ZMFS2 gene and use thereof in maize disease control
By reducing the expression or function of the ZMFS2 gene in maize using gene editing techniques, the maize plant achieves enhanced resistance to multiple diseases, addressing the lack of broad-spectrum disease resistance in existing technologies.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-15
AI Technical Summary
Maize is susceptible to multiple diseases such as southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, and seed rot, which affect yield and quality, and existing methods lack effective broad-spectrum disease resistance mechanisms.
Reducing the expression or function of the ZMFS2 gene in maize using methods like gene silencing, mutagenesis, or transposon insertion to enhance disease resistance, specifically targeting the ZMFS2 gene sequence variants.
Enhances maize resistance to a range of diseases, providing broad-spectrum protection against pathogens like southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, and seed rot, thereby improving crop yield and quality.
Smart Images

Figure PCTCN2025133719-FTAPPB-I100001 
Figure PCTCN2025133719-FTAPPB-I100002 
Figure PCTCN2025133719-FTAPPB-I100003
Abstract
Description
ZMFS2 GENE AND USE THEREOF IN MAIZE DISEASE CONTROLTECHNICAL FIELD
[0001] The present disclosure relates to the technical field of crop disease control, in particular to the use of a ZMFS2 gene in maize disease control.BACKGROUND
[0002] The information disclosed in the background art of the present disclosure is merely intended to increase understanding of the general background of the present disclosure, and is not necessarily regarded as acknowledging, or implying in any way, that this information constitutes prior art that has already become well known to those skilled in the art.
[0003] In recent years, as the environment has changed constantly, the area of maize infected by pathogens has gradually increased; as a result, the yield and quality of maize are affected, and the buildup of harmful toxins puts the safety of consumers at risk. Diseases commonly seen in maize include southern leaf blight, northern leaf blight, southern rust and stalk rot, etc. Due to the complexity of growth conditions, maize is typically infected by various pathogens at the same time during growth; in order to obtain maize germplasm of better quality, constant screening and cultivation are necessary. Increasing maize resistance through molecular breeding has a positive influence on pesticide use reduction and environmental protection. There is a need to provide a use which reduces the expression of a susceptibility gene of maize and thereby increases the disease resistance thereof.
[0004] Secondary metabolites are widespread in plants. The biological activity of flavonoids, which are secondary metabolites, includes antimicrobial, antiviral and antioxidant activity, etc. ; moreover, flavonoids affect plant growth, and participate in plant disease resistance. Flavonoids can be divided into flavanones, flavanols, flavonols, anthocyanidins, isoflavones and flavones. Research has shown that flavone synthase I is a dioxygenase dependent on 2-ketoglutaric acid; it can directly catalyse the formation of a double bond between carbon 2 and carbon 3 of a flavanone compound, and is a key enzyme in the synthesis of plant flavonoids. Flavone synthase I can catalyse the formation of flavones (such as apigenin and luteolin) from flavanones (such as naringenin and eriodictyol) . However, at present, no reports have yet been seen relating to the function of maize flavone synthase ZmFS2 in maize disease resistance. Thus, the investigation and identification of the function of ZmFS2, and research into its action in broad-spectrum disease resistance of maize, has major significance for disease resistance breeding of maize. SUMMARY OF THE DISCLOSURE
[0005] In view of the above, the present disclosure is based, at least in part, on the discovery that reducing expression of ZMFS2 gene can provide improved maize disease resistance. Further, reducing expression of ZMFS2 gene can increase broad-spectrum disease resistance in maize, which has major significance in maize disease resistance breeding.
[0006] In a first aspect, the present disclosure provides a method comprising reducing expression or function of ZMFS2 gene in maize to provide improved disease control, where the ZMFS2 gene encodes an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%98%, 99%or 100%amino acid sequence identity to SEQ ID NO: 2. The ZMFS2 gene cDNA can have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%98%, 99%or 100%nucleotide sequence identity to SEQ ID NO: 1.
[0007] In one example, the method comprises altering a susceptible maize plant that is susceptible to at least one maize disease that is southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, seed rot or a combination thereof. The method comprises reducing the expression or function of ZMFS2 gene in the susceptible plant to thereby generate an altered maize plant, germplasm or cell thereof. As a result of reducing the expression or function of ZMFS2 gene, the altered maize plant, germplasm or cell thereof has improved resistance to at least one of southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, or seed rot relative to the initial susceptible maize plant, germplasm or cell thereof.
[0008] Preferably, the method comprises inhibiting the function or expression of the ZMFS2 gene in maize, so as to increase the disease resistance of the crop to one or more of southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, seed rot or a combination thereof.
[0009] Further, the method of said inhibiting of the function or expression of the ZMFS2 gene in maize comprises one or more of transposon insertion, gene editing, gene silencing or mutagenesis such as ethyl methanesulfonate (EMS) mutagenesis. For example, gene editing or mutagenesis can be used to reduce ZMFS2 gene expression or function by introducing nonsense mutations, missense mutations, and deletions that eliminate or reduce ZMFS2 gene function and / or expression. Gene silencing can involve the use of RNA silencing or RNA interference (RNAi) to inhibit ZMFS2 gene expression or translation, e.g., via micro RN As (miRNAs ) , small interfering RNAs (siRNAs) , trans-acting siRNA (ta-siRNA) , piwi-interacting RNAs (piRNA) , antisense RNA, transfer RNA (tRNA) , small nuclear RNA (snoRNA) , small nucleolar RNA (snoRNA) and repeats-derived RNA and the like. In particular example, gene silencing can involve the use of gene editing to alter native maize sequence to produce non-coding RNA having silencing activity towards RNA ZMFS2 (see for example International Application WO2019 / 058255) .
[0010] In a particular example, the method comprises uses a double stranded break agent (such as CRISPR / CAS endonuclease system) to reduce ZMFS2 gene expression or function. Such a method can include the use of guide RNAs such as gRNA1 (SEQ ID NO: 10) targeting nucleotides at sites 333 –352 in SEQ ID NO: 1; and gRNA2 (EQ ID No. 11) targeting nucleotides at sites 642 -661 in SEQ ID NO: 1.
[0011] In a different example, the method comprises altering the susceptible plant to include a transposon in the ZMFS2 gene, wherein the sites of said transposon insertion correspond to positions 68 and 424 (which is in the 3’ UTR region) of the sequence SEQ ID NO: 1.
[0012] In a second aspect, the present disclosure provides the use of a ZMFS2 gene-related biological material in maize disease control, the nucleotide sequence of cDNA of the ZMFS2 gene being as shown in SEQ ID NO: 1; the maize disease comprises southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot and seed rot. Preferably, the biological material is any one of (1) to (4) : (1) a protein encoded by the ZMFS2 gene, the amino acid sequence of the protein being as shown in SEQ ID NO: 2; (2) a recombinant vector containing the ZMFS2 gene; (3) a recombinant microbe containing the ZMFS2 gene; or (4) a transgenic or gene edited plant cell line containing the ZMFS2 gene.
[0013] Further, the vector is a plasmid, a cosmid, a phage or a viral vector; the microbe may be a yeast, a bacterium, an alga or a fungus.
[0014] In a third aspect, the present disclosure provides an altered maize plant, cell or germplasm thereof, which is produced by the method according to the first aspect disclosed above. Such altered maize plant, cell or germplasm thereof, comprises reduced expression or function of ZMFS2 gene and improved disease resistance relative to the susceptible maize plant of the first aspect but is otherwise isogenic or near isogenic to the susceptible maize plant. Thus, provided herewith is an altered maize plant, cell or germplasm thereof, that comprises (a) ZMFS2 gene having reduced expression by gene silencing and improved disease resistance relative to the susceptible maize plant of the first aspect, (b) ZMFS2 gene which has been altered by genome editing to provide reduce expression or function of ZMFS2 gene and improved disease resistance relative to the susceptible maize plant of the first aspect, (c) ZMFS2 gene which has been altered by mutagenesis to provide reduce expression or function of ZMFS2 gene and improved disease resistance relative to the susceptible maize plant of the first aspect, or (d) ZMFS2 gene which has been altered by transposon insertion to provide reduce expression or function of ZMFS2 gene and improved disease resistance relative to the susceptible maize plant of the first aspect. In particular examples of the foregoing (a) , the maize plant, cell or germplasm thereof altered by gene silencing comprises increased resistance to (i) southern leaf blight, (ii) northern leaf blight, (iii) southern rust, (iv) anthracnose, (v) stalk rot, (vi) seed rot, or any combination of (i) - (vi) . In particular examples of the foregoing (b) , the maize plant, cell or germplasm thereof altered by genome editing comprises increased resistance to (i) southern leaf blight, (ii) northern leaf blight, (iii) southern rust, (iv) anthracnose, (v) stalk rot, (vi) seed rot, or any combination of (i) - (vi) . In particular examples of the foregoing (c) , the maize plant, cell or germplasm thereof altered by mutagenesis comprises increased resistance to (i) southern leaf blight, (ii) northern leaf blight, (iii) southern rust, (iv) anthracnose, (v) stalk rot, (vi) seed rot, or any combination of (i) - (vi) . In particular examples of the foregoing (d) , the maize plant, cell or germplasm thereof altered by transposon insertion comprises increased resistance to (i) southern leaf blight, (ii) northern leaf blight, (iii) southern rust, (iv) anthracnose, (v) stalk rot, (vi) seed rot, or any combination of (i) - (vi) .
[0015] In a fourth aspect, the present disclosure provides method comprising the following steps: inhibiting the expression of a ZMFS2 gene in maize, so that the maize is resistant to southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot and seed rot; the nucleotide sequence of cDNA of the ZMFS2 gene being as shown in SEQ ID NO: 1.
[0016] In a fifth aspect, provided herein is a method for producing a maize plant having increased resistance to one or more of southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot and seed rot. The method comprises crossing a first parent maize plant with a second parent maize plant. The second parent maize plant is susceptible to at least one maize disease that is southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, seed rot or a combination thereof; and the first parent maize plant has reduced expression or function of ZMFS2 gene and improved disease resistance relative to the second parent maize plant. The method produces a plurality of first generation progeny plants. The method comprises selecting one or more first generation progeny plants having reduced expression or function of ZMFS2 gene relative to the second parent plant. In some examples, the method further includes crossing one or more selected first generation progeny plants and back-crossing the selected first generation progeny plants with the second parent maize plant to generate a plurality of second generation progeny plants, and then selecting one or more second generation progeny plants having reduced expression or function of ZMFS2 gene relative to the second parent plant. The step of backcrossing progeny plants to the second parent maize plant can be repeated two, three, four, of five times to generate progeny plants having genetic background that is near isogenic to the second parent plant, but that has reduced expression or function of ZMFS2. In particular examples, the progeny plants that have reduced expression or function of ZMFS2 also have increased resistance to one or more of southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot and seed rot, relative to the second parent plant.
[0017] Compared with the prior art, the present disclosure achieves the following beneficial effects:
[0018] In the present disclosure, it was found through gene function testing and verification that a ZMFS2 transgenic overexpression positive line exhibited a susceptible phenotype for various maize diseases such as southern leaf blight, northern leaf blight and stalk rot; two transposon insertion mutant lines ZMFS2-1 and ZMFS2-2 were subjected to disease resistance identification, and it was found that these two mutants exhibited broad-spectrum disease resistance to various fungal diseases of maize such as southern leaf blight, northern leaf blight, southern rust and stalk rot. It can be seen that the ZMFS2 gene provided in the present disclosure is a broad-spectrum disease resistance gene, which can significantly enhance the resistance of maize to various diseases, so provides a novel solution for controlling maize diseases from the perspective of molecular biology, and also provides a certain theoretical and practical basis for the use of this gene in maize disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING
[0019] Fig. 1 is a CDS sequence electropherogram for the PCR clone maize type I flavone synthase gene ZMFS2 in Example 1.
[0020] Fig. 2 is a Western blot identification chart for the transgenic overexpression positive line in Example 2, wherein a GFP antibody was used to perform Western Blot identification of ZMFS2 transgenic material; above the lanes are the serial numbers of two transgenic line positive (pos) and corresponding negative (neg) plants; 1, 2, 3, 4, 5 and 6 are from six different plants.
[0021] Fig. 3 is disease resistance identification for anthracnose and southern leaf blight in the ZMFS2 transgenic overexpression seedling stage in Example 2 of the present disclosure, wherein panel A shows phenotypes of the ZMFS2 positive overexpression line and its corresponding negative line after inoculation with Colletotrichum graminicola; panel B shows post-inoculation lesion areas measured using Image J; panel C shows disease resistance phenotypes of the ZMFS2 positive overexpression line and its corresponding negative line for southern leaf blight; panel D shows lesion areas after inoculation with Bipolaris maydis, measured using Image J (*p < 0.05, **p < 0.01, Student’s t-test) .
[0022] Fig. 4 is disease resistance identification for southern leaf blight and northern leaf blight in a large field in the ZMFS2 transgenic overexpression mature plant stage in Example 2 of the present disclosure, wherein panel A shows disease resistance phenotypes of the ZMFS2 positive overexpression line and its corresponding negative for southern leaf blight; panel B shows lesion grades or scores of the ZMFS2 positive overexpression line and its corresponding wild type after infection with southern leaf blight; panel C is disease resistance phenotypes of the ZMFS2 positive overexpression line and its corresponding negative for northern leaf blight; panel D shows lesion scores of the ZMFS2 positive overexpression line and its corresponding negative after infection with northern leaf blight (*p < 0.05, ***p < 0.001, Student’s t-test) .
[0023] Fig. 5 is disease resistance identification of the ZMFS2 transgenic overexpression line for stalk rot and seed rot in Example 2 of the present disclosure, wherein panel A shows resistance phenotypes of the ZMFS2 positive overexpression line and its corresponding negative for stalk rot; panel B shows lesion scores of the ZMFS2 positive overexpression line and its corresponding negative after inoculation with Fusarium verticillioides; panel C shows resistance phenotypes of the ZMFS2 positive overexpression line and its corresponding negative for seed rot; panel D shows spore concentrations of the ZMFS2 positive overexpression line and its corresponding negative after inoculation with Fusarium verticillioides (*p < 0.05, **p < 0.01, ***p < 0.001, Student’s t-test) .
[0024] Fig. 6 is identification of the ZMFS2 mutant line in Example 3 of the present disclosure, wherein panel A is a schematic diagram of positions of ChinaMu transposon insertion sites and the ZMFS2 gene structure; panel B shows the ZMFS2 mutant PCR identification results; panel C shows transcription levels of ZMFS2 in ZMFS2 mutants detected by qRT-PCR (*P < 0.05, **p < 0.01, Student’s t-test) .
[0025] Fig. 7 is disease resistance identification for southern leaf blight and northern leaf blight in a large field of the ZMFS2 mutant in Example 3 of the present disclosure, wherein panel A shows field phenotypes of the ZMFS2 mutant and its wild type for southern leaf blight; panel B shows lesion scores of the ZMFS2 mutant and its wild type after infection with southern leaf blight; panel C shows field phenotypes of the ZMFS2 mutant and its wild type for northern leaf blight; panel D shows lesion scores of the ZMFS2 mutant line and its wild type after infection with northern leaf blight (**p < 0.01; ***p < 0.001, Student’s t-test) .
[0026] Fig. 8 is disease resistance identification of the ZMFS2 mutant line for stalk rot and seed rot in Example 3 of the present disclosure, wherein panel A shows resistance phenotypes of the ZMFS2 mutant and its wild type for stalk rot; panel B shows lesion scores of the ZMFS2 mutant and its wild type after inoculation with Fusarium verticillioides; panel C shows resistance phenotypes of the ZMFS2 mutant and its wild type for seed rot; panel D shows spore concentrations of the ZMFS2 mutant and its wild type after inoculation with Fusarium verticillioides (*P < 0.05, **p < 0.01, Student’s t-test) .
[0027] Fig. 9 is disease resistance identification for southern rust in the ZMFS2 mutant line in Example 1 of the present disclosure, wherein panel A shows field phenotypes of the ZMFS2 mutant and its wild type for southern rust; panel B shows lesion scores of the ZMFS2 mutant and its wild type after infection with southern rust (**p < 0.01, Student’s t-test) .
[0028] Fig. 10 is identification of the ZmFS2 gene edited positive line in Example 4 of the present disclosure, wherein panel A is a schematic drawing of the positions of gRNA1 and gRNA2 sites and the ZmFS2 gene structure; panel B shows sequence changes at the gRNA sites and sequencing chromatograms of the ZmFS2 CRISPR / Cas9 edited line; panel C is the amino acid sequence of ZmFS2 after being edited.
[0029] Fig. 11 is disease resistance identification for anthracnose in the seedling stage of the ZmFS2 gene edited positive line in Example 4 of the present disclosure, wherein panel A shows phenotypes of the ZmFS2 edited line and its corresponding wild type after inoculation with Colletotrichum graminicola; panel B shows post-inoculation lesion areas in the ZmFS2 edited line and its corresponding wild type measured using Image J (**p < 0.001, Student’s t-test) .DETAILED DESCRIPTION
[0030] As used herein the singular forms “a” , “and” , and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “acell” includes a plurality of such cells and reference to “the protein” includes reference to one or more proteins and equivalents thereof, and so forth. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs unless clearly indicated otherwise.
[0031] As used herein, the term “maize” means Zea mays or corn and includes all plant varieties that can be bred with corn, including wild maize species.
[0032] A gene or allele is “associated with” a trait when it is part of or linked to a DNA sequence or allele that affects the expression of the trait. The presence of the allele is an indicator of how the trait will be expressed.
[0033] “Backcrossing” refers to the process whereby hybrid progeny are repeatedly crossed back to one of the parents. In a backcrossing scheme, the “donor” parent refers to the parental plant with the desired gene or locus to be introgressed. The “recipient” parent (used one or more times) or “recurrent” parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed.
[0034] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; International Application Publication WO2007 / 025097, published 01 March 2007) . A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers) , which can be flanked by diverse Cas (CRISPR-associated) genes.
[0035] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR-associated) gene. A Cas protein includes but is not limited to: a Cas9 protein, a Cpf1 (Cas12) protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, Cas10, or combinations or complexes of these. A Cas protein may be a “Cas endonuclease” or “Cas effector protein” , that when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. The endonucleases of the disclosure may include those having one or more RuvC nuclease domains. A Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity with a native Cas protein, and retains at least partial activity.
[0036] A “Cas endonuclease” may comprise domains that enable it to function as a double-strand-break-inducing agent. A “Cas endonuclease” may also comprise one or more modifications or mutations that abolish or reduce its ability to cleave a double-strand polynucleotide (dCas) . In some aspects, the Cas endonuclease molecule may retain the ability to nick a single-strand polynucleotide (for example, a D10A mutation in a Cas9 endonuclease molecule) (nCas9) .
[0037] The term “crossed” or “cross” refers to a sexual cross and involved the fusion of two haploid gametes via pollination to produce diploid progeny (e.g., cells, seeds or plants) . The term encompasses both the pollination of one plant by another and selfing (or self-pollination, e.g., when the pollen and ovule are from the same plant) .
[0038] An “elite line” is any line that has resulted from breeding and selection for superior agronomic performance.
[0039] “Gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence, as well as intervening intron sequences. “Native gene” refers to a gene as found in its natural endogenous location with its own regulatory sequences.
[0040] “Germplasm” refers to genetic material of or from an individual (e.g., a plant) , a group of individuals (e.g., a plant line, variety or family) , or a clone derived from a line, variety, species, or culture, or more generally, all individuals within a species or for several species (e.g., maize germplasm collection or Andean germplasm collection) . The germplasm can be part of an organism, cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm includes cells, seed or tissues from which new plants may be grown, or plant parts, such as leaves, stems, pollen, or cells, that can be cultured into a whole plant.
[0041] The term “genome” as it applies to a prokaryotic and eukaryotic cell or organism cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.
[0042] As used herein, “genotype” is the actual nucleic acid sequence at one or more loci in an individual plant. As used herein, “phenotype” means the detectable characteristics (e.g. increased free phosphate) of a cell or organism which can be influenced by genotype.
[0043] As used herein, the term “guide polynucleotide” , relates to a polynucleotide sequence that can form a complex with a Cas endonuclease and that enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (aRNA-DNA combination sequence) .
[0044] The terms “single guide RNA” and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA) , fused to a tracrRNA (trans-activating CRISPR RNA) . The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, optionally bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.
[0045] As used herein, the terms “guide polynucleotide / Cas endonuclease complex” , “guide polynucleotide / Cas endonuclease system” , “guide polynucleotide / Cas complex” , “guide polynucleotide / Cas system” and “guided Cas system” “Polynucleotide-guided endonuclease” , “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein (s) and suitable polynucleotide component (s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13) .
[0046] The term “hybrid” refers to the progeny obtained between the crossing of at least two genetically dissimilar parents.
[0047] The term “inbred” refers to a line that has been bred for genetic homogeneity.
[0048] The term “introgression” refers to the transmission of a desired allele of a genetic locus from one genetic background to another. For example, the desired trait providing reduced expression or function ZMFS2 can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired trait in its genome. Alternatively, for example, transmission of the trait can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired trait can be, e.g., detected by a marker that is associated with a phenotype, at a QTL, a transgene, or the like. Offspring comprising the desired trait may be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, to result in the allele becoming fixed in a selected genetic background.
[0049] The process of “introgressing” is often referred to as “backcrossing” when the process is repeated two or more times.
[0050] A “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic) . A “subline” refers to an inbred subset of descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor.
[0051] A “marker” is a means of finding a position on a genetic or physical map, or else linkages among markers and trait loci (loci affecting traits) . The position that the marker detects may be known via detection of polymorphic alleles and their genetic mapping, or else by hybridization, sequence match or amplification of a sequence that has been physically mapped. A marker can be a DNA marker (detects DNA polymorphisms) , a protein (detects variation at an encoded polypeptide) , or a simply inherited phenotype (such as a MLN resistance) . A DNA marker can be developed from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from a spliced RNA or a cDNA) . Depending on the DNA marker technology, the marker may consist of primers complementary to sequence flanking the locus and / or probes that hybridize to polymorphic alleles at the locus. A DNA marker, or a genetic marker, may also be used to describe the gene, DNA sequence or nucleotide on the chromosome itself (rather than the components used to detect the gene or DNA sequence) and is often used when that DNA marker is associated with a particular trait in human genetics (e.g. a marker for breast cancer) . The term marker locus is the locus (gene, sequence or nucleotide) that the marker detects.
[0052] As used herein, a ‘nucleic acid molecule” is a polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid” , “nucleotide sequence” , “nucleic acid sequence” , and “polynucleotide. ” The term includes single-and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or engineered nucleotide linkages.
[0053] Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc. ) , charged linkages (e.g., phosphorothioates, phosphorodithioates, etc. ) , pendent moieties (e.g., peptides) , intercalators (e.g., acridine, psoralen, etc. ) , chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc. ) . The term “nucleic acid molecule” also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations. An “endogenous nucleic acid sequence” refers to a nucleic acid sequence within a plant cell.
[0054] A virus or vector “transforms” or “transduces” a cell when it transfers nucleic acid molecules into the cell. A cell is “transformed” by a nucleic acid molecule transduced into the cell when the nucleic acid molecule becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication. As used herein, the term “transformation” encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to, transfection with viral vectors, transformation with plasmid vectors, electroporation (Fromm et al., 1986, Nature 319: 791-3) , lipofection (Feigner et al., 1987, Proc. Natl. Acad. Sci. USA 84:7413-7) , microinjection (Mueller et al., 1978, Cell 15: 579-85) , Agrobacterium-mediated transfer (Fraley et al., 1983, Proc. Natl. Acad. Sci. USA 80: 4803-7) , direct DNA uptake, and microprojectile bombardment (Klein et al., 1987, Nature 327: 70) .
[0055] Double-Strand-Break (DSB) Inducing Agents (DSB Agents) . Double-strand breaks can be induced by agents such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non-homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., 2003 Nucleic Acids Res 1: 418-20, Roberts et al., 2003, Nucleic Acids Res 31: 1805-12, and Belfort et al., 2002 in Mobile DNA II, pp. 761-783, Eds. Craigie et al., (ASM Press, Washington, DC) ) , meganucleases (see e.g., International Application Publication WO 2009 / 114321; Gao et al., 2010, Plant Journal 1: 176-187) , and TAL effector nucleases or TALENs (see e.g., US Application Publication US 20110145940 and Christian et al., 2010, Genetics 186 (2) : 757-61) . Methods of targeting DNA double-strand breaks have been described for TALENs (Christian et al., 2010, Genetics 186 (2) : 757-61 and Boch et al., 2009, Science 326 (5959) : 1509-12) , zinc finger nucleases (see e.g. Kim, et al., 1996, Proc. Nat’ l Acad. Sci USA 93 (3) 1156-1160) and CRISPR-Cas endonucleases (see e.g. International Application Publication WO2007 / 025097) .
[0056] Any DSB or -nick or -modification inducing agent may be used for the methods described herein, including for example but not limited to: Cas endonucleases, recombinases, TALENs, zinc finger nucleases, restriction endonucleases, meganucleases, and deaminases.
[0057] Methods and compositions are provided for polynucleotide modification with a CRISPR Associated (Cas) endonuclease. Class I Cas endonucleases comprise multi-subunit effector complexes (Types I, III, and IV) , while Class 2 systems comprise single protein effectors (Types II, V, and VI) (Makarova et al., 2015, Nature Reviews Microbiology 13: 1-15; Zetsche et al., 2015, Cell 163: 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13; Haft et al., 2005, Computational Biology, PLoS Comput Biol 1 (6) : e60; and Koonin et al., 2017, Curr Opinion Microbiology 37: 67-78) . In Class 2 Type II systems, the Cas endonuclease acts in complex with a guide RNA (gRNA) that directs the Cas endonuclease to cleave the DNA target to enable target recognition, binding, and cleavage by the Cas endonuclease. The gRNA comprises a Cas endonuclease recognition (CER) domain that interacts with the Cas endonuclease, and a Variable Targeting (VT) domain that hybridizes to a nucleotide sequence in a target DNA. In some aspects, the gRNA comprises a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA) to guide the Cas endonuclease to its DNA target. The crRNA comprises a spacer region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrRNA, forming an RNA duplex. In many systems, the Cas endonuclease-guide polynucleotide complex recognizes a short nucleotide sequence adjacent to the target sequence (protospacer) , called a “protospacer adjacent motif” (PAM) .
[0058] Examples of a Cas endonuclease include but are not limited to Cas9, Cas12f, Cas12a or Cpf1, and variants thereof (See e.g., US Patent No. 10,934,536 and International Application Publication WO 2022 / 082179) . Cas9 (formerly referred to as Cas5, Csn1, or Csx12) is a Class 2 Type II Cas endonuclease (Makarova et al., 2015, Nature Reviews Microbiology 13: 1-15) . For Cas9 and Cas12f, a Cas-gRNA complex recognizes a 3’ PAM sequence at the target site, permitting the spacer of the guide RNA to invade the double-stranded DNA target, and, if sufficient homology between the spacer and protospacer exists, generate a DSB cleavage. Cas9 endonucleases comprise RuvC and HNH domains that together produce DSBs, and separately can produce single strand breaks. For the S. pyogenes Cas9 endonuclease, the DSB leaves a blunt end. Cpf1 is a Class 2 Type V Cas endonuclease, and comprises a nuclease RuvC domain but lacks an HNH domain (Yamane et al., 2016, Cell 165: 949-962) . Cas12f can generate 5’ staggered overhangs at DSB sites (Karvelis et al., Nucl Acids Res 48 (12) : 5016-5023) . Cpf1 endonucleases create “sticky” overhang ends.
[0059] Some uses for Cas-gRNA systems at a genomic target site include but are not limited to insertions, deletions, substitutions, or modifications of one or more nucleotides at the target site; modifying or replacing nucleotide sequences of interest (such as a regulatory elements) ; insertion of polynucleotides of interest; gene dropout; gene knock-out; gene knock in; modification of splicing sites and / or introducing alternate splicing sites; modifications of nucleotide sequences encoding a protein of interest; amino acid and / or protein fusions; and gene silencing by expressing an inverted repeat into a gene of interest. Genome editing using DSB-inducing agents, such as Cas9-gRNA complexes, has been described, for example in U.S. Patent Application No. 2015 / 0082478, US Patent No. 10,934,536, International Application Publication WO2015 / 026886 A1, International Application Publication WO2016007347, International Application Publication WO201625131, and International Application Publication WO 2022 / 082179 all of which are incorporated by reference herein.
[0060] Recombinant Constructs and Transformation of Cells. Polynucleotides can be introduced into a cell (in some case along with the disclosed DSB agents e.g., CRISPR-Cas endonucleases) . Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds produced by the methods described herein. In a preferred aspect of the disclosure, the cells are maize cells.
[0061] Standard recombinant DNA and molecular cloning techniques used herein are known in the art and are described more fully in Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989) . Transformation methods are well known to those skilled in the art and are described infra.
[0062] Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory or analysis. In some examples a recognition site and / or target site can be comprised within an intron, coding sequence, 5' UTRs, 3' UTRs, and / or regulatory regions.
[0063] In one aspect, the constructs of the disclosure comprise a promoter operably linked to a nucleotide sequence encoding a DSB Agent, such as a CAS nuclease (e.g., gene encoding a Streptococcus pyrogenes Cas9 gene or Cas12f gene) and a promoter operably linked to a guide RNA of the present disclosure. The promoter is capable of driving expression of an operably linked nucleotide sequence in a prokaryotic or eukaryotic cell / organism. In some aspects, target specific guide RNAs are built as a fusion of CRISPR RNA (crRNA) fused to trans-activating CRISPR RNA (tracrRNA) of Streptococcus pyrogenes.
[0064] In accordance with the methods disclosed herein, a guide RNA comprising any of SEQ ID NOs: 19-25) can be used to introduce polynucleotides described herein.
[0065] The isolated polynucleotides, constructs and vectors disclosed herein (e.g., for expression of endonucleases or guide RNAs) can comprise a selectable marker to identify or select for or against a molecule or a cell that comprises the construct or vector. Examples of selectable or scorable markers that can be used in a construct or vector disclosed herein include DsRed and Glyphosate N-Acetyltransferase (GAT) gene variant 4621 for herbicide resistance.
[0066] Isolated Nucleic Acid Molecules. An “isolated” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e.g., RNA or DNA) that is no longer in its natural environment, for example in vitro. A “recombinant” nucleic acid molecule (e.g., RNA or DNA) is used herein to refer to a nucleic acid sequence (e.g., RNA or DNA) that is in a recombinant bacterial or plant host cell; has been edited from its native sequence; or is located in a different location than the native sequence. In some embodiments, an “isolated” or “recombinant” nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5′and 3′ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For purposes of the disclosure, “isolated” or “recombinant” when used to refer to nucleic acid molecules excludes isolated chromosomes. For example, in various embodiments, the recombinant nucleic acid molecules can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequences that naturally flank a ZMFS2 gene variant in the genome of the cell.
[0067] “Percent (%) sequence identity” with respect to a reference sequence (subject) is determined as the percentage of amino acid residues or nucleotides in a candidate sequence (query) that are identical with the respective amino acid residues or nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any amino acid conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways, for instance, using publicly available computer software such as BLAST, BLAST-2. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., percent identity of query sequence = number of identical positions between query and subject sequences / total number of positions of query sequence ×100) .
[0068] Nucleotide Constructs, Expression Cassettes and Vectors. The use of the term “construct” in connection with isolated and / or heterologous polynucleotides herein is not intended to limit the disclosure to constructs comprising DNA. Polynucleotide constructs, particularly polynucleotides and oligonucleotides composed of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides, may also be employed in the methods disclosed herein. The isolated polynucleotide constructs, nucleic acids, and nucleotide sequences disclosed herein additionally encompass all complementary forms (e.g., the reverse complement) of each sequence disclosed for such a construct. Further, polynucleotide constructs and nucleotide sequences disclosed herein can encompass any such constructs, molecules, and sequences suitable for use in a method for transforming plant material disclosed herein. Such constructs can include naturally occurring molecules and / or synthetic analogues. The disclosed nucleotide constructs, nucleic acids, and nucleotide sequences also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures and the like.
[0069] Transformed organisms disclosed herein include plant cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae. The transformed organism comprises a disclosed sequence (e.g., as part of a construct, expression cassette, or vector comprising the nucleotide sequence disclosed herein which are associated with increased disease resistance.
[0070] The disclosed sequences can be used in constructs for expression in the organism of interest. Constructs can include 5’ and 3’ ; regulatory sequences operably linked to an R gene sequence, variant or fragment disclosed herein. The term “operably linked” as used herein refers to a functional linkage between a promoter and / or a regulatory sequence and a second sequence, wherein the promoter and / or regulatory sequence initiates, mediates, and / or affects transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary, to join two protein coding regions in the same reading frame. The construct may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene (s) can be provided on multiple DNA constructs.
[0071] Such a DNA construct is provided with a plurality of restriction sites for insertion of the polypeptide gene sequence of the disclosure to be under the transcriptional regulation of the regulatory regions. The DNA construct may additionally contain selectable marker genes.
[0072] The DNA construct will generally include in the 5' to 3' direction of transcription: a transcriptional and translational initiation region (e.g., a promoter) , a DNA sequence of the embodiments, and a transcriptional and translational termination region (e.g., termination region) functional in the organism serving as a host. The transcriptional initiation region (e.g., the promoter) may be native, analogous, foreign or heterologous to the host organism and / or to the sequence of the embodiments. Additionally, the promoter or regulatory sequence may be the natural sequence or alternatively a synthetic sequence. The term “foreign” as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced. As used herein, the term “heterologous” in reference to a sequence means a sequence that originates from a foreign species or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. Where the promoter is a native or natural sequence, the expression of the operably linked sequence is altered from the wild-type expression, which results in an alteration in phenotype.
[0073] A DNA construct may also include a transcriptional enhancer sequence. An “enhancer” refers to a DNA sequence which can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Various enhancers include, for example, introns with gene expression enhancing properties in plants (US Patent Application Publication Number 2009 / 0144863, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464) ) , the omega enhancer or the omega prime enhancer (Gallie et al. 1989 Molecular Biology of RNA ed. Cech (Liss, New York) 237-256 and Gallie et al. 1987 Gene 60: 217-25) , the CaMV 35S enhancer (see, e.g., Benfey et al. 1990 EMBO J. 9: 1685-96) and the enhancers of US Patent Number 7,803,992 may also be used. The above list of transcriptional enhancers is not meant to be limiting. Any appropriate transcriptional enhancer can be used in the embodiments.
[0074] The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the sequence of interest, the plant host or any combination thereof) .
[0075] Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau et al. 1991 Mol. Gen. Genet. 262: 141-144; Proudfoot 1991 Cell 64: 671-674; Sanfacon et al. 1991 Genes Dev. 5: 141-149; Mogen et al. 1990 Plant Cell 2: 1261-1272; Munroe et al. 1990 Gene 91: 151-158; Ballas et al. 1989 Nucleic Acids Res. 17: 7891-7903 and Joshi et al. 1987 Nucleic Acid Res. 15: 9627-9639.
[0076] Where appropriate, a nucleic acid may be optimized for increased expression in the host organism. Thus, where the host organism is a plant, the synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri 1990 Plant Physiol. 92: 1-11 for a discussion of host-preferred usage. For example, although nucleic acid sequences of the embodiments may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. 1989 Nucleic Acids Res. 17: 477-498) . Thus, the plant-preferred for a particular amino acid may be derived from known gene sequences from plants.
[0077] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other well-characterized sequences that may be deleterious to gene expression. The GC content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. The term “host cell” as used herein refers to a cell which contains a vector and supports the replication and / or expression of the expression vector is intended. Host cells may be prokaryotic cells such as E. coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells or monocotyledonous or dicotyledonous plant cells. An example of a monocotyledonous host cell is a maize host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
[0078] In preparing the expression cassette, the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.
[0079] A number of promoters can be used in the practice of the embodiments. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, inducible
[0080] Plant Transformation. Plant Transformation. Any suitable techniques known in the art for introduction of transgenes into plants may be used to produce a transformed plant or plant cell disclosed herein. Suitable methods for transformation of plants may include virtually any method by which DNA can be introduced into a cell, such as: by electroporation as illustrated in U.S. Patent No. 5,384,253; by microprojectile bombardment, as illustrated in U.S. Patent Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865; by Agrobacterium-mediated transformation as illustrated in U.S. Patent Nos. 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301; and by protoplast transformation, as set forth in U.S. Patent No. 5,508,184, etc. These techniques can be used to transform plant cells and these cells may be developed into transgenic plants by techniques known to those of skill in the art. Techniques for transforming Brassica plants in particular are disclosed, for example, in U.S. Patent No. 5,750,871.
[0081] After effecting delivery of exogenous DNA to recipient cells, transformed cells are identified for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable marker gene with the transformation vector used to generate the transformant. In this case, the potentially transformed cell population can be assayed by exposing the cells to a selective agent or agents, or the cells can be screened for the desired marker.
[0082] Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In some embodiments, any suitable plant tissue culture media may be modified by including further substances, such as growth regulators. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks) , then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturity.
[0083] The alteration (e.g., introduction of a stop codon, mutation or deletion) of an endogenous genein regenerating plants can be confirmed by one or more assays, for example, a molecular biological assay, such as Southern blotting, Northern blotting, or PCR; a biochemical assay, such as detecting the absence of a protein product by immunoassay (ELISA or Western blot) or by screening for reduced enzymatic function; plant part assays, such as leaf or root assays; and analysis of the phenotype of the whole regenerated plant.
[0084] “Stable transformation” as used herein means that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. “Transient transformation” as used herein means that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant. “Plant” as used herein refers to whole plants, plant organs (e.g., leaves, stems, roots, etc. ) , seeds, plant cells, propagules, embryos and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g. callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells and pollen) .
[0085] Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al. (1986) Biotechniques 4: 320-334) , electroporation (Riggs et al. 1986 Proc. Natl. Acad. Sci. USA 83: 5602-5606) , Agrobacterium-mediated transformation (US Patent Numbers 5,563,055 and 5,981,840) , direct gene transfer (Paszkowski et al. 1984 EMBO J. 3: 2717-2722) and ballistic particle acceleration (see, for example, US Patent Numbers 4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes et al. 1995 in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin) and McCabe et al. 1988 Biotechnology 6: 923-926) and Lecl transformation (WO 00 / 28058) . For potato transformation see, Tu et al. 1998 Plant Molecular Biology 37: 829-838 and Chong et al. 2000 Transgenic Research 9: 71-78. Additional transformation procedures can be found in Weissinger et al. 1988 Ann. Rev. Genet. 22: 421-477; Sanford et al. 1987 Particulate Science and Technology 5: 27-37 (onion) ; Christou et al. 1988 Plant Physiol. 87: 671-674 (soybean) ; McCabe et al. 1988 Bio / Technology 6: 923-926 (soybean) ; Finer and McMullen 1991 In Vitro Cell Dev. Biol. 27P: 175-182 (soybean) ; Singh et al. 1998 Theor. Appl. Genet. 96: 319-324 (soybean) ; Datta et al. 1990 Biotechnology 8: 736-740 (rice) ; Klein et al. 1988 Proc. Natl. Acad. Sci. USA 85: 4305-4309 (maize) ; Klein et al. 1988 Biotechnology 6: 559-563 (maize) ; US Patent Numbers 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol. 91: 440-444 (maize) ; Fromm et al. 1990 Biotechnology 8: 833-839 (maize) ; Hooykaas-Van Slogteren et al. 1984 Nature (London) 311: 763-764; US Patent Number 5,736,369 (cereals) ; Bytebier et al. 1987 Proc. Natl. Acad. Sci. USA 84: 5345-5349 (Liliaceae) ; De Wet et al. 1985 in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York) , pp. 197-209 (pollen) ; Kaeppler et al. 1990 Plant Cell Reports 9: 415-418 and Kaeppler et al. 1992 Theor. Appl. Genet. 84: 560-566 (whisker-mediated transformation) ; D'Halluin et al. 1992 Plant Cell 4: 1495-1505 (electroporation) ; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford 1995 Annals of Botany 75: 407-413 (rice) ; Osjoda et al. 1996 Nature Biotechnology 14: 745-750 (maize via Agrobacterium tumefaciens) .
[0086] Marker assisted selection. Molecular markers can be used in a variety of plant breeding applications (e.g. see Staub et al. 1996 Hortscience 31: 729-741; Tanksley 1983 Plant Molecular Biology Reporter. 1: 3-8) . One of the main areas of interest is to increase the efficiency of backcrossing and introgressing genes using marker-assisted selection (MAS) . Thus, MAS can be used for backcrossing and introgressing the traits disclosed herein.
[0087] A molecular marker that demonstrates linkage with a locus affecting a desired phenotypic trait provides a useful tool for the selection of the trait in a plant population. This is particularly true where the phenotype is hard to assay. Since DNA marker assays are less laborious and take up less physical space than field phenotyping, much larger populations can be assayed, increasing the chances of finding a recombinant with the target segment from the donor line moved to the recipient line. The closer the linkage, the more useful the marker, as recombination is less likely to occur between the marker and the gene causing the trait, which can result in false positives. Having flanking markers decreases the chances that false positive selection will occur as a double recombination event would be needed. In the most preferred case, a marker is located within the gene itself, so that recombination cannot occur between the marker and the gene.
[0088] Gene introgression by MAS can be used to diminish linkage drag and yield drag. Gepts 2002 Crop Sci; 42: 1780-1790; Young et al. 1998 Genetics 120: 579-585; Tanksley et al. 1989 Biotechnology 7: 257-264. Markers disclosed herein, as well as other marker types such as SSRs and FLPs, can be used in marker assisted selection protocols. SSRs can be defined as relatively short runs of tandemly repeated DNA with lengths of 6 bp or less, which are often highly suited to mapping and MAS. Tautz 1989 Nucleic Acid Research 17: 6463-6471; Wang et al. 1994 Theoretical and Applied Genetics, 88: 1-6; Levinson and Gutman 1987 Mol Biol Evol 4: 203-221; Weber and May 1989 Am J Hum Genet. 44: 388-396; Rafalski et al. 1996 Generating and using DNA markers in plants. In: Non-mammalian genomic analysis: a practical guide. Academic press. pp 75-135) . FLP markers refer to fragment length polymorphisms that are in many ways similar to SSR markers, except that the region amplified by the primers is not typically a highly repetitive region. Bhattramakki et al. 2002 Plant Mol Biol 48, 539-547; Rafalski 2002b, supra.
[0089] SNP markers detect single base pair nucleotide substitutions, which can be assayed at an even higher level of throughput than SSRs, in so-called “ultra-high-throughput” fashion, as SNPs do not require large amounts of DNA and automation of the assay may be straight-forward. SNPs also have the promise of being relatively low-cost systems. These three factors together make SNPs highly attractive for use in MAS. Several methods are available for SNP genotyping, including but not limited to, hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, minisequencing, and coded spheres. Such methods have been reviewed in: Gut 2001 Hum Mutat 17: 475-492; Shi 2001 Clin Chem 47: 164-172; Kwok 2000 Pharmacogenomics 1: 95-100; and Bhattramakki and Rafalski 2001 Discovery and application of single nucleotide polymorphism markers in plants. In: R. J. Henry, Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI Publishing, Wallingford. A wide range of commercially available technologies utilize these and other methods to interrogate SNPs including Masscode. TM. (Qiagen) , (Third Wave Technologies) and Invader (Applied Biosystems) , (Applied Biosystems) and (Illumina) .
[0090] In addition to SSR's , FLPs and SNPs, as described above, other types of molecular markers are also widely used, including but not limited to expressed sequence tags (ESTs) , SSR markers derived from EST sequences, randomly amplified polymorphic DNA (RAPD) , and other nucleic acid-based markers. Isozyme profiles and linked morphological characteristics can, in some cases, also be indirectly used as markers. Even though they do not directly detect DNA differences, they are often influenced by specific genetic differences. However, markers that detect DNA variation are far more numerous and polymorphic than isozyme or morphological markers (Tanksley 1983 Plant Molecular Biology Reporter 1: 3-8) .
[0091] The following are specific examples of some aspects of the disclosure. The examples are offered for illustrative purposes only and are not intended to limit the scope of the disclosure in any way. EXAMPLESExample 1: ZMFS2 cloning.
[0092] 1. Extraction of total RNA from maize inbred line B73
[0093] (1) With maize B73 leaves in a mortar sterilized at high temperature, liquid nitrogen was poured in to accomplish rapid freezing, followed by grinding to a powder, which was then transferred into a centrifuge tube, and 500 μL of RNA-easy extraction liquid was immediately added.
[0094] (2) 500 μL of RNase-free ddH2O was added, the tube was inverted to mix evenly, then left to stand for 5 min at room temperature.
[0095] After centrifugation at 12,000 g for 15 min, the supernatant was collected and transferred into a new centrifuge tube, an equal volume of isopropanol was added, and after mixing evenly, the tube was left to stand for 10 min at room temperature.
[0096] After centrifugation at 12,000 g for 10 min, the supernatant was discarded, and 500 μL of 75%ethanol was used to wash the precipitate, flicking the bottom of the tube so that the precipitate came into full contact with the liquid; after centrifugation at 8,000 g for 3 min, the supernatant was discarded, and the above steps were repeated to wash a second time.
[0097] (5) The tube was placed in an ultra-clean workbench and dried for about 3 min, then 30 μl of RNase-Free aqueous solution was added.
[0098] (6) An ultra-micro spectrophotometer was used to measure the OD value and concentration of the RNA sample, with A260 / A280 = 1.8 –2.0 being preferred; the mass of RNA was measured by agarose gel electrophoresis.
[0099] 2. Reverse transcription of RNA to cDNA
[0100] (1) The reagents in Table 1 were added to a centrifuge tube in sequence (20 μl reaction system) : Table 1
[0101] (2) After mixing evenly by pipetting, 42℃ for 2 min.
[0102] (3) 4 μl of 5 x HiScript IIIqRT SuperMix was added to the centrifuge tube.
[0103] (4) After mixing evenly, 25℃ for 5 min, 50℃ for 15 min, 85℃ for 5 min, followed by storage at -20℃ ready for use.
[0104] 3. ZMFS2 gene cloning
[0105] Primer sequence used:
[0106] ZMFS2‐F1: 5’ ‐TAGAGCGGCGGCGGCGGGC‐3’ (SEQ ID NO: 3) ; ZMFS2‐R1: 5’ ‐GAGAAGCATCCAAAATACTC‐3’ (SEQ ID NO: 4) .
[0107] Table 2 shows the reaction system using the high-fidelity enzyme KOD to perform amplification (20 μl system) . Table 2
[0108] Amplification conditions:
[0109] (1) 5℃, 2 min;
[0110] (2) 98℃, 10 s;
[0111] (3) 60℃, 30 s;
[0112] (4) 68℃, 45 s;
[0113] (5) steps (2) – (4) cycled 34 times;
[0114] (6) 68℃, 7 min;
[0115] (7) 15℃, storage.
[0116] When amplification had ended, a loading Buffer was added, then agarose gel electrophoresis detection was performed; as shown in Fig. 1, the amplified ZMFS2 gene CDS sequence length was 1011 bp. Gel recovery of the cloned fragments was performed.
[0117] 4. Linking of target gene with gateway vector
[0118] The reaction system was as follows: DNA recovery fragments: 7 μl; Gateway vector pENTR-T: 1 μl; T4 Ligase: 1 μl; T4 Buffer: 1 μl; 16℃, linking overnight.
[0119] 5. Transformation of plasmid or DNA linking product to E. coli competent state
[0120] (1) 10 μL of the linking product was added to 50 μl of DH5α competent cells; after mixing evenly, the mixture was put in an ice bath for 30 min.
[0121] (2) 42℃, heat shock for 1 min, on ice for 2 min; 800 μl of LB culture medium was added, followed by shaking for 1 h at 37℃ and 220 rpm.
[0122] (3) Centrifugation for 2 min at room temperature and 5000 rpm, and the supernatant was discarded; a small amount of supernatant suspended bacterial mass was retained, and then spread on an LB plate containing a corresponding antibiotic, then inverted and cultured overnight at 37℃.
[0123] (4) A single clone was picked and subjected to colony PCR identification, a positive clone was chosen for sequencing, and a clone with the correct sequencing result was separately named ZmFS2; the nucleotide sequence of cDNA of this gene is shown in SEQ ID NO: 1, and the amino acid sequence which it encodes is as shown in SEQ ID NO: 2.Example 2: Construction of ZMFS2 overexpression vector and disease resistance function verification of transgenic line.
[0124] 1. Construction of maize ZMFS2 overexpression vector
[0125] (1) BamH1 and Xma1 restriction sites were respectively added to two ends of the gene ZMFS2, and the overexpression vector pCAMBIA3301 and ZMFS2 fragment were subjected to double enzyme digestion.
[0126] (2) After gel recovery, linking was performed with T4 DNA ligase.
[0127] (3) Transformation of E. coli competent DH5α; a positive clone resulting from PCR identification was sent to a company for sequencing, and a correct plasmid vector was named pCAMBIA3301: : ZMFS2.
[0128] 2. Plasmid transformation of agrobacterium
[0129] (1) 1 μg of pCAMBIA3301: : ZMFS2 plasmid was transformed into the EHA105 competent state, and after mixing evenly, the mixture was placed on ice for 30 min.
[0130] (2) Liquid nitrogen rapid freezing for 1 min; 37℃ for 3 min; 800 μl of LB liquid culture medium was added, followed by shaking for 3 h at 28℃ and 220 rpm.
[0131] (3) Centrifugation for 2 min at room temperature and 5000 rpm, and the supernatant was discarded.
[0132] (4) A small amount of supernatant suspended bacterial mass was retained, and then spread on an LB culture plate containing a corresponding antibiotic, then inverted and cultured for 48 h at 28℃; a single clone was picked and subjected to colony PCR identification, and a positive clone was stored in a refrigerator at -80℃.
[0133] 3. Genetic transformation of maize
[0134] Agrobacterium EHA105 containing the pCAMBIA3301: : ZMFS2 plasmid vector was sent to a biological company for transformation of maize inbred line B104, to obtain a transgenic line.
[0135] 4. Western blot detection of ZMFS2 transgenic maize plant
[0136] (1) Preparation of SDS-PAGE concentrating gel and separating gel:
[0137] First, 10%separating gel was prepared; once the separating gel had been prepared, water was added to perform layer sealing, until a clear boundary line was formed, then the separating gel congealed, and an upper layer of liquid was removed; 5%concentrating gel was prepared, and after the concentrating gel had been prepared, a comb was inserted, and the gel was left to stand for 0.5 h until the concentrating gel had congealed. The formula of the 10%separating gel is shown in Table 3. Table 3
[0138] The formula of the 5%concentrating gel is shown in Table 4. Table 4
[0139] (2) Preparation of sample:
[0140] 200 mg of leaves were collected in a 2 ml centrifuge tube, ceramic beads were added, liquid nitrogen was put in to accomplish rapid freezing, then the sample was beaten to a powder in a sample beater (40 Hz, 30 s) , 200 μL of protein extraction buffer was added, and after thoroughly mixing until uniform, the mixture was put in an ice bath for 30 min. The formula of the protein extraction buffer is shown in Table 5. Table 5
[0141] (3) Centrifugation was performed for 15 min at 4℃ and 12000 rpm, 15 μL of supernatant was collected and mixed evenly with 15 μL of 2x laemmlli (containing 5%mercaptoethanol) , in preparation for sample loading.
[0142] (4) SDS-PAGE gel was put in an electrophoresis tank, 1x Running buffer was poured in, the comb was taken out vertically, and 15 μL samples were collected for loading; 80 V for 20 min, 150 V for 1 h.
[0143] Table 6 shows the formula of the 10x Running buffer. Table 6
[0144] (5) Membrane transfer
[0145] a. Once gel running had ended, an upper layer of concentrating gel was removed, separating gel was put in a glass dish loaded with ddH2O for cleaning, and a ready-cut NC membrane (5.8 x 8.5 cm) and filter paper (8 x 10 cm) were put in 1x membrane transfer buffer for cleaning, ready for use.
[0146] b. The black side of the membrane transfer clamp was placed facing down; sponge, filter paper, separating gel, NC membrane, filter paper and sponge were placed in sequentially, driving away excess bubbles after each placement; after fixing, this was placed in a membrane transfer tank in which an ice pack had already been placed, and pre-cooled 1x membrane transfer buffer was added.
[0147] c. The electrophoresis tank was put in an ice water mixture for membrane transfer, with a current of 160 –200 mA for 2.25 h.
[0148] The formula of the 10x membrane transfer buffer is shown in Table 7 (DDH2O was used to make up the volume to 1L, and HCL was used to adjust the PH to 8.3) . Table 7
[0149] (6) Blocking
[0150] Once membrane transfer had ended, it was placed in blocking solution (4%skimmed milk powder) and blocked for 1.5 h.
[0151] (7) Primary antibody
[0152] The blocking solution was removed, the NC membrane was transferred into a primary antibody solution (1 : 5000) , and incubated for 2 h at room temperature on a horizontal shaker.
[0153] (8) Secondary antibody
[0154] The primary antibody was poured out, the membrane was washed 3 times in 1x PBST, for 10 min each time, secondary antibody (1 : 4000) was added, and incubation was performed for 1.5 h at room temperature on a horizontal shaker.
[0155] (9) The secondary antibody was poured out, the membrane was washed 2 times in 1x PBST and once in 1x PSB, for 10 min each time.
[0156] (10) Using an ECL kit, AB colour development solution was mixed in equal quantities, the liquid mixture was collected and evenly spread on the front side of the NC membrane; finally, a chemiluminescence analyser was used for development. The Western blot identification results for ZMFS2 transgenic overexpression plants are shown in Fig. 2.
[0157] 5. Identification of southern leaf blight and anthracnose inoculated into maize leaves in-vitro.
[0158] (1) Bipolaris maydis and Glomerella graminicola, which cause southern leaf blight and anthracnose in maize, were separately grown on V8 culture medium, and cultured in dark conditions in an incubator at 28℃.
[0159] (2) Preparation of spore elution solution: agar powder 0.5 g / L, Tween-20 0.5 ml / L, ddH2O to make up the volume to 1 L, high-pressure sterilization.
[0160] (3) A suitable amount of spore elution solution was added to the culture plates, the culture plates were scraped and filter paper was used for filtration, a hemocytometer was used for counting under a microscope, and the fungal suspension was diluted to 1 x 106 per ml.
[0161] (4) Two layers of filter paper were spread on a black tray, maize leaves were stuck onto the filter paper, holes were punched in the leaves, a suitable amount of sterile water was added to the tray, then 10 μl of fungal suspension was collected and dripped onto the holes.
[0162] (5) Cling film was used to seal the tray for better retention of moisture, followed by two days in dark conditions, photographs were taken to observe the disease spot phenotypes, and Image J was used for statistical analysis. The identification found that the ZMFS2 overexpression line (Y12-21 pos, Y12-25 pos) was more susceptible to anthracnose than the corresponding negative line (Y12-21 neg, Y12-25 neg) , and the identification results are shown as A and B in Fig. 3; the ZMFS2 overexpression line (Y12-21 pos, Y12-25 pos) was more susceptible to southern leaf blight than the corresponding negative line (Y12-21 neg, Y12-25 neg) , and the identification results are shown as C and D in Fig. 3.
[0163] 6. Disease resistance identification of southern leaf blight in field and northern leaf blight in field
[0164] In mid-May, maize material was planted in Qingdao, and the southern leaf blight phenotype after flowering was analysed statistically in the field. Graded identification, i.e., scoring was performed according to the severity of disease, with a total of 9 grades (1 –9) ; the greater the disease area, the lower the grade. The ZMFS2 overexpression line was more susceptible to southern leaf blight in the field than its corresponding negative line; the scoring results are shown as A and B in Fig. 4.
[0165] In late April, maize was planted in Changchun, Jilin, and the northern leaf blight phenotype after flowering was analysed statistically in the field. Graded identification was performed according to the severity of disease, with a total of 9 grades (1 –9) ; the greater the disease area, the higher the grade. The ZMFS2 overexpression line was more susceptible to northern leaf blight in the field than its corresponding negative line; the scoring results are shown as C and D in Fig. 4.
[0166] 7. Disease resistance identification of stalk rot and seed rot in maize
[0167] (1) Fusarium verticillioides was cultured in a PDA culture medium, growing the hyphae in the middle of the PDA, and performing culture in dark conditions in an incubator at 28℃.
[0168] (2) A fungal mass of Fusarium verticillioides was picked in a mung bean culture medium and cultured for 48 h on a shaker at 28℃. The fungal suspension was filtered through four layers of gauze, then centrifuged at 1000 g for 5 min, and the supernatant was discarded. A suitable amount of sterilized ddH2O was added to fully dissolve the fungal mass, counting was performed using a hemocytometer, and dilution to 1 x 106 per ml was performed.
[0169] (3) Stalk rot: 500 μl of fungal suspension was collected in a 1 ml syringe, injected into the third node of maize, and the inoculation region was sealed; after two weeks, the third node was chopped off and split in the middle, and the disease spot grade or score was analysed statistically. There were 5 grades in total (1 –5) ; the greater the disease area, the higher the grade. The ZmFS2 overexpression line (Y12-21 pos, Y12-25 pos) was more susceptible to stalk rot than its corresponding negative line (Y12-21 neg, Y12-25 neg) ; the identification results are shown as A and B in Fig. 5.
[0170] (4) Seed rot: Seeds were washed in 70%ethanol for 5 min, in sterile water for 1 min, in 2.5%sodium hypochlorite for 10 min, and finally rinsed in sterile water for 5 min three times. The seeds were wiped dry, and a cut was made in the embryo side with a blade. 4 seeds were put in a 20 ml bottle, 200μl of spore suspension was inoculated, vortexing was performed to evenly coat the seeds with the suspension, the cap was loosened slightly, and the bottle was put in a plastic container to create a humidity chamber. Culturing was performed for 3 –7 days at 28℃. The ZmFS2 overexpression line (Y12-25 pos) was more susceptible to seed rot than its corresponding negative line (Y12-25 neg) ; the identification results are shown as C and D in Fig. 5.Example 3: ZMFS2 mutant identification and disease resistance functional verification
[0171] 1. Extraction of maize DNA by CTAB method
[0172] Mutants 37429 (ZmFS2-1) and 43908 (ZmFS2-2) of the ZmFS2 gene were screened and purchased from the UniformMu maize mutant library (http: / / chinamu. jaas. ac. cn / cindex. html) . Seeds of the ZMFS2-1 and ZMFS2-2 mutants were sown in the field, and maize leaves were collected and put in a 96-well DNA extraction plate, rapidly frozen with liquid nitrogen, and then pulverized to a powder. 250 μl of CTAB extraction solution was added and mixed in evenly, then the mixture was left to stand for 30 min at 65℃. An equal quantity of trichloromethane was added, the mixture was left to stand at room temperature for several minutes until separation into layers occurred, then centrifugation was performed at 4000 rpm for 30 min. 100 μl of supernatant was collected and put in a 96-well plate, an equal quantity of isopropanol was added and mixed in evenly, then the mixture was left to stand overnight at -20℃. Centrifugation was performed at 4000 rpm for 30 min, the supernatant was removed, 100 μl of 75%ethanol was added, centrifugation was performed for 15 min, and this step was repeated once. The supernatant was discarded, the precipitate was blown dry, a suitable amount of ddH2O was added to dissolve, followed by storage at 4℃ ready for use.
[0173] The formula of the CTAB extraction solution is shown in Table 8. Table 8
[0174] 2. Identification of ZMFS2 mutant
[0175] The ZmFS2 transposon insertion sites were located at site 68 (Zmfs2-1) and site 424 (Zmfs2-2) of the 3’ UTR region of the ZmFS2 sequence. Primers were designed according to the ZmFS2-1 and ZmFS2-2 mutant insertion sites to perform identification; A in Fig. 6 shows the positions of the identification primers in the ZmFS2 gene.
[0176] F1: AGTAGGATTTCGCTCCCTT (SEQ ID NO: 5) ;
[0177] R1: CATTATTCCCACCCTCTCA (SEQ ID NO: 6) ;
[0178] F2: AGCACGGTAATACAAGAAGTGTT (SEQ ID NO: 7) ;
[0179] R2: ACATCAAGGAGGCGCTGGG (SEQ ID NO: 8) ;
[0180] TIR8: CGCCTCCATTTCGTCGAATCCCCTS (SEQ ID NO: 9) .
[0181] The reaction reagents are shown in Table 9. Table 9
[0182] The amplification conditions were as follows:
[0183] (1) 95℃, 2 min;
[0184] (2) 98℃, 10 s;
[0185] (3) 58℃, 30 s;
[0186] (4) 68℃, 1 min;
[0187] (5) steps (2) – (4) , cycled 30 times;
[0188] (6) 68℃, 5 min;
[0189] (7) 15℃, storage.
[0190] When PCR had stopped, agarose gel electrophoresis detection identification was performed. When FR had no bands, but F+TIR8 and R+TIR8 had bands, it was homozygous; when FR had bands, but F+TIR8 and R+TIR8 had no bands, it was wild type. The identification results are shown as B in Fig. 6.
[0191] After identifying ZmFS2-1 and ZmFS2-2 and their corresponding wild types, the transcription levels of ZmFS2 in the ZmFS2-1 and ZmFS2-2 mutants were through quantitative PCR. The content of ZmFS2 in the ZmFS2-1 and ZmFS2-2 mutants was reduced, and the results are shown as C in Fig. 6.
[0192] 3. Disease resistance identification of southern leaf blight and northern leaf blight in fields
[0193] In mid-May, maize material was planted in Qingdao, and the southern leaf blight phenotype after flowering was analysed statistically in the field. Graded identification was performed according to the severity of disease, with a total of 9 grades or scores (1 –9) ; the greater the disease area, the lower the grade. The ZMFS2 mutant line (ZMFS2-1 homo) was more resistant to southern leaf blight in the field than its corresponding wild type (ZMFS2-1 WT) ; the identification results are shown as A and B in Fig. 7.
[0194] In late April, maize was planted in Changchun, Jilin, and the northern leaf blight phenotype after flowering was analysed statistically in the field. Graded identification, i.e., scoring, was performed according to the severity of disease, with a total of 9 grades or scores (1 –9) ; the greater the disease area, the higher the grade. The ZMFS2 mutant line was more resistant to northern leaf blight in the field than its corresponding wild type; the identification results are shown in Fig. 7, panels C and D.
[0195] 4. Disease resistance identification of stalk rot and seed rot in maize
[0196] (1) Fusarium verticillioides was cultured in a PDA culture medium, growing the hyphae in the middle of the PDA, and performing culture in dark conditions in an incubator at 28℃.
[0197] (2) A fungal mass of Fusarium verticillioides was picked in a mung bean culture medium and cultured for 2 on a shaker at 28℃. The fungal suspension was filtered through four layers of gauze, then centrifuged at 1000 g for 5 min, and the supernatant was discarded. A suitable amount of sterilized ddH2O was added to fully dissolve the fungal mass, counting was performed using a hemocytometer, and dilution to 1 x 106 per ml was performed.
[0198] (3) Stalk rot: 500 μl of fungal suspension was collected in a 1 ml syringe, injected into the third node of maize, and the inoculation region was sealed; after two weeks, the third node was chopped off and split in the middle, and the disease spot grade was analysed statistically. There were 5 grades or scores in total (1 –5) ; the greater the disease area, the higher the grade. The ZMFS2 mutant line was more resistant to stalk rot than its corresponding wild type line; the identification results are shown as in Fig. 8, panels A and B.
[0199] (4) Seed rot: Seeds were washed in 70%ethanol for 5 min, in sterile water for 1 min, in 2.5%sodium hypochlorite for 10 min, and finally rinsed in sterile water for 5 min three times. The seeds were wiped dry, and a cut was made in the embryo side with a blade. 4 seeds were put in a 20 ml bottle, 200μL of spore suspension was inoculated, vortexing was performed to evenly coat the seeds with the suspension, the cap was loosened slightly, and the bottle was put in a plastic container to create a humidity chamber. Culturing was performed for 3 –7 days at 28℃. The ZMFS2 mutant line was more resistant to seed rot than its corresponding wild type line; the identification results are shown in Fig. 8, panels C and D.
[0200] 5. Disease resistance identification of southern rust in maize
[0201] In November, maize was planted in Hainan, and the southern rust phenotype after flowering was analysed statistically in the field. Grading was performed according to the severity of disease, with a total of 9 grades or scores (1 –9) ; the greater the disease area, the higher the grade. As shown in Fig. 9, it can be seen that the ZMFS2 mutant line was more resistant to southern rust than its wild type.
[0202] Example 4: Construction of ZmFS2 gene editing vector and disease resistance function verification of edited line
[0203] 1. Construction of maize ZmFS2 gene editing vector
[0204] For ZmFS2, two targets gRNA1 and gRNA2 were designed; the nucleotide sequences of gRNA1 and gRNA2 are respectively as shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively corresponding to the nucleotides at sites 333 –352 and the nucleotides at sites 642 –661 in SEQ ID NO: 1. gRNA1 was the F primer, gRNA2 was the R primer, and a BsaI restriction site was introduced at the 5’ end of FR, the gRNA1 –sgRNA –gRNA2 fragment was amplified, and BsaI was used to subject the fragment and the CRISPR / CAS9 vector to enzyme digestion. T4 Ligase was used for linking, then sequencing was performed by a company to obtain the correct clone, which was CRISPR-ZmFS2.
[0205] 2. Genetic transformation of maize
[0206] The CRISPR-ZmFS2 plasmid was transformed to the agrobacterium EHA105 competent state, and sent to a company to transform the B104 maize inbred line, to obtain a transgenic line.
[0207] 3. Identification of ZmFS2 gene edited maize line
[0208] Primer sequences used:
[0209] ZmFS2‐gDNA1‐F1: TCTAGAGCTAGAGCGG (SEQ ID NO: 12) ;
[0210] ZmFS2‐gDNA1‐R1: AGGAAAGGAAACGATCTGAGGC (SEQ ID NO: 13) ;
[0211] ZmFS2‐gDNA2‐F1: TACTGCAAGGAGGTCCGGG (SEQ ID NO: 14) ;
[0212] ZmFS2‐gDNA2‐R1: CCCCAACGCGCTCACCATCCTGC (SEQ ID NO: 15) ;
[0213] Cas9‐F: GTGGCCTATTCTGTGCTGGT (SEQ ID NO: 16) ;
[0214] Cas9‐R: ATCCCGGTGCTTGTTGTAGG (SEQ ID NO: 17) .
[0215] Detection was performed to ascertain whether Cas9 was contained; the reaction system was as shown in Table 10. Table 10
[0216] Maize material containing no Cas9 was selected for PCR amplification; the reaction conditions were as shown in Table 11. Table 11
[0217] When PCR had stopped, agarose gel electrophoresis detection was performed; if the band was correct, it was sent to a sequencing company for sequencing using ZmFS2‐gDNA1‐F1 and ZmFS2‐gDNA2‐F1 primers.
[0218] Through sequencing identification, a mutant line that contained no CAS9 but in which the ZmFS2 gene was successfully edited was obtained; this was named Y2-1, and the nucleotide sequence thereof was as shown in SEQ ID NO: 18. A, B and C in Fig. 10 show the post-editing sequence changes in the edited mutant line.
[0219] 4. Inoculation identification of in vitro anthracnose of maize leaves
[0220] (1) Colletotrichum graminicola, which causes anthracnose of maize, was grown on a PDA culture medium, being cultured in dark conditions in an incubator at 28℃.
[0221] (2) After preparing a spore elution solution, a fungal suspension was collected, filtered into a new 50 ml centrifuge tube, and adjusted to 5 x 105 per ml.
[0222] (3) Leaves were evenly spread on filter paper, and the needle head of a syringe was used to make holes on the leaves; fungal suspension was dripped above the holes on the leaves, and after keeping moist, treatment was carried out in dark conditions; on the third day, a photograph was taken to observe the disease spot phenotype, and the disease spot area was analysed statistically using Image J software. The ZmFS2 gene edited line was more resistant to anthracnose than its corresponding wild type line; the identification results are shown as A and B in Fig. 11.
[0223] The above are merely preferred examples of the present disclosure, which are not intended to limit it; to a person skilled in the art, various changes and modifications to the present disclosure are possible. Any amendments, equivalent substitutions or improvements, etc. made within the spirit and scope of the present disclosure should be included in the scope of protection thereof.
Claims
1.A method of altering a maize plant, cell, or germplasm thereof which is susceptible to southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, seed rot or a combination thereof, the method comprising reducing expression or function of ZmFS2 gene in the susceptible plant, cell, or germplasm to thereby produce an altered plant, cell, or germplasm comprising an altered genome, wherein the altered maize plant, cell, or germplasm thereof has improved resistance to southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, or seed rot relative to the susceptible maize plant, germplasm or cell thereof.2.The method of claim 1, wherein the method comprises reducing ZmFS2 gene expression in the in the susceptible plant, cell, or germplasm thereof by gene silencing.3.The method of claim 1, wherein the method comprises reducing ZmFS2 gene expression in the in the susceptible plant, cell, or germplasm thereof by transposon insertion.4.[Corrected under Rule 26, 19.12.2025]The method of claim 1, wherein the method comprises reducing ZmFS2 gene expression in the in the susceptible plant, cell, or germplasm thereof by gene editing.5.The method of claim 1, wherein the method comprises reducing ZmFS2 gene expression in the in the susceptible plant, cell, or germplasm thereof by mutagenesis.6.[Corrected under Rule 26, 19.12.2025]The method of claim 2, wherein the method comprises reducing ZmFS2 gene expression in the in the susceptible plant, cell, or germplasm thereof by altering genomic sequence in the susceptible plant, cell, or germplasm to produce non-coding RNA having silencing activity towards RNA ZMFS2.7.The method of any one of claims 1-6, wherein the ZMFS2 gene encodes an amino acid sequence having at least 90%amino acid sequence identity to SEQ ID NO: 2.8.The method of any one of claims 1-6, wherein the ZMFS2 gene encodes an amino acid sequence having at least 95%amino acid sequence identity to SEQ ID NO: 2.9.The method of any one of claims 1-6, wherein the ZMFS2 gene encodes an amino acid sequence having at least 98%amino acid sequence identity to SEQ ID NO: 2.10.The method of any one of claims 1-6, wherein the ZMFS2 gene encodes an amino acid sequence comprising SEQ ID NO: 2.11.The method of any one of claims 1-6, wherein the ZMFS2 gene cDNA comprises 90%nucleotide sequence identity to SEQ ID NO: 1.12.The method of any one of claims 1-6, wherein the ZMFS2 gene cDNA comprises 95%nucleotide sequence identity to SEQ ID NO: 1.13.The method of any one of claims 1-6, wherein the ZMFS2 gene cDNA comprises 98%nucleotide sequence identity to SEQ ID NO: 1.14.The method of any one of claims 1-6, wherein the ZMFS2 gene cDNA comprises SEQ ID NO: 1.15.An altered maize plant, cell or germplasm thereof, which is produced by the method of any one of claims 1-14.16.A method of introducing reduced expression or function of the ZMFS2 gene into a maize plant comprising:a. crossing a first parent maize plant with a second parent maize plant to produce progeny plants, wherein the first parent plant is a plant having reduced expression or function of ZMFS2 gene relative to the second parent plant and wherein the second maize plant is susceptible to southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, seed rot or a combination thereof; andb. selecting at least one progeny plant comprising reduced expression or function of ZMFS2 gene relative to the second parent maize plant.17.The method of claim 24 further comprising:a. crossing the selected progeny plants with the second parent plant to produce backcross progeny plants; andb. selecting at least one backcross progeny plant comprising reduced expression or function of ZMFS2 gene relative to the second parent plant.18.The method of claim 16 or 17, wherein seed of the selected progeny or backcross progeny plant comprises improved resistance to southern leaf blight, northern leaf blight, southern rust, anthracnose, stalk rot, or seed rot relative to the susceptible maize plant, germplasm or cell thereof relative to the second parent maize plant.