Orthogonal ferritin nanoparticles
The orthogonal ferritin platform addresses the inefficiencies in multicomponent FNP-based vaccine manufacturing by linking distinct antigens to different ferritins, improving antigen delivery and immune response efficacy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- VACCINE CO INC
- Filing Date
- 2025-10-31
- Publication Date
- 2026-05-07
AI Technical Summary
The manufacturing of multicomponent ferritin nanoparticle (FNP)-based vaccines is laborious and can result in erroneous antigen presentation due to the co-assembly of ferritin monomers carrying different antigens, leading to reduced assembling efficiency.
An orthogonal ferritin platform is employed, where each antigen is linked to a different ferritin, reducing erroneous co-assembly by utilizing polynucleotides encoding distinct ferritins, such as those from amphibians, bacteria, archaea, mammals, fungi, or plants, and incorporating polypeptides with modifications like amino acid substitutions and linkers.
This approach enhances the efficiency of antigen delivery and immune response by minimizing erroneous co-assembly, facilitating the development of vaccines effective against multiple pathogens.
Smart Images

Figure US2025053654_07052026_PF_FP_ABST
Abstract
Description
ORTHOGONAL FERRITIN NANOPARTICLESRELATED APPLICATIONS
[0001] This application claims the priority and benefit of U. S. Provisional Application No.63 / 714,617, filed October 31, 2024, the contents of which are incorporated by reference herein in their entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (VCCN 018 01 WO SeqList ST26.xml; Size: is 67,928 bytes; and Date of Creation: October 31, 2025) are herein incorporated by reference in their entirety.BACKGROUND
[0003] Ferritin nanoparticles (FNP) have been used as a vaccine platform to deliver antigens, such as influenza A hemagglutinin (Kanekiyo et al., Nature. 2013; 499(7456): 102-6) and SARS-CoV-2 spike protein (Weidenbacher et al., Nat Commun. 2023; 14( 1 ):2149), and to enhance the immune response to the target antigen. For some pathogens, an effective vaccine may require inducing immune response to multiple antigens. While manufacturing a multicomponent FNP -based vaccine can be accomplished, the process is laborious. To simplify the manufacturing process, FNP -based vaccine can be encoded and delivered by nucleic acids such as mRNAs (Mu et al., Cell Rep. 2022; 38(11): 110514).
[0004] However, co-delivery of nucleic acids that encode different antigens carried by the same ferritin protein may lead to undesired outcomes, as the formation of ferritin nanoparticles relies on individual ferritin proteins inside the cells to self-assemble into nanoparticles. For example, ferritin monomers carrying different antigens may co-assemble and lead to erroneous antigen presentation on the ferritin nanoparticles. Co-assembly of ferritin monomers bearing heterologous antigens may also interrupt co-assembly of ferritin monomers bearing the same antigen, leading to reduced assembling efficiency. New and improved designs are desirable for nucleic acid-based delivery of multiple antigens through FNP -based vaccines. Provided herein are methods and compositions that address this need.SUMMARY
[0005] This disclosure relates to polypeptides, polynucleotides, compositions, and methods of use, for presentation of antigens on ferritin nanoparticles.
[0006] Disclosed herein is a composition comprising a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0007] In some embodiments, the first and / or second polynucleotides comprise DNA.
[0008] In some embodiments, the first and / or second polynucleotides comprise RNA.
[0009] In some embodiments, the first and / or second polynucleotides comprise mRNA or self -amplifying RNA or trans-amplifying RNA or circular RNA
[0010] In some embodiments, the first and / or second polynucleotides comprise modified nucleosides.
[0011] In some embodiments, the first and / or second polynucleotides comprise an Internal Ribosomal Entry Site (IRES) sequence.
[0012] In some embodiments, the IRES sequence comprises SEQ ID NO: 48 or a sequence with at least 70% sequence identity thereto.
[0013] Also Disclosed herein is a comprising a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0014] In some embodiments, the first ferritin is capable of self-assembling into a ferritin nanoparticle presenting the first antigen and the second ferritin is capable of self-assembling into a ferritin nanoparticle presenting the second antigen.
[0015] In certain embodiments, the first ferritin and the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
[0016] In certain embodiments, the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian.
[0017] In certain embodiments, the amphibian is a bullfrog and the ferritin is a hybrid bullfrog ferritin, wherein the hybrid bullfrog ferritin comprises (i) a bullfrog ferritin or portion thereof and (ii) a ferritin derived from a bacterium.
[0018] In certain embodiments, the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium. In certain embodiments, the bacterium is gram -negative. In certain embodiments, the bacterium is H. Pylrori, P. Furiosus, C. Tepidum V. Cholera, D. de sulfur leans, H. cetorum, H. vulpis, C. coll, or E. coll. In certain embodiments, the bacterium is gram-positive. In certain embodiments, the bacterium is U Urealycitum, M. Tuberculosis, or B. subtilis. In certain embodiments, the amino acid sequence of the first ferritin and / or the second ferritin comprises any one of SEQ ID NOs: 1-13 or a sequence with at least 70% sequence identity thereto.
[0019] In some embodiments, the first antigen and / or second antigen are derived from a pathogen. In certain embodiments, the pathogen is a virus. In certain embodiments, the virus is a flavivirus, an adenovirus, a coronavirus, a poxvirus, parainfluenza virus, influenza virus, metapneumovirus, Epstein-Barr Virus (EBV), respiratory syncytial virus (RSV), varicella zoster virus (VZV), cytomegalovirus (CMV), or rhinovirus. In certain embodiments, the coronavirus is Middle East respiratory syndrome coronavirus (MERS-CoV), Severe acute respiratory syndrome-associated coronavirus 1 (SARS-CoV-1), or Severe acute respiratory syndrome-associated coronavirus 2 (SARS-CoV-2).
[0020] In some embodiments, the pathogen is a bacterium. In certain embodiments, the bacterium is a Chlamydia spp., Neisseria spp,, or Streptococcus spp., optionally wherein the species is C. trachomatis, C. neumoniae, C. psitiaci, N gonorrhea, N. meningitide,. S. pneumoniae, S. pyogenes, S. agalactiae, or S. mutans.
[0021] In certain embodiments, the pathogen is a fungus. In certain embodiments, the first antigen and / or second antigen is derived from a tumor-associated or tumor-specific antigen. In certain embodiments, the first antigen and / or second antigen is a monomer or forms a trimer.
[0022] In some embodiments, the first antigen and / or second the antigen comprises at least one modification relative to a wild type protein.
[0023] In some embodiments, the at least one modification relative to a wildtype protein comprises a deletion, an insertion, or an amino acid substitution.
[0024] In some embodiments, the at least one modification comprises an amino acid deletion. In certain embodiments, the amino acid deletion comprises a truncation at the C-terminal or N-terminal relative to the amino acid sequence of a wildtype protein.
[0025] In some embodiments, the at least one modification comprises an amino acid substitution. In certain embodiments, the amino acid substitution comprises two or more consecutive amino acid substitutions. In certain embodiments, the two or more consecutive amino acid substitution eliminate a furin cleavage site within the amino acid sequence of the antigen.
[0026] In some embodiments, the at least one modification comprises an amino acid insertion. In certain embodiments, the amino acid insertion comprises insertion of a ribosomal skip site, a trimerization domain, a cleavage site, a signal peptide, or a combination thereof.
[0027] In certain embodiments, the amino acid insertion comprises a signal peptide. In certain embodiments, the signal sequence comprises the signal peptide from IgE, IGVH, tissue plasminogen activator (tPA), CD5, or IGKV.
[0028] In certain embodiments, the amino acid insertion comprises a trimerization domain.
[0029] In some embodiments, a composition of the disclosure comprises a linker, optionally wherein the linker fuses the antigen directly or indirectly to the ferritin. In certain embodiments, the linker is a flexible linker. In certain embodiments, the linker is a peptide linker. In certain embodiments, the peptide linker is a Gly-Ser linker. In certain embodiments, the peptide linker comprises the amino acid sequence of the formula (Gly4Ser)n, wherein n is I, 2, 3, 4, or 5.
[0030] In some embodiments, the composition comprises at least two polynucleotides, wherein the polynucleotides are combined with or incorporated into a vector.
[0031] In certain embodiments, the vector is a viral vector.
[0032] In certain embodiments, the viral vector is an adenovirus, an adeno-associated virus (AAV), a vesiculovirus, a retrovirus, a herpesvirus, or a vaccinia vims.
[0033] In some embodiments, the vector is a non-viral vector. In certain embodiments, the non-viral vector is a plasmid. In certain embodiments, the non-viral vector is a lipid nanoparticle (LNP).
[0034] In some embodiments, a composition of the disclosure comprises at least one adjuvant.
[0035] In some embodiments, a composition of the disclosure comprises one or more pharmaceutically acceptable earner, excipient, or diluent.
[0036] Also disclosed herein is a kit comprising a composition of the disclosure and instructions for use.
[0037] Also disclosed herein is a method of delivering to a cell a ferritin nanoparticle (FNP)-based nucleic acid vaccine, comprising contacting the cell with a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0038] In certain embodiments, the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
[0039] In certain embodiments, the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian. In certain embodiments, the amphibian is a bullfrog.
[0040] In certain embodiments, the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium. In certain embodiments, the bacterium is gram-negative. In certain embodiments, the bacterium is H. pylrori, P. furiosus, C. tepidum V. cholera, D. de sulfur icans, H. cetorum, H. vulpis, C. coll, or E. coli.
[0041] In certain embodiments, the bacterium is gram -positive. In certain embodiments, the bacterium is U urealycitum, M. Tuberculosis, or B. subtilis.
[0042] In some embodiments of the methods of the disclosure, the polynucleotides comprise DNA, RNA, mRNA, or a combination thereof.
[0043] In certain embodiments, the polynucleotides comprise mRNA.
[0044] Also disclosed herein is a method of treating a disease or a symptom thereof in a subject having, or at risk of having the disease, comprising administering to the subject an effective amount of the composition of the disclosure.
[0045] Also disclosed herein is a method of inducing antibodies to an antigen in a subject, comprising administering to the subject an effective amount of the composition of the disclosure, wherein the antibodies bind to the first and / or the second antigen in the composition.
[0046] Also disclosed herein is a method for inducing an immune response against a disease or disorder in a subject, comprising administering to the subject an effective amount of the composition of the disclosure.
[0047] In some embodiments, the disease is a viral infection, a bacterial infection, a fungal infection, or a cancer.
[0048] In some embodiments, the subject is a mammal.
[0049] In some embodiments, the subject is a human. In certain embodiments, the subject is immunosuppressed or immunocompromised.
[0050] In some embodiments, the composition is administered intramuscularly.BRIEF DESCRIPTION OF THE DRAWINGS
[0051] FIG. I depicts a western-blot showing expression of EBV gB protein on different ferritin FNPs in ExpiCHO supernatant, all from cultures in a 50-mL bioreactor with the exception of lane 1 as a culture in a 24-well deep well plate. FNPs have the post fusion gB on the N terminus.
[0052] FIG. 2 depicts a western-blot showing expression of EBV gB protein on different ferritin FNPs in ExpiCHO supernatant, all from cultures in a 24-well deep well plate with the exception of lane 1 as a culture in a 50-mL bioreactor. FNPs have the post fusion gB on the N terminus.
[0053] FIG. 3 depicts a protein gel with Coomassie blue staining showing the orthogonal FNPs after clean-up with Capto CoreTM 700 column and after further purification with the sizeexclusion column SRT-SEC-100 followed by concentration. FNPs have the post fusion gB on the N terminus.
[0054] FIG. 4 depicts a graph showing the radius of each orthogonal FNP as measured by dynamic light scattering. FNPs have the post fusion gB on the N terminus.
[0055] FIG. 5 depicts a graph showing the melting profiles of the orthogonal FNPs as measured by differential scanning fluorimetry. FNPs have the post fusion gB on the N terminus.
[0056] FIG. 6 depicts a Western blot showing gp220 expression, as detected by a monoclonal antibody directed against gp220, 72A1, in the supernatant and lysate following transfection of HEK-293T cells with the indicated gp350-E. coli ferritin mRNA, delivered either with a lipofection reagent or encapsulated in an LNP. The E. coli ferritin shown here contains the hybrid bull frog extension.
[0057] FIG. 7 depicts a Western blot showing gH and gp42 expression in the supernatant and lysate following transfection of HEK-293T cells with the indicated gHgLgp42-H. Pylori ferritin mRNA, delivered either with a lipofection reagent or encapsulated in an LNP. Expression was detected by a mixture of two monoclonal antibodies: CL59 is directed against gH domain 3 while5E3 is directed against gp42. The H. pylori ferritin shown here contains the hybrid bullfrog extension,
[0058] FIG. 8 depicts representative TEM images of post fusion gB ferritin constructs containing the indicated ferritins and expressed in Expi293 cells and purified using size exclusion chromatography as in FIG. 2.
[0059] FIG. 9 depicts a graph showing comparative in-vitro potency of three gB ferritin mRNA designs. Antigen expression on HeLa cells that were treated with LNPs containing each of the mRNA designs was detected by a monoclonal antibody (3A5) directed against gB Domain IV, measured by flow cytometry, and plotted as the area under the curve (AUC) relative to an untreated control.
[0060] FIG. 10A depicts a graph showing sera binding to D123 (the receptor binding domain of gp350) conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gp350.
[0061] FIG. 10B depicts a graph showing sera binding to D123 (the receptor binding domain of gp350) conjugated beads as quantified via Luminex at day 34, following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gp350.
[0062] FIG. 10C depicts a graph showing sera binding to gHgLgp42 (single chain) conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gH / gL / gp42.
[0063] FIG. 10D depicts a graph showing sera binding to gHgLgp42 (single chain) conjugated beads as quantified via Luminex at day 34, following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gH / gL / gp42.
[0064] FIG. 10E depicts a graph showing sera binding to gH + gL conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gH / gL.
[0065] FIG. 10F depicts a graph showing sera binding to gH + gL conjugated beads as quantified via Luminex at day 34, following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gH / gL.
[0066] FIG. 10G depicts a graph showing sera binding to gp42 conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gp42.
[0067] FIG. 10H depicts a graph showing sera binding to gp42 conjugated beads as quantified via Luminex at day 34, following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gp42.
[0068] FIG. 101 depicts a graph showing sera binding to gB conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB.
[0069] FIG. 10J depicts a graph showing sera binding to gB conjugated beads as quantified via Luminex at day 34 following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB.
[0070] FIG. 10K depicts a graph showing sera binding to gB Domain II conjugated beads as quantified via Luminex at day 20 following immunization on day 0 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB Domain II.
[0071] FIG. 10L depicts a graph showing sera binding to gB Domain II conjugated beads as quantified via Luminex at day 34 following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB Domain II.
[0072] FIG. 10M depicts a graph showing sera binding to gB Domain IV conjugated beads as quantified via Luminex at day 20, following immunization on day 0 with the indicated ferritinnanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB Domain IV.
[0073] FIG. ION depicts a graph showing sera binding to gB Domain IV conjugated beads as quantified via Luminex at day 34, following immunization on days 0 and 20 with the indicated ferritin nanoparticle constructs delivered as mRNA (2 or 0.4 pg per antigen). Each dot indicates the antibody binding of sera from a single mouse to gB Domain IV.
[0074] FIG. 11 depicts a graph showing the neutralizing potency of sera collected at day 34 from mice immunized with mRNA encoding the indicated orthogonal ferritin nanoparticle formulations at day 0 and day 20. Each dot indicates the neutralizing potency of sera from a single mouse.
[0075] FIG. 12A provides a graph showing B cell neutralization in the 4E3 cell line by sera collected on day 21 or day 35. Mice were immunized on day 0 and day 21 with mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single mouse.
[0076] FIG. 12B provides a graph showing epithelial cell neutralization in the HEK293T cell line by sera collected on day 21 or day 35. Mice were immunized on day 0 and day 21 with mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single mouse.
[0077] FIG. 13A provides a graph showing sera binding to D123 (the receptor binding domain of gp220 / gp350, labeled as gp220) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multi antigen formulations delivered as mRNA (2 g / antigen). Each dot indicates the antibody binding of sera from a single mouse to D123.
[0078] FIG. 13B provides a graph showing sera binding to gHgLgp42 (single chain) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (2 pg / antigen). Each dot indicates the antibody binding of sera from a single mouse to gH / gL / gp42.
[0079] FIG. 13C provides a graph showing sera binding to gH + gL conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (2 pg / antigen). Each dot indicates the antibody binding of sera from a single mouse to
[0080] FIG. 13D provides a graph showing sera binding to gp42 globular head domain conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (2 pg / antigen). Each dot indicates the antibody binding of sera from a single mouse to gp42.
[0081] FIG. 13E provides a graph showing sera binding to gB conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (2 pg / antigen). Each dot indicates the antibody binding of sera from a single mouse to gB.
[0082] FIG. 13F provides a graph showing sera binding to gB. G3 conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from mice immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (2 pg / antigen). Each dot indicates the antibody binding of sera from a single mouse to gB. G3.
[0083] FIG. 14 provides a graph showing B cell neutralization in the 4E3 cell line by sera collected on day 21 or day 35. Rabbits were immunized on day 0 and day 21 with 7.5 pg / antigen of mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single rabbit,
[0084] FIG. 15 provides a graph showing epithelial cell neutralization in the HEK293T cell line by sera collected on day 21 or day 35. Rabbits were immunized on day 0 and day 21 with 7.5 pg / antigen of mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single rabbit. The dotted line at the top indicated the ULOQ, some animals had neutralizing potency too high to be accurately quantified.
[0085] FIG. 16A provides a graph showing sera binding to D123 (the receptor binding domain of gp350, labeled as gp220) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gp350.
[0086] FIG. 16B provides a graph showing sera binding to gHgLgp42 (single chain) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulationsdelivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gH / gL / gp42.
[0087] FIG. 16C provides a graph showing sera binding to gH + gL conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gH / gL.
[0088] FIG. 16D provides a graph showing sera binding to gp42 globular head domain conj gated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gp42.
[0089] FIG. 16E provides a graph showing sera binding to gB conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gB.
[0090] FIG. 16F provides a graph showing sera binding to gB. G3 conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from rabbits immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (7.5 pg / antigen). Each dot indicates the antibody binding of sera from a single rabbit to gB. G3.
[0091] FIG. 17 provides a graph showing B cell neutralization in the 4E3 cell line by sera collected on day 21 or day 35. Guinea pigs were immunized on day 0 and day 21 with 4 pg / antigen of mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single guinea pig.
[0092] FIG. 18 provides a graph showing epithelial cell neutralization in the HEK293T cell line by sera collected on day 21 or day 35. Guinea pigs were immunized on day 0 and day 21 with 4 pg / antigen of mRNA encoding the indicated antigens. Each dot indicates the neutralizing potency of sera from a single guinea pig. The dotted line at the top indicated the ULOQ, some animals had neutralizing potency too high to be accurately quantified.
[0093] FIG. 19A provides a graph showing sera binding to D123 (the receptor binding domain of gp220 / gp350, labeled as gp220) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pigs immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to DI 23.
[0094] FIG. 19B provides a graph showing sera binding to gHgLgp42 (single chain) conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pig immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to gH / gL / gp42.
[0095] FIG. 19C provides a graph showing sera binding to gH + gL conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pigs immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to gH / gL.
[0096] FIG. 19D provides a graph showing sera binding to gp42 globular head domain conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pigs immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to gp42.
[0097] FIG. 19E provides a graph showing sera binding to gB conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pigs immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRNA (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to gB.
[0098] FIG. 19F provides a graph showing sera binding to gB. G3 conjugated beads as quantified via Luminex. Sera was collected on day 21 (top panel) or day 35 (bottom panel) from guinea pigs immunized on days 0 and 21 with the indicated multiantigen formulations delivered as mRN A (4 pg / antigen). Each dot indicates the antibody binding of sera from a single guinea pig to gB. G3.
[0099] FIG. 20 shows sera B cell neutralization analyzed from nonhuman primates (NHPs) immunized with the indicated vaccines in the 4E3 cell line, NHPs were immunized with the indicated formulations at days 0 and 57 (indicated on the graph with grey arrows), and neutralizing potency of sera were assayed at days 0, 29, 57, 71, 85, 120, 180, 240, 298, 360, and 420. Each dot indicates the neutralizing potency of sera from a single NHP. Arrows indicate day of vaccination. Vaccinations were conducted at 25 pg per antigen in mRNA formulations or 50 pg per antigen of recombinant protein formulation.
[0100] FIG. 21 shows sera epithelial cell neutralization analyzed from nonhuman primates (NHPs) immunized with mRNA encoding the indicated antigens in the HEK-293T cell line. NHPs were immunized with the indicated formulations at days 0 and 57 (indicated on the graph with grey arrows), and neutralizing potency of sera were assayed at days 0, 29, 57, 71, 85, 120, 180, 240, 298, 360, and 420. Each dot indicates the neutralizing potency of sera from a single NHP. Arrows indicate day of vaccination. Vaccinations were conducted at 25 pg per antigen in mRNA formulations or 50 pg per antigen of recombinant protein formulation.
[0101] FIG. 22A shows sera binding to gp350 (labeled as gp220) conjugated beads, quantified via Luminex at days 0, 29, 57, 71, 85, 120, 180, and 240 following immunization on days 0 and 57 with the indicated vaccines. Each dot indicates the antibody binding of sera from a single nonhuman primate to gp350.
[0102] FIG. 22B shows sera binding to gHgLgp42 (single chain) conjugated beads, quantified via Luminex at days 0, 29, 57, 71, 85, 120, 180, and 240 following immunization on days 0 and 57 with the indicated vaccines. Each dot indicates the antibody binding of sera from a single nonhuman primate to gH / gL / gp42.
[0103] FIG. 22C shows sera binding to gH + gL conjugated beads, quantified via Luminex at davs 0, 29, 57, 71, 85, 120, 180, and 240 following immunization on days 0 and 57 with the indicated vaccines. Each dot indicates the antibody binding of sera from a single nonhuman primate to gH / gL.
[0104] FIG. 22D shows sera binding to gp42 globular head domain conjugated beads, quantified via Luminex at days 0, 29, 57, 71, 85, 120, 180, and 240 following immunization on days 0 and 57 with the indicated vaccines. Each dot indicates the antibody binding of sera from a single nonhuman primate to gp42.
[0105] FIG. 23 shows reciprocal serum dilution of sera from mice immunized with mRNA encoded H. Pylori ferritin with an N terminal gE protein of VZV (top) or gB protein from CMV (bottom).DETAILED DESCRIPTIONOrthogonal ferritin platform
[0106] Ferritin nanoparticles (FNP) can be used as a vaccine platform to deliver antigens, as described in further detail below. In some instances, an effective vaccine against a pathogen or a disease or disorder may require inducing an immune response to multiple antigens. However, the manufacturing of a multicomponent FNP -based vaccine can be laborious and costly, and delivery of multiple antigens on the same ferritin can result in erroneous co-assembly of FNPs. Use of an orthogonal ferritin platform, as described herein, may be advantageous for delivery by nucleic acids encoding FNP -based vaccines composed of multiple antigens. In an orthogonal ferritin approach, each antigen can be linked to a different ferritin, which would be expected to reduce erroneous co-assembly of heterologous ferritins, in particular when the ferritins used have low amino acid sequence homology.
[0107] The present disclosure provides compositions comprising a first and a second polypeptide, wherein the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, where the first ferritin and the second ferritin are not the same. Additionally, provided herein are methods for making such compositions and methods for using them to generate vaccines. Additionally, compositions comprising polynucleotides encoding said first and second polypeptides, vectors comprising the same, and vaccine compositions are also disclosed.
[0108] In some embodiments, the compositions described herein comprise a first, a second, and a third polypeptide, or polynucleotides encoding the same. In some embodiments, the compositions described herein comprises a first, a second, a third, and a fourth polypeptide, or polynucleotides encoding the same.
[0109] In some embodiments, the compositions described herein comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, at least 11, or at least 12 polypeptides, wherein each of the polypeptides are not the same and wherein each polypeptide comprises an antigen and a ferritin, wherein each of the ferritins are not the same. In someembodiments, the compositions described herein comprise polynucleotides encoding at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, at least 11, or at least 12 polypeptides, wherein each of the polypeptides are not the same and wherein each polypeptide comprises an antigen and a ferritin, wherein each of the ferritins are not the same. In some embodiments, the compositions described herein comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, at least 11, or at least 12 polynucleotides, wherein each polynucleotide encodes a polypeptide comprising an antigen and a ferritin, wherein the ferritins of each of the polypeptides are not the same. In some embodiments, each of the antigens are not the same.Terms and Concepts
[0110] A number of terms and concepts are discussed below. They are intended to facilitate the understanding of various embodiments of the invention in conjunction with the rest of the present document and the accompanying figures. These terms and concepts may be further clarified and understood based on the accepted conventions in the fields of the present invention, as well as the description provided throughout the present document and / or the accompanying figures. Some other terms can be explicitly or implicitly defined in other sections of this document and in the accompanying figures and may be used and understood based on the accepted conventions in the fields of the present invention, the description provided throughout the present document and / or the accompanying figures. The terms not explicitly defined can also be defined and understood based on the accepted conventions in the fields of the present invention and interpreted in the context of the present document and / or the accompanying figures.
[0111] Unless otherwise dictated by context, singular terms shall include pluralities, and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, cell and ti ssue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry are those well-known and commonly used. Known methods and techniques are generally performed according to conventional methods well-known and as described in various general and more specific references, unless otherwise indicated. The nomenclatures used in connection with the laboratory procedures and techniques described in the present disclosure are those well-known and commonly used.
[0112] As used herein, the terms "a", "an", and "the" can refer to one or more unless specifically noted otherwise. The use of the term "or" is used to mean "and / or," unless explicitly indicated to refer to alternatives only, or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and / or." As used herein "another" can mean at least a second or more.
[0113] The terms "about" and "approximately" as used herein shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20% (%); e.g., within 10%; or e.g., within 5% of a given value or range of values. Any reference to "about X" or "approximately X" specifically indicates at least the values X, 0.95X, 0.96X, 0.97X, 0.98X, 0.99X, 1.0IX, 1.02X, 1.03X, 1.04X, and 1.05X. Thus, expressions "about X" or "approximately X" are intended to teach and provide written support for a claim limitation of, for example, "0.98X." Alternatively, in biological systems, the terms "about" and "approximately" may mean values that are within an order of magnitude, within 5- fold, e.g. within 2-fold of a given value. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term "about" or "approximately" can be inferred when not expressly stated. When "about" is applied to the beginning of a numerical range, it applies to both ends of the range.
[0114] The terms "protein" and "polypeptide" are used interchangeably to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers and non-natural amino acid polymers, as well as to amino acid polymers in which one (or more) amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, or a non-naturally occurring amino acid. The terms encompass amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds.
[0115] The terms "sequence identity," and the related terms and expressions used in the context of describing nucleic acid or amino acid sequences refer to a sequence that has at least 60% sequence identity to a reference sequence. Examples include at least: 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, sequence identity, as compared to a reference sequence using the programs for comparison of nucleic acid or amino acid sequences, such as BLAST using standard parameters. For sequence comparison, typically one sequence acts as a reference sequence (subject sequence) to which test sequences (query sequence) are compared. When using a sequence comparison algorithm, test and referencesequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default (standard) program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well-known. Optimal alignment of sequences for comparison may be conducted, for example, by the local homology algorithm of Smith and Waterman, 1981, by the homology alignment algorithm of Needleman and Wunsch, 1970, by the search for similarity method of Pearson and Lipman, 1988, by computerized implementations of these algorithms (for example, BLAST), or by manual alignment and visual inspection. Algorithms that are suitable for determining percent sequence identity and sequence similarity include BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., 1990, and Altschul et al., 1977, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site.
[0116] Depending on the algorithm, the calculated percent sequence identity may differ. For example, there are at least three ways in which to calculate a percent sequence identity.
[0117] % Query sequence identity: = (Number of alignment identities) / (Length of Query' sequence);
[0118] % Subject sequence identity: = (Number of alignment identities) / (Length of Subject sequence);
[0119] % Alignment sequence identity = (Number of alignment identities) / (Length of Alignment)
[0120] Accordingly, when the term “sequence identity” is used herein, it can include any of the above non-limiting methodologies provided above to calculate.
[0121] The expression "neutralizing antibody" can refer to an antibody capable of reducing the ability of an infectious agent, such as a virus, from infecting a cell by neutralizing or inhibiting one or more parts of the life cycle of the infectious agent. In the context of the present disclosure, neutralizing antibodies can prevent a herpesvirus, such as, but not limited to, EBV, from completing its life cycle in host cell. The life cycle of the vims, for example, a herpesvirus, starts with attachment of the virus to a host cell and ending with budding of newly formed virus from the host cell. This life cycle includes, but is not limited to, the steps of attaching to a ceil, entering a cell, fusion of the viral membrane with the host cell membrane, release of viralribonucleoproteins into the cytoplasm, formation of new viral particles and budding of viral particles from the host cell membrane
[0122] The term “tumor antigen” when used in the context of the present disclosure refers to (i) tumor-specific antigens, (ii) tumor-associated antigens, (iii) cells that express turn or- specific antigens, (iv) cells that express tumor-associated antigens, (v) embryonic antigens on tumors, (vi) autologous tumor cells, (vii) tumor-specific membrane antigens, (viii) tumor-associated membrane antigens, (ix) growth factor receptors, (x) growth factor ligands, (xi) neoantigens and (xii) any other type of antigen or antigen-presenting cell or material that is associated with a cancer or a tu or.
[0123] The term “tumor-associated antigen” or “TAA” refers an antigenic molecule, such as a protein, that is generally expressed at a higher level in tumor cells than in non-tumor cells, in which it may not be expressed at all, or only at low levels. In some embodiments, tumor-associated structures which are recognized by the immune system of the tumor-harboring host are referred to as tumor-associated antigens. In some embodiments, a tumor-associated antigen is a universal tumor antigen if its broadly expressed by most tumors. In some embodiments, tumor-associated antigens are differentiation antigens, mutational antigens, overexpressed cellular antigens or viral antigens.
[0124] The term “tumor specific antigen” or “TSA” refers to an antigenic molecule, such as a protein, that is specific to a tumor cell. Tumor specific antigens may be exclusively expressed in tumor cells.
[0125] The term “antigenicity” as used herein refers to the ability of a molecule to be recognized by antibodies or effector cells produced by the immune system.
[0126] The term “immunogenicity” as used herein refers to the ability of a molecule to induce an immune response. The immune response may be humoral and / or cell-mediated.Ferritin nanoparticles
[0127] Ferritin is a globular protein found in animals, bacteria, and plants, that acts primarily to control the rate and location of polynuclear Fe(III)2Ch formation through transportation of hydrated iron ions and protons to and from a mineralized core. The globular form of ferritin is made up of monomeric subunit proteins (also referred to as monomeric ferritin subunits), which are polypeptides having a molecular weight of approximately 17-20 kDa. Each monomeric ferritinsubunit has the topology of a helix bundle which includes a four antiparallel helix motif, with a fifth shorter helix (the c-terminal helix) lying roughly perpendicular to the long axis of the 4-helix bundle. According to convention, the helices are labeled ‘A, B, C, and D & E, from the N-terminus, respectively. The N-tenninal sequence lies adjacent to the capsid three-fold axis and extends to the surface, while the E helices pack together at the four-fold axis with the C-terminus extending into the particle core. The consequence of this packing creates two pores on the capsid surface. Without being held to theory or mechanism, it is expected that one or both of these pores represent the point by which the hydrated iron diffuses into and out of the capsid. Following production, these monomeric ferritin subunit proteins self-assemble into the globular ferritin protein. Thus, the globular form of ferritin comprises 24 monomeric, ferritin subunit proteins, and has a capsid-like structure having a 4-3-2 symmetry. Accordingly, where the compositions of the present disclosure comprise a first and a second polypeptide comprising a first and a second ferritin, respectively, ferritins that are the same would be expected to spontaneously self-assemble into 24-valent nanoparticles displaying a three-fold axis of symmetry for presentation of the antigen of the corresponding polypeptide.
[0128] In some embodiments, co-assembly of ferritin monomers with identical amino acid sequences occurs significantly more than often co-assembly of ferritin monomers with nonidentical amino acid sequences. In some embodiments where the composition of the present disclosure comprises a first and a second polypeptide comprising a first and a second ferritin, respectively, the first ferritin would not be expected to co-assemble with the second ferritin. In some embodiments where the composition of the present disclosure comprises a first and a second polypeptide comprising a first and a second ferritin, respectively, the first ferritin does not coassemble with the second ferritin.
[0129] The ferritin may be linked directly or indirectly to the C terminal or the N terminal of an antigen. In some embodiments where a composition of the present disclosure comprises a first and a second polypeptide and where the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, the first ferritin is linked to the C terminal or N terminal of the first antigen and the second ferritin is linked to the C terminal or N terminal of the second antigen. In exemplary embodiments, the first ferritin is linked to the C terminal of the first antigen and the second ferritin is linked to the C terminal of the second antigen.
[0130] Ferritins suitable for inclusion in the compositions of the present disclosure may be derived from a mammal, an amphibian, a bacterium, a fungus, an insect, an archaea, or a plant. In some embodiments, the first ferritin and / or the second ferritin is derived from a mammal. In some embodiments, the first ferritin and / or the second ferritin is derived from an amphibian. In some embodiments, the first ferritin and / or the second ferritin is derived from a bacterium. In some embodiments, the first ferritin and / or the second ferritin is derived from a fungus. In some embodiments, the first ferritin and / or the second ferritin is derived from an insect. In some embodiments, the first ferritin and / or the second ferritin is derived from an archaea. In some embodiments, the first ferritin and / or the second ferritin is derived from a plant,
[0131] In some embodiments, the first ferritin and / or the second ferritin comprises a ferritin derived from a bacterium. Non-limiting examples of bacteria from which the first ferritin and / or the second ferritin may be derived include H. pylori, M. tuberculosis, U urealyticum, P. fur iosus, V. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coli, E. coli, and B. subtilis. In some embodiments, the first ferritin and / or the second ferritin comprises a ferritin in Table 1 below.
[0132] In some embodiments where a composition of the present disclosure comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, at least 11, or at least 12 polypeptides, wherein each of the polypeptides are not the same and wherein each polypeptide comprises an antigen and a ferritin, wherein each of the ferritins are not the same, each ferritin does not co-assemble with another ferritin that is not the same. In some embodiments where a composition of the present disclosure comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, at least 11, or at least 12 polypeptides, wherein each of the polypeptides are not the same and wherein each polypeptide comprises an antigen and a ferritin, wherein each of the ferritins are not the same, each respective ferritin is linked to the C terminal or N terminal of each respective antigen in each polypeptide. In exemplary embodiments, each respective ferritin is linked to the C terminal of each respective antigen.
[0133] In some embodiments, the ferritin is derived from a mammal. In some embodiments, the ferritin is derived from an amphibian. In some embodiments, the ferritin is derived from a bacterium. In some embodiments, the ferritin is derived from a fungus. In some embodiments, the ferritin is derived from an insect. In some embodiments, the ferritin is derived from an archaea. In some embodiments, the ferritin is derived from a plant.
[0134] In some embodiments, the ferritin comprises a ferritin derived from a bacterium. Nonlimiting examples of bacteria from which the first ferritin and / or the second ferritin may be derived include H. pylori, M. tuberculosis, U urealyticum, P. furiosus, V. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coll, E. coli, andB. subtilis. In some embodiments, the ferritin comprises a ferritin in Table I below.
[0135] Exemplary amino acid sequences of bacterial ferritins are provided in Table 1 below. Table 1: Exemplary ferritin sequences
[0136] In some embodiments of the compositions described herein, the first ferritin or the second ferritin comprises the amino acid sequence of any one of SEQ ID NOs. 1-13 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.
[0137] In some embodiments, the first ferritin or the second ferritin is derived from H. pylori, A / . tuberculosis, U. urealyticum, P. furiosus, V. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coli, E. coli, or B. subtilis. In some embodiments, the first ferritin or the second ferritin is derived from H. pylori, U urealycitum, E. coli, M. tuberculosis, P. furiosus, C. tepidum, or P cholera. In some embodiments, the first ferritin or the second ferritin is derived from E. coli, H. pylori, or P. furiosus. In some embodiments, the first ferritin or the second ferritin is derived from E. coli. In some embodiments, the first ferritin or the second ferritin is derived from H. pylori. In some embodiments, the first ferritin or the second ferritin is derived from P. furiosus.
[0138] In some embodiments, the first ferritin or the second ferritin comprises a H. pylori, M. tuberculosis, U urealyticum, P. furiosus, P. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coli, E. coli, or B. subtilis ferritin. In some embodiments, the first ferritin or the second ferritin comprises a H. pylori, U urealycitum, E. coli, M. tuberculosis, P. furiosus, C. tepidum, or V. cholera ferritin. In some embodiments, the first ferritin or the second ferritin comprises an E. coli, H. pylori, or P. furiosus ferritin. In some embodiments, the first ferritin or the second ferritin comprises an E. coli ferritin. In some embodiments, the first ferritin or the second ferritin comprises a H. pylori ferritin. In some embodiments, the first ferritin or the second ferritin comprises a P. furiosus ferritin.
[0139] In some embodiments, the first ferritin or the second ferritin is derived from an amphibian. In certain embodiments, the amphibian is a bullfrog. The first ferritin or the second ferritin may also comprise a hybrid bullfrog ferritin. In some embodiments, the first ferritin or the second ferritin comprises a hybrid bullfrog ferritin. As used herein, a “hybrid bullfrog ferritin” comprises (i) a bullfrog ferritin or a portion thereof and (ii) a ferritin derived from a bacterium, a mammal, a fungus, an insect, an archaea, or a plant.
[0140] In some embodiments, the first ferritin or the second ferritin comprises a hybrid bullfrog ferritin comprising (i) a bullfrog ferritin or a portion thereof and (ii) a ferritin derived from a bacterium. For example, a hybrid bullfrog ferritin may comprise a bullfrog ferritin and a ferritinderived from E. coli or H. pylori, referred to as a hybrid bullfrog-E. Colt ferritin or a hybrid bullfrog- / / , pylori ferritin, respectively. In some embodiments, the first ferritin or the second ferritin comprises a hybrid bullfrog-E. coli ferritin. In some embodiments, the first ferritin or the second ferritin comprises a hybrid bullfrog- / / , pylori ferritin. In exemplary embodiments, the hybrid bullfrog-H. pylori ferritin comprises the amino acid sequence of SEQ ID NO: 2 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In exemplary embodiments, the hybrid bullfrog-E. coli ferritin comprises the amino acid sequence of SEQ ID NO: 13 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.
[0141] In some embodiments of the compositions described herein, a ferritin of any one of the polypeptides comprises the amino acid sequence of any one of SEQ ID NOs: 1-13 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.
[0142] In some embodiments, a ferritin of any one of the polypeptides is derived from H. pylori, M. tuberculosis, U urealyticum, P. furiosus, V. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coli, E. coli, or B. subtilis. In some embodiments, a ferritin of any one of the polypeptides i s derived from H. pylori, U urealycitum, E. coli, M. tuberculosis, P. furiosus, C. tepidum, or V cholera. In some embodiments, a ferritin of any one of the polypeptides is derived from E. coli, H. pylori, or P. furiosus. In some embodiments, a ferritin of any one of the polypeptides is derived from E. coli. In some embodiments, a ferritin of any one of the polypeptides is derived from H. pylori. In some embodiments, a ferritin of any one of the polypeptides is derived from P. furiosus.
[0143] In some embodiments, a ferritin of any one of the polypeptides comprises a H. pylori, M. tuberculosis, U. urealyticum, P. furiosus, V. cholerae, C. tepidum, H. cetorum, H. vulpis, C. coli, E. coli, or B. subtilis ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises a H. pylori, U. urealycitum, E. coli, M. tuberculosis, P. furiosus, ('. tepidum, or I cholera ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises a E. coli, PI. pylori, or P. furiosus ferritin. In some embodiments, a ferritin of any one of thepolypeptides comprises a E. coli ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises a H. pylori ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises P. furiosus ferritin.
[0144] In some embodiments, a ferritin of any one of the polypeptides is derived from an amphibian. In certain embodiments, the amphibian is a bullfrog. A ferritin of any one of the polypeptides may also comprise a hybrid bullfrog ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises a hybrid bullfrog ferritin. As used herein, a “hybrid bullfrog ferritin” comprises (i) a bullfrog ferritin or a portion thereof and (ii) a ferritin derived from a bacterium, a mammal, a fungus, an insect, an archaea, or a plant.
[0145] In some embodiments, a ferritin of any one of the polypeptides comprises a hybrid bullfrog ferritin comprising (i) a bullfrog ferritin or a portion thereof and (ii) a ferritin derived from a bacterium. For example, a hybrid bullfrog ferritin may comprise a bullfrog ferritin and a ferritin derived from E. coli or H. pylori, referred to as a hybrid bullfrog-E. Coli ferritin or a hybrid bullfrog-7 / . pylori ferritin, respectively. In some embodiments, a ferritin of any one of the polypeptides comprise a hybrid bullfrog-E. coli ferritin. In some embodiments, a ferritin of any one of the polypeptides comprises a hybrid bullfrog-77, pylori ferritin. In exemplary embodiments, the hybrid bullfrog-H. pylori ferritin comprises the amino acid sequence of SEQ ID NO: 2 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In exemplary embodiments, the hybrid bullfrog-E. coli ferritin comprises the amino acid sequence of SEQ ID NO: 13 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.
[0146] Variations can be made in the amino acid sequence of a ferritin or hybrid ferritin without affecting its ability to self-assemble into an oligomer or a nanoparticle. Such variations include, but are not limited to, insertion of amino acid residues, deletions of amino acid residues, or substitutions of amino acid residues. For example, the sequence of a monomeric ferritin subunit can be derived from a mammalian ferritin amino acid sequence, and the sequence may be modified to be divergent enough from the naturally occurring sequence such that, when administered to a mammalian subject of the species from which the mammalian ferritin amino acid sequence wasderived, it does not result in the production of antibodies that react with the natural ferritin protein of the mammal.
[0147] Additionally, a portion of a sequence of a ferritin may be sufficient for directing selfassembly of ferritin monomers into ferritin nanoparticles. For example, a portion of H. pylori ferritin, located between amino acids 5-168 of the amino acid sequence of H. pylori ferritin of SEQ ID NO: 1, can direct self-assembly into nanoparticles. The amino acid sequence of a ferritin may also comprise artificial glycosylation sites, such as artificial N-glycosylation sites, which are engineered by inserting artificial mutations into a ferritin amino acid sequence to create a consensus glycosylation sequence. For example, an artificial N-glycosylation site may be created by introducing a consensus sequence N-X-S / T in a ferritin amino acid sequence, wherein X is any amino acid residue except for proline (P). A consensus glycosylation sequence can be created by artificial substitutions of amino acid residues in a ferritin amino acid sequence. For example, an artificial N-glycosylation site can be created by introducing two amino acid substitutions in a ferritin amino acid sequence: K to N at a position corresponding to position 75 of SEQ ID NO: 1, and E to T at a position corresponding to position 75 of SEQ ID NO:1. In another example, an artificial N-glycosylation site can be created by introducing two amino acid substitutions: T to N at a position corresponding to position 67 of SEQ ID NO: 1 and I to T at a position corresponding to position 69 of SEQ ID NO: 1. In yet another example, an artificial N-glycosylation site can be created by introducing two amino acid substitutions: H to N at a position corresponding to position 74 of SEQ ID NO: 1 and F to T at a position corresponding to position 76 of SEQ ID NO: 1. In one more example, an artificial N-glycosylation site can be created by introducing two amino acid substitutions: E to N at a position corresponding to position 143 of SEQ ID NO:1 and H to T at a position corresponding to position 145 of SEQ ID NO: 1.
[0148] In some embodiments of the compositions described herein, the amino acid sequence of the first ferritin or the second ferritin comprises one or more deletions or substitutions, wherein the one or more deletions or substitutions are expected to eliminate a glycosylation site and / or allow for more efficient production. For example, the N at a position corresponding to position 9 of SEQ ID NO: 1 may be substituted for a Q. In some embodiments, the N at a position corresponding to position 9 of SEQ ID NO: 1 is substituted for an Q. In some embodiments, the K at a position corresponding to position 131 of SEQ ID NO: 1 is substituted for an N.Antigens
[0149] Generally, suitable antigens for inclusion in the compositions described herein are derived from soluble proteins or proteins with single-pass transmembrane domains, more specifically single-pass domains that are homotrimers. However, antigens may also be derived from portions of proteins that have multi-pass transmembrane domains. Antigens suitable for inclusion in the compositions described herein may be derived from any source, for example from a pathogen (e.g. a viral pathogen, or a bacterial pathogen) or from a tumor (e.g. tumor associated antigen or a tumor specific antigen). Non-limiting examples of pathogens include a bacterial pathogen, a viral pathogen, a fungal pathogen, a protozoan pathogen, and a unicellular or a multi-cellular parasitic pathogen.
[0150] In some embodiments, the antigen is derived from a virus. Exemplary viruses include, but are not limited to Epstein-Barr virus (EBV), respiratory syncytial virus (RSV), hepatitis B virus (HBV), hepatitis C virus (HCV), Dengue virus DENV), herpes simplex virus (HSV; e.g., HSV-I, HSV-II), molluscum contagiosum virus, vaccinia virus, variola virus, lentivirus, human immunodeficiency virus (HIV), human papilloma virus (HPV), cytomegalovirus (CMV), varicella zoster virus (VZV), rhinovirus, enterovirus, adenovirus, coronavirus (e.g., SARS-CoV and MERS-CoV), influenza vims (flu), para-influenza vims, papovavirus, hepadnavims, flavivims, retrovirus, arenavims (e.g., Lymphocytic Choriomeningitis Vims, Junin vims, Machupo vims, Guanarito vims, or Lassa vims), norovirus, yellow fever vims, rabies vims, Filovims (e.g., Ebola vims or marbug virus), hepatitis A virus, Morbillivimses (e.g., measles vims), Rubulaviruses (e.g., mumps vims), Rubivimses (e.g., rubella vims), and bovine viral diarrhea vims.
[0151] In some embodiments of the compositions described herein, the first antigen or the second antigen is EBV glycoprotein gB, gH, gL, gp350, gp42, or BMRF-2 In some embodiments, the first antigen or the second antigen is the spike protein of MERS-CoV or SARS-CoV. In some embodiments, the first antigen or the second antigen is RSV-F antigen. In some embodiments, the first antigen or the second antigen is a portion of a flavivims protein E, M, NS1, NS2A, NS2B, NS3, NS4A, NS4B or NS5. For simplicity, homo-trimeric proteins are often incorporated onto ferritin proteins, but other geometries can also be incorporated.
[0152] In some embodiments of the compositions described herein, the first antigen or the second antigen is derived from a parasite. In some embodiments, the first antigen or the second antigen isderived from a species from within the Plasmodium genus, such as P. falciparum, P. vivax, P. malar iae or P. ovale.
[0153] In some embodiments, the first antigen or the second antigen is derived from a bacterial pathogen. Non-limiting examples of bacterial pathogens include Neisser ia spp, including N. gonorrhea and N meningitides; Streptococcus spp, including S. pneumoniae, S. pyogenes, S. agalactiae, and S. mutans; Haemophilus spp, including H. influenzae type B, non typeable H. influenzae, and H. ducreyi; Moraxella spp, including M. catarrhalis, also known as Branhamella catarrhalis; Bordetella spp, including B. pertussis, B. parapertussis and B. bronchiseptica; Mycobacterium spp,, including M. tuberculosis, M. bovis, M. leprae, M. avium, M. paratuberculosis, and M. smegmatis; Legionella spp, including L. pneumophila; Escherichia spp, including enterotoxic E. coli, enterohemorragic E. coli, and enteropathogenic E. coli; Vibrio spp, including V cholera, Shigella spp, including S. sonnei, S. dysenteriae, and S. flexnerii; Yersinia spp, including Y. enterocolitica, Y. pestis, and Y. pseudotuberculosis, Campylobacter spp, including C. jejuni and C. coli; Salmonella spp, including S. typhi, S. paratyphi, S. choleraesuis, and 5. enteritidis; Listeria spp., including L. monocytogenes; Helicobacter spp, including H pylori; Pseudomonas spp, including P. aeruginosa, Staphylococcus spp., including S. aureus and S. epidermidis; Enterococcus spp., including E. faecalis and E. faecium; Clostridium spp., including C. tetani, C. botulinum, and C. difficile; Bacillus spp., including B. anthracis; Corynebacterium spp., including C. diphtheriae; Borrelia spp., including B. burgdorferi, B. garinii, B. afzelii, B. andersonii, and B. hermsii; Ehrlichia spp., including E. equi and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis, C. neumoniae, and C. psittaci; Leptospira spp., including L. interrogans; and Treponema spp., including T. pallidum, T. denticola, and T. hyodysenteriae. In some embodiments, the antigen is all of or a portion of the C. trachomatis proteins M0MP or CPAF.
[0154] In some embodiments, the first antigen or the second antigen is derived from a fungal pathogen. Non-limiting examples of fungal pathogens include Aspergillus fumigatus, A.flavus, A. niger, A. terreus, A. nidulans, Coccidioides immitis, Coccidioides posadasii, Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, and Pneumocystis jirovecii.
[0155] In some embodiments, the first antigen or the second antigen is derived from a protozoan pathogen. Non-limiting examples of protozoan pathogens include Toxoplasma gondii and Strongyloides ster cor alls.
[0156] In some embodiments, the first antigen or the second antigen is derived from a multicellular parasitic pathogen. Non-limiting examples of multicellular parasitic pathogens include trematodes (flukes), cestodes (tapeworms), nematodes (roundworms), and arthropods.
[0157] In some embodiments, the first antigen or the second antigen is derived from a tumor antigen selected from: (a) cancer-testis antigens such as NY-ESO-1, SSX2, SCP1 as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, in treating melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (b) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUM1 (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLR-FUT; (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT 1 (associated with, e.g., various leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-1 (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (d) shared antigens, for example, melanoma melanocyte differentiation antigens such as MART-l / Melan A, gpIOO, MC1R, melanocyte stimulating hormone receptor, tyrosinase, tyrosinase related protein- 1 / TRPl and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate associated antigens such as PAP, PSA, PSMA, PSH-P1, PSM-P1, PSM-P2, associated with e.g., prostate cancer; (f) immunoglobulin idiotypes (associated with myeloma and B ceil lymphomas, for example). Incertain embodiments, tumor antigens include, but are not limited to, pl5, Hom / Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic vims antigens, TSP-180, pl85erbB2, p!80erbB-3, c-met, mn-23Hl, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, pl 6, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV! 8, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, and the like.
[0158] Antigens suitable for inclusion in the compositions described herein may also be derived from a normal cell. In some embodiments of the compositions described herein, the first and antigen or the second antigen is an autoantigen derived from a normal cell. Allergens may also be suitable antigens. Examples of allergens include, but are not limited to, proteins from pollen, mites, pet dander, nuts, fish, shellfish, dairy products, soy products, or other food sources.
[0159] The antigens in the compositions described herein may be a wild type antigen or a modified antigen comprising at least one modification relative to a wild type antigen. In some embodiments of the compositions described herein where the compositions comprise a first and a second polypeptide and where the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, the first antigen or the second antigen comprises at least one modification relative to a wild type antigen. In some embodiments, the at least one modification comprises a deletion, an insertion, or a substitution of at least one amino acid.Deletion
[0160] In some embodiments, the at least one modification to the first antigen or the second antigen comprises a deletion relative to a wild type antigen. In some embodiments, the deletion comprises deletion of at least one amino acid residue at the C-terminal, N-terminal, and / or a middle portion of the antigen relative to the wild type glycoprotein. In some embodiments, the deletion comprises deletion of at least 2 consecutive amino acid residues or at least 2 non -consecutive amino acid residues. In some embodiments, the deletion comprises deletion of at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125, at least 150, at least 175, or at least 200 consecutive amino acids. Insome embodiments, the deletion comprises a truncation, where at least one amino acid is deleted from the N-terminal or C-terminal of the glycoprotein.Substitution
[0161] In some embodiments, the at least one modification to the first antigen or the second antigen comprises an amino acid substitution relative to a wild type antigen. In some embodiments, the substitution comprises substitution of at least one amino acid residue at the C-terminal, N-terminal, and / or a middle portion of the antigen relative to the wild type antigen. In some embodiments, the substitution comprises substitution of at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125, at least 150, at least 175, or at least 200 amino acids.Insertion
[0162] In some embodiments, the at least one modification to the first antigen or the second antigen comprises an amino acid insertion relative to a wild type antigen. The insertion may occur at the C terminal, N terminal, or in the middle relative to a wiki type antigen. In some embodiments, the insertion comprises insertion of a cleavage site such as a furin cleavage site, a ribosomal skip site, an internal ribosomal entry' site, a trimerization domain, or a signal peptide, or a combination thereof.Cleavage sites
[0163] In some embodiments, the insertion comprises insertion of a cleavage site relative to a wild type antigen. In specific embodiments, the cleavage site is a furin cleavage site, also referred to as “furin site” herein. The furin cleavage site is a motif recognized by the protease furin. In general, the furin cleavage site occurs after a basic amino acid. In some embodiments, the furin cleavage occurs after a basic acid amino, such as arginine (R) or Lysine (K). In some embodiments, the furin cleavage site motif is R-X-K / R-R. Exemplary sequences for furin cleavage sites are provided in Table 2A below. In some embodiments, the furin cleavage site comprises the amino acid sequence of SEQ ID NO: 15-20 or a sequence with at least 75% sequence identity thereto.Ribosomal skip site
[0164] In some embodiments of the compositions described herein where the antigen comprises an amino acid insertion, the insertion comprises insertion of a ribosomal skip site. Use of a ribosomal skip site allows for encoding multiple antigens in a single chain polypeptide. In someembodiments, the ribosomal skip site comprises a 2A peptide, also referred to as a 2A site. The 2A site can either allow for ribosomal read through, generating a full-length polypeptide, or cause the ribosome to pause during translation, generating two shorter polypeptides. In specific embodiments, the 2A peptide is derived from foot-and-mouth disease virus, equine rhinitis virus, porcine teschovirus-1, or Thosea asigna virus. The 2A peptide derived from foot-and-mouth disease virus is referred to as F2A. The 2A peptide derived from equine rhinitis A virus is referred to as E2A. The 2A peptide derived from porcine teschovirus-1 is referred to as P2A, and the 2A peptide derived from Thosea asigna virus is referred to as T2A. In some embodiments, a GSG linker sequence is added to the 2A peptide. The linker may enhance the cleavage efficiency at the 2A site. Exemplary 2A peptide sequences are provided in Table 2B below. In some embodiments, the 2A peptide comprises the amino acid sequence of any one of SEQ ID NOs: 36-39 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. Without being held to theory, using 2A peptides may allow for increased control of the ratio at which the two shorter polypeptides are expressed during a skip event.Signal peptide (SP)
[0165] In some embodiments of the compositions described herein where the antigen comprises an amino acid insertion, the insertion comprises insertion of a signal peptide. In some embodiments, the signal peptide is a peptide segment of about 10 to 40 amino acids. When fused to the amino acid sequence of the antigen described herein, the signal peptide is capable of targeting the polypeptide comprising the antigen to an organelle, to the plasma membrane, or for secretion from a cell. In some embodiments, the signal peptide targets the polypeptide to the endoplasmic reticulum (ER). Exemplary signal peptide sequences are provided in Table 2C below. In some embodiments, the signal peptide comprises the amino acid sequence of any one of SEQ ID NO: 40-47 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.Trimerization domains
[0166] In many cases the ferritin protein acts as a trimerization domain, and therefore an additional trimerization domain is not required. However, in some cases, a trimerization domain may be important, in some embodiments of the compositions described herein where the antigencomprises an amino acid insertion, the insertion comprises insertion of a trimerization domain. For antigens that exist as trimers, insertion of a trimerization domain may stabilize the trimeric structure of the antigen, thereby improving its antigenicity or immunogenicity. An exemplary’ trimerization domain sequence is provided in Table 2D. In some embodiments, the trimerization domain comprises the amino acid sequence of SEQ ID NO: 70 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.Table 2 A: Exemplar)' Furin site sequencesTable 2B: Exemplary 2A peptides (ribosomal skip sites)Table 2C: Exemplary signal peptide (SP) sequencesTable 2D: Exemplary trimerization domain sequencesLinkers
[0167] In some embodiments, the polypeptides, or polynucleotides encoding the same, in the compositions described herein comprise a linker. A linker may be used, for example, to fuse an antigen to the ferritin or to facilitate insertion of a ribosomal skip site, or a combination thereof. A linker may be employed, for instance, to ensure that an antigen is positioned to ensure proper folding and formation of the antigen or to block or expose particular epitopes. In some embodiments, the linker is a peptide linker or an oligonucleotide linker.
[0168] In some embodiments, the linker is a peptide linker. In some embodiments, a peptide linker comprises or consists of a Gly-Ser linker. As used herein, the term “Gly-Ser linker” refers to a peptide that consists of glycine and serine residues. An exemplary Gly-Ser linker comprises an amino acid sequence of the formula (Glv4Ser)n, wherein n is a positive integer (e.g., 1, 2, 3, 4, or 5) (SEQ ID NO: 25). In certain embodiments the Gly-Ser linker is (Gly4Ser)i. In certain embodiments the Gly-Ser linker is (Gly4Ser)2. In certain embodiments the Gly-Ser linker is (Gly4Ser)3. In certain embodiments the Gly-Ser linker is (Gly4Ser). In certain embodiments the Gly-Ser linker is (Gly4Ser)s. In certain embodiments, the Gly-Ser linker may be inserted between two other sequences described herein. In other embodiments, a Gly-Ser linker is attached at one or both ends of another sequence. In yet other embodiments, two or more Gly-Ser linker are incorporated in series in a peptide linker. Other linkers that are suitable for use in any ofpolypeptides described herein are known in the art, for example, the serine-rich linkers disclosed in U. S. Pat. No, 5,525,491, the helix forming peptide linkers (e.g., A(EAAAK)nA (n::::2-5)) disclosed in Arai et al., Protein Eng 2001; 14:529-32, and the stable linkers disclosed in Chen et al,, Mol Pharm 2011; 8:457-65, i.e., the dipeptide linker LE, a thrombin-sensitive disulfide cyclopeptide linker, and the alpha-helix forming linker LEA(EAAAK)4ALEA(EAAAK)4ALE. Other exemplary linkers include GS linkers (i.e., (GS)n), GGSG linkers (i.e., (GGSG)n), GSAT linkers, SEG linkers, and GGS linkers (i.e., (GGSGGS)n), wherein n is a positive integer (e.g., 1, 2, 3, 4, or 5).
[0169] In some embodiments, the linker may be a non-cleavable linker or a cleavable linker. A non-cleavable linker may include an amide bond or phosphate bond, and the cleavable linker may include a disulfide bond, acid-cleavable linkage, ester bond, anhydride bond, biodegradable bond, or enzyme-cleavable linkage.
[0170] Peptide linkers of the invention are at least one amino acid in length and can be of varying lengths. In some embodiments, a peptide linker is from about 1 to about 50 amino acids in length, including a length of from 1 to 48-52 amino acids in length, from about 1-5 amino acids in length, from about 5-10 amino acids in length, from about 10-20 amino acids in length, or from about 15 to about 50 amino acids in length. In some embodiments, the peptide linker is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more amino acids in length.Polynucleotides
[0171] Also disclosed herein are compositions comprising polynucleotides that encode polypeptides comprising an antigen and a ferritin, the ferritin nanoparticles. In some embodiments, the polynucleotide is or comprises DNA. In some embodiments, the polynucleotide is or comprises RNA, In some embodiments, the RNA is non-replicating mRNA or virally derived, self-amplifying RNA, trans-amplifying RNA, and / or circular RNA. In some specific embodiments, the RNA is non-replicating mRNA. In specific embodiments, the RNA is virally derived, self-amplifying RNA which encodes not only the polypeptides described herein but also viral replication machinery that enables intracellular RNA amplification. In some embodiments, the polynucleotides of the present disclosure comprise an Internal Ribosomal Entry Site (IRES) sequence. An exemplar}' IRES sequence is provided below:
[0172] CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAG GCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGT GAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCC TCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGA AGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCC CACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCA AAGGCGGCACAACCCCAGTGCC ACGTTGTGAGT TGGATAGTTTGTGGAAAGAGTCAA ATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCC ATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGA GGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAA ACACGATGATAATATGGCCACAACC (SEQ ID NO: 48)
[0173] In some embodiment, the IRES sequence comprises the amino acid sequence of SEQ ID NO: 48 or a sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.
[0174] In some embodiments, the polynucleotides of the present disclosure comprise a promoter. In some embodiments, the promoter comprises a ubiquitous promoter, an inducible promoter, a tissue-specific promoter and / or a lineage-specific promoter. In some embodiments, the ubiquitous promoter is selected from the group consisting of: a viral simian virus 40 (SV40) (e.g., early or late), a Rous sarcoma virus (RSV) LTR, an RSV promoter, a cytomegalovirus (CMV) immediate early promoter, a CMV promoter, a Moloney murine leukemia vims (MoMLV) LTR promoter, a herpes simplex virus (HSV) (thymidine kinase) promoter, HS, P7. S, and Pl 1 promoters from vaccinia virus, an elongation factor I-alpha (EFla) promoter, early growth response 1 (EGR1), ferritin H (FerH), ferritin L (FerL), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF4A1), heat shock 70 kDa protein S (HSP AS), heat shock protein 90 kDa beta, member I (HSP90B 1 ), heat shock protein 70 kDa (HSP70), P-kinesin (P-KIN), the human ROSA 26 locus, a Ubiquitin C promoter (UBC), a phosphoglycerate kinase-I (PGK) promoter, 3 -phosphoglycerate kinase promoter, a cytomegalovirus enhancer, human P-actin (HBA) promoter, chicken P-actin (CBA) promoter, a CAG promoter, a CASI promoter, a CBH promoter, or any combination thereof.
[0175] In some embodiments, the polynucleotide of the present disclosure comprises a poly-A tails. Inclusion of a 3’ poly(A) tail in an mRNA sequence can contribute to the stability andtranslation efficiency of the mRNA. Generally, longer poly(A) tails are associated with increased mRNA stability, thereby allowing their translation and promoting high protein expression.
[0176] In some embodiments, where the polynucleotides of the present disclosure comprise mRNA, the mRNA comprises a poly(A) sequence having at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 185, or at least about 190 adenine nucleotides. In some embodiments, the mRNA comprises a 5' untranslated region (UTR), a 3' UTR, and / or a cap. The nucleoside sequence in an mRNA molecule provides instructions that cells use to create specific proteins. mRNA is a molecule that typically is composed of four different nucleosides: adenosine, guanosine, cytidine, and uridine. Vaccines containing mRNA can trigger the body ’ s own immune system to attack the mRNA molecule. This immune response may destroy the mRNA before it can have its intended effect. Different modifications to the mRNA molecule have been developed to disguise the mRNA from the body’s immune system, such as those described in U. S. Patent No. 10,898,574, U. S. Patent No. 10,703,789, U. S. Patent No. 10,577,403, and U. S. Patent No. 10, 064,959, the contents of which are herein incorporated by reference in their entirety. In some embodiments, where the polynucleotides of the present disclosure comprise mRNA, the mRNA comprises one or more modified nucleotides selected from the group consisting of: pseudouridine, N-l-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl -cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,0(6)-methylguanine, and 2-thiocytidine. In some embodiments, the mRNA comprises a modified nucleotide in place of one or more uridines. In some embodiments, the modified nucleoside is selected from pseudouridine (\|i), N 1-methyl-pseudouridine (m lq / ), and 5-methyl-uridine(m5U). In some embodiments, the mRNA comprises a modified nucleotide in place of one or more uridines. In some embodiments where the polynucleotides comprise mRNA, the mRNA may be formulated in a lipid nanoparticle (LNP). In some embodiments, the mRNA may be complexed or associated with one or more lipids or lipid-based carriers, thereby forming liposomes, lipid nanoparticles (LNPs), lipoplexes, and / or nanoliposomes, optionally encapsulating mRNA.
[0177] In some embodiments, where the polynucleotide of the present disclosure is mRNA, the mRNA molecule is synthesized through in vitro transcription of a corresponding DNA template molecule. For example, synthetic mRNA can be produced by in vitro transcription of a cDNA template, such as plasmid DNA (pDNA).Vectors
[0178] Also disclosed herein are vectors comprising the polynucleotide described herein. In some embodiments, the vector is a non-viral vector. Examples of non-viral vectors include, but are not limited to, a plasmid, a transposable element, a naked DNA vector, a lipid nanoparticle (LNP), or any combination thereof. In an exemplary embodiment, the vector is an LNP comprising an mRNA polynucleotide. Generally, LNP has four components: ionizable cationic lipids, phospholipids, cholesterol, and PEG lipids. Each component contributes to LNP stability, transfection efficacy, and safety.
[0179] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adenovirus, an Adeno-associated virus (AAV), a vesiculovirus, a retrovirus, a herpesvirus, or a vaccinia virus. In some embodiments, the viral vector is an adenovirus. In specific embodiments, the adenovirus is a human adenovirus selected from the group consisting of Adenovirus 3, Adenovirus 5, Adenovirus 26, Adenovirus 35, and Adenovirus 48. In some embodiments, the viral vector is a non-human adenovirus. In specific embodiments, the non-human adenovirus is a primate-derived adenovirus, such as a chimpanzee adenovirus. In some embodiments, the viral vector is a vesiculovirus such as Vesicular Stomatitis Vims (VSV). In some embodiments, the viral vector is a retrovirus. In specific embodiments, the retrovirus is a lentivirus. In some embodiments, the viral vector is a herpesvirus such as cytomegalovirus (CMV). In some embodiments, the viral vector is a vaccinia virus such as modified vaccinia Ankara (MV A).
[0180] In some embodiments, the polynucleotides and vectors of the present disclosure may be administered to a subject as part of a vaccine composition to prevent or treat a disease or disorder, as will be described in more detail herein.Vaccine Compositions
[0181] The compositions disclosed herein, including the polynucleotides and vectors described herein, are intended to be used as vaccines. In certain embodiments, the compositions are deliveredas mRNA vaccines. When delivered to a cell, the ferritins self-assemble into ferritin nanoparticles presenting antigen described herein.
[0182] In some embodiments, the compositions, polynucleotides, and vectors described herein for use as a vaccine comprise at least one adjuvant.
[0183] The compositions, polynucleotides, and vectors described herein for use as a vaccine may comprise one or more pharmaceutically acceptable carrier, excipient, or diluent. Non-limiting examples of suitable carriers, excipients, and diluents include a buffer agent, an osmotic agent, or a stabilizer. In some embodiments, the buffer agent comprises Tris-HCl, Trizma Base, phosphate buffered saline, or the like. In some embodiments, the osmotic agent comprises NaCl or the like. In some embodiments, the stabilizer comprises sucrose, lactose, glycine, glutamic acid, potassium, sodium, human serum albumin, gelatin, or the like,
[0184] The compositions, polynucleotides, and vectors described herein for use as a vaccine may be generated within a range of unit doses. The dose may be provided as a single dose or may be provided as multiple doses, for example 2, 3 or 4 doses. Typically polypeptides or polynucleotides are administered in the range of 1 pg to 1 mg, more typically 1 pg to 10 pg for nanoparticle mediated delivery.
[0185] The compositions, polynucleotides, and vectors described herein for use as a vaccine may offer broad protection against infection by a pathogen or may induce an immune response against tumor cells. The compositions may reduce the severity of one or more symptoms of cancer or an infection by a pathogen.Methods
[0186] Disclosed herein is a method of delivering to a cell a ferritin nanoparticle (FNP)-based nucleic acid vaccine, comprising contacting the cell with a composition of the disclosure, a polynucleotide of the disclosure, or a vector of the disclosure.
[0187] Also disclosed herein is a composition of the disclosure, a polynucleotide of the disclosure, or a vector of the disclosure for use in the treatment or prevention of a disease or disorder. Also disclosed herein is a use of a composition of the disclosure, a polynucleotide of the disclosure, or a vector of the disclosure for the manufacture of a medicament for treatment of a disease or disorder. In some embodiments, the use comprises treatment or prevention of a disease or disorder in a subject.
[0188] In some embodiments, the disease or disorder is a flavivirus infection, an EBV infection, a MERS-CoV infection, a SARS-CoV infection, a poxvirus infection, an influenza infection, or another viral infection. In some embodiments, the disease or disorder is a bacterial infection. In some embodiments, the disease or disorder is a chlamydia infection. In some embodiments, the disease or disorder is cancer.
[0189] Also disclosed herein are methods of inducing neutralizing antibodies, preventing an infection by a pathogen, and treating an infection or cancer in a subject in need thereof. In some embodiments, the subject has a viral infection or is at risk of a viral infection. In some embodiments, the subject has or is at risk of a flavivirus infection, an EBV infection, a MERS-CoV infection, a SARS-CoV infection, a poxvirus infection, an influenza infection, or another viral infection. In some embodiments, the subject has a bacterial infection or is at risk of a bacterial infection. In some embodiments, the subject has or is at risk of a chlamydia infection. In some embodiments, the subject has a tumor or a cancer, or is at risk of developing cancer. In some embodiments, the methods described herein reduces the severity of a symptom of viral infection or a disease associated with cancer. In some embodiments, the methods comprise administering to the subject in need thereof an effective amount of the composition, polynucleotide, or vector described herein, where the antigens in the compositions are associated with a disease or disorder that the subject has or is at risk of having.
[0190] In some embodiments, the method comprises administering to the subject in need thereof at least a first dose of an effective amount of any one of the compositions, polynucleotides, or vectors, of the disclosure.
[0191] In some embodiments, the administration is in the context of vaccination, and used for the prevention of an infection by a pathogen. In some embodiments, the administration is in the context of treatment and used for the mitigation of an already existing infection and facilitates antibody-mediated clearance of the infection. In some embodiments, the administration is in the context for treatment and used to reduce the severity of a symptom of an infection or a cancer and may facilitate killing of infected cells or tumor cells,
[0192] In some embodiments, the methods described herein comprises administering to the subject at least two doses of an effective amount of the compositions, polynucleotides, or vectors described herein. In some embodiments, the methods comprise administering 2, 3, 4, or 5 doses.
[0193] In some embodiments, the second dose is administered to the subject at a first time point after the administration of the first dose. For example, in some embodiments, the second dose is administered to the subject at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 12 months, at least 18 months, or at least 24 months after administration of the first dose. In some embodiments, additional subsequent doses are administered to the subject at any time point after the first dose or the second dose. For example, the second dose may be administered to a subject about 4 months after the first dose, and a third dose may be administered to the subject about 4 months after the second dose. In some embodiments, subsequent doses of may be administered to the subject at regular intervals (e.g., about once every 4 months, once every 6 months, once every 12 months, or once every 18 or 24 months or the like).
[0194] In some embodiments, the second or subsequent doses are administered to the subject using the same route of administration as the first dose administered to the subject or using a different route of administration as the first dose administered to the subject. For example, the first dose may be administered to the subject intramuscularly and the second dose may be administered to the subject intravenously.
[0195] The route of administration may be selected from any known method suitable for the treatment. Suitable routes of administration include, but are not limited to, intramuscular, intradermal, subcutaneous, intravenous, intraperitoneal injections. In some embodiments, the route of administration is intramuscular. In some embodiments, the route of administration is intravenous. In some embodiments, the route of administration is subcutaneous. In some embodiments, the route of administration comprises injection. In some embodiments, the route of administration may use traditional syringes and needleless injection devices. For injection, the compositions described herein can be formulated in aqueous solutions, optionally in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. In some embodiments, administering comprises intraperitoneal delivery, intramuscular injection, intravenous injection, subcutaneous injection, intratumoral injection, intradermal injection, or any combination thereof.
[0196] In some embodiments, the subject is a mammal. Non-limiting examples of mammals include, a human, a non-human primate, a rodent, a dog, a cat, a rabbit, a cow, a horse, a goat, a sheep, a llama, a camel, a donkey, a bat, a deer, a bear, a squirrel, or a pig. In some embodiments,the subject is a human subject. In some embodiments, the subject in need thereof is not a human subject. In some embodiments, the subject is a bird, such as a chicken, a duck, a pheasant, a turkey, or a goose. In some embodiments, the subject is a human. In some embodiments, the subject is a child under the age of 18. In some embodiments, the subject is an adolescent. In some embodiments, the subject is pregnant. In some embodiments, the subject being treated in accordance with the methods described herein has been diagnosed with an infection or is at risk of an infection. In some embodiments, the subject has had one or more prior infections. In some embodiments, the subject has a cancer. In some embodiments, the subject is immunocompromised or immunosuppressed.
[0197] The disclosure and the embodiments described herein are further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as the Figures, are incorporated herein by reference for all purposes.EXEMPLARY EMBODIMENTS
[0198] Embodiment 1-1. A composition comprising a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0199] Embodiment 1-2. The composition of embodiment 1-1, wherein the first and / or second polynucleotides comprise DNA
[0200] Embodiment 1-3, The composition of embodiment I- 1, wherein the first and / or second polynucleotides comprise RNA.
[0201] Embodiment 1-4. The composition of embodiment 1-3, wherein the first and / or second polynucleotides comprise mRNA or self -amplifying RNA or trans-amplifying RNA or circular RNA.
[0202] Embodiment 1-5. The composition of embodiment 1-4, wherein the first and / or second polynucleotides comprise modified nucleosides.
[0203] Embodiment 1-6. The composition of any one of embodiments 1-1 to 1-5, wherein the first and / or second polynucleotides comprise an Internal Ribosomal Entry Site (IRES) sequence.
[0204] Embodiment 1-7. The composition of embodiment 1-6, wherein the IRES sequence comprises SEQ ID NO: 48 or a sequence with at least 70% sequence identity thereto.
[0205] Embodiment 1-8. A composition comprising a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0206] Embodiment 1-9. The composition of any one of embodiments I- 1 to 1-8, wherein the first ferritin is capable of self-assembling into a ferritin nanoparticle presenting the first antigen and the second ferritin is capable of self-assembling into a ferritin nanoparticle presenting the second antigen.
[0207] Embodiment I- 10. The composition of any one of embodiments I- 1 to 1-9, wherein the first ferritin and the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
[0208] Embodiment 1-11. The composition of embodiment 1-10, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian.
[0209] Embodiment 1-12. The composition of embodiment 1-11, wherein the amphibian is a bullfrog and the ferritin is a hybrid bullfrog ferritin, wherein the hybrid bullfrog ferritin comprises (i) a bullfrog ferritin or portion thereof and (ii) a ferritin derived from a bacterium.
[0210] Embodiment 1-13. The composition of embodiment 1-10, wherein the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium.
[0211] Embodiment 1-14. The composition of embodiment 1-13, wherein the bacterium is gramnegative.
[0212] Embodiment 1-15. The composition of embodiment 1-14, wherein the bacterium is H. Pylrori, P. Furiosus, C. Tepidum V. Cholera, D. desulfiiricans, H. cetorum, H. vulpis, C. co l, or E. coll.
[0213] Embodiment 1-16. The composition of embodiment 1-13, wherein the bacterium is grampositive.
[0214] Embodiment 1-17. The composition of embodiment 1-16, wherein the bacterium is U. Urealycitum, M. Tuberculosis, or B. subtilis.
[0215] Embodiment 1-18. The composition of embodiment I- 10, wherein the amino acid sequence of the first ferritin and / or the second ferritin comprises any one of SEQ ID NOs: I -13 or a sequence with at least 70% sequence identity thereto.
[0216] Embodiment 1-19. The composition of any one of embodiments 1-1 to 1-18, wherein the first antigen and / or second antigen are derived from a pathogen.
[0217] Embodiment 1-20. The composition of embodiment 1-19, wherein the pathogen is a virus.
[0218] Embodiment 1-21. The composition of embodiment 1-20, wherein the vims is a flavivirus, an adenovirus, a coronavirus, a poxvirus, parainfluenza virus, influenza vims, metapneumovirus, Epstein-Barr Virus (EBV), respiratory syncytial virus (RSV), varicella zoster vims (VZV), cytomegalovirus (CMV), or rhinovims.
[0219] Embodiment 1-22, The composition of embodiment 1-21, wherein the coronavirus is Middle East respiratory' syndrome coronavims (MERS-CoV), Severe acute respiratory syndrome-associated coronavims 1 (SARS-CoV-1), or Severe acute respiratory' syndrome-associated coronavims 2 (SARS-CoV-2).
[0220] Embodiment 1-23. The composition of embodiment 1-19, wherein the pathogen is a bacterium.
[0221] Embodiment 1-24. The composition of embodiment 1-23, wherein the bacterium is a Chlamydia spp,, Neisseria spp., or Streptococcus spp,, optionally wherein the species is C. trachomatis, C. neumoniae, C. psittaci, N gonorrhea, N meningitide,. S. pneumoniae, S. pyogenes, S. agalactiae, or 5. mutans.
[0222] Embodiment 1-25. The composition of embodiment 1-19, wherein the pathogen is a fungus.
[0223] Embodiment 1-26. The composition of any one of embodiments 1-1 to 1-18, wherein the first antigen and / or second antigen is derived from a tumor-associated or tumor-specific antigen.
[0224] Embodiment 1-27. The composition of any one of embodiments 1-1 to 1-26, wherein the first antigen and / or second antigen is a monomer or forms a trimer.
[0225] Embodiment 1-28. The composition of any one of embodiments 1-1 to 1-27, wherein first antigen and / or second the antigen comprises at least one modification relative to a wild type protein.
[0226] Embodiment 1-29. The composition of embodiment 1-28, wherein the at least one modification relative to a wildtype protein comprises a deletion, an insertion, or an amino acid substitution.
[0227] Embodiment 1-30. The composition of embodiment 1-29, wherein the at least one modification comprises an amino acid deletion,
[0228] Embodiment 1-31. The composition of embodiment 1-30, wherein the amino acid deletion comprises a truncation at the C-terminal or N-terminal relative to the amino acid sequence of a wildtype protein.
[0229] Embodiment 1-32. The composition of any one of embodiments 1-29 to 1-31, wherein the at least one modification comprises an amino acid substitution.
[0230] Embodiment 1-33. The composition of embodiment 1-32, comprising two or more consecutive amino acid substitutions.
[0231] Embodiment 1-34. The composition of embodiment 1-33, wherein the two or more consecutive amino acid substitution eliminate a furin cleavage site within the amino acid sequence of the antigen.
[0232] Embodiment 1-35. The composition of any one of embodiments 1-29 to 1-34, wherein the at least one modification comprises an amino acid insertion.
[0233] Embodiment 1-36. The composition of embodiment 1-35, wherein the amino acid insertion comprises insertion of a ribosomal skip site, a trimerization domain, a cleavage site, a signal peptide, or a combination thereof.
[0234] Embodiment 1-37. The composition of any one of embodiments 1-35 or 36, wherein the amino acid insertion comprises a signal peptide.
[0235] Embodiment 1-38. The composition of embodiment 1-37, wherein the signal sequence comprises the signal peptide from IgE, IGVH, tissue plasminogen activator (tPA), CD5, or IGKV.
[0236] Embodiment 1-39. The composition of any one of embodiments 1-35 to 1-38, wherein the amino acid insertion comprises a trimerization domain.
[0237] Embodiment 1-40. The composition of any one of embodiments 1-1 to 1-39, comprising a linker, optionally wherein the linker fuses the antigen directly or indirectly to the ferritin.
[0238] Embodiment 1-41. The composition of embodiment 1-40, wherein the linker is a flexible linker.
[0239] Embodiment 1-42. The composition of embodiment 1-40 or 1-41, wherein the linker is a peptide linker.
[0240] Embodiment 1-43. The composition of embodiment 1-42, wherein the peptide linker is a Gly-Ser linker.
[0241] Embodiment 1-44. The composition of embodiments 1-42 or 1-43, wherein the peptide linker comprises the amino acid sequence of the formula (Gly4Ser)n, wherein n is 1, 2, 3, 4, or 5.
[0242] Embodiment 1-45. The composition of any one of embodiments 1-1 to 1-7 and 1-9 to 1-44, comprising at least two polynucleotides, wherein the polynucleotides are combined with or incorporated into a vector.
[0243] Embodiment 1-46. The composition of embodiment 1-45, wherein the vector is a viral vector.
[0244] Embodiment 1-47. The composition of embodiment 1-46, wherein the viral vector is an adenovirus, an adeno-associated virus (AAV), a vesiculovirus, a retrovirus, a herpesvirus, or a vaccinia virus.
[0245] Embodiment 1-48. The composition of embodiment 1-45, wherein the vector is a non-viral vector.
[0246] Embodiment 1-49. The composition of embodiment 1-48, wherein the non-viral vector is a plasmid.
[0247] Embodiment 1-50. The composition of embodiment 1-48, wherein the non-viral vector is a lipid nanoparticle (LNP).
[0248] Embodiment 1-51. The composition of any one of embodiments 1-1 to 1-50, comprising at least one adjuvant.
[0249] Embodiment 1-52. The composition of any one of embodiments 1-1 to 1-51, comprising one or more pharmaceutically acceptable carrier, excipient, or diluent.
[0250] Embodiment 1-53. A kit comprising the composition of any one of embodiments 1-1 to I-52 and instructions for use.
[0251] Embodiment 1-54. A method of delivering to a cell a ferritin nanoparticle (FNP)-based nucleic acid vaccine, comprising contacting the cell with a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
[0252] Embodiment 1-55. The method of embodiment 1-54, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
[0253] Embodiment 1-56. The method of embodiment 1-55, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian.
[0254] Embodiment 1-57. The method of embodiment 1-56, wherein the amphibian is a bullfrog.
[0255] Embodiment 1-58. The method of embodiment 1-55, wherein the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium.
[0256] Embodiment 1-59. The method of embodiment 1-58, wherein the bacterium is gramnegative.
[0257] Embodiment 1-60. The method of embodiment 1-59, wherein the bacterium is H. pylrori, P. fur iosus, C. tepidum V. cholera, D. desulfuricans, H. cetorum, H. vulpis, C. coll, or E. coll.
[0258] Embodiment 1-61. The method of embodiment 1-58, wherein the bacterium is grampositive.
[0259] Embodiment 1-62. The method of embodiment 1-61, wherein the bacterium is U. urealycitum, M. Tuberculosis, or B. subtilis.
[0260] Embodiment 1-63. The method of any one of embodiments 1-54 to 1-62, wherein the polynucleotides comprise DNA, RNA, mRNA, or a combination thereof.
[0261] Embodiment 1-64. The method of embodiment 1-63, wherein the polynucleotides comprise mRNA.
[0262] Embodiment 1-65. A method of treating a disease or a symptom thereof in a subject having, or at risk of having the disease, comprising administering to the subject an effective amount of the composition of any one of embodiments I- 1 to 1-52.
[0263] Embodiment 1-66. A method of inducing antibodies to an antigen in a subject, comprising administering to the subject an effective amount of the composition of any one of embodiments I- 1 to 1-52, wherein the antibodies bind to the first and / or the second antigen in the composition.
[0264] Embodiment 1-67. A method for inducing an immune response against a disease or disorder in a subject, comprising administering to the subject an effective amount of the composition of any one of embodiments 1-1 to 1-52.
[0265] Embodiment 1-68. The method of any one of embodiments 1-65 to 1-67, wherein the disease is a viral infection, a bacterial infection, a fungal infection, or a cancer.
[0266] Embodiment 1-69. The method of any one of embodiments 1-65 to 1-68, wherein the subject is a mammal.
[0267] Embodiment 1-70. The method of embodiment 1-69, wherein the subject is a human.
[0268] Embodiment 1-71. The method of embodiment 1-70, wherein the subject is immunosuppressed or immunocompromised.
[0269] Embodiment 1-72. The method of any one of embodiments 1-65 to 1-71, wherein the composition is administered intramuscularly.EXAMPLESExample 1: Sequence homology of bacterial ferritins
[0270] The possibility of heterologous ferritin co-assembly is presumably lower when the amino acid sequences are less alike. Therefore, amino acid sequence alignment was performed with ferritin orthologs selected from twelve bacterial species. The amino acid sequences of the ferritinsare provided in Table 1 above. The percent sequence identity (homology) between each pair of ferritins is shown in Table 3 below. To reduce the risk o f co-assembly of ferritins derived from different bacterial species, six ferritin orthoiogs, derived from M. tuberculosis, U urealyticum, P. furiosus, V. cholerae, D. de sulfur icans, and C. tepidum, which ha d with low amino acid sequence homologies were selected for further analyses for use in the orthogonal ferritin platform. H. pyloriferritin, one of the most studied ferritins, was also selected for further analyses.Table 3: Percent sequence homology between exemplary ferritin sequencesExample 2: Purification and physical characterization of orthogonal ferritin nanoparticles Materials and MethodsOrthogonal ferritin nanoparticle expression and purification
[0271] Epstein Barr Virus (EBV) glycoproteins gB was used as a model antigen to test the orthogonal ferritin platform. Plasmids encoding EBV gB fused to a panel of ferritin subunits were transfected into ExpiCHO cells using ExpiFectamine (Gibco) CHO reagent according to manufacturer’s recommendations. Cells were transfected at a 2.5 mL scale and were grown at 5% CO2 while shaking at 250 rpm in either a 50 mL bioreactor tube or in a 24-well plate. Cells were harvested ~1 week post transfection by spinning at 7,100 xg. Ceil supernatants were filtered using a 0.22-pm filter. gB-functionalized ferritin nanoparticles were purified by flowing supernatant over a CaptoCore 700 (Cytiva) 1 mL column on a fast protein liquid chromatography (FPLC) AKTA system. Flow-through was collected, concentrated using Ami con spin concentrators, and nanoparticles were further purified on an SRT SEC- 1000 (Sepax) preparative-scale size-exclusion chromatography column. Protein-containing fractions were pooled, concentrated, and frozen at -80°C until use.Dynamic light scattering (DLS) and differential scanning fluorimetry (DSF)
[0272] gB-functionalized ferritin nanoparticles were loaded into glass capillaries and analyzed using a NanoTemper Prometheus Panta. Dynamic light scattering (DLS) analysis was used to determine the cumulant radius of the particles and differential scanning fluorimetry (DSF) was used to determine the melting temperature (Tm). Melting temperature runs were performed using a gradient of 1.0 °C per minute from 25 °C to 90 °C.Transmission electron microscopy grid preparation and imaging
[0273] Negatively stained specimens were prepared and imaged in the following manner. 3.5 microliters of sample was placed on a carbon-coated, copper, transmission EM grid that had beenglow-discharged to make it more hydrophilic. After approximately one minute, filter paper was used to remove excess solution from the grid by touching the side of the grid. This was followed by two steps of brief (approx. 1-2 seconds) wash in your buffer and blotting with filter paper in the same manner. Next, this process was repeated twice but with the negative stain solution (1% ammonium molybdate). Finally, the grid was incubated for 15-20 seconds in a droplet of 1% ammonium molybdate, blotted again, and allowed to air dry. Negatively stained specimens were viewed on a JEOL JEM1400-Plus transmission electron microscope operated at 120 kV. Images were recorded on a Gatan Orius camera.SDS PAGE gel analysis of purified proteins
[0274] Samples were prepared via transfection of ExpiCHO cells as described above. SDS-PAGE analysis was performed by mixing purified proteins 3: 1 with 4x Laemmli sample buffer (Bio Rad) containing P-mercaptoethanol for reducing conditions, heating at 95 °C for 5 min, and loading onto a pre-cast 4-20% SDS-PAGE gel (Bio Rad). Gels were run at 230 V for 30 min. Gels were stained using Gel Code Blue staining reagent, washed extensively with deionized water, and imaged using a Thermo Fisher Scientific gel imager.Western blots on supernatants following transfections
[0275] Samples were prepared via transfection of ExpiCHO cells cells as described above. Samples were mixed 3: 1 with 4x Laemmli sample buffer (Bio Rad) containing P-mercaptoethanol for reducing conditions, heated at 95 °C for 5 min, and loaded onto a pre-cast 4-20% SDS-PAGE gel (Bio Rad). Gels were run at 230 V for 30 min, transferred to a 0.45 μm nitrocellulose membrane using a Trans-Blot Turbo Transfer System (Bio Rad), and blocked with milk in PBST for 1 h. Membranes were washed three times and then treated with 1:1000 diluted human monoclonal antibodies diluted in PBST. The human mAb is specific for the antigens on the surface of the. Membranes were then washed three times and treated with 1: 5000 HRP-conjugated cross-adsorbed secondary antibodies diluted in PBST. Finally, membranes were washed three times and treated with Pierce™ ECL Western Blotting Substrate (Thermo Fisher) and imaged using a Thermo Fisher Scientific gel imager.Preparation of mRNA encoding antigens of interest
[0276] Antigen designs were prepared as mRNA using in-vitro transcription from a linearized T7 plasmid vector. Plasmid templates containing the antigen of interest encoded in a pcDNA3.1 vectorwere codon optimized for mammalian expression and synthesized by Twist. Antigen target sequences were amplified via PCR using primers containing 15-base pair overlaps with the 3’ and 5’ ends homologous to those of a linearized T7 template vector. The T7 template vector was synthesized by Takara and contains a T7 promoter, transcription start site, 5'- and 3 '-untranslated regions (UTRs), 141 nucleotide poly(A) tail sequences, and BspQI digestion site. PCR products were run on a 1% agarose gel and purified via gel extraction using a GeneJET PCR purification kit (Thermo Fisher). Next, 25 ng of purified gene insert was incubated with 0.5 pl of linearized vector and 0.5 pl of In-Fusion® Snap Assembly Master Mix (Takara) at 50 °C for 15 min. These reactions were then mixed with 10 pl of stellar competent cells, heat shocked at 42 °C for 45s, and subsequently recovered, plated, and incubated until colonies were visible. Individual colonies were selected and grown to allow amplification of the insert in the T7 vector. GeneJET Plasmid Miniprep Kit (Thermo Fisher) was used to isolate resultant DNA, and the sequence of each plasmid was confirmed via NanoPore sequencing at Plasmidsaurus.Following sequence confirmation, vectors were linearized with BspQI (Takara) at 37 °C for 2 h, and linearized vectors were purified by precipitation with sodium acetate and ethanol at -20 °C. Purified vector products were resuspended in nanopure water for in-vitro transcription (IVT) of RNA. IVT reactions were conducted using the IVTpro T7 mRNA Synthesis Kit (Takara) on a 4x scale with CleanCap® Reagent AG (Trilink) and Nl-methylpseudouridine-5'-triphosphate (Trilink) in place of uridine-5'-triphosphate. Nucleoside triphosphates, IVT enzyme mix, and capping reagent were allowed to react at 37 °C for 2 h, treated with DNAse I (New England BioLabs), and then purified via LiCl precipitation. mRNA was dissolved at 1.0-4.0 pg / pL in 1 mM pH 6.5 sodium citrate buffer and stored at -80 °C until use.Formulation of LNPs
[0277] Lipid nanoparticles (LNPs) encapsulating mRNAs of interest were formulated using a NanoAssemblr Ignite system (Cytiva) using lipid ratios and compositions described previously in Schoenmaker et al., Int J Pharm. 2021;601: 120586, which is incorporated herein by reference in its entirety. ALC-0315 (Avanti Lipids), ALC-0159 (Cayman Chemical), DSPC (Avanti Lipids), and cholesterol (Sigma Aldrich) were dissolved at 25-50 mg / mL in absolute ethanol and mixed in a molar ratio of 46.3: 1.6: 42.7: 9.4 to obtain the organic phase. mRNAs were prepared in 10 mM pH=4.0 sodium citrate buffer to a concentration of 0.2-0.4 mg / mL to obtain the aqueous phase. The organic phase was diluted in ethanol to target an N / P ratio of 6 after mixing, and LNPs weresubsequently formulated by mixing the aqueous and organic phases using a NxGen formulation cartridge (Cytiva) at a 2 mL scale using a 12 mL / min flow rate and 3: 1 aqueous: organic flow ratio. Following formulation, LNPs were dialyzed against 20 mM pH=7.4 tris buffer at 4 °C using 20 kDa, 2 mL Slide-A-Lyzer™ MINI Dialysis Devices (Thermo Fisher). LNPs were subsequently diluted with 50% sucrose, 20 mM tris buffer to a final concentration of 10% sucrose, concentrated using 4 mL 50 kDa Amicon® Ultra Centrifugal Filters (EMD Millipore) to a target of 0.1 -0.2 mg / mL mRNA, and sterile filtered through a 0.22 pm PES membrane. LNPs were frozen and stored at -80 °C until use.mRNA integrity characterization
[0278] Capillary electrophoresis was conducted on mRNA before and after packaging in LNPs. Unpackaged mRNA was diluted to 100 pg / mL, heated to 70 °C for 2 min, then cooled on ice and loaded onto the instrument. Packaged mRNA was extracted from LNPs by mixing 5 pL of LNP with 10 pL of LNP digestion buffer (30% v / v ethanol + 20% v / v Triton X-100) and heating the resultant solution to 37 °C for 20 min to digest LNPs and isolate mRNA, then to 70 °C for 2 min to denature isolated mRNA. Samples were cooled on ice and loaded onto the instrument. RNA integrity and purity was validated using capillary electrophoresis on a Fragment Analyzer 5200 System (Agilent) using the DNF-471 15nt RNA Kit (Agilent) according to the manufacturer’s protocol. RNA integrity was determined via smear analysis using the instrument software.In vitro potency of RNAs
[0279] Cell based assays were used to validate protein expression and relative potency of mRNA and LNP encoded antigen constructs. HeLa cells were maintained in RPMI-1640 + 10% heat inactivated FBS + 55 pM P-mercaptoetlianol + 100 U / mL Penicillin-Streptromycin (HeLa media). Cells were plated at 1.5 x 105cells / well in a 24 well plate and allowed to adhere for at least 6 h. LNPs were prepared as a 10x stock of the working concentration by dilution in PBS. RNAs were prepared as a 10x stock of the working concentration by complexing with Messenger Max (Thermo Fisher) and diluting in Opti-MEM media (Gibco) according to the manufacturer’s protocol. At assay start, media was removed and replaced with 450 pL of pre-warmed HeLa media. Then, to each well was added 50 pL of I Ox RNA or LNP stock. Cells were incubated for 24 h at 37 °C, 5% CO2. The media was then collected, concentrated to 50 pL using 0.5 mL 30 kDa Amicon® Ultra Centrifugal Filters (EMD Millipore), and stored at -80 °C for analysis of secreted antigen. Meanwhile, cells were detached from the plate via treatment for 5 min with Accutase(Innovative Cell Technologies, Inc.) and transferred to a 96-well plate for analysis of cell surface potency via flow cytometry. In some cases, cells were lysed with M-PER Mammalian Protein Extraction Reagent (Thermo Fisher), and supernatants and lysates were analyzed via Western blot as described above. For Western blot, primary antibodies were prepared by GenScript with mouse or human Fc domains and stored in pH=7.4 TBS.
[0280] To analyze cell-based potency via flow cytometry, cells were spun down at 500 x G for 5 min. Media was removed, and cells were washed with 200 pL PBS. Cells were subsequently treated with 200 pL of 1:2000 Live-or-dye 665 / 685 (Biotium) or Live-or-dye 510 / 550 diluted in PBS for 20 min at room temperature in the dark. Cells were then spun down at 500 x G for 5 min, media was removed, and cells were treated with 50 pL 1:500 diluted primary antibody in flow buffer (PBS + 1% heat inactivated FBS + 1 mM EDTA) at 4 °C for 1 h. Primary antibodies were prepared by GenScript with mouse or human Fc domains and stored in pH=7.4 TBS. Cells were then spun down at 500 x G for 5 min, media was removed, and cells were treated with 50 pL 1:500 diluted secondary antibody in flow buffer at 4 °C for 30 min. Secondary antibodies were Goat antimouse or anti-human IgGs conjugated with R-phycoerythrin or Alexa Fluor 647 (Southern Biotech). Cells were then spun down at 500 x G for 5 min, media was removed, and cells were washed twice with 200 pL flow buffer. Finally, cells were resuspended in 100 pL flow buffer and analyzed using a Cytek Aurora flow cytometer. The media fluorescence intensity of PE and / or Alexa Fluor 647 was determined using FlowJo, and data were plotted in GraphPad Prism 9. Vaccine formulation and administration
[0281] Female BALB / c mice (age 7-8 weeks) were purchased from Charles River Laboratories and acclimated for at least one week in a contract vivarium (Fortis Life Sciences) prior to immunization. LNPs were formulated in 20 mM tris, 10% sucrose, pH=7.4 to deliver the indicated doses (see figure legends) in 100 pL volume. Mice were injected intramuscularly with 2 x 50 pL doses of antigen in each hind leg, to deliver 100 L of vaccine formulation per immunization. To obtain blood via retroorbital bleeding, a capillary tube was inserted into the medial canthus. Blood was then transferred to a microtainer blood collection tube (BD 365967), allowed to clot at room temperature for approximately 2 hours, and then spun down at 4000 rpm in a tabletop centrifuge. The serum layer was transferred to an Eppendorf tube and frozen at -80 °C. Prior to subsequent assays, serum was heat inactivated at 56 °C for 30 min. All mouse studies were conducted in accordance with lACUC-approved protocols.Growth and purification of live virus
[0282] Live EBV virus containing a green fluorescent protein (GFP) reporter was isolated from mutant Akata BX-1 cells which contain a recombinant EBV with GFP / Neomycin gene placed in the BXL. F1 region of the viral genome (Romero-Masters et al., PLoS Pathog.2020;16(2):el008365). Cells were expanded at a density of 0.3-1.0 x 106cells / mL in RPMI-1640 + 10% heat inactivated FBS + lx GlutaMAX supplement + 100 U / niL Penicillin-Streptromycin (R10 media) + 350 pg / ml G418 (Corning) at 37 °C, 5% CO2 to a volume of approximately 1 L. Once expanded, cells were resuspended at 4.0 x 106cells / mL in RPMI-1640 + 1% heat inactivated FBS + lx GlutaM AX supplement (R1 media) and virus was induced by treatment with 100 pg / ml goat anti-human IgG F(ab')2 (MP Bio). Cells were incubated for 4 h and subsequently diluted in R1 media to a final cell concentration of 2.0 x 106cells / mL. Cells were incubated for 5 d and then pelleted by centrifugation at 5,000 rpm for 10 min at 4 °C. Supernatant was collected, passed through a 0.8 pm cellulose nitrate filter (Thermo Fisher), and treated with 100 pg / ml bacitracin. Virions were then isolated by centrifugation at 21,000 x g for 90 min at 4 °C using a fixed angle rotor. Supernatant was decanted and virus, concentrated 100-fold by resuspension in RPMI-1640 + 100 pg / ml bacitracin, and stored at -80 °C until use.Neutralization assays
[0283] Virus was titrated using a 4E3 target cell line. Virus was serially 2-fold diluted in R10 media starting from a 1:5 starting dilution, and 30 pL / well of virus (or RIO as an untreated control) was added to a 96-well plate. 30 pL / well of R10 media was then added to each well. Then, 4.4 x 1044E3 cells / well in 60 pL was added to each well and incubated for 3 d at 37 °C, 5% CO2. Cells were then analyzed by high content imaging as described below, and the dilution of virus needed to target a 20% rate of infectivity was determined for each lot of virus.B cell neutralization was assessed in 4E3 cells. 4E3 cells were maintained at 37 °C, 5% CO2 in RPMI-1640 + 10% heat inactivated FBS + lx GlutaMAX supplement + 100 U / mL Penicillin-Streptromycin (R10 media). 30 pL / well of sera (or controls) were prepared in a 96-well flat bottom plate at a starting dilution of 1:5 in R10 and serially 5-fold diluted in R10. Then, 30 pL / well of EBV-GFP vims (titrated to an infectivity of 20%) was added to each well to obtain a top dilution of 1:10, and sera were incubated with vims for 1 h at 37 °C. Untreated cells and virus-only treatments were also prepared as controls. Then, 4.4 x 1044E3 cells / well in 60 pL were added tovirus-containing wells and incubated for 3 d at 37 °C, 5% CO2. After 3 days at 37 °C, cells were analyzed by high content imaging.
[0284] High content imaging-based neutralization analysis was conducted using a ImageXpress® Pico (Molecular Devices). Image-based neutralization assays were run in RIO media without phenol red to reduce background fluorescence. Plates were directly transferred from the 37 °C incubator 3 days after infection to the instrument and imaged using a lOx objective. Transmitted light and GFP images were acquired at automatically determined exposure settings, with two field of view collected per well. Data were analyzed using the Pico’s automated ceil identification algorithm, which uses transmitted light image to identify individual cells and GFP thresholds were defined based on cell-only and virus-only infection conditions. Following collection of counts for GFP positive and negative cells, serum concentrations giving 50% neutralization values were determined by 4 parameter logistic regression using GraphPad Prism 9.Antibody binding assays
[0285] Antibody binding titers were quantified via a bead-based Luminex assay. Recombinant proteins defined against antigens of interest (Table 5) were expressed as described above in Expi293F or ExpiCHO cells with a C-terminal AviTag. Following initial purification, proteins were biotinylated using BirA biotin-protein ligase bulk reaction kit (Avidity LLC) according to the manufacturer’s protocol. The crude reaction mixture was purified using a Sepharose 200 sizeexclusion column equilibrated in 20 mM Tris pH 7.5, 150 mM NaCl on an AKTATMchromatography system, and biotinylated product containing fractions were pooled, concentrated using appropriately sized Amicon® Ultra Centrifugal Filters (EMD Millipore), formulated with 5% sucrose as a cryoprotectant and stored at -80 °C until use. To prepare antigen conjugated beads, MagPlex®-Avidin microspheres (Diasorin) designed for the regions described in Table 5 were counted using a Countess S3 cell counter (Thermo Fisher), collected via magnetic separation, and storage buffer was removed. Beads were resuspended in 3 mL PBS + 1% bovine serum albumin (BS / X), and 5 pg antigen / 100 kDa antigen / IxlO6beads was added. The reaction was allowed to proceed for 2 hours, then washed and resuspended in 1 mL Luminex wash buffer (0.1% BSA, 0.02% Tween-20 in PBS pH 7.4). The post-conjugation antigenicity of each antigen was validated by measuring binding to mAbs as shown in Table 4. The mAbs used for validation were purchased from Gen script.
[0286] To assess antibody binding, serum samples from mice were diluted 750-fold or 18750-fold in Luminex assay diluent (1% non-fat milk, 5% FBS, 0.05% Tween-20 in PBS pH 7.4). 25 pL of diluted serum was added to 25 pL of antigen-conjugated microsphere suspension (at least 1000 microspheres / antigen). After a 30-minute incubation, microspheres were pelleted with a magnetic separator and washed three times with Luminex wash buffer. Microspheres were incubated with 100 pL of goat anti-mouse IgGPE (2 pg / mL, SouthernBiotech) for 30 minutes. Microspheres were then pelleted with a magnetic separator, washed three times with Luminex wash buffer, and resuspended in Luminex wash buffer for analysis. Results were read on a Luminex xMAP Intelliflex system and data analyzed in GraphPad Prism 9,Table 4: Luminex Bead PanelExperiments and Results
[0287] Seven ferritin orthologs from H. pylori, M. tuberculosis, U. urealyticum, P. juriosus, V. cholerae, D. desulf uricans, and C. tepidum were fused with Epstein-Barr virus glycoprotein B (EBV gB) and expressed in ExpiCHO system. The ExpiCHO cells were transfected and incubated in a 50-mL bioreactor and in a 24-well deep well plate. Quantified by Western blot, all the ferritins demonstrated decent levels of expression with H. pylori ferritin being the highest expressing construct and 1). desulfuricans and C. tepidum. being the lowest, as shown in FIGs. 1 and 2. As the protein expression was comparable between the 50-mL bioreactor and 24-well deep well plate,the cultures from these two vessels were combined for purification. In the preliminary purification, CaptoTM Core 700 was used to remove impurities with molecular weight lower than 700 kDa Given the large size of ferritin nanoparticles, they were retained and were then further purified with a size-exclusion chromatography, SRT-SEC-1000, and then concentrated. Protein gel electrophoresis with Coomassie blue staining was used to characterize the products from each purification steps. As shown in FIG. 3, after clean-up with CaptoTM Core 700 column, most of the impurity was removed from the cell supernatant.
[0288] In dynamic light scattering (DLS) analysis, orthogonal FNPs that carried EBV gB protein demonstrated similar radius despite the substantial difference in the amino acid sequence, with the peaks ranging from 23 to 30.5 nm, as shown in FIG. 4. In addition to similar particle size, orthogonal FNPs also showed comparable thermostability in differential scanning fluorimetry with the primary peaks ranging between 62 and 63.8°C, as shown in FIG. 5. This data suggests that orthogonal FNPs, despite their diverse origins, may have very similar thermostability. Furthermore, transmission electron microscopy (FEM) demonstrated that gB-fused orthogonal ferritins form FNPs and the spikes of EBV gB protein can be clearly seen on the orthogonal FNPs, as shown in FIG. 8.Example 3: Vaccines comprising mRNA encoded ferritin nanoparticles
[0289] Vaccines comprising mRNA encoded ferritin nanoparticles displaying three engineered EBV antigens, gB, gp350, and a single polypeptide chain of gH / gL / gp42, were designed and tested. It was desirable to ensure that the EBV antigens were displayed on nanoparticles in an orthogonal manner such that antigens do not intermix in the formation of triniers. For example, in the case of EBV gB glycoprotein, a response against trimeric complexes resembling homotrimers present during natural infection could enhance vaccine mediated protection. LTsing the orthogonal ferritin platform, each EBV antigen-encoding mRNA was engineered with a ferritin from a different host species. The EBV gp350 antigen was designed in its truncated form (gp350-trunc) with ferritin derived from E. colt. An engineered polypeptide composed of portions of the EBV gH, gL, and gp42 glycoproteins was designed as a single chain (referred to as gHgLgp42-SC) with ferritin derived from H. pylori, and a small library of gB-ferritin variants were engineered using a gB variant with post-fusion conformation with no furin site and HSV1 -derived fusion loops (gB-NoFurin). EBV antigens designs used for ferritin screening are provided in Table 5 below.Table 5: EBV Antigen Designs Used For Ferritin Screening
[0290] The tested gB-ferritin constructs include:
[0291] 1. gB-ff. Py / rorz-Fer-NoFurin (reference control)
[0292] 2, gB-7J. t / rea / j’cztom-Fer-NoFurin
[0293] 3. gB-M. Tuberculosis-Fer-NoFurin
[0294] 4. gB-. Fz / rz<95z / -Fer-NoFurin
[0295] 5. gB-C. Pe ziP / ZM-Fer-NoFurin
[0296] 6. gB-E CAo / era-Fer-NoFurin
[0297] In the tested orthogonal ferritin antigen designs, ferritins were affixed to the C-terminus following a short linker. Orthogonal gp220-P. coll ferritin and gHgLgp42-SC- 7. pylori ferritin mRNAs were prepared, and expression of mRNA packaged in LNPs or delivered with a commercial lipofection reagent was analyzed via Western blot with monoclonal antibodies directed against ferritin derived from each species. Both gp220 (FIG. 6) and gHgLgp42 (FIG. 7) were detected at high levels primarily in the supernatant, as expected for antigens encoded with ferritin.
[0298] A more comprehensive evaluation of the orthogonal ferritin platform was conducted using gB antigens. gB ferritin variants were first expressed from plasmid in expiCHO cells and purified via size exclusion chromatography. Formation of multivalent ferritin nanoparticles was assessed via TEM imaging. As shown in FIG. 8, most ferritins could successfully form nanoparticles, though some incomplete nanoparticle formation was observed for V. Cholera. Three ferritins, U.ureatycitum, P. furiosus and C. tepidum were then selected for production of gB-ferritin mRNAs. After in vitro transcription, mRNAs were delivered to FleLa cells with a lipofection reagent and analyzed via an in vitro potency assay. As shown in FIG. 9, gB-G. wrerz / ycztz / z / z-Fer-NoFurin was poorly expressed from mRNA, while the other samples were more highly expressed. Based on these results, gB-P. furiosus Fer-NoFurin was selected for in vivo characterization.
[0299] Vaccines formulated with gp350-£". Coll ferritin, gHgLgp42-SC H. pylori ferritin, and gB-P. furiosus Fer-NoFurin mRNAs encapsulated in LNPs were administered individually or in combination at 2 pg per antigen per dose on days 0 and 20. Binding antibody responses were determined by Luminex at days 20 and 34 (FIG. 10A-N), and the neutralizing capacities of sera against B cells (FIG. 11) were evaluated at days 34. As shown in FIGs. 10A-N, the orthogonal ferritin platform generated robust binding antibody responses against each antigen. In addition, as shown in FIG. 11, a neutralization response was generated against B cell infection. Taken together, these results show that using orthogonal ferritins to co-deliver mRNAs that encode different antigens led to proper and efficient protein expression and antigen presentation on the ferritin nanoparticles.Example 4: Immunogenicity of vaccines comprising mRNA encoded ferritin nanoparticles
[0300] Vaccine immunogenicity of combination vaccines containing orthogonal ferritin-tagged antigens was tested alongside conventional cell anchored antigens or ESCRT-recruiting domain (ERD)-tagged antigens in various small animal models. Mice, rabbits, or guinea pigs were immunized on days 0 and 21 with 2 or 0.4pg, 7.5 pg, or 4 pg of mRNA per antigen per dose, respectively, separately encapsulated in LNPs. On days 21 and 35, binding responses were evaluated via Luminex, and on days 21 and 35, sera neutralization responses were evaluated against B cells and epithelial cells. The study groups were as follows:
[0301] Group 1: gp220 + WT. SP-gHgL-EPM-MPMV.fflV-GT2A-gp42-RtoK + gB. G3-foldon-gp220TM-EPM-MPMV. HIV
[0302] Group 2: gp220 + WT. SP-gHgL-GT2A-gp42-RtoK + gB. G3-foldon-gp220TM
[0303] Group 3: CD5-SP-gp350-D123-E. Coli-fer + gHgLgp42-SC-RtoK-Fer + gB-P.furi-fer-NoFurin
[0304] Group 4: CD5-SP-gp350-D123-E. Coli-fer + gHgLgp42-SC-RtoK-Fer + gB. G3- P. FuriFer-NoFurin
[0305] Group 5: gH + gL + gp42 + gp350-mod
[0306] Results generated in each of the three species are presented in FIGS. 12A-B to 19A-F. In rabbits and guinea pigs, the Group 3 gB-ferritin design showed increased gB binding responses (FIGs. 16E, 16F, 19E, and 19F), showing that proteins delivered as mRNA using the orthogonal platform assembled properly, based on potential need for gB to form a trim er to elicit robust responses, and induced an antigen-specific immune response.
[0307] Vaccine immunogenicity was also tested in non-human primates. Adult non-human primates (NHPs, n = 4 per group) were immunized with 25 pg per antigen of mRNAs or 50 pg of recombinant protein as follows:
[0308] Group 1. gp350 recombinant protein adjuvanted with alum and MPLA
[0309] Group 2. gp220 + WT SP-gHgL-GT2A-gp42-RtoK mRNA
[0310] Group 3. gp220-MPMV. HIV + WT. SP-gHgL-EPM-MPMV. HIV-GT2A-gp42-RtoK mRNA
[0311] Group 4. gp220-D123-E. Coli-Fer + gHgLgp42-SC-RtoK-Fer mRNA
[0312] Group 1 serves as a benchmark comparator to a recombinant protein formulation that was used in a previous clinical vaccine (see Sokal et al., J Infect Dis. 2007; 196(12): 1749-53), whereas Group 4 represents antigens presented on nanoparticles generated by mRNA encoded antigen designs incorporating ferritins. Due to strong pre-existing immunity to rhesus lymphocryptovirus, a gamma-herpesvirus with strong homology to EB V, NHPs were matched based on pre-existing neutralizing sera responses against EBV, and no gB component was included. NHPs were immunized on days 0 and 57 with the indicated formulations, and sera were collected on days 0, 29, 57, 71, 85, 120, 180, 240, 298, 360, and 420 to allow for analysis of vaccine durability one-year post boost.
[0313] B and epithelial cell neutralization and antibody binding responses were evaluated at each of the listed serum collection timepoints (FIGs. 20-22). In terms of neutralization, the ferritin nanoparticle antigen design showed increased B and epithelial cell neutralization up to six months to one year post boost (FIGs. 20, 21). Binding antibody responses as measured by Luminex show that the ferritin nanoparticle (FNP)-tagged antigens generated high binding responses against gH / gL / gp42 that persist for at least 240 days following the first immunization dose (FIGs. 22B-D)Example 5: Immunogenicity of vaccines comprising mRNA encoded ferritin nanoparticles
[0314] Two proteins, gE of VZV and gB of CMV, were cloned into mRNA expression vectors and produced as mRNAs either in the cell anchored (traditional) format or as mRNA encoded ferritin (H. Pylori ferritin) format. The mRNAs were formulated into an LNP and screened for activity in a mouse model. Mice were immunized on days 0 and day 21 with 2ug of mRNA each. Antisera from the mice was subsequently analyzed by ELISA.
[0315] ELISA antigens (either his-tagged VZV gE or his-tagged and trimerized gB from CMV) were coated onto maxisorp plates (ThermoFisher) at lug / mL concentration overnight at 4°C. Plates were subsequently blocked with 300uL superblock overnight at 4°C and sera dilutions (starting at 1:50 dilution in super block and then 6-point dilution curves 1:5 or 1:10 dilution series steps depending on the day of the bleed) were tested for binding by incubation on the plate for at least Ih, 3x washing with IxPBS, incubation with an goat anti-mouse HRP secondary at a dilution of 1:10000 in superblock for Ih at room temperature and then 6x washing with 300uL of IxPBS followed by developing with TMB turbo ELISA substrate (ThermoFisher) and quenching after sufficient signal develops using ELISA Stop Solution (ThermoFisher). EC50s were determined using Prism.
[0316] The results from these assays are presented in FIG.23. After 1 dose for VZV gE, and after 1 and 2 doses for CMV gB, mRNA-encoded ferritin nanoparticles showed increased binding responses relative to the cell anchored control group. Taken together, these results show the utility of mRNA encoded ferritin molecules and support encoding multiple ferritin molecules in a single formulation may be advantageous, for example, for vaccine delivery of multiple antigens that would be desirable to express on individual nanoparticles. As an example, in a combination vaccine against VZV and CMV, one could encode VZV gE-ferritin as an mRNA or other genetic delivery modality and mix this with a CMV component encoding CMV gB-ferritin with a different ferritin, that would be unable to co-assemble with the first ferritin molecule. The orthogonality of the two ferritin molecules are essential to ensure that combinations of CMV gB / VZV gE ferritin particles did not form, which could lead, for example, to disruption of important trimeric display of the CMV gB.
[0317] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application or other reference was specifically andindividually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present disclosure.
[0318] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.
[0319] From the foregoing, it will be appreciated that specific embodiments of the invention have been described herein for purposes of illustration, but that various modifications may be made without deviating from the scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
Claims
CLAIMS1. A composition comprising a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
2. The composition of claim 1, wherein the first and / or second polynucleotides comprise DNA.
3. The composition of claim 1, wherein the first and / or second polynucleotides comprise RNA.
4. The composition of claim 3, wherein the first and / or second polynucleotides comprise mRNA or self -amplifying RNA or trans-amplifying RNA or circular RNA.
5. The composition of claim 4, wherein the first and / or second polynucleotides comprise modified nucleosides.
6. The composition of any one of claims 1 - 5, wherein the first and / or second polynucleotides comprise an Internal Ribosomal Entry Site (IRES) sequence.
7. The composition of claim 6, wherein the IRES sequence comprises SEQ ID NO: 48 or a sequence with at least 70% sequence identity thereto.
8. A composition comprising a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a first antigen and a first ferritin and the second polypeptide comprises a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
9. The composition of any one of claims 1-8, wherein the first ferritin is capable of selfassembling into a ferritin nanoparticle presenting the first antigen and the second ferritin is capable of self-assembling into a ferritin nanoparticle presenting the second antigen.
10. The composition of any one of claims 1 - 9, wherein the first ferritin and the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
11. The composition of claim 10, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian.
12. The composition of claim 11, wherein the amphibian is a bullfrog and the ferritin is a hybrid bullfrog ferritin, wherein the hybrid bullfrog ferritin comprises (i) a bullfrog ferritin or portion thereof and (ii) a ferritin derived from a bacterium.
13. The composition of claim 10, wherein the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium.
14. The composition of claim 13, wherein the bacterium is gram-negative.
15. The composition of claim 14, wherein the bacterium is H. Pylrori, P Furiosus, C.Tepidum V Cholera, D. desulfuricans, H. cetorum, H. vulpis, C. co l, or E. coll.
16. The composition of claim 13, wherein the bacterium is gram-positive.
17. The composition of claim 16, wherein the bacterium is U. Urealycitum, M. Tuberculosis, or B. subtilis.
18. The composition of claim 10, wherein the amino acid sequence of the first ferritin and / or the second ferritin comprises any one of SEQ ID NOs: 1-13 or a sequence with at least 70% sequence identity thereto.
19. The composition of any one of claims 1-18, wherein the first antigen and / or second antigen are derived from a pathogen.
20. The composition of claim 19, wherein the pathogen is a virus.
21. The composition of claim 20, wherein the virus is a flavivirus, an adenovirus, a coronavirus, a poxvirus, parainfluenza virus, influenza virus, metapneumovirus, Epstein-Barr Virus (EBV), respiratory syncytial virus (RSV), varicella zoster virus (VZV), cytomegalovirus (CMV), or rhinovirus.
22. The composition of claim 21, wherein the coronavirus is Middle East respiratory syndrome coronavirus (MERS-CoV), Severe acute respiratory syndrome-associated coronavirus 1 (S / XRS-CoV-l), or Severe acute respiratory syndrome-associated coronavirus 2 (SARS-CoV-2).
23. The composition of claim 19, wherein the pathogen is a bacterium.
24. The composition of claim 23, wherein the bacterium is a Chlamydia spp., Neisseria spp., or Streptococcus spp., optionally wherein the species is C. trachomatis, C. neumoniae, ('. psittaci, N gonorrhea, N meningitide,. S. pneumoniae, S. pyogenes, S. agalactiae, or S. mutans.
25. The composition of claim 19, wherein the pathogen is a fungus.
26. The composition of any one of claims 1-18, wherein the first antigen and / or second antigen is derived from a tumor-associated or tumor-specific antigen.
27. The composition of any one of claims 1-26, wherein the first antigen and / or second antigen is a monomer or forms a trimer.
28. The composition of any one of claims 1-27, wherein first antigen and / or second the antigen comprises at least one modification relative to a wild type protein.
29. The composition of claim 28, wherein the at least one modification relative to a wildtype protein comprises a deletion, an insertion, or an amino acid substitution.
30. The composition of claim 29, wherein the at least one modification comprises an amino acid deletion.
31. The composition of claim 30, wherein the amino acid deletion comprises a truncation at the C -terminal or N-terminal relative to the amino acid sequence of a wildtype protein.
32. The composition of any one of claims 29-31, wherein the at least one modification comprises an amino acid substitution.
33. The composition of claim 32, comprising two or more consecutive amino acid substitutions.
34. The composition of claim 33, wherein the two or more consecutive amino acid substitution eliminate a furin cleavage site within the amino acid sequence of the antigen.
35. The composition of any one of claims 29-34, wherein the at least one modification comprises an amino acid insertion.
36. The composition of claim 35, wherein the amino acid insertion comprises insertion of a ribosomal skip site, a trimerization domain, a cleavage site, a signal peptide, or a combination thereof,37. The composition of any one of claims 35 or 36, wherein the amino acid insertion comprises a signal peptide.
38. The composition of claim 37, wherein the signal sequence comprises the signal peptide from IgE, IGVH, tissue plasminogen activator (tPA), CD5, or IGKV.
39. The composition of any one of claims 35 - 38, wherein the amino acid insertion comprises a trimerization domain.
40. The composition of any one of claims 1 - 39, comprising a linker, optionally wherein the linker fuses the antigen directly or indirectly to the ferritin.
41. The composition of claim 40, wherein the linker is a flexible linker.
42. The composition of claim 40 or 41, wherein the linker is a peptide linker.
43. The composition of claim 42, wherein the peptide linker is a Gly-Ser linker.
44. The composition of claims 42 or 43, wherein the peptide linker comprises the amino acid sequence of the formula (Gly4Ser)n, wherein n is 1, 2, 3, 4, or 5.
45. The composition of any one of claims 1 - 7 and 9 - 44, comprising at least two polynucleotides, wherein the polynucleotides are combined with or incorporated into a vector.
46. The composition of claim 45, wherein the vector is a viral vector.
47. The composition of claim 46, wherein the viral vector is an adenovirus, an adeno-associated vims (AAV), a vesiculovirus, a retrovirus, a herpesvirus, or a vaccinia vims.
48. The composition of claim 45, wherein the vector is a non-viral vector.
49. The composition of claim 48, wherein the non-viral vector is a plasmid.
50. The composition of claim 48, wherein the non-viral vector is a lipid nanoparticle (LNP).
51. The composition of any one of claims 1 - 50, comprising at least one adjuvant.
52. The composition of any one of claims 1 - 51, comprising one or more pharmaceutically acceptable carrier, excipient, or diluent.
53. A kit comprising the composition of any one of claims 1-52 and instructions for use.
54. A method of delivering to a cell a ferritin nanoparticle (FNP)-based nucleic acid vaccine, comprising contacting the cell with a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising a first antigen and a first ferritin and the second polynucleotide encodes a second polypeptide comprising a second antigen and a second ferritin, and wherein the first ferritin and the second ferritin are not the same.
55. The method of claim 54, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian, a bacterium, an archaea, a mammal, a fungus, or a plant.
56. The method of claim 55, wherein the first ferritin and / or the second ferritin is derived from a ferritin of an amphibian.
57. The method of claim 56, wherein the amphibian is a bullfrog.
58. The method of claim 55, wherein the first ferritin and / or the second ferritin is derived from a ferritin of a bacterium.
59. The method of claim 58, wherein the bacterium is gram-negative.
60. The method of claim 59, wherein the bacterium is H. pylrori, P furiosus, C. tepidum V. cholera, D. desulfuricans, H. cetorum, H. vulpis, C. coll, or E. coll.
61. The method of claim 58, wherein the bacterium is gram-positive.
62. The method of claim 61, wherein the bacterium is U urealycitum, M. Tuberculosis, or B. sub tills.
63. The method of any one of claims 54-62, wherein the polynucleotides comprise DNA, RNA, mRNA, or a combination thereof.
64. The method of claim 63, wherein the polynucleotides comprise mRNA.
65. A method of treating a disease or a symptom thereof in a subject having, or at risk of having the di sease, compri sing administering to the subject an effective amount of the composition of any one of claims 1-52.
66. A method of inducing antibodies to an antigen in a subject, comprising administering to the subject an effective amount of the composition of any one of claims 1-52, wherein the antibodies bind to the first and / or the second antigen in the composition.
67. A method for inducing an immune response against a disease or disorder in a subject, comprising administering to the subject an effective amount of the composition of any one of claims 1-52.
68. The method of any one of claims 65- 67, wherein the disease is a viral infection, a bacterial infection, a fungal infection, or a cancer.
69. The method of any one of claims 65- 68, wherein the subject is a mammal.
70. The method of claim 69, wherein the subject is a human.
71. The method of claim 70, wherein the subject is immunosuppressed or immunocompromi sed.
72. The method of any one of claims 65-71, wherein the composition is administered intramuscul rly.fQ