Sirna for suppressing or reducing EGLN1 gene expression, drug, and use thereof

By designing and modifying siRNAs that specifically target EGLN1, the toxic side effects and non-targeting issues of small molecule inhibitors have been resolved, achieving precise inhibition of EGLN1 and safe treatment.

WO2026092593A1PCT designated stage Publication Date: 2026-05-07BEBETTER MED INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BEBETTER MED INC
Filing Date
2025-10-30
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing small molecule HIF-PH inhibitors have toxic side effects and systemic adverse reactions when treating EGLN1-related diseases, making it difficult to achieve precise targeting. siRNA therapy has the advantages of specificity and safety, but naked siRNA is unstable in vivo.

Method used

We designed and screened siRNAs that specifically target EGLN1, and improved their stability and activity in vivo and in vitro through chemical modification. Combined with a delivery system, we achieved precise inhibition of EGLN1.

Benefits of technology

It achieves highly specific inhibition of the EGLN1 gene, reduces the impact on non-target organs, avoids the adverse reactions of small molecule inhibitors, and improves the stability and therapeutic effect of siRNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025131261-FTAPPB-I100001
    Figure PCTCN2025131261-FTAPPB-I100001
  • Figure PCTCN2025131261-FTAPPB-I100002
    Figure PCTCN2025131261-FTAPPB-I100002
  • Figure PCTCN2025131261-FTAPPB-I100003
    Figure PCTCN2025131261-FTAPPB-I100003
Patent Text Reader

Abstract

An siRNA for suppressing or reducing EGLN1 gene expression, a drug, and a use thereof. Multiple siRNAs capable of suppressing EGLN1 expression are obtained by screening, which have the advantages of high targeting specificity and high biological activity. By means of appropriate modifications, a modified siRNA and a drug which have a higher silencing capacity against a target are obtained. The siRNA and the corresponding drug can be used for treating diseases related to EGLN1 target.
Need to check novelty before this filing date? Find Prior Art

Description

siRNAs, drugs, and their applications for inhibiting or reducing EGLN1 gene expression Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to siRNA, drugs, and their applications for inhibiting or reducing the expression of Egl-9 family hypoxia inducible factor 1 (EGLN1) gene. Background Technology

[0002] The Egl-9 family hypoxia-inducible factor 1 (EGLN1) plays a crucial regulatory role in various kidney diseases and kidney-related disorders. EGLN1 encodes PHD2, a protein containing a prolyl hydroxylase domain, which regulates the stability of hypoxia-inducible factor (HIF) under hypoxic conditions. Excessive activity or regulatory imbalance of EGLN1 leads to dysregulation of HIF stability, thereby affecting the progression of various kidney-related diseases. In chronic kidney disease, EGLN1 activity causes HIF pathway imbalance, exacerbating oxidative stress and fibrosis, thus accelerating disease progression. In acute kidney injury, EGLN1 modulates the hypoxic response, leading to HIF degradation, weakening the cells' ability to cope with hypoxia, and worsening kidney damage. In diabetic nephropathy, EGLN1-induced HIF inhibition exacerbates hypoxia and inflammation, promoting disease progression. In glomerulonephritis, increased EGLN1 activity may lead to HIF instability, making glomerular cell damage more severe in an inflammatory environment and accelerating disease progression. Furthermore, in renal cell carcinoma, EGLN1 regulates HIF activity, affecting tumor cell growth and angiogenesis, and plays a crucial role in hypoxic adaptation within the tumor microenvironment. In hypertensive kidney injury, EGLN1 may exacerbate hypertension-induced hypoxia and tissue damage by reducing HIF activity, further impairing renal function. In transplant-induced kidney injury, EGLN1 plays a significant role in the hypoxic adaptation of the transplanted kidney, and its activity regulation directly affects graft survival and long-term function. It has a particularly significant impact in renal anemia. In patients with renal anemia, overexpression of EGLN1 inhibits erythropoietin (EPO) synthesis, leading to insufficient erythropoiesis and exacerbating anemia symptoms. Simultaneously, EGLN1 further influences the pathological mechanisms of renal anemia by regulating iron metabolism and affecting erythrocyte lifecycle.

[0003] Significant progress has been made in research targeting the prolyl hydroxylase domain 2 (PHD2) encoded by EGLN1, particularly in the treatment of anemia and hypoxia-related diseases. Roxadustat is a PHD inhibitor (i.e., a HIF-PH inhibitor) approved in multiple countries worldwide for the treatment of anemia in chronic kidney disease. Other clinically validated HIF-PH inhibitors include daprodustat and vadadustat. These drugs enhance the stability of hypoxia-inducible factor (HIF) by inhibiting PHD2, thereby promoting erythropoietin (EPO) synthesis. It is widely used to treat anemia caused by chronic kidney disease.

[0004] In addition to kidney-related diseases, EGLN1 is involved in a variety of human diseases, such as cancer (e.g., breast cancer, colon cancer), peripheral artery disease (PAD), chronic obstructive pulmonary disease (COPD), retinopathy, neurodegenerative diseases (e.g., Parkinson's disease), traumatic brain injury and spinal cord injury, pulmonary hypertension, etc.

[0005] While small molecule HIF-PH inhibitors have shown significant efficacy in treating hypoxia-related diseases, they also present certain toxic side effects. Common adverse reactions include hypertension, abnormal liver function, and an increased risk of thrombosis. Furthermore, because small molecule inhibitors may affect HIF signaling pathways in multiple tissues and organs, precise targeting is difficult, potentially leading to systemic adverse reactions and even increasing the risk of abnormal angiogenesis and tumor growth.

[0006] In contrast, siRNA therapy offers significant advantages. siRNA can specifically target EGLN1 (the gene for PHD2), achieving precise inhibition in specific cells or tissues. This specificity reduces the impact on non-target organs, thus significantly reducing toxic side effects. Furthermore, siRNA therapy reduces protein expression through gene silencing, rather than directly inhibiting enzyme activity, thereby avoiding the adverse metabolic effects that may arise from small-molecule inhibitors. siRNA therapy can also further enhance its stability and targeting through chemical modifications and specific delivery systems (such as peptide conjugation and antibody conjugation), enabling it to produce long-lasting and mild regulatory effects in the kidneys or other sites requiring treatment. Therefore, siRNA therapy targeting EGLN1 offers advantages in terms of safety, targeting, and durability. Summary of the Invention

[0007] The purpose of this invention is to provide a siRNA that specifically targets the EGLN1 gene, a drug containing the siRNA, and its applications. The siRNA can inhibit or reduce EGLN1 gene expression and has the advantages of high specificity and good biological activity.

[0008] In a first aspect, the present invention provides siRNA or a pharmaceutically acceptable salt thereof for inhibiting or reducing the expression of the EGLN1 gene, said siRNA comprising a sense strand and an antisense strand, said siRNA being selected from any group of sense strands and their corresponding complementary antisense strands in Table 1, or sequences differing from its sense strand or antisense strand by no more than 3, 2, or 1 nucleotides, respectively.

[0009] The present invention also provides modified siRNAs to improve the stability and activity of siRNAs in vivo and in vitro.

[0010] Secondly, the present invention provides a medicament for inhibiting or reducing the expression of the EGLN1 gene, wherein the active ingredient comprises the above-mentioned siRNA or a pharmaceutically acceptable salt thereof.

[0011] Thirdly, the present invention provides the use of any of the above-mentioned siRNAs or their pharmaceutically acceptable salts, or any of the above-mentioned drugs, in the preparation of biological agents or pharmaceutical preparations that inhibit or reduce EGLN1 gene expression.

[0012] Or the use of the aforementioned siRNA or its pharmaceutically acceptable salt, or any of the aforementioned drugs in the preparation of products for treating EGLN1 gene-mediated or related diseases.

[0013] Fourthly, the present invention provides a method for inhibiting EGLN1 expression, the method comprising the following steps:

[0014] (a) Contacting cells with any of the above-mentioned siRNAs or their pharmaceutically acceptable salts, or any of the above-mentioned drugs; and

[0015] (b) The cells generated in step (a) are maintained for a time sufficient to allow for the degradation of the mRNA transcripts expressing EGLN1, thereby simultaneously inhibiting the expression of EGLN1 in the cells.

[0016] This invention screened multiple siRNAs and their salts capable of inhibiting or reducing EGLN1 gene expression, and further modified them appropriately to enhance their target silencing ability. The screened siRNAs possess the advantages of high target specificity and high biological activity. The siRNAs and their salts containing the aforementioned inhibitory or depressant EGLN1 gene expression can be used as drugs to treat energy metabolism disorders and other wasting diseases related to the EGLN1 target. Detailed Implementation

[0017] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0018] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0019] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0020] As used herein, the term "subject" includes both humans and mammals (e.g., mice, rats, pigs, cats, dogs, and horses). In many embodiments, the subject is a mammal, particularly a primate, especially a human. In some embodiments, the subject is livestock, such as cattle, sheep, goats, dairy cows, pigs, etc.; poultry, such as chickens, ducks, geese, turkeys, etc.; and domesticated animals, especially pets such as dogs and cats. In some embodiments (e.g., particularly in a research setting), the test mammal will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or pigs.

[0021] In this invention, the terms "inducing," "inhibiting," "enhancing," "increasing," "reducing," "lowering," etc., generally refer to quantitative differences between two states. For example, "the amount of EGLN1 activity or expression effectively inhibited" means that the level of EGLN1 activity or expression in the treated sample will be lower than the level of EGLN1 activity or expression in the untreated sample. These terms apply, for example, to expression levels and activity levels. The terms "reducing" and "lowering" are used interchangeably and generally refer to any change less than the original. "Reducing" and "lowering" are relative terms and need to be compared between before and after measurement. "Reducing" and "lowering" include complete depletion.

[0022] In this invention, the term "reduction" refers to an overall reduction, detectable by standard methods known in the art (such as those described herein), of the expression level / amount of a gene, gene product (e.g., protein), or biomarker in a first sample compared to the expression level / amount of the corresponding gene, gene product (e.g., protein), or biomarker in a second sample, by approximately 5% to 95% or 100%. In some embodiments, the term "reduction" refers to a reduction in the expression level / amount of a gene or biomarker in a test sample, wherein such reduction is at least approximately 0.9 to 0.01 times the expression level / amount of the corresponding gene or biomarker.

[0023] In this invention, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0024] In this invention, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. This also includes sterile water or physiological saline. Such preparations typically contain salts, excipients, buffers, preservatives, compatibility carriers, and optionally other therapeutic agents. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0025] In some embodiments of the present invention, there is a siRNA or a pharmaceutically acceptable salt thereof for inhibiting or reducing the expression of the EGLN1 gene. The siRNA comprises a sense strand and an antisense strand, and the siRNA is selected from any group of sense strands and their corresponding complementary antisense strands in Table 1, or sequences that differ from their sense strands or antisense strands by no more than 3, 2, or 1 nucleotides, respectively.

[0026] The difference can be understood as different situations such as nucleotide substitution, deletion, addition, and insertion.

[0027] In some embodiments, the nucleotide composition of the siRNA is selected from any of the corresponding sense strands and their corresponding complementary antisense strands in Table 1.

[0028] In some embodiments, the siRNA comprises a sense strand containing a nucleotide sequence that differs from any sense nucleotide sequence in Table 1 by no more than 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence that differs from any antisense nucleotide sequence in Table 1 by no more than 3 nucleotides.

[0029] In some embodiments, the nucleotide sequence of the siRNA is selected from any of the following pairs of sequences:

[0030] a)25023a: The positive chain sequence is shown in SEQ ID NO:73, and the negative chain sequence is shown in SEQ ID NO:74;

[0031] b)25006a: The sense chain sequence is shown in SEQ ID NO:19, and the antisense chain sequence is shown in SEQ ID NO:20;

[0032] c)25005a: The sense chain sequence is shown in SEQ ID NO:15, and the antisense chain sequence is shown in SEQ ID NO:16;

[0033] d)25023: The positive chain sequence is shown in SEQ ID NO:71, and the negative chain sequence is shown in SEQ ID NO:72;

[0034] e)25006: The sense chain sequence is shown in SEQ ID NO:17, and the antisense chain sequence is shown in SEQ ID NO:18;

[0035] f)25005: The sense chain sequence is shown in SEQ ID NO:13, and the antisense chain sequence is shown in SEQ ID NO:14;

[0036] g)25022: The positive chain sequence is shown in SEQ ID NO:65, and the negative chain sequence is shown in SEQ ID NO:66;

[0037] h)25022a: The sense chain sequence is shown in SEQ ID NO:67, and the antisense chain sequence is shown in SEQ ID NO:68;

[0038] i)25007: The positive chain sequence is shown in SEQ ID NO:21, and the negative chain sequence is shown in SEQ ID NO:22;

[0039] j)25007b: The positive chain sequence is shown in SEQ ID NO:25, and the negative chain sequence is shown in SEQ ID NO:26;

[0040] k)25004: The sense chain sequence is shown in SEQ ID NO:9, and the antisense chain sequence is shown in SEQ ID NO:10;

[0041] l)25019a: The positive chain sequence is shown in SEQ ID NO:55, and the negative chain sequence is shown in SEQ ID NO:56;

[0042] m)25024a: The sense chain sequence is shown in SEQ ID NO:79, and the antisense chain sequence is shown in SEQ ID NO:80;

[0043] n)25026: The positive chain sequence is shown in SEQ ID NO:85, and the negative chain sequence is shown in SEQ ID NO:86;

[0044] o)25027: The positive chain sequence is shown in SEQ ID NO:91, and the negative chain sequence is shown in SEQ ID NO:92;

[0045] p)25043: The sense chain sequence is shown in SEQ ID NO:127, and the antisense chain sequence is shown in SEQ ID NO:128;

[0046] q)25043a: The sense chain sequence is shown in SEQ ID NO:129, and the antisense chain sequence is shown in SEQ ID NO:130;

[0047] r)25045: The positive chain sequence is shown in SEQ ID NO:135, and the antisense chain sequence is shown in SEQ ID NO:136;

[0048] s)25046: The sense chain sequence is shown in SEQ ID NO:139, and the antisense chain sequence is shown in SEQ ID NO:140.

[0049] In some embodiments of the present invention, the above-mentioned modified siRNA is used to improve the stability and activity of siRNA in vivo and in vitro.

[0050] In some embodiments, the positive strand of the siRNA comprises no more than 3, 2, 1, or 0 unmodified nucleotides, wherein the modified nucleotides in the positive strand comprise nucleotides selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, and 2'-fluorine modified nucleotides, respectively, and are free of reverse base residues, and the positive strand contains 0, 1, 2, or 3 phosphate thioester bonds at the 5'-end and 3'-end.

[0051] In some embodiments, the antisense strand of the siRNA comprises no more than 3, 2, 1, or 0 unmodified nucleotides, wherein the modified nucleotides in the antisense strand include nucleotides selected from 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2'-fluorine-modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinylphosphate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinylphosphate-3'-phosphate), or other VPU derivatives, wherein the antisense strand contains 1-3 thiophosphate bonds at both the 5'-end and the 3'-end.

[0052] In some embodiments, the positive strand comprises at least 15, 16, or 17 consecutive nucleotides, which differ from any of the positive strand nucleotide sequences shown in Table 4 by no more than 3 nucleotides; and wherein the antisense strand comprises at least 15, 16, or 17 consecutive nucleotides, which differ from any of the antisense strand nucleotide sequences shown in Table 4 by no more than 3 nucleotides.

[0053] In some embodiments, the double-stranded siRNA is selected from any pair of siRNAs in Table 2, or a sequence that differs from the siRNAs shown in Table 2 by no more than 3, 2, or 1 nucleotides; the antisense strand nucleotide sequence differs by no more than 3, 2, or 1 nucleotide.

[0054] a) In some embodiments, the modified siRNA is selected from any of the following pairs of sequences: 25023a.2.1: its sense strand sequence is as shown in Invab*mC*mAmAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmAInvab, and its antisense strand sequence is as shown in VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mG;

[0055] b)25023a.1.1: Its positive chain sequence is shown as mC*mA*mAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mG;

[0056] c)25006a.2.1: The positive chain sequence is shown as Invab*mG*mCmAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmAInvab, and the negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mC;

[0057] d)25006a.1.1: The positive chain sequence is shown as mG*mC*mAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmA, and the negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mC;

[0058] e)25005a.2.1: The positive chain sequence is shown as Invab*mC*mGmGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmAInvab, and the negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mG;

[0059] f)25005a.1.1: The positive chain sequence is shown as mC*mG*mGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmA, and the negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mG;

[0060] g)25023.1.1: The positive chain sequence is shown as mG*mA*mAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmA, and the negative chain sequence is shown as VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mC;

[0061] h)25006.1.1: The positive chain sequence is shown as mC*mC*mAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmA, and the negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mG;

[0062] i)25005.1.1: The positive chain sequence is shown as mU*mG*mGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmA, and the negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mA;

[0063] j)25022.2.1: The positive chain sequence is shown as Invab*mG*mUmGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmUmAmUmAInvab, and the negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mC;

[0064] k)25022.1.1: The positive chain sequence is shown as mG*mU*mGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmAmUmA, and the negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mC;

[0065] l)25022a.2.1: Its positive chain sequence is shown as Invab*mC*mUmGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mG;

[0066] m)25022a.1.1: Its positive chain sequence is shown as mC*mU*mGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mG;

[0067] n)25007.2.1, its positive chain sequence is shown as Invab*mG*mAmUmGmUmGmUmGfAfCfAfUmGfUmAmUmAmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmAfCmAmCmA*mU*mC;

[0068] o)25007.1.1, its positive chain sequence is shown as mG*mA*mUmGmUmGmUmGfAfCfAfUmGfUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmAfCmAmCmA*mU*mC;

[0069] p)25007b.2.1: Its positive chain sequence is shown as Invab*mG*mAmUmGmUmGmCmGfAfCfAfUmGfUmAmUmAmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmGfCmAmCmA*mU*mC;

[0070] q)25007b.1.1: Its positive chain sequence is shown as mG*mA*mUmGmUmGmCmGfAfCfAfUmGfUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmGfCmAmCmA*mU*mC;

[0071] r)25004.2.1: Its positive chain sequence is shown as Invab*mC*mGmUmGmAmCmAmUfGfUfAfUmAfUmAmUmUmAmUmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mAmUmAmAmUmAmUmAmUdAmCfAmUfGmUmCmA*mC*mG;

[0072] s)25004.1.1: Its positive chain sequence is shown as mC*mG*mUmGmAmCmAmUfGfUfAfUmAfUmAmUmUmAmUmCmA, and its negative chain sequence is shown as VPU-S*fG*mAmUmAmAmUmAmUmAmUdAmCfAmUfGmUmCmA*mC*mG;

[0073] t)25019a.2.1, its positive chain sequence is shown as Invab*mG*mUmAmAmUmCmCmAfAfAfUfGmGfAmGmAmUmGmGmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mCmCmAmUmCmUmCmCmAdTmUfUmGfGmAmUmU*mA*mC;

[0074] u)25019a.1.1, its positive chain sequence is shown as mG*mU*mAmAmUmCmCmAfAfAfUfGmGfAmGmAmUmGmGmAmA, and its negative chain sequence is shown as VPU-S*fU*mCmCmAmUmCmUmCmCmAdTmUfUmGfGmAmUmU*mA*mC;

[0075] v)25024a.2.1: Its sense chain sequence is shown as Invab*mC*mAmUmGmGmAmAmGfAfUfGfUmGfUmGmAmCmAmUmGmAInvab, and its antisense chain sequence is shown as VPU-S*fC*mAmUmGmUmCmAmCmAmCdAmUfCmUfUmCmCmA*mU*mG.

[0076] w)25024a.1.1: Its positive chain sequence is shown as mC*mA*mUmGmGmAmAmGfAfUfGfUmGfUmGmAmCmAmUmGmA, and its negative chain sequence is shown as VPU-S*fC*mAmUmGmUmCmAmCmAmCdAmUfCmUfUmCmCmA*mU*mG;

[0077] x)25026.2.1: The positive chain sequence is shown as Invab*mC*mAmUmGmUmUmGmAfUfAfAfUmCfCmAmAmAmUmGmGmAInvab, and the negative chain sequence is shown as VPU-S*fC*mCmAmUmUmUmGmGmAmUdTmAfUmCfAmAmCmA*mU*mG;

[0078] y)25026.1.1: The positive chain sequence is shown as mC*mA*mUmGmUmUmGmAfUfAfAfUmCfCmAmAmAmUmGmGmA, and the negative chain sequence is shown as VPU-S*fC*mCmAmUmUmUmGmGmAmUdTmAfUmCfAmAmCmA*mU*mG;

[0079] z)25027.2.1: Its positive chain sequence is shown as Invab*mA*mAmAmGmCmCmAmUfGfGfUfUmGfCmUmUmGmUmUmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mAmAmCmAmAmGmCmAmAmAdCmCfAmUfGmGmCmU*mU*mU;

[0080] aa)25027.1.1: Its positive chain sequence is shown as mA*mA*mAmGmCmCmAmUfGfGfUfUmGfCmUmUmGmUmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmAmCmAmAmGmCmAmAmAdCmCfAmUfGmGmCmU*mU*mU;

[0081] ab)25043.2.1: Its positive chain sequence is shown as Invab*mG*mUmAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mC;

[0082] ac)25043.1.1: Its positive chain sequence is shown as mG*mU*mAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmA, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mC;

[0083] ad)25043a.2.1: Its positive chain sequence is shown as Invab*mC*mUmAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mG;

[0084] ae)25043a.1.1: Its positive chain sequence is shown as mC*mU*mAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmA, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mG;

[0085] af)25045.2.1: Its positive chain sequence is shown as Invab*mU*mAmUmGmUmAmCmGfUfCfAfUmGfUmUmGmAmUmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mUmAmUmCmAmAmCmAmUdGmAfCmGfUmAmCmA*mU*mA;

[0086] ag)25045.1.1: Its positive chain sequence is shown as mU*mA*mUmGmUmAmCmGfUfCfAfUmGfUmUmGmAmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mUmAmUmCmAmAmCmAmUdGmAfCmGfUmAmCmA*mU*mA;

[0087] ah)25046.2.1: Its positive chain sequence is shown as Invab*mG*mGmUmUmAmUmGmUfAfCfGfUmCfAmUmGmUmUmGmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mCmAmAmCmAmUmGmAmCdGmUfAmCfAmUmAmA*mC*mC;

[0088] ai)25046.1.1: Its positive chain sequence is shown as mG*mG*mUmUmAmUmGmUfAfCfGfUmCfAmUmGmUmUmGmAmA, and its negative chain sequence is shown as VPU-S*fU*mCmAmAmCmAmUmGmAmCdGmUfAmCfAmUmAmA*mC*mC;

[0089] Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- Fluorouraidine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is a reverse abase-free residue, and * is a thiophosphate bond.

[0090] In some embodiments of the present invention, there is also a drug for inhibiting or reducing EGLN1 gene expression, wherein the active ingredient of the drug comprises the above-mentioned siRNA or a pharmaceutically acceptable salt thereof.

[0091] In some embodiments, the drug further includes a delivery carrier, which is known in the art.

[0092] Some embodiments of the present invention relate to the use of any of the above-mentioned siRNAs or their pharmaceutically acceptable salts, or the drugs, in the preparation of biological agents or pharmaceutical formulations that inhibit or reduce EGLN1 expression.

[0093] The use of the aforementioned siRNA or its pharmaceutically acceptable salt, or any of the aforementioned drugs, in the preparation of drugs for the prevention or treatment of diseases mediated or related to the EGLN1 gene.

[0094] Some embodiments of the present invention relate to a method for inhibiting or reducing EGLN1 gene expression, the method comprising the following steps:

[0095] (a) Contacting cells with any of the above-mentioned siRNAs or their pharmaceutically acceptable salts, or any of the above-mentioned drugs; and

[0096] (b) The cells produced in step (a) are maintained for a time sufficient to allow for the degradation of the mRNA transcripts that express the EGLN1 gene, thereby simultaneously inhibiting or reducing the expression of EGLN1 in the cells.

[0097] In some embodiments, the cells are located within the subject's body.

[0098] In some embodiments, the cells are in vitro from the subject.

[0099] In some implementations, the subject is a mammal, including primates (e.g., humans, non-human primates such as monkeys and chimpanzees), non-primates, and preferably, the mammal is a human, a rat, or a mouse.

[0100] In some embodiments, EGLN1 expression is inhibited or reduced by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0101] The siRNA is used in the preparation of vaccines for the prevention or treatment of diseases mediated by the EGLN1 gene. These diseases include, but are not limited to, chronic kidney disease or kidney-related diseases; or EGLN1 gene-mediated cancer, peripheral artery disease (PAD), chronic obstructive pulmonary disease (COPD), retinopathy, neurodegenerative diseases (such as Parkinson's disease), traumatic brain injury and spinal cord injury, and pulmonary hypertension.

[0102] The chronic kidney disease and kidney-related diseases mentioned are renal anemia, chronic kidney disease, acute kidney injury, diabetic nephropathy and glomerulonephritis, renal cancer, hypertensive kidney injury, and transplanted kidney injury; the cancers mentioned are EGLN1 gene-mediated breast cancer and colon cancer.

[0103] The abbreviations and structures of the nucleotide monomers used in nucleic acid sequence representation are as follows:

[0104] The specific structure is as follows:

[0105] Those skilled in the art, based on existing technology, would recognize that the pharmaceutically acceptable salt of the siRNA could be a sodium or potassium salt, for example, a sodium salt of the siRNA produced during purification.

[0106] The present invention will be further described in detail below with reference to specific embodiments, but this is not intended to limit the scope of protection of the claims of the present invention.

[0107] Example 1: Synthesis of siRNA

[0108] On the 48-channel nucleic acid synthesizer of Jiangsu Lingkun Biotechnology Co., Ltd., 0.2-1 μmol of oligonucleotides were synthesized using a solid-phase oligonucleotide synthesis protocol.

[0109] The 3'-terminal alkyne-modified siRNA positive strand SS-GalNAc (R=O or S) is synthesized using a structure-controlled microporous glass bead (CPG) vector as shown. If a delivery vector, such as a GalNAc ligand, is required, the structure of the GalNAc ligand linked to the 3' end of the siRNA is as follows:

[0110] Ammonolysis reagent was added to the synthesized oligonucleotides, and the mixture was incubated at 45-80℃ to separate the oligonucleotides from the solid-phase support, thus freeing them. The crude oligonucleotides were then precipitated with ethanol, centrifuged at high speed to discard the supernatant, and the process was repeated twice to obtain the crude oligonucleotides. The precipitate was then resuspended in DEPC-treated water. The crude oligonucleotides were purified by ion-pairing HPLC, and the collected product was dried to powder in a vacuum centrifuge. The purified product was dissolved in DEPC-treated water and analyzed by TOF LC-MS. The oligonucleotide concentration was determined, and the required volumes of equimolar amounts of the sense and antisense strands were calculated. Equimolar amounts of the sense and antisense strands were mixed thoroughly, and the mixture was annealed by heating at 95℃ for 5 minutes, followed by natural cooling to room temperature to prepare the double strands.

[0111] Table 1: Sensitive and antisense nucleotide sequences of unmodified siRNA targeting human EGLN1

[0112] The siRNA sequence in Table 1 targets the human EGLN1 transcript NM_022051.3.

[0113] Naked siRNA sequences are unstable in vivo and are easily degraded by nucleases. Modifying siRNA not only makes the sequence more stable in vivo and in vitro, but also further enhances its activity.

[0114] Table 2: Double-stranded siRNA sequences targeting EGLN1

[0115] Example 2: In vitro screening of siRNA in 293Ta-hEGLN1 cells using liposome transfection.

[0116] Construction of the 293Ta-hEGLN1 cell line: Based on the EGLN1 sequence information published by NCBI, the gene was synthesized at Qingke Biotechnology and ligated into the pLVX-mCMV vector. Lentiviral packaging was performed using the pLVX-mCMV-hEGLN1, psPAX2, and pMD2.G three-plasmid system. Before lentiviral infection, 293Ta cells were seeded to a density of approximately 80%. After 12 hours, the culture medium in the six-well plates was discarded, and 750 μl of virus and 750 μl of culture medium were added to each well, along with Polybrene (final concentration 10 μg / ml), and mixed thoroughly. The plates were incubated at 37°C in a 5% CO2 incubator. After 16 hours of infection, the culture medium was discarded, fresh culture medium was added, and puromycin was added for selection.

[0117] Cell culture and 96-well plate transfection: In vitro experiments were performed in 293Ta-hEGLN1 cells using DMEM + 10% FBS + 1X penicillin-streptomycin + 1X non-essential amino acid medium. When cells reached 80% confluency, they were digested with trypsin, and cell density was measured using a Scepter automated cell counter (Millipore, #PHCC00000). Simultaneously, siRNA, Opti-MEM, and INTERFERin (Polyplus transfection) were mixed in 96-well plates and incubated at room temperature for 10 minutes. Then, complete medium containing 293Ta-hEGLN1 cells was added to each well, and the 96-well plates were incubated at 37°C with 5% CO2 for 24 hours. The modified siRNA was screened at a final concentration of 10 nM.

[0118] RNA extraction and reverse transcription in 96-well plates: mRNA was extracted from cells in 96-well plates using the Dynabeads mRNADIRECT kit (Ambion). The culture medium in the 96-well plates was aspirated, and the cells were washed once with DPBS. 50-300 μl of cell lysis buffer was added to each well, followed by 20-100 μl of [unclear text - possibly a typo, should be 20-100 μl]. Shake the beads on a vibrator, place the 96-well plate on a magnetic separator, aspirate the lysis buffer from the wells, add 50-300 μl of washing buffer A to each well, pipette, place on the magnetic separator, aspirate washing buffer A, then use washing buffer B to lift the beads and transfer them to a new 96-well plate. Place the plate on a magnetic separator, aspirate washing buffer B, and then use washing buffer B to lift the beads and transfer them to a 96-well PCR plate. At the same time, prepare the reverse transcription reagent, place the 96-well PCR plate on a magnetic separator, aspirate washing buffer B, add 20 μl of reverse transcription reagent to each well, seal the plate with sealing film, and incubate on a PCR instrument at 25°C for 10 minutes, then at 37°C for 2 hours, then at 85°C for 5 minutes, cool to 4°C, and the reverse transcription is complete.

[0119] Real-time quantitative PCR: After reverse transcription, the 96-well plate was placed on a magnetic separator until the beads were adsorbed to the bottom. The reverse transcription reagent was removed, and the prepared qPCR system was added to the 96-well PCR plate. The plate was sealed with a sealing membrane, and PCR was performed on a StepOnePlus real-time PCR system (applied biosystems). Data were analyzed using the ΔΔCt method, and the results were standardized using cells transfected with the same concentration of negative control sequence.

[0120] The negative control AD-1955 sequence is as follows:

[0121] Chain of Justice: CUUACGCUGAGUACUUCGAdTdT (SEQ ID NO:161)

[0122] Antonym chain: UCGAAGUACUCAGCGUAAGdTdT (SEQ ID NO:162).

[0123] The primers for detecting human EGLN1 are as follows:

[0124] Forward primer: AGGCGATAAGATCACCTGGAT (SEQ ID NO:163)

[0125] Reverse primer: TTCGTCCGGCCATTGATTTTG (SEQ ID NO:164)

[0126] The primers for detecting EGLN1 in mice are as follows:

[0127] Forward primer: ACCAGATCACCTGGATCGAGG (SEQ ID NO:165)

[0128] Reverse primer: GCCGTTTATCCTGTAGTTGCC (SEQ ID NO:166)

[0129] Table 3: Results of liposome transfection of 10 nM modified siRNA double strands in 293Ta-hEGLN1 cells

[0130] Example 3: In vitro screening of siRNA in mouse primary renal tubular epithelial cells using liposome transfection.

[0131] Isolation of primary renal tubular epithelial cells from mice: Male Kunming mice aged 4-6 weeks were euthanized by cervical dislocation and disinfected by immersion in 75% alcohol. The kidneys were aseptically obtained by cutting along the dorsal renal region and placed in a culture dish containing pre-chilled PBS (4°C). The kidneys were repeatedly rinsed. The renal capsule was removed, and the cells were rinsed 2-3 times with pre-chilled PBS. The renal cortex was separated from the medulla, leaving the renal cortex. The cortex was thoroughly minced with tissue scissors in a culture dish, mixed with pre-chilled PBS, and transferred to a centrifuge tube. The mixture was centrifuged at 1500 rpm for 5 min. The supernatant in the centrifuge tube was removed, and 2 mL of type II collagenase solution (0.1%) was added to each tube. The mixture was repeatedly pipetted and agitated several times. The centrifuge tubes were then placed on a shaker at 37°C for 30 min for digestion. Digestion was terminated by adding culture medium containing 10% FBS. The mixture was filtered through a 70 μm filter, and the filtrate was repeatedly pipetted and agitated before being transferred to a centrifuge tube. The mixture was centrifuged at 1500 rpm for 5 min. Remove the supernatant, add preheated primary culture medium (37°C) to the cell pellet in the centrifuge tube, and resuspend the cells by pipetting several times. Inoculate into 75cm culture flasks and place in a 37°C, 5% CO2 incubator. Do not shake the culture flasks for 12 hours. Change the culture medium for the first time after 48 hours, and then every other day thereafter.

[0132] Table 4: Results of screening experiments using modified siRNA double strands in primary renal tubular epithelial cells of Kunming mice at a transfection concentration of 10 nM.

[0133] Example 4: In vitro screening of siRNA in Caov-3 cells using liposome transfection.

[0134] Cell culture and 96-well plate transfection: In vitro experiments were performed in Caov-3 cells using MEM + 10% FBS + 1X penicillin-streptomycin + 1X non-essential amino acid medium. When the cells reached 80% coverage, they were digested with trypsin, and the cell density was measured using a Scepter automated cell counter (Millipore, #PHCC00000). Simultaneously, siRNA, Opti-MEM, and INTERFERin (Polyplus transfection) were mixed in 96-well plates and incubated at room temperature for 10 minutes. Then, complete medium containing Caov-3 cells was added to each well, and the 96-well plates were incubated at 37°C with 5% CO2 for 24 hours.

[0135] Table 5: Experimental results of liposome transfection of 1 nM modified siRNA double strands in Caov-3 cells.

[0136] Table 6: Results of liposome transfection of 0.3 nM modified siRNA double strands in Caov-3 cells

[0137] Table 7: Results of liposome transfection of 0.1 nM modified siRNA double strands in Caov-3 cells.

[0138] Example 5: The hEGLN1 (human EGLN1) gene was integrated into a liver-targeting AAV8 expression vector, and a virus (PackGene Biotech, AAV8LP) was prepared and then used to infect mice to obtain transgenic mice that stably express hEGLN1.

[0139] Primary mouse hepatocyte extraction: Mouse hepatocytes were extracted by collagenase digestion via inferior vena cava perfusion. After filtration through a tissue cell filter (BIOLOGIX, 15-1070), viable primary mouse hepatocytes were obtained and resuspended in DMEM medium + 10% FBS + 1X penicillin-streptomycin. Cell density was determined using a Scepter automated cell counter (Millipore).

[0140] 96-well plate transfection: In vitro experiments were performed in mouse primary hepatocytes. siRNA, Opti-MEM, and INTERFERin (Polyplus transfection) were mixed in 96-well plates and incubated at room temperature for 10 minutes (INTERFERin is not required for siRNA with free uptake). Then, complete culture medium containing mouse primary hepatocytes was added to each well. The 96-well plates were incubated at 37°C with 5% CO2 for 24 hours.

[0141] Table 8 shows the experimental results of screening at a concentration of 1 nM using modified siRNA double strands delivered via GalNAc in primary mouse hepatocytes expressing hEGLN1.

[0142] Table 8:

[0143] Table 9 shows the experimental results of screening at a concentration of 0.3 nM using modified siRNA double strands delivered via GalNAc in primary mouse hepatocytes expressing hEGLN1.

[0144] Table 9:

[0145] Example 6: Evaluation of the effect of different sequences on EGLN1 expression in the liver of mice expressing hEGLN1

[0146] Following the experimental procedure described in Example 5, the effects of different sequences on EGLN1 expression in the liver were evaluated in mice expressing hEGLN1.

[0147] Table 10: Activity assay results of different conjugates (siRNA duplexes) in liver tissue of mice expressing hEGLN1 on day 12.

[0148] Table 11: Activity assay results of different conjugates (siRNA duplexes) in liver tissue of mice expressing hEGLN1 on day 27.

[0149] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. siRNA or a pharmaceutically acceptable salt thereof for inhibiting or reducing EGLN1 gene expression, wherein, The siRNA includes a sense strand and its corresponding complementary and antisense strands. The siRNA is selected from any group of sense strands and their corresponding complementary and antisense strands in Table 1, or a sequence that differs from its sense strand or antisense strand by no more than 3, 2, or 1 nucleotides, respectively.

2. The siRNA or a pharmaceutically acceptable salt thereof according to claim 1, wherein, The siRNA is selected from any of the following pairs of sequences: 25023a: the sense strand sequence is shown in SEQ ID NO:73, and the antisense strand sequence is shown in SEQ ID NO:74; 25006a: The sense chain sequence is shown in SEQ ID NO:19, and the antisense chain sequence is shown in SEQ ID NO:20; 25005a: The sense chain sequence is shown in SEQ ID NO:15, and the antisense chain sequence is shown in SEQ ID NO:16; 25023: The positive chain sequence is shown in SEQ ID NO:71, and the negative chain sequence is shown in SEQ ID NO:72; 25006: The positive chain sequence is shown in SEQ ID NO:17, and the negative chain sequence is shown in SEQ ID NO:18; 25005: The positive chain sequence is shown in SEQ ID NO:13, and the negative chain sequence is shown in SEQ ID NO:14; 25022: The positive chain sequence is shown in SEQ ID NO:65, and the negative chain sequence is shown in SEQ ID NO:66; 25022a: The positive chain sequence is shown in SEQ ID NO:67, and the negative chain sequence is shown in SEQ ID NO:68; 25007: The positive chain sequence is shown in SEQ ID NO:21, and the negative chain sequence is shown in SEQ ID NO:22; 25007b: The positive chain sequence is shown in SEQ ID NO:25, and the negative chain sequence is shown in SEQ ID NO:26; 25004: The sense chain sequence is shown in SEQ ID NO:9, and the antisense chain sequence is shown in SEQ ID NO:10; 25019a: The positive chain sequence is shown in SEQ ID NO:55, and the negative chain sequence is shown in SEQ ID NO:56; 25024a: The sense chain sequence is shown in SEQ ID NO:79, and the antisense chain sequence is shown in SEQ ID NO:80; 25026: The positive chain sequence is shown in SEQ ID NO:85, and the negative chain sequence is shown in SEQ ID NO:86; 25027: The positive chain sequence is shown in SEQ ID NO:91, and the negative chain sequence is shown in SEQ ID NO:92; 25043: The positive chain sequence is shown in SEQ ID NO:127, and the negative chain sequence is shown in SEQ ID NO:128; 25043a: The positive chain sequence is shown in SEQ ID NO:129, and the negative chain sequence is shown in SEQ ID NO:130; 25045: The positive chain sequence is shown in SEQ ID NO:135, and the negative chain sequence is shown in SEQ ID NO:136; 25046: The positive chain sequence is shown in SEQ ID NO:139, and the negative chain sequence is shown in SEQ ID NO:

140.

3. The siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 1-2, wherein, The siRNA is modified, wherein the sense strand comprises no more than 3, 2, 1, or 0 unmodified nucleotides, the modified nucleotides in the sense strand comprising nucleotides selected from 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2'-fluorine-modified nucleotides, and reverse-free base residues, and the sense strand contains 0, 1, 2, or 3 thiophosphate bonds at the 5'-end and 3'-end; and wherein the antisense strand comprises no more than 3, 2, 1, or 0 unmodified nucleotides, the modified nucleotides in the antisense strand comprising nucleotides selected from 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2'-fluorine-modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinylphosphate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinylphosphate-3'-phosphate), or other VPU derivatives, and the antisense strand contains 1-3 thiophosphate bonds at both the 5'-end and 3'-end.

4. The siRNA or a pharmaceutically acceptable salt thereof according to claim 3, wherein, The siRNA is selected from any one of the positive strands and its corresponding complementary antisense strands in Table 2, or a sequence that differs from its positive strand or antisense strand by no more than 3, 2, or 1 nucleotide or modified nucleotide, respectively.

5. The siRNA or a pharmaceutically acceptable salt thereof according to claim 4, wherein, The modified siRNA is selected from any of the following sequence pairs: 25023a.2.1: its sense strand sequence is as shown in Invab*mC*mAmAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmAInvab, and its antisense strand sequence is as shown in VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mG; 25023a.1.1: Its positive chain sequence is shown as mC*mA*mAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mG; 25006a.2.1: Its positive chain sequence is shown as Invab*mG*mCmAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmAInvab, and its negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mC; 25006a.1.1: Its positive chain sequence is shown as mG*mC*mAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmA, and its negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mC; 25005a.2.1: Its positive chain sequence is shown as Invab*mC*mGmGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mG; 25005a.1.1: Its positive chain sequence is shown as mC*mG*mGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mG; 25023.1.1: Its positive chain sequence is shown as mG*mA*mAmGmAmUmGmUfGfUfGfAmCfAmUmGmUmAmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmUmAmCmAmUmGmUmCdAmCfAmCfAmUmCmU*mU*mC; 25006.1.1: The positive chain sequence is shown as mC*mC*mAmAmAmUmGmGfAfGfAfUmGfGmAmAmGmAmUmGmA, and the negative chain sequence is shown as VPU-S*fC*mAmUmCmUmUmCmCmAmUdCmUfCmCfAmUmUmU*mG*mG; 25005.1.1: The positive chain sequence is shown as mU*mG*mGmAmAmGmAmUfGfUfGfUmGfAmCmAmUmGmUmAmA, and the negative chain sequence is shown as VPU-S*fU*mAmCmAmUmGmUmCmAmCdAmCfAmUfCmUmUmC*mC*mA; 25022.2.1: The positive chain sequence is shown as Invab*mG*mUmGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmUmAmUmAInvab, and the negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mC; 25022.1.1: The positive chain sequence is shown as mG*mU*mGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmAmUmA, and the negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mC; 25022a.2.1: Its positive chain sequence is shown as Invab*mC*mUmGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mG; 25022a.1.1: Its positive chain sequence is shown as mC*mU*mGmUmGmAmCmAfUfGfUfAmUfAmUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmAmUmAmUmAmUmAdCmAfUmGfUmCmAmC*mA*mG; 25007.2.1, its positive chain sequence is shown as Invab*mG*mAmUmGmUmGmUmGfAfCfAfUmGfUmAmUmAmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmAfCmAmCmA*mU*mC; 25007.1.1, its positive chain sequence is shown as mG*mA*mUmGmUmGmUmGfAfCfAfUmGfUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmAfCmAmCmA*mU*mC; 25007b.2.1: Its positive chain sequence is shown as Invab*mG*mAmUmGmUmGmCmGfAfCfAfUmGfUmAmUmAmUmAInvab, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmGfCmAmCmA*mU*mC; 25007b.1.1: Its positive chain sequence is shown as mG*mA*mUmGmUmGmCmGfAfCfAfUmGfUmAmUmAmUmA, and its negative chain sequence is shown as VPU-S*fA*mUmAmUmAmUmAmCmAmUdGmUfCmGfCmAmCmA*mU*mC; 25004.2.1: Its positive chain sequence is shown as Invab*mC*mGmUmGmAmCmAmUfGfUfAfUmAfUmAmUmUmAmUmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mAmUmAmAmUmAmUmAmUdAmCfAmUfGmUmCmA*mC*mG; 25004.1.1: Its positive chain sequence is shown as mC*mG*mUmGmAmCmAmUfGfUfAfUmAfUmAmUmUmAmUmCmA, and its negative chain sequence is shown as VPU-S*fG*mAmUmAmAmUmAmUmAmUdAmCfAmUfGmUmCmA*mC*mG; 25019a.2.1, its positive chain sequence is shown as Invab*mG*mUmAmAmUmCmCmAfAfAfUfGmGfAmGmAmUmGmGmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mCmCmAmUmCmUmCmCmAdTmUfUmGfGmAmUmU*mA*mC; 25019a.1.1, its positive chain sequence is shown as mG*mU*mAmAmUmCmCmAfAfAfUfGmGfAmGmAmUmGmGmAmA, and its negative chain sequence is shown as VPU-S*fU*mCmCmAmUmCmUmCmCmAdTmUfUmGfGmAmUmU*mA*mC; 25024a.2.1: Its positive chain sequence is shown as Invab*mC*mAmUmGmGmAmAmGfAfUfGfUmGfUmGmAmCmAmUmGmAInvab, and its negative chain sequence is shown as VPU-S*fC*mAmUmGmUmCmAmCmAmCdAmUfCmUfUmCmCmA*mU*mG; 25024a.1.1: Its positive chain sequence is shown as mC*mA*mUmGmGmAmAmGfAfUfGfUmGfUmGmAmCmAmUmGmA, and its negative chain sequence is shown as VPU-S*fC*mAmUmGmUmCmAmCmAmCdAmUfCmUfUmCmCmA*mU*mG; 25026.2.1: The positive chain sequence is shown as Invab*mC*mAmUmGmUmUmGmAfUfAfAfUmCfCmAmAmAmUmGmGmAInvab, and the negative chain sequence is shown as VPU-S*fC*mCmAmUmUmUmGmGmAmUdTmAfUmCfAmAmCmA*mU*mG; 25026.1.1: The positive chain sequence is shown as mC*mA*mUmGmUmUmGmAfUfAfAfUmCfCmAmAmAmUmGmGmA, and the negative chain sequence is shown as VPU-S*fC*mCmAmUmUmUmGmGmAmUdTmAfUmCfAmAmCmA*mU*mG; 25027.2.1: Its positive chain sequence is shown as Invab*mA*mAmAmGmCmCmAmUfGfGfUfUmGfCmUmUmGmUmUmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mAmAmCmAmAmGmCmAmAmAdCmCfAmUfGmGmCmU*mU*mU; 25027.1.1: Its positive chain sequence is shown as mA*mA*mAmGmCmCmAmUfGfGfUfUmGfCmUmUmGmUmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mAmAmCmAmAmGmCmAmAmAdCmCfAmUfGmGmCmU*mU*mU; 25043.2.1: Its positive chain sequence is shown as Invab*mG*mUmAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mC; 25043.1.1: Its positive chain sequence is shown as mG*mU*mAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmA, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mC; 25043a.2.1: Its positive chain sequence is shown as Invab*mC*mUmAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmAInvab, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mG; 25043a.1.1: Its positive chain sequence is shown as mC*mU*mAmCmGmUmCmAfUfGfUfUmGfAmUmAmAmUmCmCmA, and its negative chain sequence is shown as VPU-S*fG*mGmAmUmUmAmUmCmAmAdCmAfUmGfAmCmGmU*mA*mG; 25045.2.1: Its positive chain sequence is shown as Invab*mU*mAmUmGmUmAmCmGfUfCfAfUmGfUmUmGmAmUmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mUmAmUmCmAmAmCmAmUdGmAfCmGfUmAmCmA*mU*mA; 25045.1.1: Its positive chain sequence is shown as mU*mA*mUmGmUmAmCmGfUfCfAfUmGfUmUmGmAmUmAmA, and its negative chain sequence is shown as VPU-S*fU*mUmAmUmCmAmAmCmAmUdGmAfCmGfUmAmCmA*mU*mA; 25046.2.1: Its positive chain sequence is shown as Invab*mG*mGmUmUmAmUmGmUfAfCfGfUmCfAmUmGmUmUmGmAmAInvab, and its negative chain sequence is shown as VPU-S*fU*mCmAmAmCmAmUmGmAmCdGmUfAmCfAmUmAmA*mC*mC; 25046.1.1: Its positive chain sequence is shown as mG*mG*mUmUmAmUmGmUfAfCfGfUmCfAmUmGmUmUmGmAmA, and its negative chain sequence is shown as VPU-S*fU*mCmAmAmCmAmUmGmAmCdGmUfAmCfAmUmAmA*mC*mC; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- Fluorouraidine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is a reverse abase-free residue, and * is a thiophosphate bond.

6. A drug that inhibits or reduces the expression of the EGLN1 gene, wherein, The active ingredient of the drug includes the siRNA as described in any one of claims 1-5 or a pharmaceutically acceptable salt thereof.

7. The use of the siRNA or a pharmaceutically acceptable salt thereof as described in any one of claims 1-5, or the drug of claim 6, in the preparation of a product that inhibits or reduces EGLN1 gene expression.

8. The use of the siRNA or a pharmaceutically acceptable salt thereof as described in any one of claims 1-5, or the medicament as described in claim 6, in the preparation of a medicament for the prevention or treatment of diseases mediated or related to the EGLN1 gene.

9. The application according to any one of claims 7-8, wherein, The diseases mentioned are EGLN1 gene-mediated chronic kidney disease or kidney-related diseases; or EGLN1 gene-mediated cancer, peripheral artery disease (PAD), chronic obstructive pulmonary disease (COPD), retinopathy, neurodegenerative diseases, traumatic brain injury and spinal cord injury, and pulmonary hypertension.

10. The application according to claim 9, wherein, The chronic kidney disease and kidney-related diseases mentioned are renal anemia, chronic kidney disease, acute kidney injury, diabetic nephropathy and glomerulonephritis, renal cancer, hypertensive kidney injury, and transplanted kidney injury; the cancers mentioned are EGLN1 gene-mediated breast cancer and colon cancer.

11. A method for preventing or treating diseases mediated by the EGLN1 gene, wherein, The subject is given an appropriate dose of the siRNA of any one of claims 1-5 or a pharmaceutically acceptable salt thereof, or the drug of claim 6.

12. The method according to claim 11, wherein, The subjects were mammals.

13. The method according to claim 12, wherein, The subjects were primates.

14. A method for inhibiting or reducing EGLN1 gene expression, wherein, The method includes the following steps: (a) Contacting in vivo or in vitro cells with the siRNA or a pharmaceutically acceptable salt thereof as described in any one of claims 1-5, or the drug as described in claim 6; and (b) The cells generated in step (a) are maintained for a time sufficient to allow for the degradation of the mRNA transcripts expressing EGLN1, thereby simultaneously inhibiting or reducing the expression of EGLN1 in the cells.