Extracellular vesicles derived from lung progenitor cells or differentiated cells thereof
Extracellular vesicles from lung progenitor cells address the limitations of existing drug delivery systems by providing a safe and effective means to deliver therapeutic agents to lung cells, enhancing treatment options for respiratory diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- HILUNG INC
- Filing Date
- 2025-10-31
- Publication Date
- 2026-05-07
AI Technical Summary
Existing drug delivery systems face challenges such as formulation issues, sterility concerns, stability problems, and biological capture by the reticuloendothelial system, and lipid nanoparticles used in mRNA vaccines have shown strong side effects.
Extracellular vesicles derived from lung progenitor cells or their differentiated cells are used as carriers, which are produced by culturing these cells to secrete vesicles and can incorporate active ingredients, providing a method for targeted delivery to alveolar epithelial cells.
The extracellular vesicles offer improved safety and efficacy for drug delivery, enabling targeted introduction of active ingredients into lung cells and potential treatments for respiratory diseases like cystic fibrosis.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Extracellular vesicles derived from lung progenitor cells or their differentiated cells
[0001] This disclosure relates to extracellular vesicles derived from lung progenitor cells or their differentiated cells, extracellular vesicles derived from lung progenitor cells or their differentiated cells containing an active ingredient, methods for producing the same, and compositions containing the said extracellular vesicles derived from lung progenitor cells or their differentiated cells.
[0002] Treatment methods for respiratory diseases include administering active ingredients such as peptides, nucleic acids, and small molecules that have therapeutic effects on the disease. For these active ingredients to exert their full effect, efficient delivery to the affected tissue is essential, and drug delivery systems (DDS) have been investigated as a system for this purpose. Furthermore, the lungs are organs with a very large surface area, which may be advantageous for drug absorption, and have therefore been considered as a route of drug administration for non-respiratory diseases.
[0003] Recent representative drug delivery systems (DDSs) include liposome formulations and lipid nanoparticles. However, liposome formulations have had the problem of generally facing high hurdles to formulation, as they require overcoming several challenges, including formulation engineering issues such as ensuring uniformity and reproducibility, ensuring sterility, ensuring long-term storage stability, and achieving high retention rates of water-soluble drugs, as well as biological issues such as being easily captured by the reticuloendothelial system (RES).
[0004] Furthermore, lipid nanoparticles (LNPs) generally refer to liposomes with a particle size of 100 nm or less. In recent years, mRNA vaccines have shown excellent efficacy against the COVID-19 pandemic, but relatively strong side effects, including serious ones, have been a major challenge. One of the causes of these side effects is attributed to LNPs carrying mRNA, and the lipids that make up LNPs are immunostimulant, which can trigger inflammatory responses (Non-Patent Literature 1).
[0005] As described above, there was a need for a carrier that could be used in DDS without side effects.
[0006] Ndeupen et al., iScience 24,103479, 2021
[0007] Therefore, the object of this disclosure is to provide a carrier with improved side effects for DDS, a method for producing the carrier, a composition for introducing an active ingredient into alveolar epithelial cells, etc., using the carrier, and a composition for preventing or treating diseases that can be prevented or treated by the active ingredient.
[0008] To achieve the above objective, the present disclosure provides a method for producing extracellular vesicles derived from lung progenitor cells or their differentiated cells (the method for producing extracellular vesicles 1 of the present disclosure). The method for producing extracellular vesicles 1 of the present disclosure includes a step (1) of culturing lung progenitor cells to cause the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium. The method for producing extracellular vesicles 1 of the present disclosure may further include a step (2) of recovering the extracellular vesicles secreted into the culture medium.
[0009] The method for producing extracellular vesicles 1 of the present disclosure may further include a step (A) of introducing an active ingredient into lung progenitor cells prior to step (1), wherein the extracellular vesicles are extracellular vesicles containing the active ingredient, and is provided as a method for producing extracellular vesicles (2a of the method for producing extracellular vesicles of the present disclosure).
[0010] The method for producing extracellular vesicles 1 of the present disclosure may further include a step (B) of introducing an active ingredient into the extracellular vesicles after step (2), wherein the extracellular vesicles are extracellular vesicles containing the active ingredient, and this method for producing extracellular vesicles (the method for producing extracellular vesicles 2b of the present disclosure).
[0011] The disclosure also provides extracellular vesicles (extracellular vesicle 1 of the disclosure) derived from lung progenitor cells or their differentiated cells that are positive for cystic fibrosis transmembrane conductance regulator (CFTR).
[0012] The Disclosure also provides a composition (Composition 1 of the Disclosure) comprising the extracellular vesicle 1 of the Disclosure.
[0013] Composition 1 of the present disclosure may further be provided as a composition for use in introducing cystic fibrosis membrane conductance regulatory factors into airway epithelial cells, alveolar epithelial cells, alveolar macrophages, pulmonary fibroblasts, or airway epithelium (Cell introduction composition 1 of the present disclosure).
[0014] Composition 1 of the present disclosure may further be provided as a composition for use in the prevention or treatment of cystic fibrosis (pharmaceutical composition 1 of the present disclosure).
[0015] Extracellular vesicle 1 of the present disclosure may further be provided as an extracellular vesicle of the present disclosure (extracellular vesicle 2 of the present disclosure) containing the active ingredient.
[0016] The Disclosure also provides a composition (Composition 2 of the Disclosure) comprising the extracellular vesicle 2 of the Disclosure.
[0017] Composition 2 of the present disclosure may also be provided as a composition for use in introducing the active ingredient into alveolar epithelial cells, airway epithelial cells, alveolar macrophages, lung fibroblasts, or airway epithelium (composition 2 of the present disclosure for cell introduction), or as a composition for use in preventing or treating diseases that can be prevented or treated by the active ingredient (pharmaceutical composition 2 of the present disclosure).
[0018] According to this disclosure, it is possible to provide extracellular vesicles as carriers with improved side effects for DDS, a method for producing the extracellular vesicles, a composition for introducing an active ingredient using the extracellular vesicles into alveolar epithelial cells, etc., and a pharmaceutical composition for preventing or treating diseases that can be prevented or treated by the active ingredient. Furthermore, according to this disclosure, since the extracellular vesicles are CFTR-positive, it is possible to provide a composition for introducing CFTR into airway epithelial cells, etc., and a pharmaceutical composition for preventing or treating cystic fibrosis.
[0019] Figure 1 shows the manufacturing process of extracellular vesicles (EVs) derived from alveolar epithelial progenitor cells. Figure 2 shows the purification process of EVs. Figure 3 shows Capto TMThis figure shows a chromatogram of size exclusion chromatography using Core 700. Figure 4(A) is a particle size distribution map of EVs derived from re-seeded CPM-high-expression cells. Figure 4(B) is a histogram of particle sizes of EVs derived from re-seeded CPM-high-expression cells. Figure 5(A) is a graph showing the average particle size of EVs. Figure 5(B) is a graph showing the mode particle size of EVs. iPSC: iPS cells; Differentiation day 14: Cells 14 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Differentiation day 21: Cells 21 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Replated CPMhigh cells: Re-seeded CPM-high-expression cells; Human alveolar epithelial cells: Human alveolar epithelial cells; Fibroblast: Fibroblasts; Hek293 cells: Hek293 cells. Figure 6(A) is a graph showing the total number of EV particles. Figure 6(B) is a graph showing the particle density of EVs. iPSC: iPS cell; Differentiation day 14: Cells 14 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Differentiation day 21: Cells 21 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Replated CPMhigh cells: Re-disseminated CPM high-expression cells; Human alveolar epithelial cells: Human alveolar epithelial cells; Fibroblast: Fibroblast; Hek293 cells: Hek293 cells. Figure 7 is a graph showing the number of particles per gram of EV protein.iPSC: iPS cell; Differentiation day 14: Cells 14 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Differentiation day 21: Cells 21 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Replated CPMhigh cells: Re-seeded CPM high-expression cells; Human alveolar epithelial cells: Human alveolar epithelial cells; Fibroblast: Fibroblast; Hek293 cells: Hek293 cells. Figure 8 shows the process of binding EVs to magnetic beads using the PS Capture exosome flow cytometry kit (Fujifilm). Figure 9 is a graph showing the positivity rates of CD9, CD63, CD81, or CPM in EVs. iPSC: iPS cell; Differentiation day 14: Cells 14 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Differentiation day 21: Cells 21 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; Replated CPMhigh cells: Re-seeded CPM high-expression cells; Human alveolar epithelial cells: Human alveolar epithelial cells; Fibroblast: Fibroblast; Hek293 cells: Hek293 cells. Figure 10 shows the results of flow cytometry analysis of airway epithelial cells treated with each labeled EV. iPSC EV: iPS cell-derived EV; Replated CPMhi EV: Re-seeded CPM high-expression cell-derived EV; HILC D20 EV: EV derived from cells 20 days after the start of differentiation induction from iPS cells to alveolar epithelial cells. Figure 11 shows the results of flow cytometry analysis of airway epithelial cells treated with each labeled EV. iPSC EV: iPS cell-derived EV; Replated CPMhi EV: Re-seeded CPM-high-expression cell-derived EV; HILC D20 EV: Cell-derived EV 20 days after the start of differentiation induction from iPS cells to alveolar epithelial cells; TIG-1 EV: TIG-1 cell-derived EV. Figure 12 shows the fluorescence images of airway epithelial cells treated with each labeled EV.iPSC EV: iPS cell-derived EV; HILC D14 EV: HILC D20 Figure 15 is a graph showing the relationship between particle size and particle density for HILC D20-derived EVs treated with RNA-lipofectamine complex, mRNA, or mRNA-lipofectamine complex. Figure 16 shows the results of flow cytometry analysis of HILC D20-derived EVs treated with mRNA or mRNA-lipofectamine complex. Figure 17 shows the fluorescence images and flow cytometry analysis results of airway epithelial cells treated with mRNA-treated HILC D20-derived EVs or mRNA-lipofectamine complex. Figure 18 shows the fluorescence images and flow cytometry analysis results of alveolar epithelial cells treated with mRNA-treated HILC D20-derived EVs or mRNA-lipofectamine complex. Figure 19(A) shows that RBD-PEG-DSPE is prepared from SARS-CoV2 spike protein-derived RBD and DSPE-PEG-NHS. Figure 19(B) shows that EV modified on the outside with RBD-PEG-DSPE is prepared from EV and RBD-PEG-DSPE. Figure 20 shows the results of separating RBD-PEG-DSPE by SDS-PAGE.Figure 21 shows the RBD positivity rate of HILC D20-derived EVs modified externally with RBD-PEG-DSPE. Figure 22 shows the results of LC-MS analysis of CD9 contained in each EV. HEK_PS: EVs purified from HEK293 cells using MagCaptur Exosome Isolation Kit PS Ver.2. HEK_SEC: EVs purified from HEK293 cells using IZON qEV 35nm. PSC_PS: EVs purified from human iPS cells using MagCaptur Exosome Isolation Kit PS Ver.2. PSC_SEC: EVs purified from human iPS cells using IZON qEV 35nm. LP_PS: EVs purified from CPM-positive lung progenitor cells using MagCaptur Exosome Isolation Kit PS Ver.2. LP_SEC: EVs purified from CPM-positive lung progenitor cells using IZON qEV 35nm. Figure 23 shows the results of LC-MS analysis of CD63 contained in each EV. Figure 24 shows the results of LC-MS analysis of CD81 contained in each EV. Figure 25 shows the results of LC-MS analysis of CPM contained in each EV. Figure 26 shows the results of LC-MS analysis of CFTR contained in each EV. Figure 27 shows the results of measuring the expression level of CFTR mRNA expressed in each cell. iPSC: iPS cell. CPMhi: CPM-positive lung progenitor cell. Vi24-LLI: Airway epithelial cells differentiated by liquid-liquid interface culture. Cr24-ALI: Airway epithelial cells differentiated by gas-liquid interface culture. Figure 28 is a histogram of particle size for LP_SEC. Figure 29 is a histogram of particle size for Vi24_SEC. Vi24_SEC: EV purified from Vi24-LLI using IZON qEV 35nm. Figure 30 is a histogram of particle size for Cr24_SEC. Cr24_SEC: Extracellular viable cells (EVs) purified from Cr24-LLI using IZON qEV 35nm. Figure 31 shows the results of flow cytometry analysis of the percentage of CFTR-positive EVs in each EV. Figure 32 shows the results of MQAE assays on airway epithelial cells (CF-Del) treated with each EV.Figure 33 shows the results of the MQAE assay on airway epithelial cells (CF-Del) treated with each EV. Figure 34 shows the results of the swelling assay on airway organoids (Wildtype) treated with forskolin. Figure 35 shows the results of the swelling assay on airway organoids (CF-Del) treated with each EV. Figure 36 (left) shows the results of the swelling assay on airway organoids (Wildtype) treated with forskolin. Figure 36 (right) shows the results of the swelling assay on airway organoids (CF-Del) treated with each EV.
[0020] 1. Method for producing extracellular vesicles according to the present disclosure and extracellular vesicles produced by the said method <Method for producing extracellular vesicles according to the present disclosure 1> The present disclosure provides a method for producing extracellular vesicles derived from lung progenitor cells or their differentiated cells (Method for producing extracellular vesicles according to the present disclosure 1). Method for producing extracellular vesicles according to the present disclosure 1 includes a step (1) of culturing lung progenitor cells to cause the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium.
[0021] (Lung progenitor cells) In this specification, "lung progenitor cells" include, for example, the lung progenitor cells, alveolar epithelial progenitor cells, airway epithelial progenitor cells, ventral anterior foregut endoderm cells, anterior foregut endoderm cells, and / or definitive endoderm cells. The ventral anterior foregut endoderm cells, the foregut endoderm cells, and the definitive endoderm cells may also be called progenitor cells of the lung progenitor cells.
[0022] In this specification, "definitive endoderm (DE)" refers to cells that, given appropriate developmental stimuli, are destined to differentiate into the thymus; digestive organs such as the stomach, intestines, and liver; respiratory organs such as the trachea, bronchi, and lungs; and urinary organs such as the bladder and urethra; and are cells that express SOX17 (SRY (sex determining region Y)-box 17) and FOXA2 (Forkhead box protein A2).
[0023] In this specification, "anterior foregut endoderm cells" (AFE) (also called anterior foregut cells) refer to cells that are destined to differentiate into the thymus and respiratory organs such as the trachea, bronchi, and lungs, given appropriate embryological stimuli, and are cells that express SOX2, SOX17, and FOXA2.
[0024] In this specification, "ventral anterior foregut endoderm" (VAFE) (also called ventral anterior foregut cells) refers to cells that are destined to differentiate into lungs if appropriately stimulated embryologically, and which express NKX2.1 (or NKX2-1) (NK2 homeobox 1), GATA6 (GATA-binding factor 6), and HOPX (Homeodomain-only protein).
[0025] The aforementioned lung progenitor cells also refer to cells that are destined to have the ability to differentiate into alveolar epithelial cells or airway epithelial cells if appropriately stimulated embryologically.
[0026] In this specification, "differentiated cells" means cells differentiated from the lung progenitor cells under developmentally appropriate stimulation conditions. Examples of cells that differentiate from lung progenitor cells include alveolar epithelial cells, respiratory bronchiolar epithelial cells, and airway epithelial cells.
[0027] In this specification, “alveolar epithelial cells” means epithelial cells present in the alveoli of the lungs. Examples of such alveolar epithelial cells include type I alveolar epithelial cells and / or type II alveolar epithelial cells.
[0028] In this specification, "Type I alveolar epithelial cells" refers to epithelial cells that have a histologically flattened shape and express PDPN (Podoplanin), AGER (Advanced Glycosylation End-Product Specific Receptor), CAV1 (Caveolin 1), HOPX (HOP Homeobox), and / or AQP5 (Aquaporin 5).
[0029] As used herein, the “type II alveolar epithelial cell” means an epithelial cell that produces pulmonary surfactant proteins such as SFTPC (Surfactant protein C) and SFTPB, and is a cell that expresses SFTPC, SFTPB, ABCA3 (ATP-binding cassette sub-family A member 3), DCLAMP (Lysosome-associated membrane glycoprotein 3), and / or SLC34A2 (Sodium-dependent phosphate transport protein 2B).
[0030] As used herein, the “airway epithelial progenitor cell” means a cell that is destined to have the ability to differentiate into airway ciliated epithelial cells, cystic fibrosis transmembrane conductance regulator (CFTR)-positive airway epithelial cells, airway mucus-producing cells, airway basal epithelial cells, neuroendocrine epithelial cells, and / or club cells upon appropriate developmental stimuli, and is a cell that expresses SOX2, CFTR, P63 (transformation-related protein 63, TP63), and / or NKX2.1.
[0031] As used herein, the “airway epithelial cell” means an epithelial cell present in the central and peripheral airways in the lung. Examples of the airway epithelial cells include airway ciliated epithelial cells, club cells, airway basal epithelial cells, airway mucus-producing cells, CFTR-positive epithelial cells (e.g., pulmonary ionocytes), and neuroendocrine cells.
[0032] As used herein, the “airway ciliated epithelial cell” means an epithelial cell that histologically has a large number of dynamic cilia per cell and morphologically has cilia classified into the “9 + 2” structure, and is a cell that expresses Sentan (SNTN), Acetylated tubulin, FOXJ1, DNAH5 (dynein axonemal heavy chain 5), and / or NKX2.1.
[0033] In this specification, a "club cell" is an epithelial cell that produces cell-specific proteins such as SCGB1A1 (secretoglobin family 1A member 1) and SCGB3A2 (Secretoglobin family 3A member 2), similar to club cells that are abundant in the peripheral airways of the lung.
[0034] In this specification, an "airway basal epithelial cell" is an epithelial cell that expresses cell-specific proteins such as KRT5 (Keratin 5), NGFR (p75 neurotrophin receptor), and p63, similar to basal cells that are abundant in the central to peripheral airways of the lung.
[0035] In this specification, an "airway mucus-producing cell" is a cell that is abundant in the central to peripheral airways of the lung and is an epithelial cell that expresses or produces cell-specific proteins such as MUC5AC, MUC5B, AGR2 (Anterior gradient protein 2 homolog), and SPDEF (SAM pointed domain-containing Ets transcription factor), similar to goblet cells.
[0036] The lung progenitor cells also mean cells that do not have the ability to differentiate into the thyroid lineage, regardless of the presence or absence of developmental stimuli.
[0037] In this specification, the "thyroid lineage" means cells that constitute the thyroid or their progenitor cells, and are cells that express thyroglobulin and / or paired box 8 (Pax8). The thyroid lineage includes, for example, follicular cells, parafollicular cells, and their progenitor cells.
[0038] In this specification, "lung progenitor cells" or "differentiated cells" are cells expressing cystic fibrosis membrane conductance regulator (CFTR), carboxypeptidase M (CPM), NK2 homeobox 1 (NKX2.1 or NKX2-1), SRY-box 9 (SRY (sex determining region Y)-box 9, SOX9), SRY-box 2 (SRY (sex determining region Y)-box 2, SOX2), and / or forkhead box protein 2A (FOXA2). The lung progenitor cells are preferably CFTR-positive cells, CPM-positive cells, or NKX2.1-positive cells, and more preferably CFTR and CPM-positive cells, CFTR and NKX2.1-positive cells, or CFTR, CPM and NKX2.1-positive cells.
[0039] The lung progenitor cells can be prepared by known methods in this art, for example, by differentiating them from progenitor cells such as pluripotent stem cells. When differentiating the lung progenitor cells from pluripotent stem cells, the lung progenitor cells can be prepared, for example, by following the method for inducing alveolar epithelial progenitor cells described in International Publication No. 2014 / 168264, the method for isolating lung progenitor cells described in U.S. Patent Specification No. 10,386,368, or the method for inducing NKX2.1-positive lung progenitor cells described in Hawkins et al. (J Clin Invest. 2017 Jun 1;127(6):2277-2294. doi: 10.1172 / JCI89950.).
[0040] Examples of pluripotent stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), embryonic tumor cells (EC cells), and embryonic germ cells (EG cells), but ES cells or iPS cells (more preferably human iPS cells) are preferred.
[0041] As described above, a cell population containing the lung progenitor cells is obtained by the method for inducing the lung progenitor cells from the pluripotent stem cells. The cell population may be any cell population containing the lung progenitor cells, and may be a cell population containing 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of the lung progenitor cells.
[0042] In the method for producing extracellular vesicles 1 of this disclosure, the obtained cell population may be used as is, or the lung progenitor cells may be isolated from the obtained cell population and used. When isolating the lung progenitor cells, it is preferable that the lung progenitor cells be isolated as CFTR, CPM, and / or NKX2.1-positive cells based on the expression of cell surface markers such as CFTR, CPM, and / or NKX2.1. The isolation of the lung progenitor cells based on cell surface markers can be carried out by methods known in the art, and can be performed using molecules that have specific affinity for CFTR, CPM, and / or NKX2.1.
[0043] Molecules with specific affinity can include antibodies, aptamers, peptides, or compounds that specifically recognize them, and preferably antibodies or fragments thereof. The antibodies may be polyclonal or monoclonal antibodies. These antibodies can be prepared using techniques well known to those skilled in the art (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Section 11.12-11.13). Examples of antibody fragments include parts of an antibody (e.g., Fab fragments) or synthetic antibody fragments (e.g., single-stranded Fv fragments (ScFv)). Antibody fragments such as Fab and F(ab')2 fragments can also be prepared by genetically engineered methods.
[0044] For the purpose of isolating the lung progenitor cells based on cell surface markers, the molecules may be labeled directly or indirectly. When directly labeled, the molecules may be labeled with a detectable substance such as a fluorescent label, radioactive label, chemiluminescent label, enzyme, biotin, or streptavidin. When indirectly labeled, for example, an antibody that specifically binds to a primary antibody (secondary antibody) may be labeled with the above-mentioned detectable substance.
[0045] Examples of methods for isolating the lung progenitor cells include a method of sorting the cells by contacting the lung progenitor cells with beads to which protein A or protein G is bound and then collecting the beads; a method of sorting the cells magnetically using magnetic beads to which protein A and protein G are bound (e.g., MACS); a method of using a cell sorter with fluorescent labeling; or a method of using a carrier to which antibodies or the like are immobilized (e.g., a cell enrichment column).
[0046] The lung progenitor cells obtained as described above are cultured for the purpose of causing the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium. Therefore, the method for producing extracellular vesicles according to the present disclosure 1 includes a step (1) of culturing lung progenitor cells to cause the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium.
[0047] (Culture medium) The culture medium may be either a maintenance medium or a differentiation induction medium, but a maintenance medium is preferred. The culture medium can be prepared, for example, using a medium used for culturing animal cells as a base medium. Examples of base media include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, Neurobasal Medium (Life Technologies), and mixed media of these. The culture medium may contain serum or may be serum-free. If necessary, the culture medium may contain one or more serum substitutes such as albumin, transferrin, Knockout Serum Replacement (KSR) (a serum substitute for FBS in ES cell culture), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, ITS premix, collagen precursors, trace elements, 2-mercaptoethanol, and 3'-thiolglycerol, as well as one or more substances such as lipids, amino acids, L-glutamine, Glutamax (Invitrogen), non-essential amino acids, vitamins, growth factors, low molecular weight compounds, antibiotics, antioxidants, pyruvate, buffers, and inorganic salts.
[0048] If the culture medium is a maintenance medium, the maintenance medium may further contain a steroid, a cAMP derivative, a phosphodiesterase inhibitor, KGF, a ROCK inhibitor, and a TGFβ inhibitor in addition to the basal medium. By culturing the lung progenitor cells in the maintenance medium, it is possible to proliferate the lung progenitor cells while maintaining their differentiated state.
[0049] (Steroids) Steroids are steroidal anti-inflammatory drugs, glucocorticoids or their synthetic derivatives, and examples include hydrocortisone, hydrocortisone succinate, prednisolone, methylprednisolone, methylprednisolone succinate, triamcinolone, triamcinolone acetonide, dexamethasone, and betamethasone. The steroid used in this disclosure is preferably dexamethasone. The concentration of dexamethasone in the culture medium is not particularly limited, but is, for example, 1 nM to 50 μM, 10 nM to 40 μM, 10 nM to 30 μM, 10 nM to 25 μM, 10 nM to 20 μM, and preferably 50 nM.
[0050] (cAMP derivatives) cAMP derivatives are compounds in which cyclic AMP is modified with substituents, and examples include cyclic adenosine monophosphate (cAMP), 8-bromo cyclic adenosine monophosphate (8-Br-cAMP or 8Br-cAMP), 8-chloro cyclic adenosine monophosphate (8-Cl-cAMP), 8-(4-Chlorophenylthio) cyclic adenosine monophosphate (8-CPT-cAMP), and dibutyryl cyclic adenosine monophosphate (DB-cAMP). The cAMP derivative used in this disclosure may preferably be 8-Br-cAMP. The concentration of 8-Br-cAMP in the culture medium is not particularly limited, but examples include 1 nM to 1 mM, 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 50 μM, 10 nM to 40 μM, 50 nM to 30 μM, 100 nM to 25 μM, and 500 nM to 20 μM.
[0051] (Phosphodiesterase Inhibitors) Phosphodiesterase inhibitors are compounds that increase the intracellular concentration of cAMP or cGMP by inhibiting phosphodiesterase (PDE), and examples include 1,3-Dimethylxanthine, 6,7-Dimethoxy-1-(3,4-dimethoxybenzyl)isoquinoline, 4-{[3',4'-(Methylenedioxy)benzyl]amino}-6-methoxyquinazoline, 8-Methoxymethyl-3-isobutyl-1-methylxanthine, and 3-Isobutyl-1-methylxanthine (IBMX). The phosphodiesterase inhibitor used in this disclosure may preferably be IBMX. The concentration of IBMX in the culture medium is not particularly limited, but examples include 1 nM to 1 mM, 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 50 μM, 10 nM to 40 μM, 50 nM to 30 μM, 100 nM to 25 μM, and 500 nM to 20 μM.
[0052] (KGF) KGF (Keratinocyte Growth Factor) (also known as FGF2 (Fibroblast Growth Factor 7)) is a polynucleotide-encoded protein indicated by NCBI accession number NM_002009, and may be in an activated form after being cleaved by a protease. Such KGF can be obtained, for example, from Wako. The concentration of KGF in the culture medium is not particularly limited, but for example, it is 10 ng / ml to 1 μg / ml, 20 ng / ml to 1 μg / ml, 30 ng / ml to 900 ng / ml, 40 ng / ml to 800 ng / ml, 50 ng / ml to 700 ng / ml, 60 ng / ml to 600 ng / ml, 70 ng / ml to 500 ng / ml, 80 ng / ml to 400 ng / ml, 90 ng / ml to 300 ng / ml, and preferably 100 ng / ml.
[0053] (ROCK inhibitors) ROCK inhibitors are not particularly limited as long as they can suppress the function of Rho kinase (ROCK) to suppress cell death of isolated pluripotent stem cells when isolated lung progenitor cells are used, for example, Y-27632((+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl)cyclohexanecarboxamide dihydrochloride) (see, e.g., Ishizaki et al., Mol. Pharmacol. 57, 976-983 (2000); Narumiya et al., Methods Enzymol. 325, 273-284 (2000)), Fasudil / HA1077 (see, e.g., Uenata et al., Nature 389: 990-994 (1997)), H-1152 (see, e.g., Sasaki et al.) Examples include al., Pharmacol.Ther.93:225-232(2002)), Wf-536 (e.g., Nakajima et al., Cancer Chemother Pharmacol.52(4):319-324(2003)) and their derivatives, as well as antisense nucleic acids against ROCK, RNA interference-inducible nucleic acids (e.g., siRNA), dominant-negative variants, and their expression vectors. Other small molecule compounds are also known as ROCK inhibitors, and such compounds or derivatives thereof may also be used in this disclosure (see, for example, U.S. Patent Publications 20050209261, 20050192304, 20040014755, 20040002508, 20040002507, 20030125344, 20030087919, and International Publications 2003 / 062227, 2003 / 059913, 2003 / 062225, 2002 / 076976, and 2004 / 039796). One or more ROCK inhibitors may be used in this disclosure. The ROCK inhibitor used in this disclosure may preferably be Y-27632.The concentration of Y-27632 is, for example, 1 nM to 50 μM, 10 nM to 40 μM, 50 nM to 30 μM, 100 nM to 25 μM, 500 nM to 20 μM, 750 nM to 15 μM, and preferably 10 μM.
[0054] (TGFβ Inhibitors) TGFβ inhibitors are substances that inhibit the signal transduction from TGFβ binding to its receptor to SMAD. They are not particularly limited as long as they inhibit binding to the ALK family of receptors or inhibit phosphorylation of SMAD by the ALK family. Examples include Lefty-1 (NCBI Accession No.: mouse: NM_010094, human: NM_020997), SB431542 (4-(4-(benzo[d][1,3]dioxol-5-yl)-5-(pyridin-2-yl)-1H-imidazol-2-yl)benzamide), and SB202190 (RKLindemann et al.). Examples include al., Mol. Cancer, 2003, 2:20), SB505124 (GlaxoSmithKline), NPC30345, SD093, SD908, SD208 (Scios), LY2109761, LY364947, LY580276 (Lilly Research Laboratories), A-83-01 (WO2009 / 146408), and derivatives thereof. The TGFβ inhibitor used in this disclosure may preferably be SB431542. The concentration of SB431542 in the culture medium is not particularly limited as long as it is a concentration that inhibits TGFβ, but for example, it is 1 nM to 1 mM, 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 50 μM, 10 nM to 40 μM, 50 nM to 30 μM, 100 nM to 25 μM, 500 nM to 20 μM, and preferably 10 μM.
[0055] In the method 1 for producing extracellular vesicles of the present disclosure, adherent culture is performed on a culture vessel. In the case of adherent culture, it may be performed using a culture vessel coated with an extracellular matrix component, or co-cultured with feeder cells. The feeder cells are not particularly limited, and examples include fibroblasts (such as mouse embryonic fibroblasts (MEF), mouse fibroblasts (STO), etc.). The feeder cells are preferably inactivated by a method known per se, such as irradiation with radiation (such as gamma rays) or treatment with an anticancer agent (such as mitomycin C). Examples of the extracellular matrix component include fibrous proteins such as Matrigel (Niwa A, et al. PLoS One. 6(7):e22261, 2011), gelatin, collagen, and elastin, glucosaminoglycans and proteoglycans such as hyaluronic acid and chondroitin sulfate, and cell adhesion proteins such as fibronectin, vitronectin, and laminin. In the method 1 for producing extracellular vesicles of the present disclosure, a culture vessel coated with Matrigel is preferably used.
[0056] When culturing the lung progenitor cells in the maintenance medium, the seeding density of the lung progenitor cells can be appropriately set. For example, 2×10 3 ~2.5×10 6 cells / cm 2 , preferably 1×10 4 ~5×10 5 cells / cm 2 , more preferably 5×10 4 ~1×10 5 cells / cm 2 is used.
[0057] Regarding the culture conditions, the culture temperature is not limited to the following, but is about 30 to 40 °C, preferably about 37 °C, and the culture is performed in an atmosphere of air containing CO2. The CO2 concentration is preferably about 2 to 5%.
[0058] The culture period is not particularly limited, and examples include 1 day or more, 2 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, 7 days or more, 8 days or more, or more days. The culture period is preferably 2 days or more, and particularly preferably 3 to 6 days.
[0059] Furthermore, in the method for producing extracellular vesicles 1 of this disclosure, as an alternative to culturing in the maintenance medium, the lung progenitor cells can also be cultured according to the method described in International Publication No. 2023 / 286852, thereby maintaining the differentiated state of the lung progenitor cells while promoting their proliferation.
[0060] If the culture medium is a differentiation induction medium, it is possible to differentiate the lung progenitor cells into their differentiated cells by culturing them in the differentiation induction medium.
[0061] The differentiated cells are not particularly limited as long as they differentiate from the lung progenitor cells and express the same cell surface markers as the lung progenitor cells, but examples include alveolar epithelial cells (type I alveolar epithelial cells, type II alveolar epithelial cells), respiratory bronchiolar epithelial cells, and airway epithelial cells.
[0062] In one embodiment, when differentiating alveolar epithelial progenitor cells into alveolar epithelial cells as the lung progenitor cells, the differentiation induction medium may further contain alveolar epithelial cell inducing factors in the basal medium.
[0063] The inducing factor for alveolar epithelial cells can be set according to the type of alveolar epithelial cells being induced. If the alveolar epithelial cells are type I alveolar epithelial cells, the inducing factor for alveolar epithelial cells is a type I alveolar epithelial cell inducing factor, and a specific example is the Wnt inhibitor. The inducing factor may be one type or multiple types. Preferably, there are multiple types of inducing factors, and more preferably, all types.
[0064] The Wnt inhibitor is a substance that inhibits Wnt signaling. Examples of Wnt inhibitors include IWP2 (N-(6-Methyl-2-benzothiazolyl)-2-(3,4,6,7-tetrahydro-4-oxo-3-phenylthieno3,2-dpyrimidin-2-yl)thio), Dickkopf-related protein 1 (DKK1), XAV939 (3,5,7,8-Tetrahydro-2-[4-(trifluoromethyl)phenyl]-4H-thiopyrano[4,3-d]-pyrimidin-4-one); and nucleic acid molecules that suppress Wnt protein expression (siRNA, shRNA, antisense, etc.), with XAV939 being preferred.
[0065] The concentrations of the Wnt inhibitor in the culture medium are, for example, 1 nmol / l to 50 μmol / l, 10 nmol / l to 40 μmol / l, 50 nmol / l to 30 μmol / l, 100 nmol / l to 25 μmol / l, and 500 nmol / l to 20 μmol / l.
[0066] When culturing the alveolar epithelial progenitor cells in the differentiation induction medium for differentiating them into type I alveolar epithelial cells, the culture period can be set according to the period during which the type I alveolar epithelial cells are induced. The lower limit of the culture period can be, for example, 4 days or more, 5 days or more, 6 days or more, 7 days or more, 8 days or more, 9 days or more, 10 days or more, 11 days or more, 12 days or more, or longer. The upper limit of the culture period can be, for example, 35 days or less, 30 days or less, 28 days or less, or 21 days or less.
[0067] When culturing the alveolar epithelial progenitor cells in the differentiation induction medium, the seeding density and culture conditions of the alveolar epithelial progenitor cells can be based on the examples of seeding density and culture conditions when using the maintenance medium.
[0068] If the alveolar epithelial cells are type II alveolar epithelial cells, the inducing factor for the alveolar epithelial cells is a type II alveolar epithelial cell inducing factor, and specific examples include at least one selected from the group consisting of steroids, cAMP derivatives, phosphodiesterase inhibitors, KGF, GSK3β inhibitors, TGFβ inhibitors, ROCK inhibitors, FGF10, and EGF (Epidermal Growth Factor). The inducing factor may be one type or multiple types. Preferably, the inducing factor is multiple types, and more preferably a combination of the steroid, the cAMP derivative, the phosphodiesterase inhibitor, and the KGF. Examples of the steroid, the cAMP derivative, the phosphodiesterase inhibitor, the KGF, the TGFβ inhibitor, the ROCK inhibitor, and the KGF, and their concentrations in the culture medium can be found by referring to the above explanation.
[0069] The aforementioned GSK3β inhibitors are substances that inhibit the kinase activity of the GSK-3β protein (e.g., phosphorylation ability for β-catenin). Examples of the aforementioned GSK3β inhibitors include indirubin derivatives such as BIO (GSK-3β inhibitor IX; 6-bromoindirubin 3'-oxime); maleimide derivatives such as SB216763 (3-(2,4-dichlorophenyl)-4-(1-methyl-1H-indole-3-yl)-1H-pyrrole-2,5-dione); phenyl α-bromomethyl ketone compounds such as GSK-3β inhibitor VII (4-dibromoacetophenone); and L803-mts (GSK-3β peptide inhibitor; Myr-N Examples of GSK3β inhibitors include cell membrane-permeable phosphorylated peptides such as GKEAPPAPPQSpP-NH2 (SEQ ID NO: 6); CHIR99021 (6-[2-[4-(2,4-Dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-ylamino]ethylamino]pyridine-3-carbonitrile); and nucleic acid molecules that suppress the expression of GSK3β protein (siRNA, shRNA, antisense, etc.). CHIR99021 is preferred as the GSK3β inhibitor due to its high selectivity for the GSK3β protein.
[0070] The concentrations of the GSK3β inhibitor in the culture medium are, for example, 1 nmol / l to 50 μmol / l, 10 nmol / l to 40 μmol / l, 50 nmol / l to 30 μmol / l, 100 nmol / l to 25 μmol / l, 500 nmol / l to 20 μmol / l, and 750 nmol / l to 15 μmol / l.
[0071] The FGF10 is a polynucleotide-encoded protein registered with NCBI under accession number NM_004465. The FGF10 may also be in an activated form after being cleaved by a protease.
[0072] The concentrations of FGF10 in the culture medium are, for example, 10 ng / ml to 1 μg / ml, 20 ng / ml to 1 μg / ml, 30 ng / ml to 900 ng / ml, 40 ng / ml to 800 ng / ml, 50 ng / ml to 700 ng / ml, 60 ng / ml to 600 ng / ml, 70 ng / ml to 500 ng / ml, 80 ng / ml to 400 ng / ml, and 90 ng / ml to 300 ng / ml.
[0073] The aforementioned EGF is a polynucleotide-encoded protein registered with NCBI under accession numbers NM_001178130, NM_001178131, NM_001963, or NM_001357021.
[0074] The EGF concentrations in the culture medium are, for example, 10 ng / ml to 1 μg / ml, 20 ng / ml to 1 μg / ml, 30 ng / ml to 900 ng / ml, 40 ng / ml to 800 ng / ml, 50 ng / ml to 700 ng / ml, 60 ng / ml to 600 ng / ml, 70 ng / ml to 500 ng / ml, 80 ng / ml to 400 ng / ml, and 90 ng / ml to 300 ng / ml.
[0075] When culturing the alveolar epithelial progenitor cells in the differentiation induction medium for differentiating them into type II alveolar epithelial cells, the culture period can be set according to the period during which the type II alveolar epithelial cells are induced. The lower limit of the culture period can be, for example, 4 days or more, 5 days or more, 6 days or more, 7 days or more, 8 days or more, 9 days or more, 10 days or more, 11 days or more, 12 days or more, 13 days or more, 14 days or more, 15 days or more, or longer. The upper limit of the culture period can be, for example, 35 days or less, 30 days or less, 28 days or less, or 21 days or less.
[0076] When culturing the alveolar epithelial progenitor cells in the differentiation induction medium, the seeding density and culture conditions of the alveolar epithelial progenitor cells can be based on the examples of seeding density and culture conditions when using the maintenance medium.
[0077] In another embodiment, when airway epithelial progenitor cells are differentiated into airway epithelial cells as lung progenitor cells, the differentiation induction medium may further contain an airway epithelial cell inducing factor. The airway epithelial cell inducing factor is, for example, at least one selected from the group consisting of steroids, Notch inhibitors, ROCK inhibitors, and heparin. There may be one or more inducing factors. Preferably, there are multiple inducing factors, and more preferably, all of them. Examples of the steroids and ROCK inhibitors and their concentrations in the medium can be found by referring to the above description.
[0078] The culture medium is preferably PneumaCult-ALI Basal Medium to which PneumaCult-ALI 10× Supplement and PneumaCult-ALI Maintenance Supplement have been added.
[0079] The Notch inhibitors are substances that inhibit Notch signaling. Examples of Notch inhibitors include DAPT (N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine), DBZ (N-[(1S)-2-[[(7S)-6,7-Dihydro-5-methyl-6-oxo-5H-dibenz[b,d]azepin-7-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), Compound E (N-[(1S)-2-[[(3S)-2,3-Dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), and FLI-06 (Cyclohexyl Examples include 1,4,5,6,7,8-hexahydro-2,7,7-trimethyl-4-(4-nitrophenyl)-5-oxo-3-quinolinecarboxylate, LY411575 (N2-[(2S)-2-(3,5-Difluorophenyl)-2-hydroxyethanoyl]-N1-[(7S)-5-methyl-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl]-L-alaninamide), and nucleic acid molecules that suppress Notch protein expression (siRNA, shRNA, antisense, etc.), with DAPT being preferred.
[0080] The concentrations of Notch inhibitors in the culture medium are, for example, 1 nmol / l to 50 μmol / l, 10 nmol / l to 40 μmol / l, 50 nmol / l to 30 μmol / l, 100 nmol / l to 25 μmol / l, and 500 nmol / l to 20 μmol / l.
[0081] The heparin is a glycosaminoglycan having anticoagulant activity. It is presumed that the heparin contributes to the induction of airway epithelial cells through its activating effects on growth factors, cytokines, etc. The heparin may also be a derivative of heparin, and heparinoids are given as specific examples.
[0082] The heparin concentrations in the culture medium are, for example, 10 ng / ml to 100 μg / ml, 20 ng / ml to 100 μg / ml, 30 ng / ml to 90 μg / ml, 40 ng / ml to 80 μg / ml, 50 ng / ml to 70 μg / ml, 60 ng / ml to 60 μg / ml, 70 ng / ml to 50 μg / ml, 80 ng / ml to 40 μg / ml, and 90 ng / ml to 30 μg / ml.
[0083] When culturing the airway epithelial progenitor cells in the differentiation induction medium for differentiating them into airway epithelial cells, the culture period can be set according to the period during which the airway epithelial cells are induced. The lower limit of the culture period can be, for example, 14 days or more, 15 days or more, 16 days or more, 17 days or more, 18 days or more, 19 days or more, 20 days or more, 21 days or more, or longer. The upper limit of the culture period can be, for example, 49 days or less, 45 days or less, 42 days or less, 40 days or less, 35 days or less, 30 days or less, or 28 days or less.
[0084] The airway epithelial cells may be airway epithelial cells differentiated by gas-liquid interface culture or airway epithelial cells differentiated by liquid-liquid interface culture, but airway epithelial cells differentiated by liquid-liquid interface culture are preferred because they express CFTR highly. Furthermore, if the airway epithelial cells are differentiated by liquid-liquid interface culture, it is preferable to differentiate the lung progenitor cells into the airway epithelial cells on Vitrigel during culture.
[0085] (Extracellular vesicles) As described above, the method for producing extracellular vesicles 1 of the present disclosure allows for the secretion of extracellular vesicles from the lung progenitor cells or their differentiated cells into a culture medium. In this specification, "extracellular vesicle" refers to a vesicle having a lipid bilayer structure secreted from living cells.
[0086] Examples of lipids constituting the aforementioned lipid bilayer include phospholipids (glycerophospholipids (phosphatidylinositol, phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, etc.), sphingophospholipids (sphingomyelin, etc.)), glycolipids (cerebrosides, gangliosides, etc.), and sterols (cholesterol, etc.).
[0087] The extracellular vesicles contain cell-derived components. Examples of these cell-derived components include DNA, mRNA, miRNA, and proteins. Furthermore, the surface of the extracellular vesicles contains cell-derived membrane proteins and is glycosylated. Examples of these cell-derived membrane proteins include tetraspanins, membrane receptor proteins, and cell adhesion molecules.
[0088] The extracellular vesicles described above are broadly classified into three types based on differences in their production mechanisms: exosomes, microvesicles, and apoptotic bodies. Unless otherwise specified, the extracellular vesicles described herein refer to exosomes or microvesicles, preferably exosomes.
[0089] (Recovery) The extracellular vesicles secreted into the culture medium may be used as is, depending on the purpose, or the extracellular vesicles may be recovered from the culture medium. Therefore, the method for producing extracellular vesicles 1 of the present disclosure may further include a step (2) of recovering the extracellular vesicles secreted into the culture medium.
[0090] Step (2) of recovering the extracellular vesicles secreted into the culture medium may include, but is not limited to, the use of methods for recovering extracellular vesicles known in the art, such as a recovery method based on the specific gravity of the extracellular vesicles, a recovery method based on the size of the extracellular vesicles, a recovery method based on the charge of the extracellular vesicles, a recovery method based on surface markers of the extracellular vesicles, a recovery method based on affinity with the extracellular vesicles, or a combination thereof. Among these, preferred recovery methods include a combination of a recovery method based on the size of the extracellular vesicles and a recovery method based on the charge of the extracellular vesicles, or a recovery method based on affinity with the extracellular vesicles.
[0091] (Recovery method based on the specific gravity of extracellular vesicles) An example of a recovery method based on the specific gravity of extracellular vesicles is centrifugation.
[0092] In the centrifugation method, a liquid containing extracellular vesicles is recovered, and by centrifuging the liquid, molecules with a specific gravity greater than the extracellular vesicles (e.g., cell debris) in the liquid are precipitated, allowing only the extracellular vesicles to be recovered. The centrifugation conditions are not particularly limited as long as the extracellular vesicles do not precipitate and molecules with a specific gravity greater than the extracellular vesicles precipitate. For example, centrifugation can be performed at a temperature of 0 to 30°C, a centrifugation time of 1 to 60 minutes, and a relative centrifugal acceleration of 500 to 20,000 x g. Furthermore, the liquid containing the extracellular vesicles is not particularly limited and can include, for example, PBS, culture medium, or sterile water.
[0093] (Recovery methods based on extracellular vesicle size) Examples of recovery methods based on extracellular vesicle size include filtration and size exclusion chromatography (SEC).
[0094] In the filtration method, the liquid containing extracellular vesicles is collected, and the liquid is filtered using a filtration filter having a certain pore size to remove molecules larger than the pore size, thereby allowing only the extracellular vesicles to be collected. The pore size of the filtration filter is not particularly limited as long as it is larger than the size of the extracellular vesicles, but examples include 160 to 250 nm, preferably 160 to 220 nm. The liquid containing the extracellular vesicles is not particularly limited and examples include PBS, culture medium, and sterile water.
[0095] Size exclusion chromatography (SEC) involves recovering a liquid containing extracellular vesicles, passing it through a column packed with a packing material, and utilizing the difference in elution time based on molecular size to recover only the extracellular vesicles. The packing material is porous, allowing the extracellular vesicles to enter its pores, while molecules larger than the extracellular vesicles cannot. As a result, molecules larger than the extracellular vesicles elute from the column first, followed by the extracellular vesicles. Such a packing material is not limited to porous materials, but examples include cross-linked polymers. The solvent for elution is not particularly limited and examples include PBS, culture medium, and sterile water.
[0096] (Charge-based recovery method for extracellular vesicles) Examples of charge-based recovery methods for extracellular vesicles include anion exchange chromatography (AIEC).
[0097] In anion exchange chromatography (AIEC), a liquid containing extracellular vesicles is recovered, and the liquid is passed through a column packed with anion exchange resin. By adsorbing the negatively charged extracellular vesicles onto the anion exchange resin, impurities are eluted first, and then only the extracellular vesicles can be recovered. The solvent for elution is not particularly limited and examples include PBS, culture medium, and sterile water.
[0098] (Recovery methods based on surface markers of extracellular vesicles) Examples of recovery methods based on surface markers of extracellular vesicles include immunological methods.
[0099] In the immunological method, the fluid containing extracellular vesicles is recovered, and only the extracellular vesicles can be recovered by an immunoassay using a surface marker of the extracellular vesicles and an antibody against the surface marker. As described below, the surface marker of the extracellular vesicles is not particularly limited, but examples include cystic fibrosis membrane conductance regulator (CFTR), CPM, and NKX2.1. Other examples of surface markers include CD9, CD63, or CD81. Recovery of the extracellular vesicles based on the surface marker can be carried out in accordance with the method described in step (1) of the method for producing extracellular vesicles 1 of this disclosure.
[0100] (Recovery method based on affinity with extracellular vesicles) Examples of recovery methods based on affinity with extracellular vesicles include methods that utilize the calcium ion-dependent binding of Tim4 protein and phosphatidylserine.
[0101] The above method can also be used to recover the extracellular vesicles of this disclosure using, for example, a commercially available MagCapture Exosome Isolation Kit PS Ver.2 (FujiFilm). In short, the Tim4 protein conjugated to magnetic beads can be bound to phosphatidylserine present in the membrane of the extracellular vesicles of this disclosure via calcium ions, the magnetic beads can be recovered, and the freed extracellular vesicles of this disclosure can be recovered by treating the magnetic beads with a chelating agent.
[0102] Step (2) may include any of the above methods, but preferably includes a recovery method based on the size of the extracellular vesicles and a recovery method based on the charge of the extracellular vesicles. In this case, the recovery method based on the size of the extracellular vesicles may be size exclusion chromatography (SEC), and the recovery method based on the charge of the extracellular vesicles may be anion exchange chromatography (AIEC). By combining size exclusion chromatography (SEC) and anion exchange chromatography (AIEC), extracellular vesicles can be recovered with high efficiency. Alternatively, step (2) may include a recovery method based on affinity with the extracellular vesicles.
[0103] <Extracellular vesicles produced by the method 1 for producing extracellular vesicles of the present disclosure> As described above, the method 1 for producing extracellular vesicles of the present disclosure can produce extracellular vesicles derived from lung progenitor cells by step (1) (and optionally step (2)). Accordingly, the present disclosure also provides extracellular vesicles derived from lung progenitor cells, which are produced by the method 1 for producing extracellular vesicles of the present disclosure.
[0104] <Method 2 for Producing Extracellular Vesicles in the Present Disclosure> Method 1 for producing extracellular vesicles in the Present Disclosure may further include a step (A) of introducing an active ingredient into lung progenitor cells before step (1), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient, and is provided as a method for producing lung progenitor cell-derived extracellular vesicles (Method 2a for producing extracellular vesicles in the Present Disclosure). Method 1 for producing extracellular vesicles in the Present Disclosure may further include a step (B) of introducing an active ingredient into the extracellular vesicle after step (2), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient, and is provided as a method for producing extracellular vesicles (Method 2b for producing extracellular vesicles in the Present Disclosure). Hereafter, Method 2a for producing extracellular vesicles in the Present Disclosure and Method 2b for producing extracellular vesicles in the Present Disclosure may be collectively referred to as Method 2 for producing extracellular vesicles in the Present Disclosure.
[0105] (Active Ingredients) In this specification, "active ingredient" refers to an exogenous substance that has, or is expected to have, a preventive or therapeutic effect against a disease. The active ingredient is not particularly limited as long as it is contained in an extracellular vesicle, but may include proteins, nucleic acids, low molecular weight compounds (drugs), or lipids.
[0106] The statement that the active ingredient is contained in an extracellular vesicle means that it is contained inside or outside the extracellular vesicle. When the active ingredient is contained inside or outside the extracellular vesicle, it may be contained as a fusion protein with a protein contained in the lipid bilayer of the extracellular vesicle, or it may be contained by being linked to the lipids constituting the lipid bilayer of the extracellular vesicle via a linker.
[0107] The aforementioned proteins are not particularly limited, but examples include proteins or partial peptides thereof that have preventive or therapeutic effects on diseases (hereinafter referred to as therapeutic proteins), and pathogen-derived proteins or partial peptides thereof that cause diseases (hereinafter referred to as antigen proteins).
[0108] When the objective is to efficiently incorporate the therapeutic protein into the extracellular vesicle, the therapeutic protein is introduced into the cell as a nucleic acid encoding a fusion protein with a protein (surface marker) contained in the extracellular vesicle, and is incorporated into the cell membrane by expression as a fusion protein with the surface marker, and is included inside the extracellular vesicle when it is released from the cell. Examples of the surface marker include CFTR, CPM, NKX2.1, CD9, CD63, or CD81, with CD63 being preferred. When CD63 is used as the surface marker, the N-terminal or C-terminal portion of CD63 is exposed inside the cell or extracellular vesicle. Therefore, the therapeutic protein is included in a form that is exposed inside the cell or extracellular vesicle by directly or via a linker to the N-terminal or C-terminal portion of CD63.
[0109] Furthermore, when the objective is to efficiently include the antigen protein outside the extracellular vesicle, in one embodiment, although not limited to the following, the antigen protein is introduced into the cell as a nucleic acid encoding a fusion protein with a protein (surface marker) contained in the extracellular vesicle, and is incorporated into the cell membrane by expression as a fusion protein with the surface marker, and is included outside the extracellular vesicle when the extracellular vesicle is released from the cell. Examples of the surface marker include CFTR, CPM, NKX2.1, CD9, CD63, or CD81, with CD63 being preferred among them. When CD63 is used as the surface marker, the antigen protein is included in a form that is exposed outside the cell or extracellular vesicle by inserting the fusion protein into the extracellular domain of CD63. Alternatively, in another embodiment, the antigen protein is included in a manner that exposes it to the outside of an extracellular vesicle by bringing into contact with an extracellular vesicle a lipid-antigen protein complex obtained by linking the lipid constituting the cell membrane (e.g., DSPE(1,2-distearoyl-sn-glycero-3-phosphoethanolamine)) via PEG.
[0110] Known methods can be used to incorporate the therapeutic protein inside or outside an extracellular vesicle. Such methods, when using a fusion protein, include, as described later, a method of incorporating the nucleic acid encoding the fusion protein containing the therapeutic protein into a vector such as a virus or plasmid, and introducing it into progenitor cells such as lung progenitor cells or pluripotent stem cells. The fusion protein is expressed within the introduced cells, and the surface marker of the extracellular vesicle contained within it acts as an anchor, allowing it to be incorporated into the cell membrane of the cell. When the extracellular vesicle is produced by the extracellular vesicle production method 2 of this disclosure, the fusion protein is incorporated into the lipid bilayer of the extracellular vesicle, thereby allowing the therapeutic protein (or antigen protein) to be incorporated inside (or outside) the extracellular vesicle. Furthermore, when using a lipid-antigen protein complex, the extracellular vesicle and the complex can be brought into contact in a solvent, causing the lipids of the complex to be inserted into the lipid bilayer of the extracellular vesicle, thereby allowing the antigen protein to be incorporated outside the extracellular vesicle.
[0111] The aforementioned protein may also be a genome editing protein used to induce artificial mutations in disease-causing genes. Examples of such genome editing proteins include the CRISPR-Cas system (CRISPR-Cas9, CRISPR-Cas12a, CRISPR-Cas13a, etc.), zinc finger nucleases (ZFNs), and transcription factor-like effector nucleases (TALENs).
[0112] The CRISPR-Cas system is provided as a complex of an RNA molecule (gRNA) consisting of a crRNA complementary to the target nucleotide sequence and a tracrRNA necessary for recruiting the Cas protein, and a Cas protein. The Cas protein is not particularly limited as long as it belongs to the CRISPR system, but examples include Cas9, Cas12a, Cas13a, etc., and Cas9 is preferred. Examples of Cas9 include, but are not limited to, Cas9 derived from Streptococcus pyogenes (SpCas9) and Cas9 derived from Streptococcus thermophilus (StCas9).
[0113] The aforementioned zinc finger nuclease (ZFN) refers to a fusion protein of a zinc finger motif and an endonuclease domain derived from FokI. The zinc finger motif is formed by linking together 3 to 6 different Cys2His2 type zinc finger units (each finger recognizing approximately 3 bases) and can recognize target nucleotide sequences of 9 to 18 bases. The zinc finger motif can be prepared by known methods such as the modular assembly method (Nat Biotechnol (2002) 20: 135-141), the OPEN method (Mol Cell (2008) 31: 294-301), the CoDA method (Nat Methods (2011) 8: 67-69), and the E. coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701).
[0114] Transcriptional activator-like effector nucleases (TALENs) refer to fusion proteins of TAL effectors and endonuclease domains derived from FokI. The TAL effectors have a repeating modular structure consisting of approximately 34 amino acids, and their binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVDs) of each module. Since each module is highly independent, it is possible to create TAL effectors specific to target nucleotide sequences simply by connecting the modules. Methods for creating these TAL effectors using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), Golden Gate method (Nucleic Acids Res (2011) 39: e82), etc.) have been established, allowing for relatively simple design of TAL effectors for target nucleotide sequences.
[0115] The nucleic acid is not particularly limited, but examples include DNA encoding a protein that has a preventive or therapeutic effect on a disease, mRNA transcribed from the DNA, siRNA, miRNA, or antisense RNA targeting the disease-causing gene, and DNA transcribing the siRNA, miRNA, or antisense RNA (hereinafter referred to as therapeutic nucleic acid). The therapeutic nucleic acid is preferably introduced into the cell together with a nucleic acid encoding a fusion protein of a protein (surface marker) contained in the extracellular vesicle and an RNA-binding protein, in order to efficiently include it inside the extracellular vesicle. Examples of the surface marker include CFTR, CPM, NKX2.1, CD9, CD63, or CD81, with CD63 being preferred. When CD63 is used as the surface marker, the N-terminal or C-terminal portion of CD63 is exposed inside the cell or extracellular vesicle. Therefore, the NA-binding protein is exposed inside the cell or extracellular vesicle by directly or via a linker to the N-terminal or C-terminal portion of CD63, and the therapeutic nucleic acid that binds thereto is also included in a form that is exposed inside the cell or extracellular vesicle.
[0116] Known methods can be used to incorporate the therapeutic nucleic acid into the extracellular vesicles. As described later, such methods include incorporating the nucleic acid encoding the fusion protein into a vector such as a virus or plasmid, and introducing it together with the therapeutic nucleic acid into progenitor cells such as lung progenitor cells or pluripotent stem cells. The fusion protein is expressed in the introduced cells, and the surface marker of the extracellular vesicles contained within it acts as an anchor, localizing it to the cell membrane of the cells. When the extracellular vesicles are produced by the method for producing extracellular vesicles 2 of this disclosure, the therapeutic nucleic acid is included inside the extracellular vesicles by binding to the RNA-binding protein of the fusion protein.
[0117] The nucleic acid may be DNA, RNA, or a DNA / RNA chimera. Furthermore, the nucleic acid may be double-stranded or single-stranded. If double-stranded, it may be double-stranded DNA, double-stranded RNA, or a DNA:RNA hybrid. If single-stranded, it may be a sense strand (i.e., coding strand) or an antisense strand (i.e., non-coding strand). Furthermore, the nucleic acid may be linear or circular. In one embodiment, the nucleic acid may be circular RNA. By adopting a circular structure, resistance to degradation by exonucleases can be acquired.
[0118] The nucleic acid may be a modified nucleic acid in order to enhance its resistance to degradation by nucleases within the cell. The modified nucleic acid is not limited in terms of the part that is modified as long as resistance to degradation is conferred, but examples include the sugar portion, base portion, and phosphate group portion of each nucleotide constituting the nucleic acid.
[0119] When the sugar moiety (ribose, deoxyribose) is modified, modifications include, for example, substitution of the hydroxyl group or hydrogen atom at the 2', 3', and / or 4' positions of the sugar moiety with other atoms. Examples of modifications include fluorination, alkoxylation (e.g., methoxylation, ethoxylation), O-allylation, S-alkylation (e.g., S-methylation, S-ethylation), S-allylation, and amination (e.g., -NH2). Such modifications of the sugar moiety can be carried out by methods known to the public (see, for example, Sproat et al., (1991) Nucl. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145). Furthermore, the sugar moiety can be cross-linked at the 2' and 4' positions (BNA: Bridged nucleic acid or LNA: Linked nucleic acid). Such modifications to the sugar moiety can also be carried out by methods already known (see, for example, Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003), Rahman SMA, Seki S., Obika S., Yoshikawa H., Miyashita K., Imanishi T., J. Am. Chem. Soc., 130, 4886-4896 (2008), etc.).
[0120] When the base portion (e.g., purine, pyrimidine) is modified (e.g., chemically substituted), examples include pyrimidine modification at position 5, purine modification at position 6 and / or 8, modification with an extracyclic amine, substitution with 4-thiouridine, or substitution with 5-bromo or 5-iodouracil.
[0121] When the phosphate group is modified, for example, the phosphate group P(O)O may be substituted with P(O)S (thioate), P(S)S (dithioate), P(O)NR2 (amidate), P(O)R, R(O)OR', CO or CH2 (formacetal), or a 3'-amine (-NH-CH2-CH2-) [wherein each R or R' is independently H, or a substituted or unsubstituted alkyl (e.g., methyl, ethyl)]. Examples of linking groups include -O-, -N-, or -S-, which can be linked to adjacent nucleotides. The modification may also include 3' and 5' modifications such as capping.
[0122] The low molecular weight compounds are not particularly limited, but examples include low molecular weight compounds that have preventive or therapeutic effects on diabetes. Insulin is an example of such a low molecular weight compound. Furthermore, the low molecular weight compounds are not particularly limited, but examples include low molecular weight compounds that have preventive or therapeutic effects on respiratory diseases. For example, if the respiratory disease is lung cancer, examples of the low molecular weight compounds include cisplatin, carboplatin, nedaplatin, pemetrexed, gemcitabine, amrubicin, paclitaxel, docetaxel, irinotecan, and etoposide.
[0123] In the method for producing extracellular vesicles 2 of this disclosure, the active ingredient may be introduced into lung progenitor cells before step (1) or into extracellular vesicles after step (2). Alternatively, if the lung progenitor cells are prepared by differentiating progenitor cells such as pluripotent stem cells, the active ingredient may be introduced into the pluripotent stem cells before differentiation. The introduction of the active ingredient into progenitor cells such as lung progenitor cells or pluripotent stem cells (hereinafter referred to as introduced cells) or extracellular vesicles can be carried out by means known in the art. If the active ingredient is DNA, for example, a vector such as a virus or plasmid can be introduced into the introduced cells or extracellular vesicles by methods such as liposomes, lipid nanoparticles, or microinjection. Examples of viral vectors include retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and Sendai virus vectors. Mammalian cell plasmids may be used as plasmids. The vector may include regulatory sequences such as promoters, enhancers, ribosome-binding sequences, terminators, and polyadenylation sites to enable DNA expression. Furthermore, it may optionally include select marker sequences such as drug resistance genes (e.g., kanamycin resistance, ampicillin resistance, puromycin resistance), thymidine kinase genes, and diphtheria toxin genes, as well as reporter gene sequences such as fluorescent proteins, β-glucuronidase (GUS), and FLAG. Examples of promoters include the SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney mouse leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, EF-α promoter, and CAG promoter. If the active ingredient is RNA, protein, or small molecule compound, it can be introduced into transcellular cells or extracellular vesicles by methods such as electroporation, lipofection, or microinjection.As described above, the active ingredient introduced into the introduced cells is contained inside or outside of extracellular vesicles secreted into the culture medium by culturing the lung progenitor cells. Alternatively, by directly introducing the active ingredient into the extracellular vesicles, the active ingredient can be contained outside the intracellular vesicles. In these cases, the extracellular vesicles containing the active ingredient outside the intracellular vesicles may contain, for example, proteins and / or lipids derived from the virus used for introduction, or lipids derived from the lipid nanoparticles used for introduction.
[0124] <Extracellular vesicles produced by the method for producing extracellular vesicles 2 of the present disclosure> As described above, the method for producing extracellular vesicles 2a of the present disclosure can produce extracellular vesicles derived from lung progenitor cells or their differentiated cells that contain the active ingredient by step (A). Furthermore, the method for producing extracellular vesicles 2b of the present disclosure can produce extracellular vesicles derived from lung progenitor cells or their differentiated cells that contain the active ingredient by step (B). Accordingly, the present disclosure also provides extracellular vesicles derived from lung progenitor cells or their differentiated cells that contain the active ingredient, produced by the method for producing extracellular vesicles 2 of the present disclosure.
[0125] 2. Extracellular Vesicles of the Disclosure <Extracellular Vesicle 1 of the Disclosure> The Disclosure provides extracellular vesicles (Extracellular Vesicle 1 of the Disclosure) derived from lung progenitor cells or their differentiated cells that are positive for cystic fibrosis membrane conductance regulator (CFTR). Here, "lung progenitor cells," "differentiated cells," and "extracellular vesicles" may be the same as (lung progenitor cells), (differentiated cells), and (extracellular vesicles) described in <Method for Producing Extracellular Vesicles of the Disclosure 1>. Here, "positive" means that a molecule is expressed on the surface of the extracellular vesicles of the Disclosure.
[0126] The extracellular vesicle 1 of this disclosure is also positive for carboxypeptidase M (CPM) in addition to CFTR. The extracellular vesicle derived from lung progenitor cells is further positive for tetraspanin. Examples of tetraspanin include CD9, CD63, and / or CD81, with CD9, CD63, and CD81 being preferred.
[0127] The extracellular vesicle 1 of this disclosure also contains at least one, preferably all, miRNAs selected from the group consisting of (i) to (v) below: (i) hsa-miR-183-5p, (ii) hsa-miR-182-5p, (iii) hsa-miR-205-5p, (iv) hsa-miR-484, (v) hsa-miR-483-5p.
[0128] The aforementioned hsa-miR-183-5p is a nucleic acid consisting of the base sequence represented by UAUGGCACUGGUAGAAUUCACU (Sequence ID 1).
[0129] The aforementioned hsa-miR-182-5p is a nucleic acid consisting of the base sequence represented by UUUGGCAAUGGUAGAACUCACACU (Sequence ID 2).
[0130] The aforementioned hsa-miR-205-5p is a nucleic acid consisting of the base sequence represented by UCCUUCAUUCCACCGGAGUCUG (SEQ ID NO: 3).
[0131] The aforementioned hsa-miR-484 is a nucleic acid consisting of the base sequence represented by UCAGGCUCAGUCCCCUCCCGAU (SEQ ID NO: 4).
[0132] The aforementioned hsa-miR-483-5p is a nucleic acid consisting of the base sequence represented by AAGACGGGAGGAAAGAAGGGAG (Sequence ID 5).
[0133] The extracellular vesicles 1 of this disclosure may also have an average particle diameter of 50 nm to 250 nm, preferably 80 nm to 150 nm. The particle diameter of the extracellular vesicles 1 of this disclosure can be measured by means known in the art, such as nanoparticle tracking analysis. In nanoparticle tracking analysis, a laser is irradiated onto a suspension containing extracellular vesicles, and the scattered light emitted from each extracellular vesicle undergoing Brownian motion in the suspension is imaged via a camera. The movement of each imaged scattered light can be tracked, and the particle diameter of the extracellular vesicle (average diameter, mode diameter, etc.) can be calculated from its respective migration velocity (diffusion coefficient). Nanoparticle tracking analysis can be performed, for example, using NanoSight NS3000 (Malvern Panalytical).
[0134] The extracellular vesicle 1 of the present disclosure may be produced by any method as long as it has the above-described characteristics, but may also be, for example, an extracellular vesicle derived from lung progenitor cells or their differentiated cells produced by the extracellular vesicle production method 1 of the present disclosure. Accordingly, the present disclosure also provides the extracellular vesicle 1 of the present disclosure, which is produced by the extracellular vesicle production method 1 of the present disclosure.
[0135] <Extracellular Vesicle 2 of the Disclosure> Extracellular vesicle 1 of the Disclosure may further be provided as an extracellular vesicle derived from lung progenitor cells or differentiated cells containing an active ingredient (extracellular vesicle 2 of the Disclosure). Herein, the “active ingredient” may be the same as the (active ingredient) described in <Method for Producing Extracellular Vesicle 2 of the Disclosure>.
[0136] In the extracellular vesicles 2 of this disclosure, the introduction of the active ingredient into extracellular vesicles derived from lung progenitor cells or their differentiated cells can be carried out by means known in the art. For example, the active ingredient (nucleic acid, protein, small molecule compound, lipid) can be introduced into or outside the extracellular vesicle by methods such as lipofection, liposomes, or lipid nanoparticles.
[0137] The extracellular vesicles 2 of the present disclosure may be produced by any method as long as they have the above-described characteristics, but may also be extracellular vesicles derived from lung progenitor cells or their differentiated cells produced by the extracellular vesicle production method 2a of the present disclosure or the extracellular vesicle production method 2b of the present disclosure. Accordingly, the present disclosure also provides extracellular vesicles 2 of the present disclosure produced by the extracellular vesicle production method 2a of the present disclosure or the extracellular vesicle production method 2b of the present disclosure.
[0138] 3. Composition of the Disclosure (Composition of the Disclosure) The Disclosure provides a composition (Composition 1 of the Disclosure) comprising an extracellular vesicle 1 of the Disclosure. The extracellular vesicle 1 of the Disclosure is taken up by endocytosis, macropinocytosis, or direct fusion to the cell membrane of the cells or tissues, such as airway epithelial cells, alveolar epithelial cells, alveolar macrophages, or pulmonary fibroblasts, or by airway epithelium, or by direct fusion to the cell membrane of the above cells or tissues. CFTR expressed on the surface of the taken up extracellular vesicle 1 migrates to the cell membrane surface and functions as an ABC transporter-type ion channel, exhibiting physiological activity that allows chloride ions to pass through the cell membrane of the above cells. Therefore, Composition 1 of the Disclosure, which is CFTR-positive, can be used for the purpose of introducing in vitro or in vivo into the above cells or tissues in which the CFTR gene is dysfunctional. Furthermore, CFTR gene dysfunction is a cause of cystic fibrosis. Therefore, composition 1 of the present disclosure can be used for the purpose of treating cystic fibrosis by introducing normal CFTR expressed on the surface of extracellular vesicles 1 in vivo into the cells or tissues of a patient with cystic fibrosis and complementing the function of CFTR.
[0139] The Disclosure also provides a composition (Composition 2 of the Disclosure) comprising the extracellular vesicle 2 of the Disclosure. The extracellular vesicle 2 of the Disclosure is taken up by airway epithelial cells, alveolar epithelial cells, alveolar macrophages, or pulmonary fibroblasts by endocytosis, macropinocytosis, or direct fusion to the cell membrane of the cells. The active ingredient contained within the taken up extracellular vesicle 2 is released into the cells and exhibits physiological activity. Therefore, Composition 2 of the Disclosure can be used for the purpose of introducing the active ingredient into airway epithelial cells, alveolar epithelial cells, alveolar macrophages, or pulmonary fibroblasts in vitro or in vivo. Furthermore, Composition 2 of the Disclosure can also be used for the purpose of preventing or treating diseases that can be prevented or treated by the active ingredient.
[0140] (Cell delivery compositions of the present disclosure) Composition 1 of the present disclosure may be provided as a composition (cell delivery composition 1 of the present disclosure) for use in introducing CFTR into airway epithelial cells, alveolar epithelial cells, alveolar macrophages, pulmonary fibroblasts, or airway epithelium (preferably airway epithelial cells, alveolar epithelial cells, alveolar macrophages, pulmonary fibroblasts, or airway epithelium with CFTR expression deficiency). Composition 2 of the present disclosure may also be provided as a composition (cell delivery composition of the present disclosure) for use in introducing an active ingredient into alveolar epithelial cells, airway epithelial cells, alveolar macrophages, pulmonary fibroblasts, or airway epithelium.
[0141] In this specification, "alveolar macrophages" refers to immune cells present in the alveoli that remove foreign substances accumulated in the alveoli during respiration.
[0142] In this specification, "pulmonary fibroblasts" refers to cells that are involved in the pathogenesis of pulmonary fibrosis as a cause of the disease.
[0143] The cell transduction composition of this disclosure may, in addition to the extracellular vesicles 2 of this disclosure, optionally include a culture medium, buffer (phosphate, acetate, carbonate, citrate), stabilizers, etc.
[0144] (Pharmaceutical compositions for diseases of the present disclosure) Composition 1 of the present disclosure may be provided as a pharmaceutical composition for use in the prevention or treatment of cystic fibrosis (Pharmaceutical composition 1 for diseases of the present disclosure). Composition 2 of the present disclosure may also be provided as a pharmaceutical composition for use in the prevention or treatment of diseases that can be prevented or treated by the active ingredient (Pharmaceutical composition 2 for diseases of the present disclosure).
[0145] The pharmaceutical compositions for diseases disclosed herein may be oral or parenterally administered. When administered to subjects such as mammals (including model animals such as mice and humans), the pharmaceutical compositions disclosed herein may be administered orally, or they may be administered intravenously (intravenously or arterially) as injections or infusions.
[0146] The pharmaceutical compositions for diseases disclosed herein may or may not contain pharmacologically acceptable carriers (pharmaceutical additives). The type of pharmaceutical additive used in the manufacture of the pharmaceutical compositions for diseases disclosed herein, the ratio of pharmaceutical additives to the active ingredient, or the method of manufacturing the pharmaceutical compositions disclosed herein can be appropriately selected by those skilled in the art depending on the form of the composition. Generally, pharmaceutical additives can be blended in amounts ranging from 1% to 99% by weight relative to the weight of the active ingredient. Here, various conventional organic or inorganic carrier substances can be used as pharmaceutical materials, and are blended as solvents, solubilizers, suspending agents, isotonic agents, buffers, analgesics, etc. in liquid formulations. Pharmaceutical additives such as preservatives, antioxidants, colorants, and sweeteners may also be used as needed. Suitable examples of solvents include, for example, water for injection, physiological saline, Ringer's solution, alcohol, propylene glycol, polyethylene glycol, sesame oil, corn oil, olive oil, and cottonseed oil. Suitable examples of solubilizers include polyethylene glycol, propylene glycol, D-mannitol, trehalose, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, sodium salicylate, and sodium acetate. Suitable examples of suspending agents include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, and hydroxypropylcellulose; and polysorbates and polyoxyethylene hydrogenated castor oil. Suitable examples of isotonic agents include sodium chloride, glycerin, D-mannitol, D-sorbitol, and glucose. Suitable examples of buffering agents include buffers such as phosphates, acetates, carbonates, and citrates. A suitable example of an analgesic agent is benzyl alcohol, for example.
[0147] Suitable preservatives include, for example, para-hydroxybenzoic acid esters, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, and sorbic acid. Suitable antioxidants include, for example, sulfites and ascorbic acid salts. Suitable colorants include, for example, water-soluble food tar dyes (e.g., food colorants such as Food Red No. 2 and 3, Food Yellow No. 4 and 5, Food Blue No. 1 and 2), water-insoluble lake dyes (e.g., aluminum salts of the aforementioned water-soluble food tar dyes), and natural pigments (e.g., β-carotene, chlorophyll, red iron oxide, etc.). Suitable sweeteners include, for example, sodium saccharin, dipotassium glycyrrhizin, aspartame, and stevia.
[0148] The dosage forms of the disease-treating pharmaceutical compositions disclosed herein include, for example, oral preparations such as inhalants, syrups, emulsions, and suspensions; and parenteral preparations such as injectable preparations (e.g., intravenous injections, intratumor injections, etc.), drip infusions, and sustained-release formulations, which can be safely administered orally or parenterally, respectively. The disease-treating pharmaceutical compositions disclosed herein can be manufactured by methods commonly used in the pharmaceutical technology, such as those described in the Japanese Pharmacopoeia.
[0149] For example, the injectable preparation is manufactured by suspending the extracellular vesicles of this disclosure in an aqueous solvent (e.g., distilled water, physiological saline, Ringer's solution, etc.) or an oily solvent (e.g., vegetable oils such as olive oil, sesame oil, cottonseed oil, corn oil, propylene glycol, etc.) together with a dispersant (e.g., polysorbate 80, polyoxyethylene hydrogenated castor oil 60, polyethylene glycol, carboxymethylcellulose, sodium alginate, etc.), a preservative (e.g., methylparaben, propylparaben, benzyl alcohol, chlorobutanol, phenol, etc.), an isotonic agent (e.g., sodium chloride, glycerin, D-mannitol, D-sorbitol, glucose, etc.), etc.
[0150] The dosage and frequency of administration of the disease-fighting pharmaceutical composition disclosed herein will vary depending on the target recipient, route of administration, target disease, symptoms, etc., but a person skilled in the art can appropriately select an appropriate dosage. For example, when administered into the bloodstream of a human, the daily dose can be 0.001 to 100 g of CFTR or the active ingredient, or it can be 0.01 to 1000 mg / kg. The daily dose may also be divided into several doses. The frequency of administration can be daily, weekly, every two weeks, monthly, or once every few months. The duration of administration can be appropriately determined based on the improvement of symptoms, and can be one month, several months, six months, one year, several years, five years, or ten years.
[0151] 4. Methods for the Prevention or Treatment of the Disease in this Disclosure This disclosure provides a method for the prevention or treatment of cystic fibrosis (Method 1 for the Prevention or Treatment of the Disease in this Disclosure), comprising administering the extracellular vesicle 1 of this disclosure to a subject in need of administration. This disclosure also provides a method for the prevention or treatment of the disease (Method 2 for the Prevention or Treatment of the Disease in this Disclosure), comprising administering the extracellular vesicle 2 of this disclosure to a subject in need of administration.
[0152] In the methods for preventing or treating diseases disclosed herein, the possible pharmaceutical additives, dosage forms, target recipients, dosages, frequency of administration, diseases, etc., may be in accordance with the descriptions of the pharmaceutical compositions for diseases disclosed herein.
[0153] 5. Extracellular vesicles of the present disclosure for use in the prevention or treatment of disease The present disclosure provides extracellular vesicle 1 of the present disclosure for use in the prevention or treatment of cystic fibrosis. The present disclosure also provides extracellular vesicle 2 of the present disclosure for use in the prevention or treatment of disease.
[0154] In the extracellular vesicles of this disclosure for use in the prevention or treatment of disease, the possible pharmaceutical additives, dosage forms, target populations, doses, frequency of administration, diseases, etc., may be contained in accordance with the descriptions of the disease-specific pharmaceutical compositions of this disclosure.
[0155] 6. Use of Extracellular Vesicles of the Disclosure for the Manufacture of Pharmaceutical Compositions for the Prevention or Treatment of Diseases The Disclosure provides the use of extracellular vesicles 1 of the Disclosure for the manufacture of pharmaceutical compositions for the prevention or treatment of cystic fibrosis (Use of Extracellular Vesicles of the Disclosure 1 for the manufacture of pharmaceutical compositions for the prevention or treatment of diseases). The Disclosure also provides the use of extracellular vesicles 2 of the Disclosure for the manufacture of pharmaceutical compositions for the prevention or treatment of diseases (Use of Extracellular Vesicles of the Disclosure 2 for the manufacture of pharmaceutical compositions for the prevention or treatment of diseases).
[0156] In the use of extracellular vesicles of this disclosure for the manufacture of pharmaceutical compositions for the prevention or treatment of diseases, the possible pharmaceutical additives, dosage forms, target populations, doses, frequency of administration, diseases, etc., may be in accordance with the descriptions of the disease-specific pharmaceutical compositions of this disclosure.
[0157] The present disclosure will be described in detail below using examples, but the present disclosure is not limited to the embodiments described in the examples. Unless otherwise specified, commercially available reagents and kits were used according to their respective protocols.
[0158] (Manufacturing Example 1) Extracellular vesicles derived from alveolar epithelial progenitor cells were collected, and purified human iPS cells were differentiated into alveolar epithelial progenitor cells. The alveolar epithelial progenitor cells were then maintained in culture to cause the extracellular vesicles to be secreted into the culture medium and collected (Figure 1). Specifically, the procedure was carried out as follows.
[0159] <Induction of Differentiation into Alveolar Epithelial Progenitor Cells> Human iPS cells were differentiated according to the methods described in International Publication No. 2014 / 168264 and International Publication No. 2016 / 143803, and CPM-positive cells were harvested as alveolar epithelial progenitor cells from the cells 21 days after induction.
[0160] <Maintenance culture of alveolar epithelial progenitor cells> The harvested alveolar epithelial progenitor cells are cultured using Geltrex TM 8.0x10 in a 24-well plate coated with 4 pieces / cm 2The cells were seeded and maintained in basal medium (50 nM Dexamethasone, 0.1 mM 8-Br-cAMP, 0.1 mM IBMX, and 100 ng / ml KGF) supplemented with 10 μM Y-27632 and 10 μM SB-431542 (Figure 1). Extracellular vesicles (EVs) secreted into the medium from alveolar epithelial progenitor cells at 3 days (Day 3) and 6 days (Day 6) were collected using the following procedure (Figure 2). <Centrifugation> The collected medium was centrifuged at 10,000 x g at 4°C for 30 minutes to precipitate cell debris and collect the EV-containing medium. <Sterile Filtration> The collected EV-containing medium was filtered through a 0.22 μm filter to remove large impurities and collect the purified EV-containing medium. <Size Exclusion Chromatography (SEC)> Impurities were removed from the recovered EV-containing medium using Capt Core 700 according to the steps in Table 1, and purified EV-containing PBS was recovered (Figure 3).
[0161]
[0162] <Anion Exchange Chromatography (AIEC)> The recovered EV-containing PBS was adsorbed onto an anion exchange resin using anion exchange chromatography, and then the EV was eluted with an elution buffer to further remove any remaining impurities from the EV-containing PBS.
[0163] <Concentration and Buffer Exchange> The recovered EV-containing elution buffer was centrifuged three times at 3000 rpm using an Amicon 100 kDa spin tube, and the buffer was exchanged for PBS. As described above, EVs derived from alveolar epithelial progenitor cells were recovered and purified.
[0164] (Example 1) Analysis of EVs derived from alveolar epithelial progenitor cells EVs derived from alveolar epithelial progenitor cells (re-seeded CPM high-expression cells) or from other cell types (iPS cells, cells differentiated on day 14 in the production example, cells differentiated on day 21 in the production example, human alveolar epithelial cells, fibroblasts, HEK293 cells) were analyzed as follows. <Nanoparticle tracking analysis> Each EV was diluted 100-fold with PBS. The particle size (average diameter (nm), mode diameter (nm)) and density (particles / mL) of each diluted EV were analyzed by nanoparticle tracking analysis using NanoSight NS3000 (Malvern Panalytical) (Table 2). The data was recorded as a 5 × 30 second data frame and analyzed with default settings.
[0165]
[0166] It was confirmed that the particle size of EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-highly expressing cells) was distributed within a consistent range (Figures 4 and 5). Furthermore, the particle density of EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-highly expressing cells) was 8.66 × 10⁻⁶. 8 The particle density is 1.56 × 10¹⁶ particles / mL, and the total number of particles is 1.56 × 10¹⁶. 10 The samples were particles (Figure 6). <Bicinchoninic acid (BCA) protein assay> First, BSA standards were prepared according to the concentrations shown in Table 3. Next, reagents A and B from Protein BCA assay (Fujifilm) were mixed in a 50:1 ratio to prepare the BCA working reagent. Tubes containing the above BSA standards or each EV (25 μl) were prepared, and the above BCA working reagent (200 μl) was added. The tubes were incubated at 60°C for 10–20 minutes. After that, the protein concentration was analyzed by measuring the absorbance (ABS) at a wavelength of 562 nm.
[0167]
[0168] As a result, combined with the above-mentioned density (particles / mL) of EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-highly expressing cells), the number of particles per 1 μg of protein of EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-highly expressing cells) was 8.66 x 10⁶. 8 It was shown that they are particles (Figure 7).
[0169] <Flow Cytometry Analysis> Using the PS Capture Exosome Flow Cytometry Kit (Fujifilm), cell-derived exosomes (EVs) were bound to Tim4-immobilized magnetic beads included in the kit, following the procedure shown in Figure 8. Next, the beads to which each EV was bound were diluted with Western blotting buffer (WB buffer) (100 μl). The antibody listed in Table 4 was added as the primary antibody and incubated at room temperature for 30 minutes. Subsequently, the beads were washed three times with WB buffer (200 μl), Alexa fluor antibody 564 was added as the secondary antibody, and incubated at room temperature for 30 minutes. The beads were again washed three times with WB buffer (200 μl) and suspended in PBS containing 2% BSA (200 μl). The resulting suspension was subjected to flow cytometry analysis.
[0170]
[0171] As a result, it was shown that 90% or more of the extracellular viable cells (EVs) derived from alveolar epithelial progenitor cells (re-disseminated CPM-highly expressing cells) were positive for carboxypeptidase M, along with the exosome markers tetraspanins (CD9, CD63, CD81) (Figure 9). Furthermore, EVs recovered from cells undergoing differentiation from iPS cells into alveolar epithelial cells (cells at day 14 of differentiation and cells at day 21 of differentiation in the production example) also showed a high positivity rate for CPM, along with tetraspanins. On the other hand, cells other than lung cells showed a low positivity rate for CPM.
[0172] (Example 2) Verification of the uptake efficiency of EVs from different origins in airway epithelial cells EVs (100 μl) (or PBS only (100 μl)) derived from each cell type (iPS cells, re-seeded CPM high-expression cells, HILC D20 cells, TIG-1 cells) were mixed with Exosparkler Mem-dye Red (Dojindo) (2 μl) and incubated at 37°C for 30 minutes. The mixture was transferred to a filtration tube, 2x PBS (100 μl) was added, and the mixture was centrifuged at 3,000xg, room temperature for 5 minutes. To remove the entire solution in the filtration membrane, the mixture was centrifuged again at 3,000xg, room temperature for 5 minutes. Each EV labeled with Mem-dye Red was resuspended in PBS (approximately 50 μl) and added to each well in HiTrach-HTS 96 (HiLung). Each well was pre-filled with airway epithelial cells. Before adding each labeled EV to each well, the culture medium was replaced with fresh PneumaCult(+) medium (heparin-free, containing 10% FBS (exosome-depleted)). The cells were incubated in a 5% CO2 incubator at 37°C for 20–24 hours. Subsequently, the cells were washed with 2x Pal medium and replaced with fresh Pal medium. The cells were observed using a fluorescence microscope (Keyence) and harvested for flow cytometry analysis (CytoFlex).
[0173] The results showed that iPS cell-derived EVs and TIG-1 cell-derived EVs were not taken up by airway epithelial cells (Figures 10 and 11). On the other hand, 66.6% (first test) and 68.9% (second test) of EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-high-expressing cells) were taken up by airway epithelial cells, and 73% (first test) and 90.2% (second test) of EVs derived from HILC D20 were taken up by airway epithelial cells (Figures 10 and 11). These results indicate that EVs derived from lung progenitor cells are more readily taken up by airway epithelial cells.
[0174] (Example 3) Verification of the uptake efficiency of EVs from different origins in alveolar epithelial cells Each cell-derived EV (100 μl) (or PBS only (100 μl)) was mixed with Exosparkler Mem-dye Red (Dojindo) (2 μl) and incubated at 37°C for 30 minutes. The number of incubated EVs and their respective particle counts are shown in Table 5. The mixture was transferred to a filtration tube, 2x PBS (100 μl) was added, and the mixture was centrifuged at 3,000x g, room temperature for 5 minutes. To remove the entire solution in the filtration membrane, the mixture was centrifuged again at 3,000x g, room temperature for 5 minutes. Each EV labeled with Mem-dye Red was resuspended in PBS (approximately 50 μl) and added to each well in a HiAlv-HTS 96, Cytograph plate (HiLung). Each well was pre-contained with alveolar epithelial cells. Before adding each labeled EV to each well, the culture medium was replaced with fresh medium (50 nM Dexamethasone, 0.1 mM 8-Br-cAMP, 0.1 mM IBMX, and 10 ng / ml KGF) supplemented with 10 μM Y-27632. The cells were incubated in a 5% CO2 incubator at 37°C for 20–24 hours. Afterward, the cells were washed with the above-mentioned medium and replaced with fresh, identical medium. The cells were observed using a fluorescence microscope (Keyence).
[0175]
[0176] The results showed that iPS cell-derived EVs were not taken up by alveolar epithelial cells (Figure 12). On the other hand, HILC D14-derived EVs and HILC D20-derived EVs were taken up by alveolar epithelial cells (Figure 12). These findings suggest that EVs derived from lung progenitor cells are more readily taken up by alveolar epithelial cells.
[0177] (Example 4) Verification of the uptake efficiency of EVs from different origins in alveolar macrophages Each cell-derived EV (100 μl) and Exosparkler Mem-dye Red (Dojindo) (2 μl) were mixed and incubated at 37°C for 30 minutes. The mixture was transferred to a filtration tube, 2x PBS (100 μl) was added, and the mixture was centrifuged at 3,000x g, room temperature for 5 minutes. To remove the entire solution in the filtration membrane, the mixture was centrifuged again at 3,000x g, room temperature for 5 minutes. Each EV labeled with Mem-dye Red was resuspended in PBS (approximately 50 μl) and added to each well containing alveolar macrophages differentiated from iPS cells. Before adding each labeled EV to each well, the culture medium was replaced with fresh medium (10 mg / mL Polyvinyl Alcohol, 0.45 mM αMTG, 64 mg / mL AA2P, 80 ng / mL MCSF, 10% exosome-depleted FBS). The cells were incubated in a 5% CO2 incubator at 37°C for 20–24 hours. Afterwards, the cells were washed with the above medium and replaced with fresh medium of the same type. The cells were observed using a fluorescence microscope (Keyence).
[0178] The results showed that iPS cell-derived EVs were not taken up by alveolar macrophages (Figure 13). On the other hand, HILC D20-derived EVs were taken up by alveolar macrophages (Figure 13). Furthermore, it was shown that EVs derived from alveolar epithelial progenitor cells (re-disseminated CPM-high-expressing cells) were more readily taken up by alveolar macrophages than HILC D20-derived EVs.
[0179] (Example 5) Evaluation of EVs treated with mRNA-lipofectamine complex. mCherry-mRNA (1 μg) dissolved in Opti-MEM (50 μl) and lipofectamine (2.5 μl) dissolved in Opti-MEM (50 μl) were mixed and incubated at room temperature for 10 minutes. Then, the mRNA-lipofectamine complex was used to evaluate EVs (1.5 x 10) derived from HILC D20. 9The particles were incubated in PBS (100 μl / particles). The combination of materials used, incubation time, and temperature were as shown in Table 6. To perform nanoparticle tracking analysis (required amount 10 μl), an aliquot (30 μl) was taken, and the remaining aliquot (170 μl) was incubated with RNase (5 μg / ml) at room temperature for 1 hour. RNA was extracted from EVs using the exoRNeasy Midi kit, and the RNA concentration was measured (Table 7). RNA was measured to a total of 80 ng calculated from the RNA concentration of each sample, subjected to reverse transcription, and RT-qPCR (Sybr Green) was performed using the obtained cDNA.
[0180]
[0181]
[0182] As a result, high levels of mCherry cDNA could be detected in the mRNA-lipofectamine complex itself and in HILC D20-derived EVs incubated with the mRNA-lipofectamine complex (Figure 14). On the other hand, the amount of mCherry cDNA detected in HILC D20-derived EVs incubated with mRNA was significantly reduced. Furthermore, nanoparticle tracking analysis using NanoSight NS3000 (Malvern Panalytical) confirmed that the particle size of HILC D20-derived EVs incubated with the mRNA-lipofectamine complex was increased compared to HILC D20-derived EVs incubated with mRNA (Figure 15). These findings suggest that EVs treated with the mRNA-lipofectamine complex contain mRNA.
[0183] (Example 6) Evaluation of surface markers of EVs treated with mRNA-lipofectamine complex mCherry-mRNA (1 μg) dissolved in Opti-MEM (50 μl) and lipofectamine (2.5 μl) dissolved in Opti-MEM (50 μl) were mixed and incubated at room temperature for 10 minutes. Then, the mRNA-lipofectamine complex was used to evaluate the surface markers of EVs (4.5 x 10) derived from HILC D20.9 The particles were added to 100 μl of PBS / Opti-MEM and incubated. The combination of materials used, incubation time, and temperature were as shown in Table 8. Each obtained sample (170 μl) was added to 50 μl of Tim4-immobilized magnetic beads from the PS Capture Exosome Flow Cytometry Kit (Fujifilm) and incubated at room temperature for 1 hour. The beads were washed twice and divided into four portions (100 μl each). Primary antibodies (CD9, CD63, CD81) were added and incubated at room temperature for 1 hour. The beads were washed, Alexa fluor antibody 647 (APC) was added as a secondary antibody, and incubated at room temperature for 1 hour. The beads were washed twice, and the surface markers of the EVs were evaluated by flow cytometry.
[0184]
[0185] As a result, it was confirmed that the proportion of EVs treated with the mRNA-lipofectamine complex that were positive for surface markers CD9, CD63, and CD81 was almost unchanged compared to control EVs that were not treated with the complex (Figure 16).
[0186] (Example 7) mRNA delivery of EVs treated with mRNA-lipofectamine complex to airway epithelial cells mCherry-mRNA (1 μg) dissolved in Opti-MEM (50 μl) and lipofectamine (2.5 μl) dissolved in Opti-MEM (50 μl) were mixed and incubated at room temperature for 10 minutes. Then, the mRNA-lipofectamine complex was delivered to HILC D20-derived EVs (2.5 x 10 9Particles were added to PBS / Opti-MEM (100 μl) and incubated at 37°C for 1 hour. Aliquots (100 μl) were taken from 200 μl of EV-containing solution treated with mRNA-lipofectamine complex and added to airway epithelial cells. The cells were incubated at 37°C under 5% CO2 conditions for 24–48 hours. Culture was performed in PneumaCult medium, PneumaCult supplement, hydrocortisone, N-[N-(3,5-Difluorophenacetyl-L-alanyl)]-(S)-phenylglycine t-butyl ester (DAPT) and Y-27632 (heparin-free). After culturing, the cells were washed twice with PneumaCult medium and fluorescence imaging and flow cytometry analysis were performed.
[0187] As a result, mCherry protein expression was observed in 7.2% of airway epithelial cells treated with mRNA-lipofectamine complex-treated EVs (Figure 17). On the other hand, in airway epithelial cells treated with mRNA-treated EVs, the percentage of cells expressing mCherry protein was only 0.69% (Figure 17). This indicates that mCherry-mRNA was introduced into airway epithelial cells by EVs treated with mRNA-lipofectamine complex.
[0188] (Example 8) mRNA delivery of EVs treated with mRNA-lipofectamine complex to alveolar epithelial cells mCherry-mRNA (1 μg) dissolved in Opti-MEM (50 μl) and lipofectamine (2.5 μl) dissolved in Opti-MEM (50 μl) were mixed and incubated at room temperature for 10 minutes. Then, the mRNA-lipofectamine complex was delivered to HILC D20-derived EVs (2.5 x 10 9The particles were added to 100 μl of PBS (Opti-MEM) and incubated at room temperature for 1 hour. Subsequently, the EV-containing solution treated with mRNA-lipofectamine complexes was added to each well of a 96-well plate seeded with alveolar epithelial cells, and the cells were incubated at 37°C under 5% CO2 conditions for 24–48 hours. After culturing, fluorescence imaging and flow cytometry analysis were performed on the cells.
[0189] As a result, mCherry protein expression was observed in 13.0% of alveolar epithelial cells treated with mRNA-lipofectamine complex-treated EVs (Figure 18). On the other hand, in alveolar epithelial cells treated with mRNA-treated EVs, the percentage of cells expressing mCherry protein was only 0.15% (Figure 18). This indicates that mCherry-mRNA was introduced into alveolar epithelial cells by EVs treated with mRNA-lipofectamine complex.
[0190] (Example 9) SARS-CoV2-RBD (receptor-binding domain of the SARS-CoV2 spike protein; 25 μg) and DSPE-PEG(2000)-NHS (approximately 2.5 mg) (molar ratio 1:1000) were incubated at 4°C for 24 hours in EV 1xPBS (500 μl) treated with a protein-lipid complex to obtain a sample (RBD-PEG-DSPE: Figure 19A). The sample was then washed three times with 1xPBS (1 ml) using an Amicon Ultra-4 centrifugal filter unit 10 kDa MWCO (4500 x g, 10 min / wash), and the protein concentration was examined by BCA protein assay (Table 9).
[0191]
[0192] Next, RBD and RBD-PEG-DSPE were separated by SDS-PAGE, stained with Coomassie blue, and characterized (Figure 20). As a result, it was confirmed that RBD-PEG-DSPE was produced.
[0193] The RBD-PEG-DSPE (430 μl) obtained above and HILC D20-derived EV (320 μl, 3.88 x 10) 10 We prepared RBD-PEG-DSPE (200 μl) and HILC D20-derived EV (120 μl, 4.65 x 10⁻¹⁵). 9 Sample 1 was prepared by incubating p / ml at 4°C for 24 hours. In addition, RBD-PEG-DSPE (200 μl) and HILC D20-derived EV (120 μl, 4.65 x 10) were prepared. 9 Sample 2 was prepared by incubating p / ml at room temperature for 1 hour, then incubating at 4°C for 23 hours. Samples 1 and 2 were washed twice with 1x PBS (1 ml) using an Amicon Ultra-4 centrifugal filter unit 10 kDa MWCO (4500xg, 10 min / wash). Then, samples 1 and 2 were purified by size exclusion chromatography (SEC) using a Capto Core 700 to remove impurities, and fractions 1 (F1 (750 μl)), 2 (F2 (750 μl)), and 3 (F3 (750 μl)) were collected, and the distribution of protein concentration and particle size was examined (Tables 10, 11).
[0194] As a result, we were able to recover HILC D20-derived EVs modified externally with RBD-PEG-DSPE from fraction 2 of samples 1 and 2 (Figure 19B).
[0195]
[0196]
[0197] It was found that over 95% of the HILC D20-derived extracellular velocities (EVs) modified on the outside with the obtained RBD-PEG-DSPE were RBD-positive (Figure 21). Furthermore, the number of particles and the average particle size remained unchanged even after 3 weeks of storage at 4°C, and nearly 70% of the EVs were maintained even at room temperature (Table 12).
[0198]
[0199] (Example 10) Analysis of EVs derived from lung progenitor cells <Induction of differentiation into lung progenitor cells> Human iPS cells were differentiated, and CPM-positive cells were collected from the differentiated cells as lung progenitor cells.
[0200] <Collection of Extracellular Vesicles> HEK293 cells, human iPS cells, and CPM-positive lung progenitor cells were prepared as cells for obtaining extracellular vesicles. For the HEK293 cells, the cells were cultured in DMEM (10% FBS) until 80% confluence, then the medium was replaced with DMEM (EV(-) 10% FBS, 1% P / S), and the cells were cultured for a further 48-72 hours before the EV-containing medium was collected. For the human iPS cells, the cells were maintained in mTeSR (FBS(-)) until 80% confluence, fresh mTeSR (FBS(-)) was added on the 5th day, and the cells were cultured further before the EV-containing medium was collected on the 7th day. For the CPM-positive lung progenitor cells, the cells were maintained in LP medium, and then 7x10⁶ cells were placed in a 10cm dish coated with Geltrex. 6 Cells were seeded, and the EV-containing media were collected on day 3 and day 6, respectively, and the two EV-containing media were combined.
[0201] <Purification of Extracellular Vesicles> Each recovered EV-containing medium was centrifuged at 4°C, 300xg, for 10 minutes. Each recovered EV-containing medium was further centrifuged at 4°C, 2,000xg, for 10 minutes. Each recovered EV-containing medium was further centrifuged at 4°C, 10,000xg, for 30 minutes. Each recovered EV-containing medium was processed through a 0.22 μm filter unit, then through a 100 kDa filter unit, and concentrated into 250 μL and 1 mL of each EV-containing medium. Impurities were removed from each recovered EV-containing medium by the following two methods.
[0202] <Size Exclusion Chromatography (SEC)> Impurities were removed from the recovered EV-containing medium using an IZON qEV 35nm, and purified EVs were recovered. Briefly, the column attached to the IZON qEV 35nm was washed twice with D-PBS, and 250 μL of EV-containing medium was added to the column. Then, the column was washed once with PBS, and the EVs remaining on the column were eluted with 600 μL of PBS to recover each purified EV (HEK_SEC, PSC_SEC, and LP_SEC).
[0203] <Affinity Purification> Impurities were removed from the recovered EV-containing medium using the MagCaptur Exosome Isolation Kit PS Ver.2 (FujiFilm), and purified EV-containing PBS was recovered. In short, following the manufacturing instructions for the MagCaptur Exosome Isolation Kit PS Ver.2, each EV was eluted from the magnetic beads to which each EV was bound using 200 μL of elution buffer, and purified EVs (HEK_PS, PSC_PS, and LP_PS) were recovered.
[0204] <LC-MS Analysis> The total protein content of each extracellular matrix (EV) (HEK_PS, HEK_SEC, PSC_PS, PSC_SEC, LP_PS, and LP_SEC) purified from HEK293 cells, human iPS cells, and CPM-positive lung progenitor cells using two different methods was quantified by microBCA assay, and 10–20 μg of protein was subjected to LC-MS analysis. The results are shown in Figures 22–26. All EVs subjected to LC-MS analysis were rich in EV-specific proteins, specifically tetraspanins (CD9, CD63, or CD81). Furthermore, EVs derived from lung progenitor cells (LP_PS and LP_SEC) were rich in CPM. Interestingly, EVs derived from lung progenitor cells were also rich in CFTR, a protein effective in the treatment of cystic fibrosis.
[0205] (Example 11) Analysis of EVs derived from airway epithelial cells <Induction of differentiation into airway epithelial cells> CPM-positive lung progenitor cells were differentiated and airway epithelial cells were harvested. Briefly, CPM-positive lung progenitor cells were seeded into Costar-based or Vitrigel-based inserts in 24-well Transwell plates and differentiated into airway epithelial cells. The Costar-based insert was used for airway epithelial cell differentiation by air-liquid interface (ALI) culture, and the Vitrigel-based insert was used for airway epithelial cell differentiation by liquid-liquid interface (LLI) culture.
[0206] <Analysis of CFTR mRNA expression in cells> The amount of CFTR mRNA expressed in human iPS cells (iPSCs), CPM-positive lung progenitor cells (CPMhi), airway epithelial cells differentiated by gas-liquid interface culture (Cr24-ALI), and airway epithelial cells differentiated by liquid-liquid interface culture (Vi24-LLI) was measured. The results are shown in Figure 27. The expression level of CFTR mRNA was significantly higher in the airway epithelial cells compared to the CPM-positive lung progenitor cells and iPS cells. Furthermore, Vi24-LLI showed a higher expression level of CFTR mRNA than Cr24-ALI.
[0207] <Purification of extracellular vesicles by SEC> The EV-containing media recovered from CPMhi, Cr24-ALI, and Vi24-LLI were treated in the same manner as in Example 9, by removing impurities using an IZON qEV 35nm and recovering the purified EVs (LP_SEC, Vi24_SEC, and Cr24_SEC).
[0208] <Nanoparticle Tracking Analysis> Similar to Example 1, the particle size (average diameter (nm)) and concentration of each EV were analyzed by nanoparticle tracking analysis using NanoSight NS3000 (Malvern Panalytical) (Table 13). The results are shown in Figures 28 to 30.
[0209]
[0210] Each purified EV exhibited a typical size of less than 250 nm, which is expected for EVs. Furthermore, the average particle size of Vi24_SEC and Cr24_SEC derived from differentiated airway epithelial cells was larger than that of LP_SEC.
[0211] <Flow Cytometry Analysis> For each EV (HEK_SEC, LP_SEC, Vi24_SEC, or Cr24_SEC), CFTR enrichment was quantified by flow cytometry analysis. First, approximately 1 x 10⁻⁶ 9 Each EV was bound to a magnetic bead in the PS Capture Exosome Flow Cytometry Kit (Fujifilm). Next, the magnetic beads bound to each EV were divided into two groups: one that underwent permeabilization treatment and one that did not. CFTR on the EV membrane was quantified using human CFTR C-terminal antibody (#24-1). The results are shown in Figure 32. LP_SEC, Vi24_SEC, and Cr24_SEC showed CFTR enrichment compared to HEK_SEC (HEK293 cells did not express CFTR). Furthermore, CFTR enrichment was higher in Vi24_SEC and Cr24_SEC derived from differentiated airway epithelial cells than in LP_SEC derived from lung progenitor cells.
[0212] (Example 12) CFTR Complementary Assay <Induction of Differentiation into Airway Epithelial Cells (CF-Del)> Human iPS cells expressing dysfunctional CFTR (△F508) were differentiated, and CPM-positive cells were collected from the differentiated cells as lung progenitor cells. The CPM-positive lung progenitor cells were seeded in a 96-well plate and cultured in differentiation induction medium for 28 days to differentiate into airway epithelial cells (CF-Del).
[0213] <Induction of Differentiation into Airway Organoids (CF-Del)> Human iPS cells expressing normal CFTR and human iPS cells expressing dysfunctional CFTR (△F508) were differentiated, and CPM-positive cells were harvested from each of the differentiated cells as lung progenitor cells. Furthermore, these CPM-positive lung progenitor cells were seeded on a Matrigel-coated culture dish to an 80% conflict level and cultured for 21 to 25 days to differentiate into airway organoids expressing normal CFTR (Wildtype) and airway organoids expressing dysfunctional CFTR (△F508) (CF-Del), respectively.
[0214] <MQAE Assay> The airway epithelial cells (CF-Del) were treated with each EV (LP_SEC, Vi24_SEC, or Cr24_SEC) or Trikafta (including 3 μM VX445, 3 μM VX661, and 1 μM VX770) as a positive control, and cultured for 24 hours. Furthermore, the airway epithelial cells (CF-Del) were treated again with each EV or Trikafta and cultured for 24 hours. Subsequently, the airway epithelial cells (CF-Del) were treated with forskolin to induce CFTR channel activation. CFTR conductance was measured using an MQAE fluorescent dye. - The measurement was performed by ion efflux. The results are shown in Figures 32 and 33. From the absorbance measurement of MQAE dyes using a plate reader, it was determined that the airway epithelial cells (CF-Del) treated with each of the aforementioned EVs or Trikafta showed an indicator of CFTR function, Cl - The ions were found to exhibit positive conductance. No significant difference in conductance rates was observed among the airway epithelial cells (CF-Del) treated with each of the EVs derived from various sources. This suggests that each of the EVs can achieve compensation for dysfunctional CFTR in the airway epithelial cells (CF-Del).
[0215] <Swelling Assay> First, airway organoids expressing normal CFTR (Wildtype), seeded in a 96-well plate, were treated with a control (FSK(-)), forskolin (FSK(+)), or a mixture of forskolin and its inhibitor (FSK&Inh), and their area was measured after 16 and 22 hours. The results are shown in Figure 34 or Figure 36 (left). The area of airway organoids treated with the control (FSK(-)) remained unchanged, while the area of airway organoids treated with forskolin (FSK(+)) expanded, and the degree of expansion was reduced in airway organoids treated with the inhibitor. These results indicate that this experimental system can be used as a forskolin-inducible response system. Next, airway organoids expressing dysfunctional CFTR (△F508) (CF-Del) were seeded in a 96-well plate, treated with each of the above EVs or Trikfata, and cultured for 24 hours. Furthermore, these airway organoids were reseeded, treated with forskolin, and their area was measured after 16 and 22 hours. The results are shown in Figure 35 or Figure 36 (right). Similar to the results of the MQAE assay, the airway organoids (CF-Del) treated with each EV suggest that complementation of dysfunctional CFTR can also be achieved with airway organoids (CF-Del) via each EV.
[0216] Although the present invention has been described above with reference to embodiments, the present invention is not limited to the above embodiments. Various modifications to the configuration and details of the present invention can be made that will be understood by those skilled in the art within the scope of the present invention.
[0217] The patents, patent applications, and documents cited herein are incorporated herein by reference in the same manner as their contents are specifically described herein.
[0218] This application claims priority based on Japanese Patent Application No. 2024-193112, filed in Japan on November 1, 2024, and the contents of that application are incorporated herein by reference.
[0219] <Notes> Some or all of the above embodiments and examples may be described as follows, but are not limited to the following. <Method 1 for producing extracellular vesicles according to the present disclosure> (Note 1) A method for producing extracellular vesicles derived from lung progenitor cells or their differentiated cells, comprising the step (1) of culturing lung progenitor cells to cause the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium. (Note 2) The method according to Note 1, wherein the lung progenitor cells have the ability to differentiate into alveolar epithelial cells or airway epithelial cells. (Note 3) The method according to Note 1 or 2, wherein the lung progenitor cells do not have the ability to differentiate into thyroid cells. (Note 4) The method according to any one of Notes 1 to 3, wherein the lung progenitor cells include alveolar epithelial progenitor cells or airway epithelial progenitor cells. (Note 5) The method according to any one of Notes 1 to 4, wherein the differentiated cells include alveolar epithelial cells or airway epithelial cells. (Note 6) The method for producing the product according to any one of Notes 1 to 5, wherein the lung progenitor cells are derived from pluripotent stem cells. (Note 7) The method for producing the product according to any one of Notes 1 to 6, wherein the lung progenitor cells or differentiated cells are positive for cystic fibrosis membrane conductance regulator. (Note 8) The method for producing the product according to any one of Notes 1 to 7, wherein the lung progenitor cells or differentiated cells are positive for carboxypeptidase M. (Note 9) The method for producing the product according to any one of Notes 1 to 8, wherein the lung progenitor cells or differentiated cells are positive for NK2 homeobox 1. (Note 10) The method for producing the product according to any one of claims 1 to 9, wherein the culture medium is a maintenance medium. (Note 11) The method for producing the product according to Note 10, wherein the maintenance medium comprises a steroid, a cAMP derivative, a phosphodiesterase inhibitor, KGF, a ROCK inhibitor, and a TGFβ inhibitor. (Note 12) The method for producing the product according to Note 11, wherein the steroid is dexamethasone. (Note 13) The method for producing the product according to Note 11 or 12, wherein the cAMP derivative is 8-Br-cAMP. (Note 14) The method for producing the product according to any one of Notes 11 to 13, wherein the phosphodiesterase inhibitor is 3-isobutyl-1-methylxanthine. (Note 15) The method for producing the product according to any one of Notes 11 to 14, wherein the ROCK inhibitor is Y-27632.(Note 16) The method for producing the product according to any one of Notes 11 to 15, wherein the TGFβ inhibitor is SB431542. (Note 17) The method for producing the product according to any one of Notes 1 to 9, wherein the culture medium is a differentiation induction medium. (Note 18) The method for producing the product according to Note 17, wherein the differentiation induction medium contains a differentiation induction factor for alveolar epithelial cells. (Note 19) The method for producing the product according to Note 18, wherein the differentiation induction factor includes (a) or (b) below: (a) a Wnt inhibitor; (b) at least one selected from the group consisting of a steroid, a cAMP derivative, a phosphodiesterase inhibitor, KGF, a GSK3β inhibitor, a TGFβ inhibitor, a ROCK inhibitor, FGF10, and EGF. (Note 20) The method for producing the product according to Note 19, wherein the Wnt inhibitor is XAV939. (Note 21) The method for producing the product according to Note 19 or 20, wherein the steroid is dexamethasone. (Note 22) The method for producing the cell according to any one of Notes 19 to 21, wherein the cAMP derivative is 8-Br-cAMP. (Note 23) The method for producing the cell according to any one of Notes 19 to 22, wherein the phosphodiesterase inhibitor is 3-isobutyl-1-methylxanthine. (Note 24) The method for producing the cell according to any one of Notes 19 to 23, wherein the GSK3β inhibitor is CHIR99021. (Note 25) The method for producing the cell according to any one of Notes 19 to 24, wherein the TGFβ inhibitor is SB431542. (Note 26) The method for producing the cell according to any one of Notes 19 to 25, wherein the ROCK inhibitor is Y-27632. (Note 27) The method for producing the cell according to Note 17, wherein the differentiation induction medium contains a differentiation induction factor for airway epithelial cells. (Note 28) The manufacturing method according to Note 27, wherein the differentiation-inducing factor comprises at least one selected from the group consisting of steroids, Notch inhibitors, ROCK inhibitors, and heparin. (Note 29) The manufacturing method according to Note 28, wherein the steroid is dexamethasone. (Note 30) The manufacturing method according to Note 28 or 29, wherein the Notch inhibitor is DAPT. (Note 31) The manufacturing method according to any one of Notes 28 to 30, wherein the ROCK inhibitor is Y-27632.(Note 32) The method for producing a cell according to any one of Notes 28 to 31, wherein the culture is a liquid-liquid interface culture. (Note 33) The method for producing a cell according to any one of Notes 1 to 32, further comprising step (2) of recovering the extracellular vesicles secreted into the culture medium. (Note 34) The method for producing a cell according to Note 33, wherein step (2) includes the use of a recovery method based on the specific gravity of the extracellular vesicles, a recovery method based on the size of the extracellular vesicles, a recovery method based on the charge of the extracellular vesicles, a recovery method based on a surface marker of the extracellular vesicles, a recovery method based on affinity with the extracellular vesicles, or a combination thereof. <Extracellular vesicles produced by the method for producing extracellular vesicles 1 of the present disclosure> (Note 35) Extracellular vesicles derived from lung progenitor cells or their differentiated cells, produced by the method for producing a cell according to any one of Notes 1 to 34. <Method 2 for producing extracellular vesicles according to the present disclosure> (Note 36) The method according to any one of Notes 1 to 34, further comprising step (A) of introducing an active ingredient into lung progenitor cells before step (1), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient. (Note 37) The method according to Note 33 or 34, further comprising step (B) of introducing an active ingredient into the extracellular vesicle after step (2), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient. (Note 38) The method according to Note 36 or 37, wherein the active ingredient is a protein, nucleic acid, low molecular weight compound, or lipid. (Note 39) The method according to Note 38, wherein the nucleic acid is a modified nucleic acid. <Extracellular vesicles produced by Method 2 for producing extracellular vesicles according to the present disclosure> (Note 40) Extracellular vesicles containing an active ingredient, produced by the method according to any one of Notes 36 to 39. <Extracellular vesicles 1 of this disclosure> (Note 41) Extracellular vesicles derived from lung progenitor cells or their differentiated cells that are positive for cystic fibrosis membrane conductance regulators. (Note 42) Extracellular vesicles as described in Note 41 that are positive for carboxypeptidase M. (Note 43) Extracellular vesicles as described in Note 41 or 42 that are positive for CD9, CD63, and CD81.(Note 44) An extracellular vesicle according to any one of Notes 41 to 43, containing at least one miRNA selected from the group consisting of (i) to (v) below: (i) hsa-miR-183-5p, (ii) hsa-miR-182-5p, (iii) hsa-miR-205-5p, (iv) hsa-miR-484, (v) hsa-miR-483-5p. (Note 45) An extracellular vesicle according to any one of Notes 41 to 44, having an average particle size of 50 nm to 250 nm. (Note 46) An extracellular vesicle according to any one of Notes 41 to 45, manufactured by the manufacturing method described in any one of Notes 1 to 34. <Composition 1 of the present disclosure> (Note 47) A composition comprising an extracellular vesicle according to any one of Notes 41 to 46. <Cell introduction composition 1 of the present disclosure> (Note 48) The composition according to claim 47, which is a composition for use in introducing the cystic fibrosis membrane conductance regulatory factor into airway epithelial cells, alveolar epithelial cells, alveolar macrophages, pulmonary fibroblasts or airway epithelium. <Pharmaceutical composition 1 for disease of the present disclosure> (Note 49) The composition according to note 47, which is a pharmaceutical composition for use in the prevention or treatment of cystic fibrosis. <Method 1 for prevention or treatment of disease of the present disclosure> (Note 50) A method for the prevention or treatment of cystic fibrosis, comprising administering the extracellular vesicle according to any one of notes 41 to 46 to a subject requiring administration. <Extracellular vesicle 1 of the present disclosure for use in the prevention or treatment of disease> (Note 51) The extracellular vesicle according to any one of notes 41 to 46 for use in the prevention or treatment of cystic fibrosis. <Use of extracellular vesicle 1 of this disclosure for the manufacture of pharmaceutical compositions> (Note 52) Use of an extracellular vesicle according to any one of Notes 41 to 46 for the manufacture of a pharmaceutical composition for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient. <Extracellular vesicle 2 of this disclosure> (Note 53) An extracellular vesicle according to any one of Notes 41 to 45, comprising an active ingredient. (Note 54) An extracellular vesicle according to Note 53, wherein the active ingredient is a protein, nucleic acid, low molecular weight compound or lipid. (Note 55) An extracellular vesicle according to Note 54, wherein the nucleic acid is a modified nucleic acid.(Note 56) An extracellular vesicle according to any one of Notes 53 to 55, manufactured by the manufacturing method described in any one of Notes 36 to 39. <Composition 2 of the Disclosure> (Note 57) A composition comprising an extracellular vesicle according to any one of Notes 53 to 56. <Composition 2 for Cell Introduction of the Disclosure> (Note 58) The composition according to Note 57, which is used for introducing the active ingredient into alveolar epithelial cells, airway epithelial cells, alveolar macrophages, lung fibroblasts, or airway epithelium. <Pharmaceutical Composition 2 for Diseases of the Disclosure> (Note 59) The composition according to Note 57, which is a pharmaceutical composition for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient. <Method for Prevention or Treatment of Diseases of the Disclosure 2> (Note 60) A method for preventing or treating a disease that can be prevented or treated by the active ingredient, comprising administering an extracellular vesicle according to any one of Notes 53 to 56 to a target requiring administration. <Extracellular vesicle 2 of the Disclosure for use in the prevention or treatment of disease> (Note 61) An extracellular vesicle according to any one of Notes 53 to 56 for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient. <Use of extracellular vesicle 2 of the Disclosure for the manufacture of a pharmaceutical composition> (Note 62) An extracellular vesicle according to any one of Notes 53 to 56 for the manufacture of a composition for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient.
[0220] As described above, this disclosure provides a carrier for DDS without side effects, a method for producing the carrier, a composition for introducing an active ingredient into alveolar epithelial cells, etc., using the carrier, and a composition for preventing or treating diseases that can be prevented or treated by the active ingredient. For this reason, this disclosure is extremely useful, for example, in the pharmaceutical field.
Claims
1. A method for producing extracellular vesicles derived from lung progenitor cells or their differentiated cells, comprising the step (1) of culturing lung progenitor cells to cause the lung progenitor cells or their differentiated cells to secrete extracellular vesicles into a culture medium.
2. The method for producing the lung progenitor cells according to claim 1, wherein the lung progenitor cells have the ability to differentiate into alveolar epithelial cells or airway epithelial cells.
3. The method for producing the lung progenitor cells according to claim 1 or 2, wherein the lung progenitor cells do not have the ability to differentiate into thyroid cells.
4. The manufacturing method according to any one of claims 1 to 3, wherein the lung progenitor cells include alveolar epithelial progenitor cells or airway epithelial progenitor cells.
5. The manufacturing method according to any one of claims 1 to 4, wherein the differentiated cells include alveolar epithelial cells or airway epithelial cells.
6. The manufacturing method according to any one of claims 1 to 5, wherein the lung progenitor cells are derived from pluripotent stem cells.
7. The method for producing the lung progenitor cells or differentiated cells according to any one of claims 1 to 6, wherein the lung progenitor cells or differentiated cells are positive for cystic fibrosis membrane conductance regulatory factor.
8. The method for producing the lung progenitor cells or differentiated cells according to any one of claims 1 to 7, wherein the lung progenitor cells or differentiated cells are carboxypeptidase M positive.
9. The method for producing the lung progenitor cells or differentiated cells according to any one of claims 1 to 8, wherein the lung progenitor cells or differentiated cells are NK2 homeobox 1 positive.
10. The manufacturing method according to any one of claims 1 to 9, wherein the culture medium is a maintenance culture medium.
11. The production method according to claim 10, wherein the maintenance medium comprises a steroid, a cAMP derivative, a phosphodiesterase inhibitor, KGF, a ROCK inhibitor, and a TGFβ inhibitor.
12. The manufacturing method according to claim 11, wherein the steroid is dexamethasone, the cAMP derivative is 8-Br-cAMP, the phosphodiesterase inhibitor is 3-isobutyl-1-methylxanthine, the ROCK inhibitor is Y-27632, and the TGFβ inhibitor is SB431542.
13. The manufacturing method according to any one of claims 1 to 9, wherein the culture medium is a differentiation induction medium.
14. The manufacturing method according to claim 13, wherein the differentiation induction medium contains a differentiation induction factor for alveolar epithelial cells.
15. The method for producing the product according to claim 14, wherein the differentiation-inducing factor comprises (a) or (b) below: (a) a Wnt inhibitor; (b) at least one selected from the group consisting of a steroid, a cAMP derivative, a phosphodiesterase inhibitor, KGF, a GSK3β inhibitor, a TGFβ inhibitor, a ROCK inhibitor, FGF10, and EGF.
16. The manufacturing method according to claim 15, wherein the Wnt inhibitor is XAV939, the steroid is dexamethasone, the cAMP derivative is 8-Br-cAMP, the phosphodiesterase inhibitor is 3-isobutyl-1-methylxanthine, the GSK3β inhibitor is CHIR99021, the TGFβ inhibitor is SB431542, and the ROCK inhibitor is Y-27632.
17. The manufacturing method according to claim 13, wherein the differentiation induction medium contains a differentiation induction factor for airway epithelial cells.
18. The manufacturing method according to claim 17, wherein the differentiation-inducing factor comprises at least one selected from the group consisting of steroids, Notch inhibitors, ROCK inhibitors, and heparin.
19. The manufacturing method according to claim 18, wherein the steroid is dexamethasone, the Notch inhibitor is DAPT, and the ROCK inhibitor is Y-27632.
20. The manufacturing method according to any one of claims 17 to 19, wherein the culture is a liquid-liquid interface culture.
21. The manufacturing method according to any one of claims 1 to 20, further comprising the step (2) of recovering the extracellular vesicles secreted into the culture medium.
22. The manufacturing method according to claim 21, wherein step (2) includes using a recovery method based on the specific gravity of the extracellular vesicles, a recovery method based on the size of the extracellular vesicles, a recovery method based on the charge of the extracellular vesicles, a recovery method based on a surface marker of the extracellular vesicles, a recovery method based on affinity with the extracellular vesicles, or a combination thereof.
23. Extracellular vesicles derived from lung progenitor cells or their differentiated cells, produced by the manufacturing method described in any one of claims 1 to 22.
24. The method for producing a product according to any one of claims 1 to 22, further comprising step (A) of introducing an active ingredient into lung progenitor cells prior to step (1), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient.
25. The manufacturing method according to claim 21 or 22, further comprising step (B) of introducing an active ingredient into the extracellular vesicle after step (2), wherein the extracellular vesicle is an extracellular vesicle containing the active ingredient.
26. The method for producing a product according to claim 24 or 25, wherein the active ingredient is a protein, nucleic acid, low molecular weight compound, or lipid.
27. The manufacturing method according to claim 26, wherein the nucleic acid is a modified nucleic acid.
28. Extracellular vesicles containing an active ingredient, manufactured by the manufacturing method described in any one of claims 24 to 27.
29. Extracellular vesicles derived from lung progenitor cells or their differentiated cells that are positive for cystic fibrosis membrane conductance regulators.
30. The extracellular vesicle according to claim 29, which is carboxypeptidase M positive.
31. The extracellular vesicle according to claim 29 or 30, which is positive for CD9, CD63, and CD81.
32. An extracellular vesicle according to any one of claims 29 to 31, containing at least one miRNA selected from the group consisting of (i) to (v) below: (i) hsa-miR-183-5p, (ii) hsa-miR-182-5p, (iii) hsa-miR-205-5p, (iv) hsa-miR-484, (v) hsa-miR-483-5p.
33. An extracellular vesicle according to any one of claims 29 to 32, wherein the average particle diameter is 50 nm to 250 nm.
34. An extracellular vesicle according to any one of claims 29 to 33, manufactured by the manufacturing method described in any one of claims 1 to 22.
35. A composition comprising an extracellular vesicle according to any one of claims 29 to 34.
36. The composition according to claim 35, which is a composition for use in introducing the cystic fibrosis membrane conductance regulatory factor into airway epithelial cells, alveolar epithelial cells, alveolar macrophages, pulmonary fibroblasts, or airway epithelium.
37. The composition according to claim 35, which is a pharmaceutical composition for use in the prevention or treatment of cystic fibrosis.
38. A method for preventing or treating cystic fibrosis, comprising administering an extracellular vesicle according to any one of claims 29 to 34 to a subject requiring administration.
39. An extracellular vesicle according to any one of claims 29 to 34, for use in the prevention or treatment of cystic fibrosis.
40. Use of extracellular vesicles according to any one of claims 29 to 34 for the manufacture of a pharmaceutical composition for use in the prevention or treatment of cystic fibrosis.
41. An extracellular vesicle according to any one of claims 29 to 33, comprising an active ingredient.
42. The extracellular vesicle according to claim 41, wherein the active ingredient is a protein, nucleic acid, low molecular weight compound, or lipid.
43. The extracellular vesicle according to claim 42, wherein the nucleic acid is a modified nucleic acid.
44. An extracellular vesicle according to any one of claims 41 to 43, manufactured by the manufacturing method described in any one of claims 24 to 27.
45. A composition comprising an extracellular vesicle according to any one of claims 41 to 44.
46. The composition according to claim 45, which is a composition for use in introducing the active ingredient into alveolar epithelial cells, airway epithelial cells, alveolar macrophages, lung fibroblasts, or airway epithelium.
47. The composition according to claim 45, which is a pharmaceutical composition for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient.
48. A method for preventing or treating a disease that can be prevented or treated by the active ingredient, comprising administering an extracellular vesicle according to any one of claims 41 to 44 to a subject requiring administration.
49. An extracellular vesicle according to any one of claims 41 to 44, for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient.
50. Use of extracellular vesicles according to any one of claims 41 to 44 for the preparation of a composition for use in the prevention or treatment of a disease that can be prevented or treated by the active ingredient.