around anti-catabolic preservation of lean mass, improved metabolic milieu and sustained functional capacity.

[0285] In some embodiments, provided are methods of treating various pulmonary indications, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary pulmonary indications include, but are not limited to chronic obstructive pulmonary disease and emphysema with or without cachexia, interstitial lung disease deconditioning, pulmonary hypertension with exercise limitation as supportive peripheral conditioning, obstructive sleep apnea via a weight-loss mechanism, obesity-related restrictive lung disease and the adult cystic fibrosis phenotype with sarcopenia.

[0286] In some embodiments, provided are methods of treating various neuromuscular and neurological conditions, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary neuromuscular and neurological conditions include, but are not limited to Duchenne muscular dystrophy, DMD (as an adjunct), Becker muscular dystrophy, BMD (as an adjunct), limb-girdle muscular dystrophies as adjuncts, facioscapulohumeral muscular dystrophy as an adjunct, myotonic dystrophy DM1 and DM2 with sarcopenia, spinal muscular atrophy types 2 and 3 as an adjunct to SMN-directed therapy, amyotrophic lateral sclerosis with support for preserved motor units, inclusion-body myositis, polymyositis and dermatomyositis alongside immunotherapy for muscle preservation, Charcot-Marie-Tooth disease and other neuropathies with denervation atrophy in supportive roles, postpolio syndrome to preserve remaining motor units, myasthenia gravis support to maintain muscle mass while the neuromuscular junction is treated, cerebral palsy in adult deconditioning for strength and fitness, spinal cord injury with below-level atrophy mitigation, stroke with hemiparesis to prevent or reverse limb atrophy during rehabilitation, Parkinson’s disease for mobility reserve and fatigue resistance, Huntington’s disease for cachexia and functional support, multiple sclerosis addressing fatigue and deconditioning, critical illness myopathy and neuropathy as ICU-acquired weakness with prophylaxis and recovery, mitochondrial myopathies such as MELAS, MERRF and POLG-related disorders with an oxidative support program, metabolic myopathies including glycogenoses such as McArdle disease GSD-V, Tarui disease GSD-VII, Pompe disease GSD-II as an adjunct to enzyme replacement therapy and GSD-III and GSD-IX where an increase in fatty-acid oxidation offers an alternative energy source, selected fatty -acid oxidation disorders individualized for CPT-II, VLCAD, LCHAD and TFP and primary carnitine transporter deficiency with careful phenotype selection for pathway rerouting or compensation, multiple acyl-CoA dehydrogenase deficiency also called glutaric acidemia type II and sarcopenia of aging as a core indication.

[0287] In some embodiments, provided are methods of treating various cancers, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary cancers include, but are not limited to pancreatic cancer, gastric cancer, esophageal cancer, colorectal cancer, lung cancer, head and neck and hepatobiliary cancers, and chemotherapy-induced sarcopenia (with agents such as platinum compounds, taxanes and anthracyclines, androgen-deprivation therapy in prostate cancer, aromatase-inhibitor therapy in breast cancer).

[0288] In some embodiments, provided are methods of treating hematologic conditions, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Hematologic conditions include, but are not limited to hematologic malignancies with post-transplant deconditioning and anemia-related fatigue of chronic disease where the focus is muscular efficiency rather than direct hematinic therapy.

[0289] In some embodiments, provided are methods of treating rheumatic diseases and autoimmune conditions, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Examples of such disease and conditions include, but are not limited to rheumatoid arthritis considering deconditioning and steroid metabolic effects, systemic lupus erythematosus with metabolic and steroid-related features, axial spondyloarthritis and ankylosing spondylitis for mobility reserve, psoriatic arthritis with weight-responsive disease activity and functional benefits, systemic sclerosis with sarcopenia and disuse support, polymyalgia rheumatica with steroid-sparing metabolic support, vasculitides on chronic steroids for metabolic and atrophy countermeasures, osteoarthritis of the knee and hip and osteoporosis or osteopenia addressing fall and fracture risk. In some embodiments, provided are methods of treating infectious and post-infections with viruses, using the agents or pharmaceutical compositions described herein (e.g., the vectors) to inhibit NC0R1 and MSTN in a subject. Exemplary infectious and post-infectious with viruses include, but are not limited to HIV and AIDS spanning wasting, lipodystrophy and insulin resistance, tuberculosis with cachexia and rehabilitation needs, post-viral syndromes including PASC or long COVID where deconditioning and myopathy are present, chronic hepatitis C with post-cure metabolic sequelae including steatosis and weight issues and sepsis survivorship targeting ICU-acquired weakness and catabolism.

[0290] As used herein, a “subject” or “individual” means a human or animal. Usually, the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, sheep, goats, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a human or a non-human mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of disorders. The terms “individual,” “patient” and “subject” can be used interchangeably herein. A subject can be male or female. In one embodiment, the subject is a human. In another embodiment, the subject is an experimental, non-human animal or animal suitable as a disease model.

[0291] As used herein, the terms “treat,” “treatment,” “treating,” and “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder. The term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with a disorder. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a disease is reduced. That is, “treatment” includes not just the improvement of symptoms or markers, but also a slowing of progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (z.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term “treatment” of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0292] The terms “prevent,” “preventing,” “prevention,” and the like are used interchangeably herein to mean inhibit, hinder, retard, reduce or otherwise delay the development of and / or progression of a condition or disorder or a symptom thereof, in a subject. In the context of the present disclosure, the term “prevent” and variations thereof do not necessarily imply the complete prevention of the specified event. Rather, the prevention may be to an extent, and / or for a time, sufficient to produce the desired effect. Prevention may be inhibition, retardation, reduction or otherwise hindrance of the event, activity or function. Such preventative effects may be in magnitude and / or be temporal in nature.

[0293] The agents described herein that inhibit NC0R1 and / or MSTN can be delivered to a subject via various modes of delivery. For example, the agents can be administered to a subject subcutaneously, intravenously, orally, parenterally, intraperitoneally, intramuscularly or systemically. In particular embodiments, the vectors or pharmaceutical compositions described herein are administered to the subject intravenously, subcutaneously, or intramuscularly.

[0294] In some embodiments, the first and second agents are administered separately. For example, the agent that inhibits NC0R1 is administered to the subject before the agent that inhibits MSTN. In another example, the agent that inhibits MSTN is administered to the subject before the agent that inhibits NC0R1. In some embodiments, the first and second agents are administered simultaneously. In some embodiments, the first and second agents are administered to a subject in the same vector (e.g., a vector described herein that comprises two shRNAs that target MSTN and NC0R1).

[0295] In some embodiments, cells comprising a vector described herein are administered to the subject. In some embodiments, an AAV vector described herein is administered to the subject at a dose ranging from about 1.0 x IO10to about 4.0 x 1014vector genomes (vg) such as about 1.0 x 1010vg, about 1.5 x 1010vg, about 2.0 x 1010vg, about 2.5 x 1010vg, about 3.0 x 1010vg, about 3.5 x 1010vg, about 4.0 x 1010vg, about 1.0 x 1011vg, about 2.0 x 1011vg, about 3.0 x I011vg, about 4.0 x 1011vg, about 5.0 x 1011vg, about 6.0 x 1011vg, about 1.0 x 1012vg, about 2.0 x 1012vg, about 3.0 x 1012vg, about 4.0 x 1012vg, about 5.0 x 1012vg, about 6.0 x 1012vg, about 1.0 x 1013vg, about 2.0 x 1013vg, about 3.0 x 1013vg, about 4.0 x 1013vg, about 5.0 x 1013vg, about 6.0 x 1013vg, about 1.0 x 1014vg, about 2.0 x 1014vg, about 3.0 x 1014vg, about 4.0 x 1014vg, or any amount in-between.

[0296] In some embodiments, the first and second agents described herein are administered to the subject with at least one additional agent that modulates activity or expression of DMN2 (Dynamin-2), IGF1 (Insulin-like growth factor 1), FGF-21 (Fibroblast growth factor 21), PGC-la (Peroxisome proliferator-activated receptor-gamma coactivator- 1 alpha), HDAC3 (Histone deacetylase 3), HDAC11 (Histone deacetylase 11), HDAC1 (Histone deacetylase 1), MYMK (myomaker, myoblast fusion factor), FOXO1 (Forkhead box 01), FOXO4 (Forkhead box 04), NRF1 (Nuclear respiratory factor 1), NRF2 (Nuclear factor erythroid 2-related factor 2), ERRa (Estrogen-related receptor alpha), MuRF (Muscle Ring-Finger Protein, which includes all variants- MuRFl, MuRF2, and MuRF3), MyoD (myogenic differentiation 1), MEF2A (Myocyte enhancer factor 2A), SMAD2 / 3 (Mothers against decapentaplegic homolog 2 / Mothers against decapentaplegic homolog 3), mTORCl (Mammalian target of rapamycin complex 1), RICTOR (RPTOR independent companion of MTOR complex 2), RAPTOR, GLUT4 (Glucose transporter type 4 ), GLUT2 (Glucose transporter 2 ), IRS1 (Insulin receptor substrate 1), IRS4 (Insulin receptor substrate 4), PI3k (Phosphatidylinositol-3 kinase), SIRT1 (Sirtuin 1), MAPK (Mitogen-activated protein kinase), or solute carrier family 22 member 5 (OCTN2 or SLC22A5). In some embodiments, the additional agent antagonizes or agonizes the above-referenced genes. The at least one additional agent can be an antibody or antigen-binding fragment thereof, an aptamer, a protein, a peptide, a nucleic acid, or a small molecule. In one embodiment, the at least one additional agent is administered to the subject following administration of the agents that inhibit MSTN andNCORl. In some embodiments, the at least one additional agent is administered to the subject before administration of the agents that inhibit MSTN and NCOR1. In some embodiments, the at least one additional agent is administered to the subject simultaneously with the agents that inhibit MSTN and NCOR1. Additional Definitions

[0297] A "subject in need" of treatment for a particular condition or disorder can be a subject having that condition or disorder, diagnosed as having that condition or disorder, or at risk of developing that condition or disorder.

[0298] As used herein and in the appended claims, the singular forms “a,” “and,” and “the” include plural references unless the context clearly dictates otherwise.

[0299] The term “about” refers to a range of values which would not be considered by a person of ordinary skill in the art as substantially different from the baseline values. For example, the term “about” may refer to a value that is within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value, as well as values intervening such stated values.

[0300] As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0301] As used herein, the term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0302] As used herein, the terms “including,” “comprising,” “containing,” or “having” and variations thereof are meant to encompass the items listed thereafter and equivalents thereof as well as additional subject matter unless otherwise noted.

[0303] The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0304] As used herein, the phrases “in one embodiment,” “in various embodiments,” “in some embodiments,” and the like are used repeatedly. Such phrases do not necessarily refer to the same embodiment, but they may unless the context dictates otherwise.

[0305] As used herein, the terms “and / or” or “ / ” means any one of the items, any combination of the items, or all of the items with which this term is associated.

[0306] All methods described herein are performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. In regard to any of the methods provided, the steps of the method may occur simultaneously or sequentially. When the steps of the method occur sequentially, the steps may occur in any order, unless noted otherwise. In cases in which a method comprises a combination of steps, each and every combination or sub-combination of the steps is encompassed within the scope of the disclosure, unless otherwise noted herein.

[0307] All references, patents and applications cited herein are incorporated herein by reference in their entireties. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0308] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention.

[0309] EXAMPLES

[0310] Example 1: Materials and Methods

[0311] 1A, shRNA Screening and Validation

[0312] A library of RNAi constructs was generated that were able to effectively target MSTN or NC0R1 using a variety of vector and promoter designs. Several shRNAs were designed and screened possessing cross species efficacy, a particular achievement that allows for gene knockdown using the same target sequence independent of the species. For screening, HEK293 cells were transfected with AAV plasmids containing a single short hairpin RNA, 21-22 bp in length under the expression of either the Hl or U6 promoters, to knockdown the expression of either MSTN or NC0R1. The cells were co-transfected with an engineered plasmid containing either MSTN or NCOR1 DNA ligated to a luciferase reporter. When MSTN or NC0R1 expression are silenced, a corresponding decrease in luminosity is observed and calculated into a relative “% knockdown” which generally correlates to an shRNA’s activity in vivo to knockdown target mRNA. Several shRNAs were generated that had effective knockdown with either or both Pol III promoters. These sequences were further evaluated in a similar fashion using microRNA adapted shRNA constructs based on miR30 scaffolds. These shRNAmiRs can be expressed from Pol II promoters, which can include a variety of tissue specific expression and regulatory elements that impact efficacy and safety in ways that are unachievable using Pol III promoters.

[0313] IB, Vector Construction and Recombinant AAV Vectors

[0314] In general, unless otherwise stated, the plasmids and rAAV vectors of these experiments were manufactured by Azenta Biosciences, Chelmsford, MA, Vigene Biosciences Inc. Rockville, MD, Vector Biolabs Malvern, PA and Signagen Laboratories Rockville, MD and produced using a helper free triple transfection protocol. Vectors were made using commercially available “off the shelf’ AAV6 and AAV8 rep / cap plasmids and a scAAV transfer plasmid with one AITR with a deleted D and C region as is well established in the art. All plasmids followed the design of Pol III promoter-shRNA-MSTN— SPACER ~87-155bp— Pol III promoter— shRNA-NCORl .

[0315] IC. C57BL6 Mouse Model Diet-Induced Obesity (DIO)

[0316] The Jackson Laboratory’s C57BL / 6J mice are widely used for DIO models due to their susceptibility to weight gain when fed a high-fat diet. The high-fat diet (60% kcal from fat) was started at -10-12 weeks of age for these mice. The mice were housed in temperature- and humidity-controlled environments with a 12-hour light / dark cycle. They were provided with ad libitum access to food and water. Under these conditions, C57BL / 6J mice exhibit significant weight gain, insulin resistance, hyperglycemia, and other metabolic abnormalities associated with obesity. ID. Sprague Dawley Rat Model Diet-Tnduced Obesity (DTP)

[0317]

[0318] The Sprague Dawley (SD) rat is commonly used in DIO studies due to its propensity to develop obesity and related metabolic disorders when fed a high-fat diet. For these experiments, the SD rats began a high-fat diet (60% kcal from fat) around 7 weeks of age. Rats were sourced from Charles River and housed in temperature- and humidity-controlled environments with a 12-hour light / dark cycle, with free access to food and water. In general, this model on a high-fat diet results in significant weight gain, hyperinsulinemia, glucose intolerance, and other metabolic abnormalities, making SD rats ideal for studying obesity, diabetes, and cardiovascular diseases. The metabolic profile of the DIO Sprague Dawley rat closely mirrors that of both the C57BL6 mouse and human metabolic syndrome.

[0319] IE. EchoMRI NMR and Body Weight (BW)

[0320] The EchoMRI NMR system is a non-invasive, high-precision tool used to accurately measure body composition in mice, including fat, lean mass, free water, and total water content. Body weights and body composition measurements were taken at various time points through all studies. Body fat, lean mass, free water, and total water were measured using an NMR-based analyzer (EchoMRI, 4inl-500). The measurements took less than 2 minutes, while conscious mice or rats were placed individually in the measuring tube. The machine was checked daily using a reference sample (i.e., canola oil) as recommended by the manufacturer.

[0321] IF. Insulin, Glucose, and Oral Glucose Tolerance Testing (OGTT)

[0322] Blood and serum were collected from mice and rats throughout the studies to analyze blood glucose and insulin. Oral glucose tolerance testing was also performed. For blood glucose and serum insulin levels, rodents were fasted for 5 hours at which point ~30 uL of blood per animal was collected by tail vein bleed. Blood glucose was determined by the commercially available glucometer Accu-Check® and serum insulin was quantified using the Millipore Rat / Mouse Insulin ELISA.

[0323] Oral glucose tolerance testing consisted of measuring blood glucose and serum insulin using the previously described methods at 5 different time points: 0, 15, 30, 60, and 120 min. IG. Energy Expenditure, Running Capacity, and Endurance

[0324] Male mice (C57BL6 / J) were treated with AAV6 vector encoded with shRNA targeting MSTN and NC0R1 (3 groups: PBS control, STK-AVi-U6, and STK-AVi-tMCK) at age of 8 weeks old and fed with a 60 cal% HFD for 9 weeks until the study. Animals were single housed and transferred to the indirect calorimetry system (Promethion System, Sable) for measurement of energy expenditure, in-cage activity, running wheel activity, food, and water under room temperature setting. All animals were kept on the HF diet throughout the experiment. 2. Energy expenditure and respiratory quotient: Oxygen consumption (VO2), carbon dioxide production (VCO2), spontaneous motor activity were measured using the Promethion (Comprehensive, High-Resolution Behavioral Analysis Systems, Sable Systems International), an integrated open-circuit calorimeter equipped with an optical beam activity monitoring device. Mice were weighed each time before the measurements and individually placed into the Mouse Cage (Model 3721; 8.1 x 14.4 x 5.5 in.) with free access to food and water. The study was carried out in an experimentation room set at 20-23 °C with 12-12 hours (6:00PM~6:00AM) dark-light cycles. The measurements were carried out continuously for 120 hours. During this time, animals were provided with food and water through the equipped feeding and drinking devices located inside the cage. The Promethion food, water intake & body weight monitoring system features high precision sensors capable of measuring real time for mice and rats. The system was routinely calibrated each time before the experiment using a standard gas (20.5% O2 and 0.5% CO2 in N2). VO2 and VCO2 in each cage were sampled sequentially for 30 seconds in 5-minute intervals and the motor activity was recorded every second in X and Z dimensions. The air flow rate through the chambers was adjusted at the level to keep the oxygen differential around 0.3% at resting conditions. Respiratory quotient (RQ), also known as respiratory exchange ratio (RER), was calculated as VCO2 / VO2. Total energy expenditure, carbohydrate oxidation, and fatty acid oxidation can be calculated respectively based on the values of VO2, VCO2, and the protein breakdown (which is usually estimated from urinary nitrogen excretion).

[0325] IH, Treadmill Running

[0326] Running capacity was measured using distance, time, and speed recorded on the Maze Engineers Five Lane Treadmill. Before the study, the mice were each placed into the treadmill chambers to acclimate them to the treadmill environment. For two days prior to the study, the mice were individually put into the same treadmill for 30 minutes each day and walked at 5m / min for the final 5 minutes of their acclimation. Mice were weighed prior to the running test. They were then individually placed into the treadmill chambers (411 * 70 x 112 mm). The slope of the treadmill was set at 15° during the entirety of the running test. The study was carried out in an experimentation room set at 20-23 °C with 12-12 hours (6:00PM-6:00AM) dark-light cycles. The measurements were only carried out between 9:00AM-12:30PM on each day. During this time, the animals were run on the treadmills one in each lane and the treadmill was wiped clean between each test.

[0327] The mice ran under the same standard treadmill schedule:

[0328] 5 minutes @ 5 m / min @ 15°

[0329] 5 minutes @ 9 m / min @ 15°

[0330] 5 minutes @ 12 m / min @ 15°

[0331] 5 minutes @ 15 m / min @ 15°

[0332] 2 minute @ 17 m / min @ 15°

[0333] 2 minute @ 19 m / min @ 15°

[0334] 2 minute @ 21 m / min @ 15°

[0335] 2 minute @ 23 m / min @ 15°

[0336] 2 minute @ 25 m / min @ 15°

[0337] 2 minute @ 27 m / min @ 15°

[0338] 2 minute @ 29 m / min @ 15°

[0339] 2 minute @ 31 m / min @ 15°

[0340] 2 minute @ 33 m / min @ 15°

[0341] 2 minute @ 35 m / min @ 15°

[0342] Exhaustion was qualified by a mouse sitting on the shocker (1.00mA) for 5 consecutive seconds at which point the animal was removed from the treadmill, body mass recorded, and the animal was placed back in its cage. IT. Liver Panel

[0343] Serum was collected at various time points from all groups in all studies for the purpose of measuring AST and ALT. Both RNAi and AAV can pose a risk of liver injury in a dose dependent manner. Testing was performed by the UMICH Toxicology Core using an industry supplied chemistry panel.

[0344] For the proof-of-concept study (i.e., Example 2), murine tissue samples of heart, liver, gastrocnemius, and quadriceps muscle were submitted for histologic preparation, sectioning, hematoxylin & eosin staining, and pathology evaluation. No information was provided on the experimental manipulation or analysis focus.

[0345] For the study to determine dosing, long term efficacy, and safety i.e., Example 3), murine tissue samples of heart, liver, gastrocnemius, and quadriceps muscle were submitted for histologic preparation, sectioning, hematoxylin & eosin staining, and pathology evaluation. Assessment was requested for necrosis or other lesions in the liver, heart, gastrocnemius, and quadriceps muscle.

[0346] 10 of 11 animals had been on 60% high fat diet for ~10 months following injection of an adeno-associated virus vector (AAV6, AAV8) or PBS. Animal 801 was removed from the study at age of 26 weeks for illness - liver only from this animal was submitted. Sections were evaluated with sample ID numbers only and were unblinded to groups post-analysis, based on the sample ID sheet provided at submission.

[0347] For the rat study, rat tissue samples of heart, liver, gastrocnemius, and quadriceps muscle were submitted for histologic preparation, sectioning, hematoxylin & eosin staining, and pathology evaluation.

[0348] Assessment was requested for necrosis or other lesions in the liver, heart, gastrocnemius, and quadriceps muscle. Animals had been on a high fat diet for 19 weeks following injection of an adeno-associated virus vector (AAV6, AAV8) or PBS. Sections were evaluated with sample ID numbers only and were unblinded to groups post-analysis, based on the sample ID sheet provided at submission.

[0349] 1J. Pathology Methods and Scoring

[0350] Samples were submitted as cassetted tissues floating in fixative (10% neutral buffered formalin). Tissues were processed and infiltrated on an automated tissue process (TissueTek5, Sakura) and embedded in paraffin. Tissues were sectioned at 4 pm thickness using a rotary microtome and mounted on glass slides. Sections were stained with hematoxylin and eosin on an automated histostainer (Leica ST5010 Autostainer XL, Leica Biosystems) by routine protocols. Sections were coverslipped and evaluated by a board-certified veterinary pathologist (ILB) using light microscopy at ocular magnifications ranging from 4X to 40X. Evaluation was performed without knowledge of the experimental manipulations and lesions were classified according to standardized consensus criteria for rodent toxicologic pathology (Berridge BR et al. (2016) Nonproliferative and proliferative lesions of the cardiovascular system of the rat and mouse. J Toxicol. Pathol. 29(3 Suppl): 1S-47S. PMC5013710; Thoolen B et al. (2010) Proliferative and nonproliferative lesions of the rat and mouse hepatobiliary system. Toxicol. Pathol. 38(7 Suppl)5S-81S. PMID 21191096; and The Digitized Atlas of Mouse liver lesions. National Toxicology Program: niehs.nih.gov / research / resources / visual-guides / liverpath / index.cfm).

[0351] Severity scoring for individual parameters:

[0352] 0: not present

[0353] 1 : mild (focal or small multifocal)

[0354] 2: moderate (large single focus or larger multiple foci) 3: severe (regionally extensive or widespread)

[0355] Severity scoring for liver degeneration (an overall parameter summarizing liver findings) 0: not present

[0356] 0.5: minimal (for samples with steatosis only)

[0357] 1 : mild (for samples with steatosis and other findings having no more than one score of 2 for a non-steatosis finding) 2: moderate (for samples with steatosis and other findings having more than one score of 2 for a non-steatosis finding) 3: severe (for samples with steatosis and other findings having at least one score of 3 for a non-steatosis finding).

[0358] For quantitative fat droplet counts, slides were digitized on a Leica Aperio AT2 digital slide scanner (Leica Biosystems) at magnification of 20x (0.5 pm / pixel). Digital slide files (svs format) imported into ImageJ 2.0 (FIJI, v 1.53f51; imagej.nih.gov / ij / ) using a Bioformats plugin. Droplets were quantified using a custom macro (written by Eric Rentchler, Advanced Microscopy Core, University of Michigan) for identification of droplets between 25-2500 pm diameter with circularity of 0.70-1.0. The macro and instructions for use are provided separately. Droplet counts were binned in 25 pm increments and summed across the specified size ranges to produce a total droplet count. Total droplet counts were multiplied by 104 and were normalized to the digitally computed tissue area (pm2) for each sample.

[0359] Example 2. Proof-of-Concept Study to Evaluate STK-AVi in a DIO Mouse Model

[0360] A study was conducted as proof-of-concept to evaluate STK-AVi in a model with a comparable disease state to that of its human counterpart. 24 male C57BL6 / J mice were divided into three groups: PBS control, STK-AVi-U6, and STK-AVi-tMCK. The STK-AVi-U6 group was treated with AAV6 vector encoded with shRNA targeting MSTN and NC0R1 under the expression of the U6 promoter whereas the STK-AVi-tMCK group received a tMCK promoter. Mice were injected at age of 8 weeks old and fed with a 60cal% HFD for 15 weeks until end of the study. Readouts for this study included body composition, blood glucose, serum insulin, oral glucose tolerance testing, energy expenditure, running capacity, liver panels, and necropsy with histology report.

[0361] As shown in FIG.l, mice treated with the AAV6 vector exhibited decreased body weight compared to mice treated with the vehicle control. Notably, this decreased body weight was sustained over 14 weeks. Additionally, AAV6 vector treated mice exhibited decreased body fat percentage and increased lean mass over the duration of the study compared to mice treated with the vehicle control (FIGS. 2 and 3). Moreover, mice treated with the AAV6 vector exhibited a statistically significant decrease in plasma insulin levels over 120 minutes during an oral glucose challenge test (FIGS. 4 and 5). Consequently, these results demonstrate that inhibiting NC0R1 and MSTN with STK-AVi increases lean mass and insulin sensitivity and decreases body fat. Example 3. Dosing, Efficacy, and Safety of STK-AVi

[0362] A study was designed to expand upon the data from the above-described proof-of-concept study to focus on the dosing, long term efficacy, and safety of STK-AVi. In this study, the vector was packaged in both AAV6 and AAV8. 40 male C57BL6 / J mice were divided into five groups of eight mice representing three progressively lower doses of STK-AVi-AAV6, one dose of STK-AVi-AAV8, and PBS. Note that pscAAV-U6-MSTN-shRNA-U6-NCORl-shRNA (SEQ ID NO: 49) was packaged into AAV6 or AAV8. Mice were injected at age of 8 weeks old and fed with a 60cal% HFD 6 weeks following injection. Mice were kept on this high fat diet between 33-35 weeks or -39-41 weeks from the AAV injection. Readouts for this study included body composition, blood glucose, serum insulin, oral glucose tolerance testing, energy expenditure, running capacity, liver panels, and necropsy with histology report.

[0363] Mice treated with the AAV8 and AAV8 vectors exhibited decreased body weight, decreased body fat percentage, and increased lean muscle mass compared to mice treated with PBS control (FIGS. 1-3). Notably, mice treated with either AAV6 or AAV8 vectors exhibited deceased plasma insulin levels over 120 minutes during an oral glucose challenge test compared to mice treated with PBS (FIGS.4 and 5). Moreover, mice treated with AAV8 exhibited increased running capacity, indicating that AAV8 could be used as an exercise enhancer. Importantly, treatment with AAV8 decreased ALT and AST levels after 4-6 weeks (FIGS. 6A and 6B).

[0364] Example 4. Cross-species Efficacy of STK-AVi

[0365] A study was conducted to demonstrate cross-species efficacy using the same transfer plasmid and AAV6 or AAV8 vectors of Example 3. 24 animals were divided into three groups of eight animals each. Accordingly, eight -4 week old male Sprague Dawley rats received either a STK-AVi-AA6, STK-AVi-AAV8, or PBS injections. NotethatpscAAV-STK-AVi-Mk3 (SEQ ID NO: 47) was packaged into AAV6 and pscAAV-U6-MSTN-shRNA-U6-NCORl-shRNA (SEQ ID NO: 48) was packaged into AAV8. At three weeks post injection, the rats were started on a 60 cal% HFD and were subsequently evaluated for 22 weeks post injection. Readouts for this study included body composition, blood glucose, serum insulin, oral glucose tolerance testing, liver panels, and necropsy with histology report.

[0366] Rats treated with the AAV6 and AAV8 vectors exhibited decreased body weight, body fat percentage, and increased lean muscle mass (FIGS. 1-3). Additionally, the AAV-treated rats exhibited significantly decreased plasma insulin over 120 minutes during an oral glucose challenge test (FIGS. 4 and 5)

[0367] Example 5. Real-Time qPCR Protocol

[0368] This Example describes the qPCR protocol used to evaluate the expression levels of NC0R1 and MSTN shown in FIGS. 10 and 11. Materials

[0369] TaqMan™ Gene Expression Cell-to-Cr™ Kit (Cat AM1728) was purchased from Thermo Fisher Scientific. FuGENE® transfection reagent was purchased from Promega (Madison, WI). qPCR primers for human MSTN (Hs00976237), mouse MSTN (Mm01254559), human NCOR1 (HsO 1094541), mouse NCOR1 (MmO 1333102), and GAPDH (Hs02786624), were purchased from Thermo Fisher Scientific. C2C12 cells were purchased from ATCC (Manassas, VA). LHCN-M2 cells were purchased from Evercyte (Vienna, Austria). Cell culture media is listed in the table below. The culture media was supplemented with 100 pg / ml of penicillin and 100 pg / ml of streptomycin. Cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air.

[0370] Cell Line Media

[0371] LHCN-M2 MyoUp medium + 15% FBS

[0372] C2C12 DMEM + 10% FBS

[0373]

[0374] Procedures

[0375] 1. 10,000 LHCN-M2 or C2C12 cells were seeded in wells of 96-well plate. LHCN-M2 cells were seeded on plates pre-coated with 0.1% gelatin. The cells were incubated overnight.

[0376] 2. A FuGENE® transfection reagent / shRNA mixture was prepared in nuclease free H2O in order to deliver 0.2 pg of shRNA + 0.6 pL of FuGENE® to each well. The mixture was allowed to incubate at room temperature for 10 minutes.

[0377] a. Plasmid 1 MSTN: hGeneMSTN-shlO, 10 hMSTN-sh (nts of NM_005259) ACCGCACTGGTATTTGGCAGAGTACTCGAGTACTCTGCCAAATACCAGTGCTTT

[0378] (SEQ IDNO:29)

[0379] b. Plasmid 2 NCOR1: hGeneNCORl-shlO, MIR-A30-NCORl-shRNA10 ACCGCTAGGAGTGAGCATGAGATTACCCTGACCCAGTAATCTCATGCTCACT CCTAGCTTT (SEQ ID NO: 56) 10 pL of either FuGENE® / shRNA mixture was added to the respective wells of the seeded assay plate as well as a mock transfection mixture containing no shRNA.

[0380] The transfected cells were placed back in the cell culture incubator and allowed to incubate for 24, 48, or 72 hours.

[0381] The culture media was aspirated and discarded from the wells.

[0382] The cells were washed with 50 pL of cold (4°C) IX PBS per well.

[0383] 50 uL of Lysis Solution containing DNase I was added to each well and mixed 5 times. The plates were incubated for 5 min at room temperature.

[0384] 5 uL of Stop Solution was added to each well and mixed 5 times.

[0385] The plates were incubated for 2 min at room temperature.

[0386] The thermal cycler was programed for the reverse transcription (RT) as shown in the table below:

[0387] Stage Reps Temp Time Reverse 1 1 37°C 60 min transcription

[0388] (hold)

[0389] RT inactivation 2 1 95°C 5 min (hold)

[0390]

[0391] Hold 3 1 4°C Indefinite

[0392] RT Master Mix was assembled and distributed to each well of the reaction plates.

[0393] Components Each 25 pL reaction (pL)

[0394] C2C12 LHCN-M2

[0395] 2x RT Buffer 12.5 12.5

[0396] 20x RT Enzyme Mix 1.25 1.25

[0397] Nuclease-free Water 6.25 1.25

[0398] Final volume RT 20 15

[0399] master mix

[0400]

[0401] 5 pL of C2C12 or 10 pL of LHCN-M2 lysate was added to each aliquot of RT Master Mix for a final 25 pL reaction volume and mixed thoroughly. Then, the plate was spun briefly. 14. QuantStudio™ 6 Pro (Applied Biosystem, Thermo Fisher Scientific) was used to run the reverse transcription (RT).

[0402] 15. QuantStudio™ 6 Pro was programed for the real-time qPCR as shown in the table below:

[0403] Stage Reps Temp Time UDG Incubation 1 1 50°C 2 min (hold)

[0404] Enzyme 2 1 95°C 10 min activation (hold)

[0405] PCR (cycle) 3 50 95°C 15 sec

[0406] 60°C 1 min

[0407]

[0408] 16. The reactions for real-time qPCR were assembled and distributed to each well of the reaction plates as shown in the table below:

[0409] Components Each 20 pL reaction (pL)

[0410] TaqMan Gene Expression 10

[0411] Master Mix (2 x)

[0412] Target Gene Primer (20 x) * 1

[0413] Nuclease-free Water 5

[0414] Final volume PCR cocktail 16

[0415]

[0416] 17. 4 pL of cDNA samples were added to each aliquot of PCR Cocktail for a final 20 pL reaction volume and mixed thoroughly. The plate was spun briefly.

[0417] 18. Real Time qPCR was run on a real-time qPCR instrument QuantStudio™ 6 Pro (Applied Biosystem, Thermo Fisher Scientific).

[0418] While the foregoing written description of the invention enables one of ordinary skill to make and use what is considered presently to be the best mode thereof, those of ordinary skill will understand and appreciate the existence of variations, combinations, and equivalents of the specific embodiments, methods, and examples herein.

Claims

CLAIMSWhat is claimed is:

1. A method of treating a disease or disorder in subject in need thereof, comprising administering to the subject a combination of a first agent that decreases the activity or expression of nuclear receptor corepressor 1 (NC0R1) and / or a second agent that decreases the activity or expression of myostatin (MSTN) in a cell of the subject.

2. The method of claim 1, wherein the disorder or disease is type I diabetes, type II diabetes, non-alcoholic fatty liver disease (NAFLD), obesity, dementia, cardiovascular disease, chronic kidney disease, heart failure, a mitochondrial disease, or Barth syndrome.

3. The method of claim 1, wherein the disorder or disease is associated with muscle atrophy, weakness and / or degeneration.

4. The method of claim 3, wherein the disorder or disease is muscular dystrophy, myotonic dystrophy (DM), amyotrophy, sarcopenia, sarcopenic obesity, myalgias, hypotonia, or cachexia.

5. The method of any one of claims 1-4, wherein the first or second agent is an antibody, an aptamer, a protein, a peptide, a nucleic acid, or a small molecule.

6. The method of any one of claims 1-5, wherein the first or second agent is carried on a viral vector or a non-viral vector.

7. The method of claim 6, wherein the first and second agents are carried on the same vectors.

8. The method of claim 6, wherein the first agent comprises a shRNA that inhibits the expression or activity ofNCORl.

9. The method of claim 6, wherein the second agent comprises a shRNA that inhibits the expression or activity of MSTN.

10. The method of claim 6, wherein the viral vector is selected from the group consisting of adenoviral vector, adeno-associated virus (AAV) vector, and lentiviral vector.

11. The method of claim 10, wherein the viral vector is an AAV vector.

12. The method of claim 11, wherein the AAV vector comprises a first cassette comprising a first promoter operably linked to an shRNA that targets NC0R1, the first cassette being linked to a second cassette, wherein the second cassette comprises a second promoter operably linked to an shRNA that targets MSTN.

13. The method of claim 12, wherein the shRNA that targets NC0R1 comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-12 and 20, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-12 and 20.

14. The method of claim 12, wherein the shRNA that targets MSTN comprises a polynucleotide sequence of any one of SEQ ID NOs: 21-31, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 21-31.

15. The method of claim 12, wherein the first or second promoter comprises a polymerase II or a polymerase III promoter.

16. The method of claim 12, wherein the first or second promoter comprises a polynucleotide sequence of any one of SEQ ID NOs: 40-42, or comprises a polynucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 40-42.

17. The method of claim 12, wherein the first cassette comprises the polynucleotide sequence of SEQ ID NO: 43 or 44, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 43 or 44, and second cassette comprises the polynucleotide sequence of SEQ ID NO: 45 or 46, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 45 or 46.

18. The method of any one of claims 12-17, wherein the first and second cassettes comprise different or the same promoters.

19. The method of any one of claims 12-18, wherein the vector further comprises a spacer element positioned between the first cassette and the second cassette.

20. The method of claim 19, wherein the spacer element has a length of 25-2,500 base pairs (bp).

21. The method of any one of claims 12-20, wherein the vector comprises a pair of inverted terminal repeats (ITRs) respectively positioned upstream of the first cassette and downstream of the second cassette.

22. The method of claim 21, wherein the ITRs are derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13.

23. The method of claim 22, wherein the ITRs are mutated.

24. The method of any one of claims 12-23, wherein the AAV vector further comprises at least one post transcriptional regulatory element.

25. The method of any one of claims 12-24, wherein the AAV vector comprises a genome derived from AAV serotype AAV1, AAV6, AAV6.2FF, AAV8, AAV9, AAVrh74, or MYOAAV.

26. The method of any one of claims 12-25, wherein the AAV vector is administered at a dose ranging from about 1.0 x 1010to about 4.0 x 1014vector genomes (vg).

27. The method of any one of claims 1-26, wherein the subject is a human.

28. The method of any one of claims 1-27, further comprising administering to the subject an agent that modulates the activity or expression of DMN2, IGF1, FGF-21, PGC-la, HDAC3, HDAC11, HDAC1, MYMK, MYMG, FOXO1, FOXO4, NRF1, NRF2, ERRa, MuRF, MyoD, MEF(2a), SMAD2 / 3, mTORcl, RICTOR, RAPTOR, GLUT4, GLUT2, IRS1, IRS4, PI3k, SIRT1, MAPK, or OCTN2.

29. The method of any one of claims 1-28, wherein the agents are administered to the subject intravenously, subcutaneously, or intramuscularly.

30. The method of any one of claims 1-29, wherein the cell is a skeletal muscle cell.

31. The method of any one of claims 1-30, wherein the cell is an autologous cell.

32. A polynucleotide comprising a first cassette comprising a first promoter operably linked to an shRNA that targets NCOR1, and a second cassette comprising a second promoter operably linked to an shRNA that targets MSTN.

33. A recombinant vector comprising the polynucleotide of claim 32.

34. A viral particle comprising the polynucleotide of claim 32 or the vector of claim 33.

35. A nanoparticle comprising the polynucleotide of claim 32 or the vector of claim 33.

36. The vector of claim 33, wherein the vector is a viral vector is selected from the group consisting of adenoviral vector, adeno-associated virus (AAV) vector, and lentiviral vector.

37. The vector of claim 36, wherein the viral vector is an AAV vector.

38. The vector of claim 37, wherein the shRNA that targets NC0R1 comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-12 and 20, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-12 and 20.

39. The vector of claim 37, wherein the shRNA that targets MSTN comprises a polynucleotide sequence of SEQ ID NOs: 21-31, or comprises a polynucleotide sequence having at least 70% sequence identity to any one of SEQ ID NOs: 21-31.

40. The vector of any one of claims 37-39, wherein the first or second promoter comprises a polymerase II or a polymerase III promoter.

41. The vector of claim 40, wherein the first or second promoter comprises a polynucleotide sequence of any one of SEQ ID NOs: 40-42, or comprises a polynucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 40-42.

42. The vector of claim 40, wherein the first cassette comprises the polynucleotide sequence of SEQ ID NO: 43 or 44, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 43 or 44 and the second cassette comprises the polynucleotide sequence of SEQ ID NO: 45 or 46, or comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO: 45 or 46.

43. The vector of any one of claims 37-42, wherein the first and second cassettes comprise different or the same promoters.

44. The vector of any one of claims 37-43, wherein the vector further comprises a spacer element positioned between the first cassette and the second cassette.

45. The vector of claim 44, wherein the spacer element has a length of 25-2,500 base pairs (bp).

46. The vector of any one of claims 37-45, wherein the vector comprises a pair of ITRs positioned respectively upstream of the first cassette and downstream of the second cassette.

47. The vector of claim 46, wherein the ITRs are derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13.

48. The vector of claim 46, wherein the ITRs are mutated.

49. The vector of any one of claims 37-48, wherein AAV vector further comprises at least one post transcriptional regulatory element.

50. The AAV vector of any one of claims 37-49, wherein the AAV vector comprises a genome derived from AAV serotype AAV1, AAV6, AAV6.2FF, AAV8, AAV9, AAVrh74, or MYOAAV.

51. A cell comprising the polynucleotide of claim 32 or the vector of any one of claims 36-50.

52. An animal model comprising the cell of claim 51 or the vector of any one of claims 32-51.

53. A pharmaceutical composition comprising the cell of claim 51 or the vector of any one of claims 36-50 and a pharmaceutically acceptable carrier.

Images