Nucleic acid conjugate and pharmaceutical composition for lipid delivery, and use thereof

Abstract

A nucleic acid conjugate comprising a small nucleic acid, lipid group II located at the 5' end and / or 3' end of the small nucleic acid, and lipid group I located at any position of the small nucleic acid other than the position where the lipid group II is located. The lipid group I is as shown in general formula (I), and the lipid group II is as shown in general formula (II).

Description

A nucleic acid conjugate for lipid delivery, a pharmaceutical composition and its application Technical Field

[0001] This disclosure belongs to the field of biomedical technology, specifically relating to a nucleic acid conjugate for fat delivery, a pharmaceutical composition, and its application. Background Technology

[0002] siRNA is a large molecule composed of two oligonucleotide chains carrying a negative charge. It cannot effectively target tissues in the body on its own, nor can it enter cells autonomously. siRNA requires a special delivery vector to achieve target organ enrichment and allow it to enter cells in order to exert its therapeutic effects.

[0003] Due to the immaturity of delivery technologies, small nucleic acid drugs currently primarily target liver tissue (previous studies have found that RNA therapies such as siRNAs, when modified with N-acetylgalactosamine (GalNAc), can be specifically delivered to the liver), with indications mainly limited to rare and genetic diseases. Although various attempts have been made in recent years to deliver small nucleic acids to certain extrahepatic cell types, including those in the central nervous system (CNS), adipocytes, and cardiomyocytes, significant challenges remain in achieving specific delivery of small nucleic acids to particular extrahepatic cells. With obesity becoming a serious public health problem and its increasing prevalence in adults and children, the need for selective and efficient delivery of small nucleic acids to adipose tissue is greater than ever before. Summary of the Invention

[0004] The purpose of this disclosure is to provide a nucleic acid conjugate, a pharmaceutical composition, and the application thereof that can specifically and efficiently deliver small nucleic acids to adipose tissue.

[0005] To achieve the above objectives, the technical solution adopted in this disclosure is:

[0006] The first aspect of this disclosure provides a nucleic acid conjugate comprising a small nucleic acid, a lipid group II located at the 5' end and / or 3' end of the small nucleic acid, and a lipid group I located at any position on the small nucleic acid other than the position of the lipid group II; wherein,

[0007] The lipid group I is shown as general formula (Ⅰ):

[0008] Wherein, B is a natural nucleobase, a modified nucleobase, a universal base, or H;

[0009] R1 and R2 are independently H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3) or OCH2CH2OCH3;

[0010] m and n are independently 1, 2 or 3;

[0011] Z represents a bond, or one of the groups shown in formulas (Z1)-(Z4):

[0012] Wherein, R4 is H, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, and C2-C6 alkynyl;

[0013] X is a bond, or a combination of one or more groups shown in formulas (X1)-(X12):

[0014] R3 can be H, halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, or C2-C6 alkynyl.

[0015] j is an integer between 1 and 10; k is 1, 2, 3 or 4;

[0016] Y is one of the groups shown in formulas (Y1)-(Y10):

[0017] Where p is an integer between 5 and 25;

[0018] The lipid group II is shown in general formula (II):

[0019] Wherein, L represents one or more of the groups shown in formulas (A1)-(A16) in a linked combination:

[0020] Wherein, R' is hydrogen, a C1-C10 alkyl group, or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 20; j2 is an integer from 1 to 20; R 6 -(CH2) j3 -NH-CO-R 7 Where j3 is an integer between 0 and 6, R 7 It is a C1-C8 alkyl group;

[0021] m' is an integer between 0 and 6;

[0022] T is a 6- to 24-membered alkylene chain or a 6- to 24-membered oxanealkylene chain;

[0023] K is Where W is hydrogen;

[0024] Q is Where R 2 R 3 Each can be independently H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, or C2-C20 alkynyl;

[0025] M is Among them, R 4 R 5 Each of the following is independently H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, C2-C20 alkynyl, or R. 4 R 5 They are directly connected to form a ring, where p1 is an integer from 1 to 6;

[0026] J is N or CR 9 , where R 9 It is H, C1-C20 alkyl or C3-C10 cycloalkyl;

[0027] It is a C3-C10 cycloalkyl or C3-C10 heterocyclic group;

[0028] R 1 It can be H, fluorine, hydroxyl, cyano, C1-C6 alkanol, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl;

[0029] n' is an integer between 0 and 10;

[0030] This indicates the site where a group is covalently bonded.

[0031] According to some specific embodiments, the structural formula of the nucleic acid conjugate is any one of the following structural formulas:

[0032] in, It is the lipid group II; It is the lipid group I.

[0033] According to some specific embodiments, R1 and R2 are independently H, OH, halogen, NH2, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, C2-C4 ynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3. Further, R1 and R2 are independently H, OH, halogen, NH2, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, butynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3. Further, R1 and R2 are independently H, OH, methyl, ethyl, or propyl. Further, R1 and R2 are both H.

[0034] According to some specific implementations, m is 1 or 2. Further, m is 1.

[0035] According to some specific implementation methods, n is 1.

[0036] According to some specific embodiments, Z is a bond, a group shown in formula (Z1), or a group shown in formula (Z3). Further, Z is a bond.

[0037] According to some specific embodiments, R4 is H, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, and C2-C4 ynyl. Further, R4 is H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, or butynyl. Further, R4 is H, methyl, ethyl, or propyl. Further, R4 is H.

[0038] According to some specific implementation methods, the groups shown in (X1)-(X12) can be arbitrarily combined and connected. The left and right ends of the groups shown in (X1)-(X12) can be interchanged. Taking (X7) as an example, the N of (X7) can be connected to the Y group or to the C group.

[0039] According to some specific embodiments, X is a bond, or a combination of one, two, three, four, five, six or seven groups from the groups shown in formula (X1), (X2), (X3), (X4), (X5), (X6), (X7), (X8), (X9), (X10), (X11) and (X12).

[0040] According to some specific embodiments, X is a bond, or a combination of one or more of the groups shown in formula (X1), formula (X2), formula (X3), formula (X6), formula (X7), and formula (X12). Further, X is a bond, or a combination of the groups shown in formula (X1) and formula (X6), formula (X2) and formula (X6), formula (X6), formula (X12), formula (X3), and formula (X6), or a combination of the groups shown in formula (X6) and formula (X7). Further, X is a bond or a group shown in formula (X12).

[0041] According to some specific embodiments, R3 is H, halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, and C2-C4 ynyl. Further, R3 is H, halogen, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, or butynyl. Further, R3 is H, methyl, ethyl, or propyl. Further, R3 is H.

[0042] According to some specific implementations, j is 1, 2, 3, 4, or 5. Further, j is 1, 2, or 3. Further, j is 1 or 2.

[0043] According to some specific implementations, k is 1, 2, 3, or 4. Further, k is 1, 2, or 3. Further, k is 1 or 2.

[0044] According to some specific embodiments, Y is a group represented by formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y6), formula (Y7), formula (Y8), or formula (Y10). Further, Y is a group represented by formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y7), formula (Y8), or formula (Y10).

[0045] According to some specific implementations, p is an integer between 10 and 25, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25.

[0046] According to some more specific implementations, R2 is H and n is 1;

[0047] Z represents a bond, a group represented by formula (Z1), or a group represented by formula (Z3);

[0048] R4 is H;

[0049] R1 is H, and m is 1 or 2;

[0050] X represents a bond, which is a combination of the group shown in formula (X1) and the group shown in formula (X6), a combination of the group shown in formula (X2) and the group shown in formula (X6), a group shown in formula (X6), a group shown in formula (X12), a combination of the group shown in formula (X3) and the group shown in formula (X6), or a combination of the group shown in formula (X6) and the group shown in formula (X7).

[0051] R3 is H;

[0052] j is 1 or 2; k is 1, 2 or 3;

[0053] Y represents the group shown in formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y7), formula (Y8), or formula (Y10).

[0054] p is an integer between 10 and 25;

[0055] B is a base A, T, C, G, or U.

[0056] According to some more specific embodiments, X is a bond, Y is a group represented by formula (Y1), wherein p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25.

[0057] According to some more specific embodiments, X is a group represented by formula (X12), Y is a group represented by formula (Y2), wherein k is 1, 2 or 3, R3 is H, methyl, ethyl or propyl, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25.

[0058] According to some more specific embodiments, X is the group shown in formula (X6), Y is the group shown in formula (Y8), wherein j is 1, 2 or 3, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25.

[0059] According to some more specific embodiments, the group formed by the connection of X and Y is any of the following structural formulas:

[0060] Where p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, R3 is H, methyl, ethyl or propyl, j is 1, 2 or 3, and k is 1, 2 or 3.

[0061] According to some more specific embodiments, Z is absent, R1 and R2 are both H, m and n are both 1, and the group represented by general formula (Ⅰ) is as follows:

[0062] Where B is a base A, T, C, G or U.

[0063] According to some more specific embodiments, the group represented by general formula (Ⅰ) is any of the following structures:

[0064] Where B is a base A, T, C, G or U.

[0065] According to some specific embodiments, the group represented by general formula (I) is derived from the compound represented by formula (III) or its tautomer.

[0066] Where E is the leaving group; Q is the phosphorus-containing reactive group. For example, E is MMTr or DMTr, and Q is...

[0067] According to some specific embodiments, the groups shown in (A1)-(A16) can be arbitrarily combined and connected to form L, wherein the left and right ends of the groups shown in (A1)-(A16) can be interchanged. Taking (A8) as an example, N of (A8) can be connected to the group on the P side or to the group on the Z side. Further, L is a combination of at least two of the groups shown in (A1)-(A16).

[0068] Further, L is a combination of one or more of the following groups: the group shown in formula (A1), the group shown in formula (A2), the group shown in formula (A3), the group shown in formula (A4), the group shown in formula (A5), the group shown in formula (A6), the group shown in formula (A7), the group shown in formula (A8), the group shown in formula (A9), the group shown in formula (A10), the group shown in formula (A11), the group shown in formula (A13), the group shown in formula (A14), and the group shown in formula (A16). Further, L is a combination of at least two of the following groups: the group shown in formula (A1), the group shown in formula (A2), the group shown in formula (A3), the group shown in formula (A4), the group shown in formula (A5), the group shown in formula (A6), the group shown in formula (A7), the group shown in formula (A8), the group shown in formula (A9), the group shown in formula (A10), the group shown in formula (A11), the group shown in formula (A13), the group shown in formula (A14), and the group shown in formula (A16).

[0069] Further, L is a combination of one or more of the groups shown in formula (A1), formula (A2), formula (A3), formula (A4), formula (A5), formula (A6), formula (A8), formula (A14), and formula (A16); further, L is a combination of at least two of the groups shown in formula (A1), formula (A2), formula (A3), formula (A4), formula (A5), formula (A6), formula (A8), formula (A14), and formula (A16). Even further, the combination of L can be one, two, three, four, five, six, or seven groups shown in (A1)-(A16).

[0070] According to some specific embodiments, R' is hydrogen, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group. Further, R' is hydrogen, a C1-C5 alkyl group, or a C4-C6 cycloalkyl group. Further, R' is hydrogen, methyl, ethyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl. Further, R' is hydrogen.

[0071] According to some specific implementations, j1 is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15;

[0072] According to some specific implementations, j2 is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. Further, j2 is an integer from 2 to 10. Even further, j2 is an integer from 2 to 5.

[0073] According to some specific implementations, j3 is 0, 1, 2, 3, 4, 5 or 6.

[0074] According to some specific embodiments, R7 is a C1-C5 alkyl group. Further, R7 is a C1-C3 alkyl group.

[0075] According to some specific implementations, m' is an integer from 0 to 3, such as 0, 1, 2, or 3. Further, m' is 0.

[0076] According to some specific embodiments, T is a 10- to 24-membered alkylene chain or a 10- to 24-membered oxaalkylene chain, wherein the alkylene chain or oxaalkylene chain can be straight-chain or branched. The number of carbon atoms in the 10- to 24-membered alkylene chain is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24. Some carbon atoms in the 10- to 24-membered oxaalkylene chain are replaced by oxygen atoms, wherein the number of oxygen atoms can be 1, 2, 3, 4, or 5.

[0077] According to some specific implementation methods, R 2 R 3 Each is independently H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl. Further, R 2 R 3 Each is independently H, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl. Further, R 2 R 3 Each can be independently H, C1-C3 alkyl, C1-C3 alkoxy, C2-C4 alkenyl, or C2-C4 alkynyl. Further, R... 2 R 3 Each of these can be independently H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, vinyl, propenyl, butenyl, pentenyl, ethynyl, propynyl, butynyl, or pentynyl. Further, R 2 R 3 They are H respectively.

[0078] According to some specific implementation methods, M is... Among them, R 4 R 5 Each of the following is independently H, fluorine, hydroxyl, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, C2-C10 alkynyl, or R. 4 R 5 They are directly connected to form three- to eight-membered rings, where p1 is 1, 2, 3, 4, 5, or 6. Furthermore, R... 4 R 5 Each of the following can be independently H, fluorine, hydroxyl, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, C2-C5 alkynyl, or R. 4 R 5 They are directly linked to form three- to six-membered carbon rings, where P1 is an integer from 1 to 3. Further, M is...

[0079] According to some specific implementation methods, J is CR 9 , where R 9It is H, C1-C10 alkyl, or C3-C8 cycloalkyl. Further, R 9 It is H, C1-C5 alkyl, or C3-C5 cycloalkyl. Further, R... 9 It can be H, methyl, ethyl, propyl, cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. Furthermore, R... 9 For H.

[0080] According to some specific implementation methods It is a C3-C6 cycloalkyl or a C3-C8 nitrogen-containing heterocyclic group. Further, It consists of four to eight-membered nitrogen-containing saturated heterocycles. Furthermore, It is a C4-C8 nitrogen-containing heterocyclic group with one nitrogen atom. Furthermore, It is pyrrolidine.

[0081] According to some specific implementation methods, R 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl. Further, R... 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl. Further, R... 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C5 alkyl, C1-C5 alkoxy, C2-C6 alkenyl, or C2-C6 alkynyl. Further, R... 1 For H.

[0082] According to some specific implementations, n' is an integer from 0 to 5, specifically, n' is 0, 1, 2, 3, 4, or 5. Further, n' is 0.

[0083] According to some specific embodiments, L is a combination of at least two of the groups shown in formula (A1), formula (A2), formula (A3), formula (A4), formula (A5), formula (A6), and formula (A16), and L contains the groups shown in formula (A1) and (A2).

[0084] R' is hydrogen, a C1-C3 alkyl group, or a C4-C6 cycloalkyl group; j1 is an integer from 1 to 15; j2 is an integer from 2 to 5;

[0085] m' is 0;

[0086] T is a 10 to 20-membered alkylene chain or a 10 to 20-membered oxaalkylene chain, and the number of oxygen atoms in T is 1 and is close to the side where K is located;

[0087] R 2R 3 Each can be independently H, C1-C3 alkyl, C1-C3 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl;

[0088] M is

[0089] J is CR 9 R9 is H, C1-C3 alkyl, or C3-C6 cycloalkyl;

[0090] It is a C3-C8 nitrogen-containing heterocyclic group with 1 nitrogen atom;

[0091] R 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C5 alkyl, C1-C5 alkoxy, C2-C6 alkenyl or C2-C6 alkynyl;

[0092] n' is 0.

[0093] According to some specific implementations, T is (CH2). j4 L is Where j4 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24.

[0094] According to some specific implementations, T is (CH2). j5 -O-(CH2) j6 L is Where j5 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, and j6 is 1, 2 or 3.

[0095] According to some specific implementations, T is (CH2). j5 -O-(CH2) j6 L stands for NHCO-(CH2). j7 -(OC2H4) j8 -NHCO, where j5 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, j6 is 1, 2 or 3, j7 is 1, 2 or 3, and j8 is 5, 6, 7, 8 or 9.

[0096] According to some specific embodiments, the group formed by the connection of L and T is any of the following structural formulas:

[0097] According to some specific embodiments, the group represented by general formula (II) is shown in the following formula:

[0098] According to some specific embodiments, the group represented by general formula (II) has the following structure:

[0099] According to some specific embodiments, the group represented by general formula (II) is derived from a compound or its tautomer containing a leaving group or a phosphorus-containing reactive group, wherein the leaving group or the phosphorus-containing reactive group is attached to the group represented by general formula (II). Location.

[0100] According to some specific embodiments, the hydrolyzable leaving group can be any hydrolyzable leaving group commonly used in the art. For example, the hydrolyzable leaving group is one or more of methyl, ethyl, acetyl, isopropyl, tert-butyl or benzyl.

[0101] For example, compounds containing leaving groups or phosphorus-containing reactive groups, or their tautomers, can be:

[0102] According to some specific implementations, the group shown in general formula (I) is linked to the adjacent nucleotide via a phosphodiester bond or a thiophosphate diester bond, and the group shown in general formula (II) is linked to the 5' or 3' end nucleotide via a phosphodiester bond or a thiophosphate diester bond.

[0103] Furthermore, H is attached to the linking site of the group as shown in general formula (I) or the group as shown in general formula (II) that is not linked to a nucleotide.

[0104] According to some specific embodiments, the small nucleic acid includes an antisense strand complementary to the target gene and a sense strand complementary to the antisense strand; wherein, the lipid group II is attached to the 5' end and / or the 3' end of the sense strand, and the lipid group I is located at any position on the sense strand, for example, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth position starting from the 5' end. Further, the lipid group I is located at any one or more positions from position 1, 4 to 8 starting from the 5' end of the sense strand, or at position 1 starting from the 3' end of the sense strand. Further, the lipid group I is located at any one or more positions from positions 1-6, 12, or 14 starting from the 5' end of the sense strand.

[0105] Furthermore, the lipid group I is located at any one or more of the 5th, 6th, and 7th positions of the positive chain starting from the 5' end.

[0106] Furthermore, the lipid group I is located at position 6, counting from the 5' end of the positive chain.

[0107] Furthermore, the small nucleic acid is siRNA.

[0108] According to some specific embodiments, when the structure of lipid group I comes from SA196 and the structure of lipid group II comes from SA192 or SA191, the small nucleic acid is a small nucleic acid that does not target the ACVR1C target gene.

[0109] According to other specific embodiments, the small nucleic acid is a single-stranded oligonucleotide, with the group shown in general formula (I) located at any position on the single-stranded oligonucleotide, for example, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth positions starting from the 5' end. Further, the group shown in general formula (I) is located at any one or more positions from the 1st, 4th to 8th positions starting from the 5' end of the single-stranded oligonucleotide, or at position 1 starting from the 3' end of the positive strand. Even further, the group shown in general formula (I) is located at any one or more positions from the 5th, 6th, and 7th positions starting from the 5' end of the single-stranded oligonucleotide. The lipid group II is attached to the 5' end and / or the 3' end of the single-stranded oligonucleotide.

[0110] According to some specific embodiments, the small nucleic acid is one of small interfering RNA, microRNA, anti-microRNA, microRNA antagonist, microRNA mimic, decoy oligonucleotide, immunostimulant, G-quadrupole, alternative splice, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; optionally, the small nucleic acid is a single-stranded oligonucleotide or a double-stranded oligonucleotide.

[0111] According to some specific implementation methods, the number of groups shown in general formula (I) in the nucleic acid chain can be 1, 2, 3, 4, 5, 6 or more.

[0112] According to some specific embodiments, each nucleotide in the small nucleic acid is independently a modified or unmodified nucleotide.

[0113] According to some embodiments, at least one nucleotide in the sense strand or antisense strand of the small nucleic acid is a modified nucleotide. In some embodiments, the number of modified nucleotides in the sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen. In some embodiments, the number of modified nucleotides in the antisense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty-one. In some embodiments, all nucleotides in both the sense strand and the antisense strand are modified nucleotides.

[0114] According to some implementation methods, some or all of the nucleotides in the small nucleic acid are modified nucleotides, and these modifications on the nucleotide groups do not cause the oligonucleotide to significantly weaken or lose its function of inhibiting the expression of the corresponding gene.

[0115] According to certain embodiments, at least one phosphate ester group in the sense chain or the antisense chain is a phosphate ester group with a modifying group. Further, the phosphate ester group with a modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0116] According to some embodiments, the 5' terminal nucleotide of the positive strand is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0117] According to some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group.

[0118] The 5' phosphate-derived group is a nucleotide modified with vinyl phosphate.

[0119] According to some embodiments, the modified nucleotide is a 2'-fluoro-modified nucleotide, a 2'-alkoxy-modified nucleotide, a 2'-substituted alkoxy-modified nucleotide, a 2'-alkyl-modified nucleotide, a 2'-substituted alkyl-modified nucleotide, a 2'-deoxynucleotide, a 2'-amino-modified nucleotide, a 2'-substituted amino-modified nucleotide, a nucleotide analog, or any combination of two or more thereof.

[0120] Further, the modified nucleotide is a 2'-fluoromodified nucleotide, a 2'-methoxymodified nucleotide, a 2'-O-CH2-CH2-O-CH3 modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, a 2'-CH2-CH2-CH=CH2 modified nucleotide, a 2'-deoxynucleotide, a nucleotide analog, a reverse debased deoxyribose residue, or any combination of two or more thereof.

[0121] According to some preferred and specific embodiments, in the positive strand, the 2'-fluorinated nucleotide is located at positions 7, 8, and 9 of the positive strand in the 5' to 3' direction, and the remaining positions are non-fluorinated nucleotides; or, the 2'-fluorinated nucleotide is located at positions 7, 9, and 11 of the positive strand, and the remaining positions are non-fluorinated nucleotides; or, the 2'-fluorinated nucleotide is located at positions 7, 9, 10, and 11 of the positive strand, and the remaining positions are non-fluorinated nucleotides.

[0122] According to some other preferred and specific embodiments, in the antisense strand, 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand in the 5' to 3' direction, with the remaining positions being non-fluorinated nucleotides; or, in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 14, and 16 of the antisense strand, with the remaining positions being non-fluorinated nucleotides; or, in the 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 6, 8, 9, 14, and 16 of the antisense strand, with the remaining positions being non-fluorinated nucleotides.

[0123] Furthermore, the hydroxyl group at the 2' position of the ribosome of the non-fluorinated modified nucleotide is replaced by a methoxy group.

[0124] Furthermore, in the sense strand and the antisense strand, the nucleotide at the 5' end of the sense strand and the nucleotide at the 3' end of the sense strand are respectively linked to a reverse debased deoxyribose residue containing a phosphate ester group or a thiophosphate ester group.

[0125] According to some preferred and specific embodiments, in the positive chain, in the direction from 5' to 3', the positive chain contains one or more thiophosphate groups located at the following positions:

[0126] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0127] Between the second and third nucleotides starting at the 5' end of the positive strand.

[0128] Furthermore, in the positive chain, following the 5' to 3' orientation, the positive chain may optionally also include one or more thiophosphate groups located at the following positions:

[0129] Between the first and second nucleotides starting at the 3' end of the positive strand;

[0130] Between the second and third nucleotides starting at the 3' end of the positive strand.

[0131] According to some preferred and specific embodiments, in the antisense chain, in the 5' to 3' orientation, the antisense chain contains one or more thiophosphate groups located at the following positions:

[0132] Between the first and second nucleotides starting at the 5' end of the antisense strand;

[0133] Between the second and third nucleotides starting at the 5' end of the antisense strand;

[0134] Between the first and second nucleotides starting at the 3' end of the antisense strand;

[0135] Between the second and third nucleotides starting at the 3' end of the antisense strand.

[0136] According to some specific implementations, the nucleic acid conjugate targets adipose tissue.

[0137] According to some specific embodiments, the nucleic acid conjugate specifically targets adipose tissue.

[0138] This disclosure also provides a pharmaceutical composition comprising the above-described nucleic acid conjugate and a pharmaceutically acceptable carrier or excipient.

[0139] This disclosure also provides the use of the above-described nucleic acid conjugates or pharmaceutical compositions in the preparation of medicaments for delivering small nucleic acids to adipose tissue.

[0140] This disclosure also provides the use of the above-mentioned nucleic acid conjugates or pharmaceutical compositions in the preparation of medicaments for treating and / or preventing obesity.

[0141] Due to the application of the above technical solution, this disclosure has the following advantages compared with the prior art:

[0142] The nucleic acid conjugates and pharmaceutical compositions disclosed herein can deliver nucleic acids to adipose tissue in a specific and efficient manner, providing more tools for the treatment of obesity. Attached Figure Description

[0143] Figure 1 shows the in vivo experimental results in mice in Example 21;

[0144] Figure 2 shows the in vivo experimental results of some of the conjugates in Example 22 in mice;

[0145] Figure 3 shows the in vivo mouse experimental results of another part of the conjugates in Example 22;

[0146] Figure 4 shows the in vivo experimental results in mice in Example 24;

[0147] Figure 5 shows the in vivo experimental results in mice in Example 25;

[0148] Figure 6 shows the in vivo experimental results in mice in Example 26;

[0149] Figure 7 shows the in vivo experimental results of cynomolgus monkeys in Example 27;

[0150] Figure 8 shows the in vivo experimental results of cynomolgus monkeys in Example 28. Detailed Implementation

[0151] It should be noted that, unless otherwise defined, the technical or scientific terms used in this disclosure should have the ordinary meaning understood by one of ordinary skill in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the medicinal materials, reagents, and other materials used in the following embodiments are commercially available products. When used herein and in the appended claims, the singular forms “a,” “an,” “another,” and “the” include the plural referents, unless the context clearly indicates otherwise.

[0152] definition

[0153] As used in this article, a hyphen ("-") that is not between two letters or two symbols or It is used to indicate the location of the substituent connection point.

[0154] Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible and / or inherently unstable.

[0155] As used herein, “alkyl” refers to a straight-chain or branched saturated organic group consisting of carbon and hydrogen atoms. For example, C1-C6 alkyl refers to straight-chain or branched alkyl groups containing 1 to 6 carbon atoms. When referring to alkyl residues with a specific number of carbons, the intention is to encompass all branched and straight-chain forms having that number of carbons; thus, for example, “butyl” means including n-butyl, sec-butyl, isobutyl, and tert-butyl; “propyl” includes n-propyl and isopropyl. Alkylenes are subsets of alkyl groups, referring to residues that are identical to alkyl groups but have two connection points.

[0156] As used herein, "alkoxy" refers to -OR, where R represents an alkyl group. For example, R in C1-C6 alkoxy groups represents a straight-chain or branched alkyl group containing 1 to 6 carbon atoms.

[0157] As used herein, “cycloalkyl” refers to a non-aromatic carbon ring, and C3-C7 cycloalkyl refers to a cyclic alkyl group having 3 to 7 carbon atoms. The ring may be saturated or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, and cyclohexenyl, as well as bridging and cage-like cyclic groups such as norbornane.

[0158] As used herein, "alkenyl" refers to a straight-chain or branched hydrocarbon chain group consisting of carbon and hydrogen atoms and having one or more carbon-carbon double bonds. Each alkenyl group is connected to the rest of the molecule by a single bond. Alkenyl groups containing up to six carbon atoms are C2-C6 alkenyl groups, and alkenyl groups containing up to five carbon atoms are C2-C5 alkenyl groups. C2-C5 alkenyl groups include C5 alkenyl, C4 alkenyl, C3 alkenyl, and C2 alkenyl groups. C2-C6 alkenyl groups include all the C2-C5 alkenyl groups described above, but also include C6 alkenyl groups. Non-limiting examples of C2-C6 alkenyl groups include methine (vinyl), 1-propenyl, 2-propenyl (allyl), isopropenyl, 2-methyl-1-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, and 5-hexenyl.

[0159] As used herein, "alkynyl" refers to a straight-chain or branched hydrocarbon chain group consisting of carbon and hydrogen atoms and having one or more carbon-carbon triple bonds. Each alkynyl group is connected to the rest of the molecule by a single bond. Alynyl groups containing up to six carbon atoms are C2-C6 alkynyl groups, and alkynyl groups containing up to five carbon atoms are C2-C5 alkynyl groups. C2-C5 alkynyl groups include C5, C4, C3, and C2 alkynyl groups. C2-C6 alkynyl groups include all the portions of the aforementioned C2-C5 alkynyl groups, but also include C6 alkynyl groups. Non-limiting examples of C2-C6 alkynyl groups include ethynyl, propynyl, butynyl, pentyynyl, etc. Unless otherwise specifically stated in the specification, the hydrocarbon group may be optionally substituted.

[0160] The compounds disclosed herein may contain one or more asymmetric centers, thus yielding enantiomers, diastereomers, and other stereoisomers, which can be defined according to absolute stereochemistry as (R)- or (S)-, or (D)- or (L)- for amino acids. This disclosure is intended to include all such possible isomers, as well as their racemic and optically pure forms, whether or not they are specifically described herein. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for preparing / separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemic mixtures (or racemic mixtures of salts or derivatives) using, for example, chiral high-performance liquid chromatography (HPLC). When the compounds described herein contain alkene double bonds or other geometrically asymmetric centers, the compound is intended to include E and Z geometric isomers unless otherwise stated. Similarly, all tautomers are intended to be included.

[0161] "Stereoisomers" are compounds composed of identical atoms bonded by the same bonds but having different three-dimensional structures that are not interchangeable. This disclosure covers a variety of stereoisomers and mixtures thereof, and includes "enantiomers," which are two stereoisomers whose molecules are mirror images of each other that are not superimposed.

[0162] "Tautomer" refers to the transfer of a proton from one atom of a molecule to another atom of the same molecule. This disclosure includes tautomers of any of the said compounds.

[0163] In the nucleotide sequences disclosed herein, A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate; dT = thymine deoxynucleotide; Am = 2'-O-methyladenosine-3'-phosphate; Ams = 2'-O-methyladenosine-3'-thiophosphate; Cm = 2'-O-methylcytidine-3'-phosphate; Cms = 2'-O-methylcytidine-3'-thiophosphate; Gm = 2'-O-methylguanosine-3'-phosphate; Gms = 2'-O-methylguanosine-3'-phosphate Thiophosphates; Um = 2'-O-methyluridine-3'-phosphate; Ums = 2'-O-methyluridine-3'-thiophosphate; Af = 2'-fluoroadenosine-3'-phosphate; Afs = 2'-fluoroadenosine-3'-thiophosphate; Cf = 2'-fluorocytidine-3'-phosphate; Cfs = 2'-fluorocytidine-3'-thiophosphate; Gf = 2'-fluoroguanosine-3'-phosphate; Gfs = 2'-fluoroguanosine-3'-thiophosphate; Uf = 2'-fluorouridine-3'-phosphate; Ufs = 2'-fluorouridine-3'-thiophosphate.

[0164] The letter combination VP indicates that the nucleotide adjacent to the right of VP is a vinyl phosphate modified nucleotide, as shown in the figure below. The lowercase d indicates that the nucleotide adjacent to the right of VP is a deoxynucleotide, such as dT for thymine deoxynucleotide.

[0165] As used herein, the term "nucleotide position" refers to the location of the nucleotide within the oligonucleotide, counting from the 5' end. For example, nucleotide position 1 refers to the 5' terminal nucleotide of the oligonucleotide.

[0166] As used herein, an oligonucleotide refers to a polymeric form of nucleotides ranging from 2 to 2500 nucleotides. In some embodiments, the oligonucleotide has 500 to 1500 nucleotides, typically, for example, where the oligonucleotide is used in gene therapy. In some embodiments, the oligonucleotide has 7 to 100 nucleotides. In some embodiments, the oligonucleotide has 15 to 100 nucleotides. In another embodiment, the oligonucleotide has 15 to 50 nucleotides, typically, for example, where the oligonucleotide is a nucleic acid inhibitor molecule. In another embodiment, the oligonucleotide is a double strand having 25 to 40 nucleotides. In yet another embodiment, the oligonucleotide has 19 to 40 or 19 to 25 nucleotides, typically, for example, where the oligonucleotide is a double-stranded nucleic acid inhibitor molecule and forms a double helix having at least 18 to 25 base pairs. Typically, as described herein, the oligonucleotide contains one or more phosphorus-containing internucleotide linking groups. In other embodiments, as described herein, the internucleotide linking group is a phosphorylated amide group.

[0167] As used herein, the term "natural nucleobase" refers to a nucleobase that is not modified from its naturally occurring form in RNA or DNA. Examples of "natural nucleobases" include purine nucleobases adenine (A) and guanine (G) and pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U). In addition to "natural nucleobases," many modified nucleobases or nucleobase mimics known to those skilled in the art are applicable to the compounds described herein.

[0168] As used herein, the term "modified nucleobase" refers to a nucleobase that is structurally very similar to the parent nucleobase, and the native nucleobase can be modified or substituted to provide iRNA with improved properties. For example, nuclease-resistant oligonucleotides can be prepared using these bases or any of synthetic and native nucleobases (e.g., inosine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine). Alternatively, any of the aforementioned bases and substituted or modified analogs of "universal bases" can be used. When a native base is substituted with a non-native and / or universal base, the nucleotide is referred to as containing the modified nucleobases described herein. Exemplary modified nucleobases include, but are not limited to, other synthetic and natural nucleobases, such as inosine, xanthine, hypoxanthine, muscarin, isoguanosine, tuberculin, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(meththio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7-(denitro)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, etc. 8-(Alkyne)adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxy)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6-(methyl)adenine, N6,N6-(dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(denitro)guanine, 8-(alkyl)guanine 8-(Alkenyl)guanine, 8-(Alkynyl)guanine, 8-(Amino)guanine, 8-(Hallo)guanine, 8-(Hydroxy)guanine, 8-(Thioalkyl)guanine, 8-(Mthio)guanine, N-(Methyl)guanine, 2-(Thio)cytosine, 3-(Deazon)-5-(Zaza)cytosine, 3-(Alkyl)cytosine, 3-(Methyl)cytosine, 5-(Alkyl)cytosine, 5-(Alkynyl)cytosine, 5-(Hallo)cytosine, 5-(Methyl)cytosine, 5-(Propyynyl)cytosine, 5-(Propyynyl)cytosine 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N4-(acetyl)cytosine, 3-(3-amino-3-carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2-(thio)uracil, 5-(methylaminomethyl)-2-(thio)uracil, 4-(thio)uracil, 5-(methyl)-4-(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4-4-(dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidinealkyl)uracil, 5-(1,3-diazol-1-alkyl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil Uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N3-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(thio)pseudouracil, 4-(thio)pseudouracil, 2,4-(dithio)pseudouracil, 5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)-2-(thio)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4-(thio)pseudouracil, 5-(methyl)-4-(thio)pseudouracil, 5-(alkyl)-2,4-(dithio)pseudouracil, 5-(methyl)-2,4-(dithio)pseudouracil, 1-substituted pseudouracil, 1-substituted 2-(thio)-pseudouracil, 1-substituted 4-(thio)pseudouracil, 1-substituted 2,4-(dithio)pseudouracil, 1-(aminocarbonylvinyl)-pseudouracil, 1-(aminocarbonylvinyl)-2-(thio)-pseudouracil, 1-(aminocarbonylvinyl)-4-(thio)pseudouracil, 1-(aminocarbonylvinyl)-2,4-(dithio)pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-2-(thio)pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-4-(thio)pseudouracil, 1-(aminoalkylaminocarbonylvinyl)-2,4-(dithio)pseudouracil, 1,3-( 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazine-1-yl, 7-(aminoalkylhydroxy)-1-(diaza)-2-(thio)-3-(diaza)-phenoxazine-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazine-1-yl, 7-(aminoalkylhydroxy)-1-(diaza)-2-(thio)-3-(diaza)-phenoxazine-1-yl, 7-(guanidinylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazine-1-yl, 7-(guanidinylhydroxy)- 1-(aza)-2-(thio)-3-(aza)-phenoxazine-1-yl, 7-(guanidinyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenoxythiazine-1-yl, 7-(guanidinyl-hydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxythiazine-1-yl, 1,3,5-(triaza)-2,6-(dioxa)-naphthalene, inosine, xanthine, hypoxanthine, muscarinic acid, tuberculin, isoguanosine, inosine, 2-aza-inosine, 7-deazo-inosine, nitroimidazolyl, nitro Pyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindoleyl, pyrrolopyrimidinyl, 3-(methyl)isoquinolone, 5-(methyl)isoquinolone, 3-(methyl)-7-(propynyl)isoquinolone, 7-(aza)indoleyl, 6-(methyl)-7-(aza)indoleyl, imidazopyridyl, 9-(methyl)imidazopyridyl, pyrrolopyrazinyl, isoquinolone, 7-(propynyl)isoquinolone, propynyl-7-(aza)indoleyl, 2,4,5-(trimethyl)phenyl, 4-(methyl) Indole, 4,6-(dimethyl)indole, phenyl, naphthyl, anthracene, phenanthrene, pyrene, stilbene, tetraphenyl, pentaphenyl, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymidine, 2-pyridone, 5-nitroindole, 3-nitropyrrole, 6-(aza)pyrimidine, 2-(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidine, N2-substituted purine, N6-substituted purine, O6-substituted purine, substituted 1,2,4-Triazole, pyrrolopyrimidine-2-one-3-yl, 6-phenyl-pyrrolopyrimidine-2-one-3-yl, para-substituted 6-phenyl-pyrrolopyrimidine-2-one-3-yl, ortho-substituted 6-phenyl-pyrrolopyrimidine-2-one-3-yl, di-ortho-substituted 6-phenyl-pyrrolopyrimidine-2-one-3-yl, p-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidine-2-one-3-yl, ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidine-2-one-3-yl, di-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidine-2-one-3-yl, pyridinopyrimidine-3-yl, 2-oxo-7-amino-pyridinopyrimidine-3-yl, 2-oxo-pyridinopyrimidine-3-yl or any O-alkylated or N-alkylated derivative thereof. As used herein, a universal nucleic acid base is a base that can pair complementaryly with at least two commonly used bases, such as hypoxanthine (whose nucleoside is inosine), which can pair with any of A, T, G, or C, with a binding affinity of I:C>I:A>I:G>I:T; or, for example, 5-bromouraidine (BrU), which can pair with A or G; alternatively, other universal bases capable of pairing complementaryly with at least two commonly used bases may be used in this disclosure, such as 3-nitropyrrole, 5-nitroindole, 7-azaindole, etc.

[0169] As used herein, "fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by fluorine, having the structure shown in formula (7). In some embodiments, the 2'-alkyl-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (8).

[0170] Where base represents a base, such as A, U, G, C, or T.

[0171] As used in this article, "non-fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by a non-fluorinated group.

[0172] In the context of this disclosure, particularly in describing methods for preparing siRNA, siRNA-containing compositions, or siRNA conjugates, unless otherwise specified, the term "nucleoside monomer" refers to unmodified or modified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.

[0173] Various hydroxyl protecting groups may be used in this disclosure. Generally, protecting groups insensitize chemical functional groups to specific reaction conditions and can be added to and removed from the functional group in a molecule without substantially impairing the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. Non-exclusive examples of hydroxyl protecting groups that may be used herein include dimethoxytriphenylmethyl (DMT), monomethoxytriphenylmethyl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (triphenylmethyl), MMTr (4-methoxytriphenylmethyl), DMTr (4,4'-dimethoxytriphenylmethyl), and TMTr (4,4',4”-trimethoxytriphenylmethyl) and tert-butyldimethylsilyl (TBS or TBDMS). Non-exclusive examples of hydroxyl protecting groups that may be used herein include alkyl acyl groups.

[0174] The pharmaceutically acceptable carriers described in this disclosure can be carriers conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene) phosphate. The excipients may be one or more of phosphate, PPEEA, and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives. The excipients may be one or more of a variety of formulations or compounds conventionally used in the art. For example, other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic regulators.

[0175] The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry.

[0176] As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder.

[0177] As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, siRNA conjugates, or pharmaceutical compositions may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0178] The technical solutions provided in this disclosure will be further described below with reference to specific embodiments. The following embodiments are for illustrative purposes only and do not limit the scope of protection of this disclosure.

[0179] Example 1: Preparation of compound SA153

[0180] 1.1 Preparation of intermediate 1-1

[0181] Methyl 3-hydroxypropionate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.2 equiv, 9.43 mmol, 0.98 g) was placed in a clean, dry reaction flask. 50 mL of tetrahydrofuran was added, and the solution was purged with argon for protection. Diisopropylaminolithium (2.0 equiv, 15.72 mmol, 7.86 mL, 2.0 M in hexane) was slowly added at -70 °C, followed by stirring for 0.5 hours under argon protection at -70 °C. Then, heptadecanal (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.0 equiv, 7.86 mmol, 2.0 g) was slowly added to the reaction solution, followed by stirring for 10 minutes under argon protection at -70 °C. The reaction was quenched with 60 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate. The organic phases were combined, dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to give a colorless oily compound 1-1 (1.37 g, 3.82 mmol, 49% yield). Compound 1-1 molecular formula: C 21 H 42 O4, molecular weight: 358.3, LC-MS yielded 359.3 (M+H).

[0182] 1.2 Preparation of intermediates 1-2

[0183] Compound 1-1 (3.82 mmol, 1.37 g) and imidazole (4.0 equiv, 15.28 mmol, 1.04 g) were placed in a clean, dry reaction flask. 50 mL of N,N-dimethylformamide was added, followed by the slow addition of tert-butyldimethylchlorosilane (3.0 equiv, 11.46 mmol, 1.73 g) at room temperature. The mixture was then stirred overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-5 / 1) to give a colorless oily compound 1-2 (1.6 g, 2.73 mmol, 71% yield). The molecular formula of compound 1-2 is C1. 33 H 70 O4Si2, molecular weight: 586.4, LC-MS showed a molecular weight of 587.4 (M+H).

[0184] 1.3 Preparation of intermediates 1-3

[0185] Compounds 1-2 (2.73 mmol, 1.6 g) were placed in a clean, dry reaction flask, and 60 mL of tetrahydrofuran was added. This solution was purged with argon. The reaction solution was cooled to -70 °C, and diisobutylaluminum hydride (2.2 equiv, 6.0 mmol, 6.0 mL, 1.0 M in THF) was slowly added dropwise under argon protection. After the addition was complete, the temperature was raised to 0 °C and stirring was continued for one hour. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated potassium sodium tartrate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a pale yellow oily compound 1-3 (1.15 g, 2.06 mmol, 75% yield). The molecular formula of compound 1-3 is C3. 32 H 70 O3Si2, molecular weight: 558.5, LC-MS yielded 581.5 (M+Na).

[0186] 1.4 Preparation of intermediates 1-4

[0187] Compounds 1-3 (2.05 mmol, 1.15 g) were placed in a clean, dry reaction flask, and 50 mL of anhydrous tetrahydrofuran was added. Triphenylphosphine (2.0 equiv, 4.1 mmol, 1.08 g) and 3-benzoyluracil (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 2.26 mmol, 0.49 g) were added dropwise under argon protection. The mixture was then stirred overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4) to give the oily compound 1-4 (1.4 g, 1.85 mmol, 90% yield). The molecular formula of compound 1-4 is: C 43 H 76 N2O5Si2, molecular weight: 756.5, LC-MS showed 757.5 (M+H).

[0188] 1.5 Preparation of intermediates 1-5

[0189] Compounds 1-4 (1.85 mmol, 1.4 g) were placed in a clean, dry reaction flask, and 30 mL of methanol was added. Then, a methanol solution of sodium methoxide (3.0 equiv, 5.55 mmol, 1.0 g, 30% wt in MeOH) was added, and the mixture was stirred at room temperature for 5 hours. After the reaction, dilute hydrochloric acid was added to adjust the pH to neutral. The reaction solution was directly concentrated to obtain the crude product, a white solid compound 1-5, which was directly added to the next reaction without further purification. The molecular formula of compound 1-5 is C1. 36 H 72 N2O4Si2, molecular weight: 652.5, LC-MS showed 653.5 (M+H).

[0190] 1.6 Preparation of intermediates 1-6

[0191] Compounds 1-5 (1.85 mmol, 1.2 g) were placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added, followed by tetrabutylammonium fluoride (4.0 equiv, 7.4 mmol, 7.4 mL, 1.0 M in THF). The mixture was stirred overnight at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give the oily compound 1-6 (0.7 g, 1.65 mmol, 89% two-step yield). The molecular formula of compounds 1-6 is C1. 24 H 44 N2O4, molecular weight: 424.3, LC-MS yielded 425.3 (M+H).

[0192] 1.7 Preparation of intermediates 1-7

[0193] Compounds 1-6 (1.65 mmol, 0.7 g) were placed in a clean, dry reaction flask, and 50 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.5 equiv, 2.47 mmol, 0.84 g) was added at room temperature, followed by stirring overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 1-7 (0.9 g, 1.23 mmol, 75% yield). The molecular formula of compounds 1-7 is C1. 45 H 62 N2O6, molecular weight: 726.5, LC-MS showed a molecular weight of 727.5 (M+H).

[0194] 1.8 Preparation of compound SA153

[0195] Compounds 1-7 (1.23 mmol, 0.9 g) were placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 2.46 mmol, 0.74 g) and 4,5-dicyanimidazole (1.5 equiv, 1.85 mmol, 0.22 g) were added, and the mixture was stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to a C8 reversed-phase column (size: 30 μm). A colorless oily compound SA153 (0.72 g, 0.77 mmol, 63% yield) was prepared by gradient elution (water / acetonitrile = 95 / 5-0 / 100) from commercially available stock purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound SA153 is: C2 54 H 79 N4O7P, molecular weight: 926.6, LC-MS yielded 925.6 (MH). 1 HNMR(400MHz,DMSO-d6)δ11.17(s,1H),7.43(t,J=8.5Hz,1H),7.37–7.23(m,4H),7.21–7.12(m ,5H),6.87–6.77(m,4H),5.47(dd,J=28.7,7.3Hz,1H),3.96–3.84(m,1H),3.83–3.75(m,1H),3 .71(s,6H),3.63–3.55(m,2H),3.53–3.43(m,2H),3.24–3.03(m,1H),3.01–2.85(m,1H),2.72– 2.61(m,2H),1.59–1.35(m,2H),1.33–1.22(m,30H),1.09–1.01(m,12H),0.84(t,J=6.6Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ147.64,147.58,146.979,146.90.

[0196] Example 2: Preparation of compound SA145

[0197] According to the synthesis method in Example 1, 0.86 g of a colorless oily compound SA145 was prepared from hexadecaldehyde (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). The molecular formula of compound SA145 is: C 53 H 77 N4O7P, molecular weight: 912.5, LC-MS yielded 911.6 (MH). 1HNMR (400MHz, DMSO-d6): δ11.19(s,1H),7.40(dd,J=22.6,7.9Hz,1H),7.34–7.23(m,4H),7.21–7 .15(m,5H),6.86–6.80(m,4H),5.47(dd,J=28.6,7.8Hz,1H),3.95–3.85(m,1H),3.82–3.75(m,1H ),3.72(s,6H),3.65–3.56(m,2H),3.54–3.44(m,3H),3.23–3.07(m,2H),2.99–2.91(m,1H),2.77 –2.62(m,2H),1.60–1.43(m,2H),1.35–1.21(m,26H),1.15–1.00(m,12H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ148.14,147.89,146.97,146.89.

[0198] Example 3 Preparation of compound SA195

[0199] 3.1 Preparation of intermediate 3-1

[0200] Compound nonadecanol (6.0 mmol, 1.7 g) (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was placed in a clean, dry reaction flask, and 50 mL of dichloromethane was added. Then, Dys-Martin oxidant (2.0 equiv, 12.0 mmol, 5.1 g) was slowly added under ice-water bath conditions, and the mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product, an oily compound 3-1, was used directly in the next step without further purification. Compound 3-1 molecular formula: C 19 H 38 O, molecular weight: 282.2, LC-MS found 283.3 (M+H).

[0201] 3.2 Preparation of compound SA195

[0202] According to the synthesis method of Example 1, 0.8 g of a colorless oily compound SA195 was prepared from intermediate 3-1. The molecular formula of compound SA195 is: C 56 H 83 N4O7P, molecular weight: 954.6, LC-MS yielded 953.3 (MH). 1H NMR(400MHz, DMSO-d6)δ11.16(s,1H),7.42(dd,J=9.9,8.0Hz,1H),7.33(dt,J=11.9,6.5Hz,3H),7.27–7.1 6(m,6H),6.82(dt,J=7.0,5.5Hz,4H),5.51–5.41(m,1H),3.91(dt,J=18.1,11.2Hz,1H),3.79(dd,J=13.2, 9.0Hz,1H),3.70(s,6H),3.60(dt,J=18.3,5.5Hz,2H),3.50–3.42(m,2H),3.26–3.02(m,1H),3.00–2.85(m ,1H),2.71–2.61(m,2H),1.59–1.32(m,2H),1.29–1.21(m,34H),1.14–1.00(m,12H),0.82(t,J=6.6Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ147.97,147.60,146.93,146.84.

[0203] Example 4: Preparation of compound SA196

[0204] 4.1 Preparation of intermediate 4-1

[0205] Compound docosyl alcohol (6.0 mmol, 1.96 g) (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was placed in a clean, dry reaction flask, and 50 mL of dichloromethane was added. Then, Dys-Martin oxidant (2.0 equiv, 12.0 mmol, 5.1 g) was slowly added under ice-water bath conditions, and the mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product, an oily compound 4-1, was used directly in the next step without further purification. Compound 4-1 molecular formula: C 22 H 44 O, molecular weight: 324.3, LC-MS found 325.6 (M+H).

[0206] 4.2 Preparation of compound SA196

[0207] According to the synthesis method of Example 1, 1.2 g of a colorless oily compound SA196 was prepared from intermediate 4-1. The molecular formula of compound SA196 is: C 59 H 89 N4O7P, molecular weight: 996.5, LC-MS yielded 995.4 (MH).1 H NMR(400MHz, DMSO-d6)δ11.16(s,1H),7.43(dd,J=10.1,7.9Hz,1H),7.37–7.23(m,4H),7.21–7.15 (m,5H),6.86–6.80(m,4H),5.52–5.42(m,1H),3.94–3.84(m,1H),3.83–3.75(m,1H),3.72(s,6H), 3.70–3.55(m,3H),3.53–3.42(m,2H),3.23–3.15(m,1H),3.14–3.02(m,1H),3.01–2.87(m,1H),2. 72–2.62(m,2H),2.44–2.35(m,1H),1.29–1.17(m,41H),1.12–1.01(m,12H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ147.96, 147.61, 146.97, 146.94.

[0208] Example 5: Preparation of compound SA208

[0209] 5.1 Preparation of intermediate 5-1

[0210] Methyl 3-hydroxypropionate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.0 equiv, 48.0 mmol, 5.0 g) was placed in a clean, dry reaction flask. 100 mL of tetrahydrofuran was added, and the solution was purged with argon for protection. Diisopropylaminolithium (2.2 equiv, 105.7 mmol, 52.8 mL, 2.0 M in hexane) was slowly added at -70 °C, followed by stirring at -70 °C under argon protection for 0.5 hours. Then, N-BOC-4-aldehydepiperidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.0 equiv, 48.0 mmol, 10.2 g) was slowly added to the reaction mixture, followed by stirring at -70 °C under argon protection for 10 minutes. The reaction was quenched with 60 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate. The organic phases were combined, dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to give a colorless oily compound 5-1 (14.0 g, 44.1 mmol, 92% yield). The molecular formula of compound 5-1 is: C 15 H 27 NO6, molecular weight: 317.3, LC-MS yielded 318.3 (M+H).

[0211] 5.2 Preparation of intermediate 5-2

[0212] Compound 5-1 (44.1 mmol, 14.0 g) and imidazole (4.0 equiv, 176.4 mmol, 12.0 g) were placed in a clean, dry reaction flask. 130 mL of N,N-dimethylformamide was added, followed by the slow addition of tert-butyldimethylchlorosilane (3.0 equiv, 132.3 mmol, 19.9 g) at room temperature. The mixture was then stirred overnight at room temperature. After the reaction, 200 mL of ethyl acetate was added to the reaction solution, followed by washing with 200 mL of saturated sodium bicarbonate solution and 200 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a colorless oily compound 5-2 (13.0 g, 23.8 mmol, 54% yield). The molecular formula of compound 5-2 is C2. 27 H 55 NO6Si2, molecular weight: 545.4, LC-MS showed 546.4 (M+H).

[0213] 5.3 Preparation of intermediate 5-3

[0214] Compound 5-2 (23.8 mmol, 13.0 g) was placed in a clean, dry reaction flask, and 120 mL of tetrahydrofuran was added. This solution was purged with argon for protection. The reaction solution was cooled to -70 °C, and diisobutylaluminum hydride (2.2 equiv, 52.4 mmol, 52.4 mL, 1.0 M in THF) was slowly added dropwise under argon protection. After the addition was complete, the temperature was raised to 0 °C and stirring was continued for one hour. After the reaction, 200 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 250 mL of saturated potassium sodium tartrate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a pale yellow oily compound 5-3 (5.2 g, 10.0 mmol, 42% yield). The molecular formula of compound 5-3 is: C 26 H 55 NO5Si2, molecular weight: 517.4, LC-MS showed 518.4 (M+H).

[0215] 5.4 Preparation of intermediate 5-4

[0216] Compound 5-3 (10.0 mmol, 5.2 g) was placed in a clean, dry reaction flask, and 100 mL of anhydrous tetrahydrofuran was added. Triphenylphosphine (2.0 equiv, 20.0 mmol, 5.3 g) and 3-benzoyluracil (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 11.0 mmol, 2.4 g) were added dropwise under argon protection. The mixture was then stirred overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4) to give the oily compound 5-4 (7.0 g, 9.8 mmol, 97% yield). The molecular formula of compound 5-4 is: C 37 H 61 N3O7Si2, molecular weight: 715.4, LC-MS showed 716.4 (M+H).

[0217] Preparation of intermediate 5-5

[0218] Compound 5-4 (4.3 mmol, 3.1 g) was placed in a clean, dry reaction flask, and 30 mL of methanol was added. Then, a methanol solution of sodium methoxide (3.0 equiv, 13.0 mmol, 2.3 g, 30% wt in MeOH) was added, and the mixture was stirred at room temperature for 5 hours. After the reaction, dilute hydrochloric acid was added to adjust the pH to neutral. The reaction solution was directly concentrated to obtain the crude product, a white solid compound 5-5, which was directly added to the next reaction without further purification. The molecular formula of compound 5-5 is C5. 30 H 57 N3O6Si2, molecular weight: 611.3, LC-MS showed 612.4 (M+H).

[0219] 5.6 Preparation of intermediates 5-6

[0220] Compound 5-5 (4.3 mmol, 2.7 g) was placed in a clean, dry reaction flask, and 30 mL of dichloromethane was added. Then, a dichloromethane solution of trifluoroacetic acid (2.0 equiv, 8.7 mmol, 6.6 mL, 10 wt% in DCM) was added, and the mixture was stirred at room temperature for 2 hours. After the reaction, saturated sodium bicarbonate solution was added to adjust the pH to neutral. The reaction solution was directly concentrated to obtain the crude product. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0-15 / 1) to give the oily compound 5-6 (0.95 g, 1.8 mmol, 43% yield). The molecular formula of compound 5-6 is: C25 H 49 N3O4Si2, molecular weight: 511.3, LC-MS showed a molecular weight of 512.6 (M+H).

[0221] 5.7 Preparation of intermediates 5-7

[0222] Hexadecanoic acid (1.86 mmol, 0.48 g) was placed in a clean, dry reaction flask, and 20 mL of dichloromethane was added. Benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate (1.3 equiv, 2.42 mmol, 0.92 g) and diisopropylethylamine (3.0 equiv, 5.58 mmol, 0.72 g) were added at room temperature, and the mixture was stirred for 10 minutes at room temperature. Compound 5-6 (1.86 mmol, 0.95 g) was dissolved in 10 mL of dichloromethane and added to the reaction mixture at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 50 mL of dichloromethane was added to the reaction mixture, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a white solid compound 5-7 (1.2 g, 1.6 mmol, 86% yield). Compounds 5-7 Molecular formula: C 41 H 79 N3O5Si2, molecular weight: 749.4, LC-MS showed a molecular weight of 750.6 (M+H).

[0223] 5.8 Preparation of intermediate 5-8

[0224] Compound 5-7 (1.6 mmol, 1.2 g) was placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added, followed by tetrabutylammonium fluoride (4.0 equiv, 6.4 mmol, 6.4 mL, 1.0 M in THF). The mixture was stirred overnight at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a white solid compound 5-8 (0.8 g, 1.53 mmol, 96% two-step yield). The molecular formula of compound 5-8 is C5. 29 H 51 N3O5, molecular weight: 521.4, LC-MS showed 522.4 (M+H).

[0225] 5.9 Preparation of intermediate 5-9

[0226] Compound 5-8 (1.53 mmol, 0.8 g) was placed in a clean, dry reaction flask, and 50 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.5 equiv, 2.3 mmol, 0.78 g) was added at room temperature, followed by stirring overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 5-9 (0.6 g, 0.73 mmol, 48% yield). The molecular formula of compound 5-9 is: C 50 H 69 N3O7, molecular weight: 823.5, LC-MS yielded 824.5 (M+H).

[0227] 5.10 Preparation of compound SA208

[0228] Compounds 5-9 (0.73 mmol, 0.6 g) were placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 1.46 mmol, 0.44 g) and 4,5-dicyanimidazole (1.5 equiv, 1.1 mmol, 0.13 g) were added, and the mixture was stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to a C8 reversed-phase column (size: 30 μm). A colorless oily compound SA208 (0.54 g, 0.52 mmol, 72% yield) was prepared by gradient elution (water / acetonitrile = 95 / 5-0 / 100) from commercially available stock purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound SA208 is: C2 59 H 86 N5O8P, molecular weight: 1023.6, LC-MS yielded 1022.6 (MH). 1HNMR(400MHz,DMSO-d6)δ11.18(s,1H),7.28(dt,J=15.8,7.6Hz,4H),7.22–7.16(m,5H),6.86–6.81(m,4H ),5.60–5.51(m,1H),5.44–5.39(m,1H),4.44–4.35(m,1H),3.95–3.79(m,2H),3.72(s,6H),3.64–3.36(m, 5H),3.13–3.05(m,1H),3.01–2.76(m,2H),2.73–2.60(m,2H),2.33–2.16(m,4H),1.70–1.56(m,2H),1.48 –1.40(m,3H),1.23–1.16(m,27H),1.12–1.04(m,9H),0.93(dd,J=12.2,6.8Hz,3H),0.85(t,J=6.8Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ149.96, 148.97, 148.40, 148.13.

[0229] Example 6 Preparation of compound SA226

[0230] 2. According to the synthesis method in Example 5, 0.9 g of a colorless oily compound SA226 was prepared. The molecular formula of compound SA226 is: C 65 H 98 N5O8P, molecular weight: 1107.7, LC-MS yielded 1106.4 (MH). 1 H NMR (400MHz, DMSO-d6) δ11.18(s,1H),7.30(dt,J=16.8,7.5Hz,4H),7.19(t,J=8.2Hz,5H),6.84(br,s,4H),5 .55(dd,J=14.9,7.6Hz,1H),5.46–5.39(m,1H),4.64(d,J=4.7Hz,1H),4.40(t,J=14.2Hz,1H),3.96–3.79(m, 1H),3.72(s,6H),3.63–3.50(m,3H),3.19–2.98(m,4H),2.92–2.69(m,1H),2.61(t,J=8.3Hz,1H),2.33–2.16 (m,3H),1.82–1.57(m,2H),1.45–1.33(m,2H),1.29–1.22(m,42H),1.14–0.91(m,12H),0.84(t,J=6.4Hz,3H). 31P NMR (162MHz, DMSO-d6): δ149.95, 148.96, 148.44, 148.10.

[0231] Example 7 Preparation of compound SA209

[0232] 7.1 Preparation of intermediate 7-1

[0233] Propylene glycol (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (100.0 mmol, 7.6 g) was placed in a clean, dry reaction flask, and 100 mL of dimethyl sulfoxide was added. Then, 1-bromohexadecane (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 110.0 mmol, 28.9 g), tetrabutylammonium bromide (1.0 equiv, 100.0 mmol, 32.2 g), and sodium hydroxide (3.0 equiv, 300.0 mmol, 12.0 g) were added separately at room temperature. The mixture was then stirred at 50 °C for 24 hours. The reaction was quenched with 100 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate. The organic phases were combined, dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to give a colorless oily compound 7-1 (12.6 g, 42.0 mmol, 42% yield). Compound 7-1 Molecular formula: C 19 H 40 O2, molecular weight: 300.3, LC-MS yielded 301.4 (M+H).

[0234] 7.2 Preparation of intermediate 7-2

[0235] Compound 7-1 (42.0 mmol, 12.6 g) was placed in a clean, dry reaction flask, and 50 mL of dichloromethane was added. Then, Dys-Martin oxidant (2.0 equiv, 84.0 mmol, 35.7 g) was slowly added under ice-water bath conditions, and the mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product, an oily compound 7-2, was used directly in the next step without further purification. The molecular formula of compound 7-2 is C7. 19 H 38 O2, molecular weight: 298.2, LC-MS showed 299.3 (M+H).

[0236] 7.3 Preparation of compound SA209

[0237] According to the synthesis method of Example 1, 1.9 g of a colorless oily compound SA209 was prepared from intermediate 7-2. The molecular formula of compound SA209 is: C 56 H 83 N4O8P, molecular weight: 970.5, LC-MS showed a molecular weight of 969.4 (MH). 1 H NMR(400MHz,DMSO-d6)δ11.13(s,1H),7.38–7.32(m,3H),7.26(dd,J=13.9,7.2Hz,2H),7.22–7.17(m,5H) ,6.85–6.80(m,4H),5.48–5.40(m,1H),4.14–4.04(m,1H),3.81–3.75(m,1H),3.72(s,6H),3.68–3.53(m,3 H),3.51–3.36(m,4H),3.24–3.17(m,1H),3.12–3.08(m,1H),3.04–2.87(m,1H),2.66(dt,J=35.4,5.9Hz, 2H),1.90–1.56(m,2H),1.50–1.42(m,2H),1.28–1.21(m,28H),1.12–0.99(m,12H),0.85(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ148.33, 148.23, 147.48, 147.42.

[0238] Example 8 Preparation of compound SA214

[0239] According to the synthesis method in Example 7, 1.3 g of a colorless oily compound SA214 was prepared from the starting material ethylene glycol (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (100.0 mmol, 6.2 g). The molecular formula of compound SA214 is: C 55 H 81 N4O8P, molecular weight: 956.5, LC-MS yielded 955.4 (MH). 1H NMR (400MHz, DMSO-d6) δ11.17(s,1H),7.38(dd,J=7.8,3.7Hz,1H),7.32(dd,J=7.3,3.7Hz,2H) ,7.20–7.18(m,5H),7.29–7.22(m,2H),6.83(dt,J=7.8,5.1Hz,4H),5.50–5.42(m,1H),4.08–3 .98(m,1H),3.84–3.77(m,1H),3.72(s,6H),3.67–3.55(m,2H),3.50–3.35(m,4H),3.20–3.18( m,1H),3.08–3.01(m,1H),2.93–2.85(m,1H),2.71–2.61(m,2H),1.44(d,J=4.6Hz,2H),1.22(br s,29H),1.11–1.00(m,12H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ148.94, 148.46, 148.31, 147.41.

[0240] Example 9 Preparation of compound SA229

[0241] According to the synthesis method of Example 7, 1.8 g of a colorless oily compound SA229 was prepared from the starting materials ethylene glycol and docosyl alcohol (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). The molecular formula of compound SA229 is: C 61 H 93 N4O8P, molecular weight: 1040.6, LC-MS yielded 1039.4 (MH). 1 H NMR(400MHz,DMSO-d6)δ11.19(s,1H),7.36–7.28(m,3H),7.26–7.10(m,7H),6.78(td,J= 8.5,4.0Hz,4H),5.48–5.39(m,1H),4.02(d,J=30.1Hz,1H),3.86–3.75(m,1H),3.68(d,J= 4.7Hz,6H),3.59–3.54(m,2H),3.48–3.39(m,3H),3.33–3.16(m,3H),3.07–2.84(m,1H), 2.67–2.58(m,2H),1.42(s,2H),1.19(s,br,41H),1.08–0.98(m,12H),0.81–0.78(m,3H). 31P NMR (162MHz, DMSO-d6): δ148.73, 148.47, 148.28, 147.51.

[0242] Example 10 Preparation of compound SA235

[0243] According to the synthesis method of Example 1, 3.4 g of a colorless oily compound SA235 was prepared from the starting materials dodecyl alcohol and N6-benzoyladenine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). The molecular formula of compound SA235 is: C 67 H 94 N7O6P, molecular weight: 1123.7, LC-MS yielded 1122.5 (MH). 1 H NMR (400MHz, DMSO-d6) δ11.10(s,1H),8.65(d,J=5.1Hz,1H),8.30(d,J=3.9Hz,1H),8.05(d,J=7.3Hz,2H),7.61(t, J=7.1Hz,1H),7.52(t,J=7.4Hz,2H),7.17(dd,J=19.3,7.2Hz,4H),7.10–6.99(m,5H),6.73(td,J=8.7,3.1Hz,4H), 4.38–4.25(m,1H),3.96(s,1H),3.75(dd,J=16.6,6.5Hz,1H),3.66(s,6H),3.62–3.57(m,1H),3.54–3.41(m,2H),3 .27–3.19(m,1H),3.07–2.89(m,1H),2.78–2.62(m,2H),1.34–1.20(m,42H),1.09–1.01(m,12H),0.82–0.79(m,3H). 31 P NMR (162MHz, DMSO-d6): δ148.41, 147.42, 147.33, 146.98.

[0244] Example 11 Preparation of compound SA246

[0245] According to the synthesis method of Example 1, 1.2 g of a colorless oily compound SA246 was prepared from the starting materials dodecyl alcohol and 6-chloropurine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). The molecular formula of compound SA246 is: C 64 H 96 N7O7P, molecular weight: 1105.7, LC-MS yielded 1104.3 (MH). 1H NMR (400MHz, DMSO-d6) δ12.03(s,1H),11.46(s,1H),7.86(dd,J=25.2,15.4Hz,1H),7.25–7.01(m,9H),6. 80–6.71(m,4H),4.19–4.01(m,1H),3.99–3.87(m,1H),3.78(dd,J=10.2,5.8Hz,1H),3.69(d,J=2.6Hz,6H) ,3.64–3.55(m,2H),3.52–3.42(m,3H),3.23–3.04(m,1H),2.96–2.90(m,1H),2.84–2.76(m,2H),2.72–2. 57(m,3H),1.59–1.34(m,2H),1.20(s,br,36H),1.13–1.07(m,12H),1.04–0.99(m,6H),0.83–0.79(m,3H). 31 P NMR (162MHz, DMSO-d6): δ148.51,147.79,147.23,146.43.

[0246] Example 12 Preparation of compound SA171

[0247] 12.1 Preparation of Intermediate 12-1

[0248] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean, dry reaction flask. 50 mL of acetonitrile was added, followed by the slow addition of tert-butyldimethylchlorosilane (1.3 equiv, 21.9 mmol, 3.31 g) at room temperature. The mixture was then stirred at room temperature for 4 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-5 / 1) to give a colorless oily compound 12-1 (4.9 g, 16.8 mmol, 99% yield). The molecular formula of compound 12-1 is C1. 17 H 29 ONSi, molecular weight: 291.2, LC-MS yielded 292.4 (M+H).

[0249] 12.2 Preparation of Intermediate 12-2

[0250] Compound 12-1 (16.8 mmol, 4.9 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 490.0 mg) was added at room temperature under hydrogen atmosphere, followed by stirring at room temperature for 4 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to give the crude product, a white solid compound 12-2 (3.31 g, 16.5 mmol, 98% yield), which was directly added to the next reaction without purification. The molecular formula of compound 12-2 is C12-1. 10 H 23 ONSi, molecular weight: 201.1, LC-MS yielded 202.3 (M+H).

[0251] 12.3 Preparation of intermediate 12-3

[0252] N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g), compound 12-2 (1.1 equiv, 16.5 mmol, 3.31 g), 4-dimethylaminopyridine (20 mol%, 3.0 mmol, 366.5 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 45.0 mmol, 4.31 g) were placed in clean, dry reaction flasks, 100 mL of dichloromethane was added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1-1 / 3) to give a white solid compound 12-3 (4.5 g, 10.65 mmol, 63% two-step yield). The molecular formula of compound 12-3 is C2. 21 H 34 O5N2Si, molecular weight: 422.2, LC-MS yielded 423.3 (M+H). 1 H NMR (400MHz, CDCl3): δ7.35–7.29(m,5H),5.96(dd,J=14.3,8.3Hz,1H),5.10(s,2H),4.61–4.40(m,2H),3.85–3.68(m,2H),3.65–3.4 9(m,2H),3.41(d,J=12.7Hz,1H),3.31(s,1H),1.95(qdd,J=15.0,11.8,5.3Hz,2H),1.77(s,1H),0.86(s,9H),0.06(d,J=3.1Hz,6H).

[0253] Preparation of intermediate 12-4

[0254] Compound 12-3 (10.65 mmol, 4.5 g) was placed in a clean, dry reaction flask, and 100 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.2 equiv, 12.78 mmol, 4.32 g) was added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a pale yellow oily compound 12-4 (7.56 g, 10.43 mmol, 98% yield). The molecular formula of compound 12-4 is: C 42 H 52 O7N2Si, molecular weight: 724.3, LC-MS showed 747.4 (M+Na). 1 HNMR (400MHz, CDCl3): δ7.35–7.31(m,1H),7.28(d,J=4.7Hz,4H),7.27–7.23(m,2H),7.23–7.14(m,5H) ,7.13–7.11(m,2H),6.80–6.78(m,1H),6.76(dd,J=7.7,5.4Hz,4H),5.72(dd,J=22.7,8.3Hz,1H),5.08 –4.99(m,2H),4.69–4.59(m,1H),4.35–4.30(m,1H),3.73(dd,J=4.5,3.7Hz,6H),3.65–3.44(m,2H),3. 36–3.20(m,3H),1.86–1.81(m,1H),1.70(s,1H),0.80(d,J=13.1Hz,9H),-0.02(dd,J=14.9,4.2Hz,6H).

[0255] Preparation of intermediate 12-5

[0256] Compound 12-4 (10.43 mmol, 7.56 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 750.0 mg) was added at room temperature under hydrogen atmosphere, followed by stirring at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to give the crude product, a white solid compound 12-5 (6.0 g, 10.22 mmol, 98% yield), which was directly added to the next reaction without purification. The molecular formula of compound 12-5 is C12-4. 34 H 46O5N2Si, molecular weight: 590.3, LC-MS yielded 591.6 (M+H).

[0257] Preparation of intermediate 12-6 (12.6)

[0258] Compound 12-5 (10.4 mmol, 6.14 g), monomethyl hexadecanoate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 11.4 mmol, 3.44 g), 4-dimethylaminopyridine (20 mol%, 2.1 mmol, 254.1 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 15.6 mmol, 2.99 g) were placed in clean, dry reaction flasks, 100 mL of dichloromethane was added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a pale yellow oily compound 12-6 (7.53 g, 8.6 mmol, 83% two-step yield). The molecular formula of compound 12-6 is C1. 51 H 76 O8N2Si, molecular weight: 872.5, LC-MS yielded 873.6 (M+H).

[0259] Preparation of intermediate 12-7 (12.7)

[0260] Compound 12-6 (8.6 mmol, 7.53 g) was placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added. Tetrabutylammonium fluoride (1.0 M in THF) (2.0 equiv, 17.2 mmol, 17.2 mL) was then added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 12-7 (5.61 g, 7.4 mmol, 86% yield). The molecular formula of compound 12-7 is C1. 45 H 62 O8N2, molecular weight: 758.4, LC-MS yielded 757.3 (MH). 1HNMR (400MHz, DMSO-d6): δ8.06(t,J=7.5Hz,1H),7.31(dt,J=24.1,7.8Hz,4H),7.20(dd,J=12.1,8.8Hz,5 H),6.87(d,J=7.7Hz,4H),5.75(s,1H),5.03(dd,J=21.6,3.2Hz,1H),4.87–4.77(m,1H),4.30(s,1H),3.7 3(s,6H),3.64(dd,J=17.0,9.4Hz,1H),3.57(s,3H),3.46–3.37(m,2H),3.20–3.14(m,1H),3.04–2.97(m, 1H),2.27(t,J=7.4Hz,2H),2.10–2.01(m,2H),1.97–1.74(m,2H),1.56–1.39(m,4H),1.23–1.16(m,20H).

[0261] 12.8 Preparation of compound SA171

[0262] Compound 12-7 (7.4 mmol, 5.61 g) was placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 14.8 mmol, 4.46 g) and 4,5-dicyanimidazole (1.5 equiv, 11.1 mmol, 1.31 g) were added, and the mixture was stirred for one hour at room temperature. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to chromatography on a C18 reversed-phase column (size: 30 μm). A colorless oily compound SA171 (5.32 g, 5.6 mmol, 75% yield) was prepared using commercially available reagent (MeCN:H2O = 85%:15%) purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound SA171 is: C2 54 H 79 O9N4P, molecular weight: 958.5, LC-MS yielded 981.3 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.13–8.07(m,1H),7.36–7.27(m,4H),7.22–7.17(m,5H),6.87(d,J=7.9Hz,4H),4.88–4 .77(m,1H),4.52(dt,J=9.7,6.4Hz,1H),3.73(s,6H),3.71–3.59(m,2H),3.57(s,3H),3.55–3.45(m,3H),3.41–3. 38(m,1H),3.18(qd,J=8.6,4.1Hz,1H),3.03(dt,J=14.6,7.2Hz,1H),2.78–2.70(m,1H),2.27(t,J=7.4Hz,2H),2 .13–1.92(m,4H),1.49(dt,J=14.7,6.3Hz,5H),1.29–1.08(m,32H),1.06(d,J=6.8Hz,1H),1.00(d,J=6.7Hz,1H). 31 P NMR (162MHz, DMSO-d6): δ146.92 (d, J = 40.2Hz), 146.68 (d, J = 13.8Hz).

[0263] Example 13 Preparation of compound SA192

[0264] 13.1 Preparation of intermediate 13-1

[0265] Ethyl hydroxyacetate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (5.0 mmol, 520.5 mg) was placed in a clean, dry reaction flask. 20 mL of N,N-dimethylformamide was added, and sodium hydride (60% dispersed in mineral oil) (2.0 equiv, 10.0 mmol, 400.0 mg) was slowly added under ice-water bath conditions. The mixture was then stirred at room temperature for 0.5 hours. Tert-butyl 16-bromohexadecanoate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 5.5 mmol, 2.15 g) was slowly added under ice-water bath conditions, and stirring continued at room temperature for 2 hours. After the reaction, water was slowly added dropwise to quench the reaction mixture, followed by the addition of 50 mL of ethyl acetate. The mixture was washed with 50 mL of saturated brine, the organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-5 / 1) to give a colorless oily compound 13-1 (1.44 g, 3.6 mmol, 72% yield). Compound 13-1 Molecular formula: C 23 H 44 O5, molecular weight: 400.3, LC-MS yielded 401.4 (M+H).1 H NMR (400MHz, CDCl3) δ4.07(s,2H),3.75(s,3H),3.51(t,J=6.7Hz,2H),2.19(t,J=7.5Hz,2H),1.65–1.55(m,5H),1.44(s,9H),1.27–1.25(m,21H).

[0266] 13.2 Preparation of intermediate 13-2

[0267] Compound 13-1 (3.6 mmol, 1.44 g) was placed in a clean, dry reaction flask, and 5 mL of trifluoroacetic acid was added. The mixture was then stirred at room temperature for 1 hour. After the reaction, saturated sodium bicarbonate solution was slowly added dropwise to adjust the pH of the reaction solution to approximately 5. Then, 50 mL of ethyl acetate was added, and the mixture was washed with 50 mL of saturated brine. The organic phase was dried, filtered, and concentrated to obtain 1.2 g of a colorless, oily crude product, compound 13-2. This crude product was used directly in the next reaction without purification. The molecular formula of compound 13-2 is C13-2. 19 H 36 O5, molecular weight: 344.2, LC-MS yielded 343.4 (MH).

[0268] 13.3 Preparation of intermediate 13-3

[0269] Compounds 12-5 (1.9 mmol, 1.13 g), 13-2 (1.1 equiv, 2.1 mmol, 722.8 mg), 4-dimethylaminopyridine (20 mol%, 0.38 mmol, 46.4 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 2.85 mmol, 546.3 mg) were placed in clean, dry reaction flasks, and 50 mL of dichloromethane was added. The mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a pale yellow oily compound 13-3 (1.6 g, 1.75 mmol, 92% yield). Compound 13-3 Molecular formula: C 53 H 80 O9N2Si, molecular weight: 916.5, LC-MS yielded 917.6 (M+H).

[0270] 13.4 Preparation of intermediate 13-4

[0271] Compound 13-3 (1.75 mmol, 1.6 g) was placed in a clean, dry reaction flask, and 30 mL of tetrahydrofuran was added. Tetrabutylammonium fluoride (1.0 M in THF) (2.0 equiv, 3.5 mmol, 3.5 mL) was then added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 13-4 (1.2 g, 1.5 mmol, 86% yield). The molecular formula of compound 13-4 is C1. 47 H 66 O9N2, molecular weight: 802.4, LC-MS yielded 801.6 (MH).

[0272] 13.5 Preparation of intermediate SA192

[0273] Compound 13-4 (1.5 mmol, 1.2 g) was placed in a clean, dry reaction flask, and 30 mL of pyridine was added. Then, 4-dimethylaminopyridine (1.0 equiv, 1.5 mmol, 183.3 mg) and succinic anhydride (2.0 equiv, 3.0 mmol, 300.0 mg) were added at room temperature, and the mixture was stirred for 12 hours at room temperature. After the reaction, 50 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to prepare a colorless oily compound SA192 (992.3 mg, 1.1 mmol, 74% yield). The molecular formula of compound SA192 is: C 51 H 70 N2O 12 Molecular weight: 902.4, LC-MS yielded 901.3 (MH). 1H NMR(400MHz, DMSO-d6)δ8.12(t,J=8.4Hz,1H),7.35–7.27(m,4H),7.23–7.18(m,5H),6.88–6.85(m,4 H),5.24(d,J=15.6Hz,1H),4.84–4.70(m,1H),4.06(s,2H),3.73(s,6H),3.70(d,J=2.4Hz,1H),3.63 (s,3H),3.56(dt,J=15.5,7.3Hz,2H),3.42(dd,J=12.5,6.0Hz,3H),3.32(s,br,4H),3.22–3.17(m,1 H),3.06–3.02(m,1H),2.39–2.23(m,2H),2.21–1.94(m,3H),1.52–1.38(m,4H),1.32–1.18(m,23H).

[0274] Example 14 Preparation of compound SA191

[0275] 14.1 Preparation of compound SA191

[0276] Compound 13-4 (1.0 mmol, 802.1 mg) was placed in a clean, dry reaction flask, and 20 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 2.0 mmol, 602.8 mg) and 4,5-dicyanimidazole (1.5 equiv, 1.5 mmol, 177.2 mg) were added, and the mixture was stirred for one hour at room temperature. After the reaction, 30 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 50 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then passed through a C18 reversed-phase column (size: 30 μm). A colorless oily compound SA191 (751.9 mg, 0.75 mmol, 75% yield) was prepared using commercially available reagent (MeCN:H2O = 85%:15%) purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound SA191 is: C2 56 H 83 O 10 N4P, molecular weight: 1002.5, LC-MS yielded 1025.3 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.13–8.07(m,1H),7.36–7.27(m,4H),7.23–7.18(m,5H),6.87(d,J=8.0Hz,4H),4.88 –4.77(m,1H),4.52(s,br,1H),4.06(s,2H),3.73(s,6H),3.70–3.65(m,2H),3.63(s,3H),3.60–3.46(m,4H),3 .43–3.38(m,3H),3.22–3.15(m,1H),3.03(dt,J=14.4,7.2Hz,1H),2.78–2.70(m,2H),2.14–1.93(m,4H),1.48 (dd,J=13.4,6.7Hz,4H),1.22–1.18(m,23H),1.15–1.05(m,10H),1.06(d,J=6.7Hz,1H),1.00(d,J=6.7Hz,1H). 31 P NMR (162MHz, DMSO-d6): δ147.06,146.81,146.74,146.66.

[0277] Example 15 Preparation of compound SA234

[0278] 15.1 Preparation of Compound 15-1

[0279] Compound 12-5 (2.0 mmol, 1.18 g), FMOC amide-octaethylene glycol-acetic acid (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 2.2 mmol, 1.43 g), 4-dimethylaminopyridine (20 mol%, 0.4 mmol, 48.9 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 3.0 mmol, 575.1 mg) were placed in clean, dry reaction flasks, 50 mL of dichloromethane was added, and the mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a pale yellow oily compound 15-1 (2.32 g, 1.9 mmol, 95% yield). The molecular formula of compound 15-1 is C1. 67 H 91 O 16 N3Si, molecular weight: 1221.6, LC-MS yielded 1222.4 (M+H).

[0280] 15.2 Preparation of compound 15-2

[0281] Compound 15-1 (1.9 mmol, 2.32 g) was placed in a clean, dry reaction flask, and 20 mL of dichloromethane and 10 mL of piperidine were added. The mixture was then stirred at room temperature for 4 hours. After the reaction, the reaction solution was concentrated, and then 100 mL of ethyl acetate was added. The mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 15-2 (1.44 g, 1.44 mmol, 76% yield). The molecular formula of compound 15-2 is C1. 52 H 81 O 14 N3Si, molecular weight: 999.5, LC-MS yielded 998.3 (MH).

[0282] 15.3 Preparation of compound 15-3

[0283] Compound 15-2 (1.44 mmol, 1.44 g), compound 13-2 (1.1 equiv, 1.58 mmol, 544.9 mg), 4-dimethylaminopyridine (20 mol%, 0.29 mmol, 35.2 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 2.16 mmol, 414.1 mg) were placed in clean, dry reaction flasks, and 50 mL of dichloromethane was added. The mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a pale yellow oily compound 15-3 (1.66 g, 1.25 mmol, 87% yield). Compound 15-3 Molecular formula: C 71 H 115 O 18 N3Si, molecular weight: 1325.7, LC-MS yielded 1326.4 (M+H).

[0284] Preparation of intermediate 15-4 (15.4)

[0285] Compound 15-3 (1.25 mmol, 1.66 g) was placed in a clean, dry reaction flask, and 30 mL of tetrahydrofuran was added. Tetrabutylammonium fluoride (1.0 M in THF) (2.0 equiv, 2.5 mmol, 2.5 mL) was then added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 15-4 (1.26 g, 1.04 mmol, 83% yield). The molecular formula of compound 15-4 is C1. 65 H 101 O 18 N3, molecular weight: 1211.7, LC-MS yielded 1210.6 (MH).

[0286] 15.5 Preparation of intermediate SA234

[0287] Compound 15-4 (1.04 mmol, 1.26 g) was placed in a clean, dry reaction flask, and 30 mL of pyridine was added. Then, 4-dimethylaminopyridine (1.0 equiv, 1.04 mmol, 127.1 mg) and succinic anhydride (2.0 equiv, 2.08 mmol, 208.0 mg) were added at room temperature, and the mixture was stirred for 12 hours at room temperature. After the reaction, 50 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to prepare a colorless oily compound SA234 (982.2 mg, 0.75 mmol, 72% yield). The molecular formula of compound SA234 is: C 69 H 105 N3O 21 Molecular weight: 1311.7, LC-MS yielded 1310.3 (MH). 1H NMR(400MHz, DMSO-d6)δ12.23(s,1H),7.79(dd,J=6.1,4.0Hz,2H),7.33–7.28(m,4H),7.23–7.17(m,5H ),6.88(dd,J=8.9,2.3Hz,4H),5.24(s,1H),4.80(dq,J=13.8,5.8Hz,1H),4.06(s,2H),3.90–3.87(m,2 H),3.73(s,6H),3.63(s,3H),3.59–3.54(m,5H),3.49–3.47(m,26H),3.40(dt,J=11.8,6.2Hz,6H),3.2 2–3.12(m,4H),2.37–2.24(m,2H),2.05–1.95(m,2H),1.48(dq,J=12.3,6.3Hz,4H),1.30–1.23(m,25H).

[0288] Example 16 Preparation of compound SM324

[0289] According to the synthesis method in Example 1, 4 g of a colorless oily compound SM324 was prepared from the starting materials dodecyl alcohol and N-acetylcytosine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). The molecular formula of compound SM324 is: C 61 H 92 N5O7P, molecular weight: 1037.67, LC-MS yielded 1036.5 (MH). 1 H NMR (400MHz, DMSO) δ10.78(s,1H),7.81–7.71(m,1H),7.31–7.21(m,4H),7.18–7. 09(m,5H),7.03(dd,J=19.8,7.2Hz,1H),6.85–6.74(m,4H),4.02–3.76(m,2H),3. 71(s,6H),3.62–3.39(m,3H),3.23–2.84(m,1H),2.75–2.59(m,2H),2.09(s,3H), 1.63–1.42(m,1H),1.42–1.15(m,43H),1.13–0.98(m,12H),0.84(t,J=6.6Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ150.48,149.68,149.19,149.17.

[0290] Example 17 Preparation of compound SM325

[0291] According to the synthesis method of Example 5, 1.3 g of a colorless oily compound SM325 was prepared. The molecular formula of compound SM325 is: C 61 H 90 N5O8P, molecular weight: 1051.6, LC-MS yielded 1050.4 (MH). 1 H NMR (400MHz, DMSO-d6) δ11.19(d,J=8.2Hz,1H),7.57–7.45(m,1H),7.34–7.24(m,4H),7.18(dd,J=15.0,7.3Hz,5H),6.87–6.80(m,4H),5.55 (dt,J=12.9,6.8Hz,1H),5.44–5.37(m,1H),4.40(dd,J=18.2,10.8Hz,1H),4.06–3.80(m,2H),3.72(s,6H),3.63–3.48(m,3H),3.43–3.36(m ,1H),3.27–3.16(m,1H),3.12–3.05(m,1H),3.02–2.96(m,1H),2.90(dd,J=9.9,6.0Hz,1H),2.84–2.75(m,1H),2.73–2.59(m,2H),2.33–2.2 3(m,3H),1.70–1.57(m,2H),1.45(d,J=5.0Hz,2H),1.23(s,br,31H),1.12–1.04(m,8H),0.94(dd,J=11.9,6.7Hz,4H),0.85(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ150.01,149.97,149.00,148.45,148.20,148.15.

[0292] Example 18 Preparation of compound SA231

[0293] According to the synthesis method of Example 5, 0.65 g of a colorless oily compound SA231 was prepared. The molecular formula of compound SA231 is: C 67 H 91 N8O7P, molecular weight: 1150.6, LC-MS yielded 1149.4 (MH). 1H NMR (400MHz, DMSO-d6) δ11.14(s,1H),8.73–8.66(m,1H),8.39(ddd,J=21.4,18.6,7.7Hz,1H),8.06(d,J=7.3Hz,2H),7.65(t,J=7.3Hz ,1H),7.56(t,J=7.5Hz,2H),7.22–7.11(m,5H),7.06–6.98(m,4H),6.82–6.72(m,4H),4.54–4.17(m,2H),3.89–3.79(m,2H),3.70(d,J =2.7Hz,6H),3.64–3.50(m,3H),3.49–3.39(m,1H),3.24–3.12(m,1H),3.05–2.93(m,1H),2.81(dd,J=22.5,11.1Hz,1H),2.72(dt,J=1 6.6,5.4Hz,2H),2.33–2.17(m,3H),1.70–1.64(m,2H),1.54–1.38(m,3H),1.23(s,br,28H),1.14–0.97(m,12H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ150.02,149.99,149.21,148.48,148.45,148.36.

[0294] Example 19 Preparation of compound SM309

[0295] 19.1 Preparation of intermediate 19-1

[0296] The compound N-tert-butoxycarbonyl-diethylene glycol-carboxylic acid (10.0 mmol, 2.77 g) was placed in a clean, dry reaction flask, and 100 mL of dichloromethane was added. 4-Dimethylaminopyridine (10 mol%, 1.0 mmol, 122.1 mg), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 15.0 mmol, 2.87 g), and dimethylhydroxylamine hydrochloride (1.1 equiv, 11.0 mmol, 1.07 g) were added separately at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-5 / 1) to give a white solid compound 19-1 (2.75 g, 8.6 mmol, 86% yield). Compound 19-1 Molecular formula: C 14 H 28N2O6, molecular weight: 320.1, LC-MS yielded 265.3 (M-55) and 220.3 (M-100).

[0297] 19.2 Preparation of intermediate 19-2

[0298] Compound 19-1 (8.6 mmol, 2.75 g) was placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added. Lithium aluminum hydride (1.1 equiv, 9.5 mmol, 358.5 mg) was slowly added under dry ice-ethanol bath conditions, followed by stirring at -70 °C for 2 hours. The reaction was quenched with water, then washed with 100 mL of ethyl acetate and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-6 / 1) to give a colorless oily compound 19-2 (1.48 g, 5.6 mmol, 66% yield). The molecular formula of compound 19-2 is C1. 12 H 23 NO5, molecular weight: 261.1, LC-MS yielded 206.3 (M-55) and 161.3 (M-100).

[0299] 19.3 Preparation of compound SM309

[0300] According to the synthesis method of Example 5, 0.58 g of a colorless oily compound SM309 was prepared from intermediate 19-2. The molecular formula of compound SM309 is: C 70 H 99 N8O9P, molecular weight: 1226.7, LC-MS yielded 1225.4 (MH). 1H NMR (400MHz, DMSO-d6) δ11.11(s,1H),8.68(dd,J=11.0,3.3Hz,1H),8.32(dd, J=12.4,4.8Hz,1H),8.05(d,J=7.9Hz,2H),7.78(dq,J=10.8,5.4Hz,1H),7.64( t,J=7.3Hz,1H),7.55(t,J=7.6Hz,2H),7.23–7.15(m,5H),7.11–7.01(m,4H),6 .78(dt,J=11.7,6.3Hz,4H),4.41–4.23(m,1H),4.14–4.01(m,1H),3.70(d,J=2 .7Hz,6H),3.67–3.58(m,1H),3.56–3.41(m,6H),3.38(t,J=5.5Hz,2H),3.24– 3.16(m,2H),3.08–2.87(m,1H),2.79–2.70(m,2H),2.67–2.60(m,1H),2.05–2. 00(m,2H),1.97–1.90(m,1H),1.86–1.73(m,1H),1.63(q,J=7.4Hz,1H),1.44(d ,J=5.6Hz,2H),1.27–1.17(m,32H),1.12–0.99(m,12H),0.84(t,J=6.8Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ148.31,148.16,147.62,147.34.

[0301] Example 20 Preparation of siRNA conjugates

[0302] Using the solid-phase phosphoramidite method, the specially modified compounds prepared in the above examples and commercially available conventionally modified monomers (phosphoramidite monomers for synthesizing modified nucleotides dT, Am, Cm, Gm, Um, Af, Cf, Gf, and Uf, all purchased from Shanghai Zhaowei Technology Development Co., Ltd.) were used to sequentially link nucleoside monomers from 3' to 5' along the nucleotide sequence. Lipid group I monomer compounds were placed at the desired position on the sense chain (counting from the 5' end), and lipid group II monomer compounds were placed at either the 5' or 3' end of the sense chain. Each linkage of a nucleoside monomer involved four steps: deprotection, coupling, capping, and oxidation or sulfidation. The synthetic conditions used for the sense and antisense chains are as follows:

[0303] Instrument model: MerMade 12 Oligonucleotide syntheizer solid phase synthesizer, Beijing Haijing 6mL synthesis column, Source™ 15Q 4.6 / 100PE purification column.

[0304] The reagents used to synthesize the siRNA conjugates were purchased from Suzhou Kelama Biotechnology Co., Ltd.

[0305] The synthesis process is described below:

[0306] The single-chain synthesis reaction proceeds from the 3'→5' direction and is performed on a solid-state synthesizer. It includes four main reaction steps:

[0307] a. Deprotection reaction of 4,4'-dimethoxytriphenylmethyl (DMTr): The protecting group DMTr on the nucleotide is removed with dichloroacetic acid to obtain the 5'-hydroxy terminus;

[0308] b. Coupling reaction: The protected phosphoramidite monomer of the nucleotide is mixed with the activator ethylthiotetrazole. The phosphoramidite group is activated, and the 5'-hydroxyl group is still protected by DMTr. It undergoes a condensation reaction with the 5'-hydroxyl group attached to the solid support to generate a phosphite triester.

[0309] c. Oxidation reaction: Under the action of the oxidizing agent iodine, the triphosphite obtained in the previous condensation reaction is converted into a more stable phosphate ester. (That is, trivalent phosphorus is oxidized to pentavalent phosphorus)

[0310] d. Sulfation reaction: Under the action of thioreagent (PADS) phenylacetyl disulfide (PADS), the triphosphite obtained in the previous condensation reaction is converted into thiophosphate (oxidation or thioation is selected according to the sequence design).

[0311] e. Capping reaction: In the condensation reaction, there may be a very small number of 5'-hydroxyl groups that do not participate in the reaction (less than 2%). These are reacted with acetic anhydride and N-methylimidazole to form an acetate end cap that cannot participate in subsequent reactions, thus preventing further reaction. This short fragment can be separated during purification.

[0312] Repeat the above four steps until the required sequence is synthesized.

[0313] After the last nucleoside monomer was ligated, the nucleic acid sequence ligated on the solid-phase support was sequentially cut, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands, wherein:

[0314] The cutting and deprotection conditions are as follows: First, prepare the ammonolysis solution (a mixture of ammonia and ethanol in a 3:1 ratio to a volume of 2 mL). Add the solid support to the reaction flask and shake thoroughly. Ammonolyse at 50°C for 16 hours in a constant temperature water bath. After ammonolysis, cool to room temperature (25°C ± 2°C) in the water bath, filter using a sintered glass funnel, collect the filtrate in a round-bottom flask, wash the residue with 50% ethanol aqueous solution, collect the filtrate, concentrate using a rotary evaporator, and then transfer to a glass bottle. Send a small sample of the crude product to the analytical department for crude LC-MS analysis. The detection method is as follows: Use Waters Acquity UPLC-LTQLC-MS (Column: ACQUITY UPLC BEH C18) to detect the purity of the sense and antisense chains and analyze the molecular weight. The measured values ​​are consistent with the theoretical values.

[0315] The purification and desalting conditions were as follows: purification was performed using an ion-exchange chromatography column, followed by desalting using a Topvan HiPrep™ 26 / 10 Desalting gel column, and then single-chain lyophilization. After single-chain lyophilization, samples were taken for LC-MS analysis.

[0316] Finally, the obtained justice chain and antisense chain need to be annealed into a dual chain.

[0317] The annealing procedure is as follows: The purified sense and antisense chains are dissolved separately in water for injection to prepare solutions of 0.1 mg / mL–40 mg / mL. The solutions are mixed in an equimolar ratio using Thermo Scientific Nanodrop Eight, heated at 90°C for 5 minutes, and then slowly cooled naturally to allow them to form a double-stranded structure through hydrogen bonds. Samples are taken and sent to test the SEC purity of the product. The double-stranded samples are then lyophilized.

[0318] The synthesized siRNA conjugates are shown in Tables 1, 2, 4 and 6. The SEC purity of the conjugates in Table 2 is shown in Table 3.

[0319] Table 1

[0320] Table 2

[0321] Table 3

[0322] Example 21: Testing the activity of siRNA conjugates in mice

[0323] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). Each mouse received 5mpk of the conjugate intravenously. Fourteen days after administration, the animals were euthanized, and adipose tissue, kidney tissue, and liver tissue were harvested. The tissue fragments were placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe-based qPCR (Applied Biosystems, 4444964).

[0324] Primers for the target gene SOD1:

[0325] Forward primer: GTCCTTTCCAGCAGTCACAT (SEQ ID NO.7);

[0326] Reverse primer: GGTTCCACGTCCATCAGTATG (SEQ ID NO.8);

[0327] Probe primers: CCAACATGCCTCTCTTCATCCGC (SEQ ID NO.9);

[0328] Primers for the internal reference gene β-actin:

[0329] Forward primer: CATTGCTGACAGGATGCAGAA (SEQ ID NO.10);

[0330] Reverse primer: GCTCAGGAGGAGCAATGATCTT (SEQ ID NO.11);

[0331] Probe primers: CCTTGGCTCCTAGCACC (SEQ ID NO.12).

[0332] The results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group being 100%). The sequences of the conjugates used for injection are shown in Table 1, and the results of the residual SOD1 mRNA expression level are shown in Figure 1. The results show that, at the injected dose, compared with the solvent, the conjugates SD004772, SD005726, SD005722, SD005723, and SD005724 all achieved better mRNA silencing activity in adipose tissue. Among them, SD005723 and SD005724, which are conjugated with SA192, significantly reduced the knockdown of SOD1 in liver tissue, and showed better tissue selectivity.

[0333] Example 22: In vivo testing of siRNA conjugate activity in mice

[0334] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). Each mouse received a subcutaneous injection of 1 mpk of the conjugate. Fourteen days after administration, the animals were euthanized, and adipose tissue, kidney tissue, and liver tissue were harvested. The tissue fragments were placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe-based qPCR (Applied Biosystems, 4444964). Primers and probes were the same as in Example 21.

[0335] The results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group was 100%). The sequences of the conjugates used for injection are shown in Table 2. The results of the residual expression level of SOD1 mRNA are shown in Figures 2 and 3. The results show that, at the injection dose, compared with the solvent, the conjugates SD007258, SD007280 and SD007285 all achieved good mRNA silencing activity in the adipose tissue of the scapula, groin and fallopian tube of mice, and the silencing activity in the liver was very low, indicating that these conjugates have good tissue selectivity.

[0336] Example 23 In vitro cell experiments

[0337] Using 96-well cell culture plates, Hepa1-6 cells were transfected with siRNA conjugates at final concentrations of 10 nM and 0.1 nM using RNAiMAX. RNA was extracted and detected 24 hours later. The siRNA conjugates are shown in Table 4 below.

[0338] Experimental methods

[0339] 1) Dilution of test substance concentration: The concentration of the compound was tested using a Synergy LX multi-functional microplate reader. The stock solution concentration was uniformly adjusted to 20 μM using DEPC water. First, 5 μL of the stock solution was diluted with 15 μL of optiMEM to a concentration of 5 μM; 6 μL (5 μM concentration) was diluted with 44 μL of optiMEM to a concentration of 600 nM; then 10 μL (600 nM concentration) was diluted with 40 μL of optiMEM to a concentration of 120 nM, and set aside; 10 μL (120 nM concentration) was diluted with 90 μL of optiMEM to a concentration of 12 nM; then 10 μL (12 nM concentration) was diluted with 90 μL of optiMEM to a concentration of 1.2 nM, and set aside.

[0340] 2) Preparation of RNAiMAX working solution: Prepare 0.3 μL RNAiMAX + 9.7 μL optiMEM per well.

[0341] 3) Preparation of transfection complex: Take 24 μL of 120 nM siRNA dilution buffer and 24 μL of 1.2 nM siRNA dilution buffer respectively using a multi-channel pipette, add 24 μL of RNAiMAX working solution to each, mix well, and incubate at room temperature for 10 minutes.

[0342] 4) Cell treatment: Under a microscope, observe that the cell confluence is about 80%. After trypsin digestion and centrifugation, count the cells and prepare a cell suspension at 20,000 cells / 100μL / well (for example, for one 96-well plate: 20,000 cells x 100; culture medium: 100μL x 100). After mixing the cells, add 100μL of cell suspension to each well using a pipette.

[0343] 5) Suspension transfection: Add the prepared transfection complex (20 μL) to the prepared cell suspension, mix well, and incubate in an incubator for 24 h before processing.

[0344] 6) RNA extraction: RNA was extracted 24 hours after transfection, according to the Zhiang Blood RNA Magnetic Bead Extraction Kit (GO-MNTR).

[0345] 7) Reverse transcription: See the product manual for HiScript IV All-in-One Ultra RT SuperMix for qPCR (catalog number: Novizan R433).

[0346] 8) q-PCR: See The Universal TaqMan multiplex qPCR master mix (catalog number: Yisheng 11211ES08) was used for quantitative real-time PCR detection to determine the SOD1 mRNA knockdown level (KD). Primers and probes were the same as in Example 21.

[0347] The experimental results are shown in Table 5 below.

[0348] Table 4

[0349] Table 5

[0350] As shown in Table 5, under 10 nM conditions, the SOD1 knockdown efficiency of SD007621, SD007622, ​​SD007623, SD007624, SD007625, SD007626, SD007630, SD007632, SD007634, SD007636, SD007637, and SD007638 is >90%. Under 0.1 nM conditions, the SOD1 knockdown efficiency of SD007621, SD007622, ​​SD007623, SD007624, SD007625, SD007626, SD007632, SD007633, SD007634, and SD007635 is >50%. In summary, SD007621, SD007622, ​​SD007623, SD007624, SD007625, SD007626, SD007632, and SD007634 all exhibited high knockdown efficiency at both high and low concentrations. The lipid group I was located at positions 1-6, 12, and 14 from the 5' end of the positive chain.

[0351] Example 24: In vivo testing of siRNA conjugates in mice

[0352] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). Each mouse received a subcutaneous injection of 1 mpk of the conjugate. Fourteen days after administration, the animals were euthanized, and adipose tissue, kidney tissue, and liver tissue were harvested. The tissue fragments were placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The tissues were ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe-based qPCR (Applied Biosystems, 4444964). Primers and probes were the same as in Example 21.

[0353] Results are expressed as residual expression levels in the siRNA-treated group compared to the solvent group (solvent group = 100%). The sequences of the conjugates used for injection are shown in Tables 1 and 2. The residual SOD1 mRNA expression levels are shown in Figure 4. The results indicate that, at the injected dose, the Uda conjugate SD005726 exhibited better mRNA silencing activity in both adipose and liver tissues compared to the solvent, without selectivity. SD005724 and SD007285 showed better mRNA silencing activity in adipose tissue, but lower knockdown activity and better selectivity in liver, kidney, and spleen tissues.

[0354] Example 25: In vivo testing of siRNA conjugates in mice

[0355] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and their condition observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received conjugates SD005724 and SD007285, while the solvent group received phosphate-buffered saline (PBS). Each mouse received a subcutaneous injection of 0.5 mpk of the conjugate. Fourteen days after administration, the animals were euthanized, and adipose tissue, heart, and gastrocnemius muscle tissue were harvested. The tissue fragments were cut and placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. Tissues were ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of SOD1 mRNA was detected by probe-based qPCR (Applied Biosystems, 4444964). Primers and probes were the same as in Example 21.

[0356] The results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group was 100%). The results of the residual expression level of SOD1 mRNA are shown in Figure 5. The results show that at the injection dose (0.5 mpk), SD007285 and SD005724 both achieved better mRNA silencing activity in adipose tissue compared to the solvent. SD007285 showed better selectivity in myocardial tissue than SD005724.

[0357] Example 26: In vivo testing of siRNA conjugates in mice

[0358] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Fourteen days after administration, the animals were euthanized, and inguinal white adipose tissue (iWAT) and perigonadal white adipose tissue (pgWAT) were collected. The expression level of ALK7 mRNA was detected using qPCR.

[0359] Target gene mouse ALK7 primers:

[0360] Forward primer: ATGCTAACCAACGGGAAAGAG (SEQ ID NO.15)

[0361] Reverse primer: GGAAGGTGCAGTGTGATATTGT (SEQ ID NO.16)

[0362] GAPDH primers for internal reference gene:

[0363] Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO.17)

[0364] Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO.18).

[0365] Results are expressed as residual expression levels in the siRNA-treated group compared to the solvent group (solvent group = 100%). The sequences of the conjugates used for injection are shown in Table 6. Figure 6 shows the residual expression levels of ALK7 mRNA in mouse inguinal white adipose tissue (iWAT) and perigonial white adipose tissue (pgWAT) after using the tested conjugates. The results showed that compounds SD007277, SD007278, SD007279, and SD007275 all exhibited good mRNA silencing activity in adipose tissue.

[0366] Table 6

[0367] Example 27: Evaluation of siRNA conjugate activity in non-human primates (NHP)

[0368] In this embodiment, the in vivo activity of siNRA conjugates SD007278 and SD007317 was evaluated in non-human primate (NHP) cynomolgus monkeys.

[0369] Healthy female cynomolgus macaques aged 3-5 years were selected, with two macaques in each group. Grouping was initiated on day 3 before drug administration, and subcutaneous abdominal fat samples were collected for subsequent ALK7 mRNA detection. SD007278 and SD007317 were administered subcutaneously on day 0 at a dose of 3 MPk. Animal experiments, as well as corresponding animal husbandry and quarantine, were conducted by WuXi AppTec. Subcutaneous abdominal fat samples were collected on days 14, 28, 56, 84, and 112 after drug administration, and ALK7 mRNA expression levels were detected using qPCR.

[0370] Primers for the target gene, cynomolgus monkey ALK7:

[0371] Forward primer: TCCCAAACCAGTGGCAAAGT (SEQ ID NO.29);

[0372] Reverse primer: TACGAAGAGCAGTTAGGCGG (SEQ ID NO.30);

[0373] GAPDH primers for internal reference gene:

[0374] Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO.31);

[0375] Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO.32).

[0376] Figure 7 shows the residual ALK7 mRNA expression level after administration to the subcutaneous fat of cynomolgus monkeys, compared to before administration. The maximum KD (knockdown) activity was greater than 90%, and the knockdown activity remained greater than 80% for 112 days. Further extending the experiment to 140 days, the knockdown activity was still greater than 75%, demonstrating good efficacy and long-term effectiveness.

[0377] Example 28: Evaluation of siRNA conjugate activity in non-human primate cynomolgus monkeys (NHP)

[0378] In this embodiment, the in vivo activity of siNRA conjugates SD007309 and SD007320 was evaluated in non-human primate (NHP) cynomolgus monkeys.

[0379] Healthy female cynomolgus macaques aged 3-5 years were selected, with two macaques in each group. Grouping was initiated 7 days prior to drug administration, and subcutaneous abdominal fat samples were collected for subsequent ALK7 mRNA detection. SD007309 and SD007320 were administered subcutaneously on day 0 at a dose of 3 MPk. Animal experiments, as well as corresponding animal husbandry and quarantine, were conducted by WuXi AppTec. Subcutaneous abdominal fat samples were collected on days 14, 28, 56, 84, and 112 post-administration, and ALK7 mRNA expression levels were detected using qPCR. Primers were the same as in Example 27.

[0380] Figure 8 shows the residual ALK7 mRNA expression level after administration to subcutaneous fat of cynomolgus monkeys compared to before administration. All conjugates achieved a maximum KD (knockdown) activity of more than 90%, and the knockdown activity remained greater than 80% for 112 days. Further extending the experiment to 140 days, it was found that the knockdown activity could still reach more than 75%, demonstrating good efficacy and long-term effectiveness.

[0381] The above detailed description of this disclosure is intended to enable those skilled in the art to understand and implement its contents, but it should not be construed as limiting the scope of protection of this disclosure. All equivalent changes or modifications made in accordance with the spirit and essence of this disclosure should be included within the scope of protection of this disclosure.

Claims

1. A nucleic acid conjugate comprising a small nucleic acid, a lipid group II located at the 5' end and / or 3' end of the small nucleic acid, and a lipid group I located at any position on the small nucleic acid other than the position of the lipid group II; wherein, The lipid group I is shown as general formula (Ⅰ): Wherein, B is a natural nucleobase, a modified nucleobase, a universal base, or H; R1 and R2 are independently H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3) or OCH2CH2OCH3; m and n are independently 1, 2 or 3; Z represents a bond, or one of the groups shown in formulas (Z1)-(Z4): Wherein, R4 is H, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl or C2-C6 alkynyl; X is a bond, or a combination of one or more groups shown in formulas (X1)-(X12): Where R3 is H, halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl or C2-C6 alkynyl; j is an integer between 1 and 10; k is 1, 2, 3 or 4; Y is one of the groups shown in formulas (Y1)-(Y10): Where p is an integer between 5 and 25; The lipid group II is shown in general formula (II): Wherein, L represents one or more of the groups shown in formulas (A1)-(A16) in a linked combination: Wherein, R' is hydrogen, a C1-C10 alkyl group, or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 20; j2 is an integer from 1 to 20; R 6 -(CH2) j3 -NH-CO-R 7 Where j3 is an integer between 0 and 6, R 7 It is a C1-C8 alkyl group; m' is an integer between 0 and 6; T is a 6- to 24-membered alkylene chain or a 6- to 24-membered oxanealkylene chain; K is Where W is hydrogen; Q is Where R 2 R 3 Each of the following can be independently H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, or C2-C20 alkynyl; M is Among them, R 4 R 5 Each of the following is independently H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, C2-C20 alkynyl, or R. 4 R 5 They are directly connected to form a ring, where p1 is an integer from 1 to 6; J is N or CR 9 , where R 9 It is H, C1-C20 alkyl or C3-C10 cycloalkyl; It is a C3-C10 cycloalkyl or C3-C10 heterocyclic group; R 1 It can be H, fluorine, hydroxyl, cyano, C1-C6 alkanol, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl; n' is an integer between 0 and 10; This indicates the site where a group is covalently bonded.

2. The nucleic acid conjugate according to claim 1, characterized in that: R1 and R2 are independently H, OH, halogen, NH2, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, C2-C4 alkynyl, S-CH3, NCH3(CH3) or OCH2CH2OCH3; or, m is 1 or 2; or, n is 1; or, Z is a bond, a group represented by formula (Z1), or a group represented by formula (Z3); or, R4 is H, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, or C2-C4 alkynyl; or... X is a bond, or a combination of one, two, three, four or more of the groups shown in formula (X1), formula (X2), formula (X3), formula (X6), formula (X7), and formula (X12); or, R3 is H, halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, C2-C4 alkenyl, or C2-C4 alkynyl; or... j is 1, 2, 3, 4, or 5; or, k is 1, 2, 3, or 4; or, Y is a group represented by formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y6), formula (Y7), formula (Y8), or formula (Y10); or, p is an integer between 10 and 25; or, B is a natural nucleobase, a modified nucleobase, or a universal nucleobase; or, L is a combination of one or more of the following groups: the group shown in formula (A1), the group shown in formula (A2), the group shown in formula (A3), the group shown in formula (A4), the group shown in formula (A5), the group shown in formula (A6), the group shown in formula (A7), the group shown in formula (A8), the group shown in formula (A9), the group shown in formula (A10), the group shown in formula (A11), the group shown in formula (A13), the group shown in formula (A14), and the group shown in formula (A16); or, R' is hydrogen, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 15; j2 is an integer from 1 to 15; or, m' is an integer between 0 and 3; or, T is a 10- to 24-membered alkylene chain or a 10- to 24-membered oxaalkylene chain; or... R 2 R 3 Each is independently H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or, M is or, J is CR 9 , where R 9 It is H, C1-C10 alkyl or C3-C8 cycloalkyl; or, It is a C3-C8 cycloalkyl group or a C3-C8 nitrogen-containing heterocyclic group; or, R 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or, n' is an integer between 0 and 5.

3. The nucleic acid conjugate according to claim 1 or 2, characterized in that: R1 and R2 are independently H, OH, halogen, NH2, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, butynyl, S-CH3, NCH3(CH3), or OCH2CH2OCH3; or, R4 is H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, or butynyl; or, X is a bond, or a combination of groups shown in formula (X1) and (X6), a combination of groups shown in formula (X2) and (X6), a group shown in formula (X6), a group shown in formula (X12), a combination of groups shown in formula (X3) and (X6), or a combination of groups shown in formula (X6) and (X7); or, R3 is H, halogen, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, vinyl, propenyl, butenyl, ethynyl, propynyl, or butynyl; or, j is 1, 2, or 3; or, k is 1, 2, or 3; or, Y is a group represented by formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y7), formula (Y8), or formula (Y10); or, p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25; or, B is a natural or modified nucleobase; or, L is a combination of at least two of the following groups: the group shown in formula (A1), the group shown in formula (A2), the group shown in formula (A3), the group shown in formula (A4), the group shown in formula (A5), the group shown in formula (A6), the group shown in formula (A7), the group shown in formula (A8), the group shown in formula (A9), the group shown in formula (A10), the group shown in formula (A11), the group shown in formula (A13), the group shown in formula (A14), and the group shown in formula (A16); or, R' is hydrogen, a C1-C5 alkyl group, or a C4-C6 cycloalkyl group; or, j1 is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15; j2 is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15; or, j3 is 0, 1, 2, 3, 4, 5, or 6; or, R7 is a C1-C5 alkyl group; or, m' is 0, 1, 2, or 3; or, T is a 10- to 24-membered alkylene chain with 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 carbon atoms, or a 10- to 24-membered oxaalkylene chain in which some carbon atoms are replaced by oxygen atoms, wherein the number of oxygen atoms is 1, 2, 3, 4, or 5; or, R 2 R 3 Each is independently H, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl; or, M is or, J is CR 9 , where R 9 It is H, C1-C5 alkyl or C3-C5 cycloalkyl; or, It is a four- to eight-membered nitrogen-containing saturated heterocycle; or, R 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl; or, n' can be 0, 1, 2, 3, 4, or 5.

4. The nucleic acid conjugate according to any one of claims 1 to 3, characterized in that: R2 is H, and n is 1; Z represents a bond, a group represented by formula (Z1), or a group represented by formula (Z3); R4 is H; R1 is H, and m is 1 or 2; X is a bond, or a combination of groups shown in formula (X1) and groups shown in formula (X6), a combination of groups shown in formula (X2) and groups shown in formula (X6), a group shown in formula (X6), a group shown in formula (X12), a combination of groups shown in formula (X3) and groups shown in formula (X6), or a combination of groups shown in formula (X6) and groups shown in formula (X7). R3 is H; j is 1 or 2; k is 1, 2 or 3; Y represents the group shown in formula (Y1), formula (Y2), formula (Y3), formula (Y4), formula (Y7), formula (Y8), or formula (Y10). p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25; B is adenine, cytosine, guanine, uracil, or thymine; L is a combination of at least two of the following groups: the group shown in formula (A1), the group shown in formula (A2), the group shown in formula (A3), the group shown in formula (A4), the group shown in formula (A5), the group shown in formula (A6), and the group shown in formula (A16), and L contains the group shown in formula (A1) and the group shown in formula (A2). R' is hydrogen, methyl, ethyl, propyl, cyclobutyl, cyclopentyl, or cyclohexyl; j1 is an integer from 1 to 15; j2 is an integer from 2 to 5; m' is 0; T is a 10 to 20-membered alkylene chain or a 10 to 20-membered oxaalkylene chain, and the number of oxygen atoms in T is 1 and is close to the side where K is located; R 2 R 3 Each of the following can be independently H, methyl, ethyl, propyl, methoxy, ethoxy, propoxy, vinyl, propenyl, butenyl, pentenyl, ethynyl, propynyl, butynyl, or pentynyl; M is J is CR 9 , where R 9 It can be H, methyl, ethyl, propyl, cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl; It is a C4-C8 nitrogen-containing heterocyclic group with 1 nitrogen atom; R 1 It can be H, fluorine, hydroxyl, cyano, C1-C3 alkanol, C1-C5 alkyl, C1-C5 alkoxy, C2-C6 alkenyl or C2-C6 alkynyl; n' is 0.

5. The nucleic acid conjugate according to any one of claims 1 to 4, characterized in that: X is a bond, and Y is a group represented by formula (Y1), where p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25; or, X is the group represented by formula (X12), Y is the group represented by formula (Y2), where k is 1, 2, or 3, R3 is H, methyl, ethyl, or propyl, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25; or, X is the group shown in formula (X6), and Y is the group shown in formula (Y8), where j is 1, 2, or 3, and p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25; or, T is (CH2) j4 L is Where j4 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24; or, T is (CH2) j5 -O-(CH2) j6 L is Where j5 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, and j6 is 1, 2 or 3; or, T is (CH2) j5 -O-(CH2) j6 L stands for NHCO-(CH2). j7 -(OC2H4) j8 -NHCO, where j5 is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21, j6 is 1, 2 or 3, j7 is 1, 2 or 3, and j8 is 5, 6, 7, 8 or 9.

6. The nucleic acid conjugate according to any one of claims 1 to 4, characterized in that: The group formed by the connection of X and Y can be any of the following structural formulas: Where p is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25, R3 is H, methyl, ethyl or propyl, j is 1, 2 or 3, and k is 1, 2 or 3; or, The group formed by the connection of L and T can be any of the following structural formulas:

7. The nucleic acid conjugate according to any one of claims 1 to 6, characterized in that: Z does not exist, R1 and R2 are both H, m and n are both 1, and the group represented by general formula (Ⅰ) is shown in the following formula: The group represented by general formula (II) is shown in the following formula:

8. The nucleic acid conjugate according to claim 1, characterized in that: The group represented by general formula (Ⅰ) is any one of the following structures: Where B is a base A, T, C, G, or U; The group represented by general formula (II) has the following structure:

9. The nucleic acid conjugate according to any one of claims 1 to 8, characterized in that: As shown in general formula (I), the group is linked to the adjacent nucleotide via a phosphodiester bond or a thiophosphate diester bond, and as shown in general formula (II), the group is linked to the 5' or 3' end nucleotide via a phosphodiester bond or a thiophosphate diester bond.

10. The nucleic acid conjugate according to any one of claims 1 to 9, characterized in that: One of the groups represented by general formula (I) or general formula (II). The indicated linker site is linked to the nucleotide via a phosphodiester bond or a phosphothiodiester bond; another... The connection site indicated is connected to H.

11. The nucleic acid conjugate according to any one of claims 1 to 10, characterized in that: The small nucleic acid includes an antisense strand complementary to the target gene and a sense strand complementary to the antisense strand; wherein, the lipid group II is attached to the 5' end and / or the 3' end of the sense strand, and the lipid group I is located at any one or more of positions 1-6, 12 or 14 from the 5' end of the sense strand, more preferably at any one or more of positions 5, 6 or 7 from the 5' end of the sense strand.

12. The nucleic acid conjugate according to any one of claims 1 to 10, characterized in that: The nucleic acid conjugate targets adipose tissue.

13. A pharmaceutical composition, characterized in that: It includes the nucleic acid conjugates according to any one of claims 1 to 12, and pharmaceutically acceptable carriers or excipients.

14. Use of a nucleic acid conjugate as described in any one of claims 1 to 12 or a pharmaceutical composition as described in claim 13 in the preparation of a medicament for delivering small nucleic acids to adipose tissue.

15. Use of a nucleic acid conjugate as described in any one of claims 1 to 12 or a pharmaceutical composition as described in claim 13 in the preparation of a medicament for treating and / or preventing obesity.

Images