EAMA transporter mutants and uses thereof
EamA transporter mutants with targeted mutations improve L-serine and S-sulfo-cysteine production by enhancing substrate export and reducing cellular stress in E. coli fermentation.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CYSBIO APS
- Filing Date
- 2025-11-07
- Publication Date
- 2026-05-15
AI Technical Summary
The inherent toxicity of L-serine towards E. coli poses a major hurdle in the development of L-serine producing E. coli, and overexpression of EamA transporter proteins leads to cellular stress, reducing productivity in fermentation processes.
Development of EamA transporter mutants with specific amino acid mutations, enhancing substrate transport activity and co-localization of the L-serine biosynthetic pathway to improve production efficiency.
The mutated EamA transporter polypeptides significantly enhance the production of L-serine and S-sulfo-cysteine in fermentation processes by improving substrate export capabilities and reducing cellular stress.
Smart Images

Figure IMGF000020_0001 
Figure IMGF000032_0001_TABLE 
Figure IMGF000032_0002_TABLE
Abstract
Description
EamA transporter mutants and uses thereofField
[0001] The present invention relates to the field of industrial biotechnology, specifically pertaining to the industrial production of natural metabolites using genetically modified hosts, possessing improved export capabilities by overexpression of mutant exporter proteins. The present disclosure describes the identification, validation and usage of mutants of the E. coli EamA transport protein with improved transport activity to improve the production of the amino acid L-serine and the uncommon amino acid, S-sulfo-cysteine (SSC) in fermentation processes. It is further disclosed how co-localization of the L-serine biosynthetic pathway to the EamA protein through polypeptide fusions improves production in fermentation processes.Background
[0002] Microbial production of L-serine is a well-known method in scientific literature, such as in EP0931833, US11,407,976 and WO 2024 / 084049. The mentioned patent documents, briefly, describe production of L-serine via fermentation on glucose, genetic methods to improve the L-serine tolerance of producing microorganisms, and genetic methods to increase L-serine production in producing microorganisms, respectively. Contemporary literature has indicated that the inherent toxicity of L-serine towards E. coli is a major hurdle for development of L-serine producing E. coli [1], [2], Tolerance towards L-serine can be improved by genetic methods, as identified by evolution studies [2], or through overexpression of the acetyl-serine, L-serine and cysteine exporter, EamA [1], [2],
[0003] EamA (formerly YdeD) is an integral membrane protein (IMP) belonging to the drug / metabolite exporter (DME) family within the drug / metabolite transporter (DMT) superfamily [3], Members of the DMT superfamily have been used in fermentation processes by facilitating product export, for example RhtA for L-threonine production (W02005 / 078113A1), YddG for aromatic amino acid production (US7,666,655B2), and EamA for L-serine production (USll,407,976B2). The use of a mutant YddG-homologue has also been described to improve production of the aromatic amino acid L-tryptophan (US11,524,981B2). Lastly, EamA has been used as part of scaffolding strategies to colocalize enzymes of the L-serine pathway to the exporter, which has been shown to benefit production of L-serine, by the addition of affinity tags to EamA and the L-serine production pathway's constituent proteins, SerA, SerC, and SerB [4], [5], The mentioned disclosures use overexpression of the respective transport proteins to improve production. However, overexpression of IMPs is known to cause cellular stress [6], [7], risking reduced productivity when implemented in production hosts. For this reason, itwas of interest to carry out protein engineering of EamA to improve the activity of the protein, lowering the need for overexpression, with the goal of achieving higher amino acid production. Similar work has been carried out for RhtA [8], which identified 6 mutations within the first 90 residues of the RhtA protein that improved the activity of the protein. Similar work has not been carried out for EamA, whose structure / activity relationship remains unknown.Summary
[0004] Over this background art, the present disclosure provides a transporter polypeptide which has at least 50% sequence identity to a polypeptide of EamA of SEQ ID NO: 4, or an ortholog or paralog thereof, wherein the transporter polypeptide has one or more amino acid mutations relative to the polypeptide of EamA, for example relative to SEQ ID NO: 4. The transporter polypeptide of the present disclosure is useful in i.a. exporting a substrate across a cell membrane. Further, in some embodiments of the present disclosure, the transporter polypeptide is mutated relative to wildtype reference transporters of the EamA family - the mutants being capable of significantly increased substrate transport across a cell membrane.
[0005] In one aspect, a genetically modified host cell is provided comprising a heterologous polynucleotide encoding a transporter polypeptide capable of exporting a substrate, such as an amino acid across a cell membrane, such as out of a cell.
[0006] In a further aspect, a polynucleotide construct is provided comprising a polynucleotide sequence encoding the transporter polypeptide defined herein, operably linked to one or more control sequences.
[0007] In a further aspect, a cell culture is provided comprising the cell as defined herein and a growth medium
[0008] In a further aspect, a method for producing a substrate is provided, such as an amino acid, for example serine comprisinga) culturing the cell culture defined herein at conditions allowing the cell to produce the substrate; andb) optionally recovering and / or isolating the substrate.
[0009] In a further aspect, a fermentation composition is provided comprising the cell culture defined herein and the substrate, such as the amino acid, for example serine, comprised therein.
[0010] In a further aspect, a composition is provided comprising the fermentation composition of the present disclosure, and one or more carriers, agents, additives and / or excipients.Drawings and figuresFigure 1 shows that L-serine production is improved by overexpression of mutant eamA and is further improved by increasing the expression levels of the gene.Figure 2 shows that the identified EamA(F73G) mutant shows improved growth in the presence of amino acids and amino acid intermediates of the L-cysteine pathwayFigure 3 shows that the identified EamA(F73G) mutant shows improved growth in the presence of branched chain amino acids, among others.Figure 4 shows a phylogenetic tree of E. coli EamA and 491 related proteins with sequence similarities down to 50%, from which 6 representatives were chosen for structural analysis.Figure 5 shows a sequence identity matrix comparing protein sequences of EcEamA and 6 sequence homologues.Figure 6 shows the protein models of E. coli EamA and 6 homologues superimposed to highlight structural similarities in the protein backbone and the proposed binding pocket.Figure 7 shows the predicted topology of E. coli EamA and the orientation of the constituent transmembrane helices. Generated using the DeepTMHMM webtool.Figure 8 shows a view of E. coli EamA protein (AlphaFold model P31125) with residues showing mutations indicated as stick figures. The protein backbone and proposed binding pockets are highlighted.Figure 9 shows a view of E. coli EamA protein (AlphaFold model P31125) with residues showing mutations indicated as stick figures; seen from the side, rotated 360 degrees across 4 pictures.Figure 10 shows a LOGO plot made by multiple alignment of 137.000 EamA-like proteins from the UniRef90 database, generated using the EVcouplings webserver. Residues discussed herein are highlighted.Figure 11 shows a summary of the secondary structure of E. coli EamA, indicating alpha-helical regions and unstructured regions, in addition to the location of the conserved GX6G motifs.Figure 12 shows the location of the proposed binding pocket of E. coli EamA (in black), by comparison to the crystal structure of Starkeya Novella YddG (in grey), where the location of the binding pocket is known. Based on proximity to the binding pocket of YddG, EamA residues proposed to constitute the whole binding pocket are shown as sticks.Figure 13 shows production of L-serine by expression of EamA-SerB to co-localize L-serine export to L-serine production.Figure 14 shows that the combined use of improved EamA mutants, with co-localized SerB, significantly improved L-serine production in fermentation.Figure 15 shows that overexpression of mutant E. coli EamA protein improves production of S-sulfocysteine during fermentation considerably.Incorporation by reference
[0011] All publications, patents, and patent applications referred to herein are incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict between a term herein and a term in an incorporated reference, the term herein prevails and controls.Detailed descriptionDefinitions
[0012] Any EC numbers used herein refers to Enzyme Nomenclature 1992 from NC-IUBMB, Academic Press, San Diego, California, including 30 supplements 1-5 published in Eur. J. Bio-chem. 1994, 223, 1-5; Eur. J. Biochem. 1995, 232, 1-6; Eur. J. Biochem. 1996, 237, 1-5; Eur. J. Biochem. 1997, 250, 1-6; and Eur. J. Biochem. 1999, 264, 610-650; respectively. The nomenclature is regularly supplemented and updated; see e.g. http: / / enzyme.expasy.org / . The term "PEP" as used herein refers to phosphoenol pyruvate.
[0013] The terms "heterologous" or "recombinant" or "genetically modified" and their grammatical equivalents as used herein interchangeably refers to entities "derived from a different species or cell". For example, a heterologous or recombinant polynucleotide gene is a gene in a host cell not naturally containing that gene, i.e. the gene is from a different species or cell type than the host cell. The terms as used herein about microbial host cells refers to microbial host cells comprising and expressing heterologous or recombinant polynucleotide genes.
[0014] The term "metabolic pathway" as used herein is intended to mean two or more enzymes acting sequentially in a live cell to convert chemical substrate(s) into chemical product(s). Enzymes are characterized by having catalytic activity, which can change the chemical structure of the enzymatic substrate(s). An enzyme may have more than one enzymatic substrate and produce more than one product. The enzyme may also depend on cofactors, which can be iganic chemical compounds or organic compounds such as proteins for example enzymes (co-enzymes). The term "operative biosynthetic metabolic pathway" refers to a metabolic pathway that occurs in a live recombinant host, as described herein.
[0015] The term "in vivo", as used herein refers to within a living cell or organism, including, for example animal, a plant or a microorganism.
[0016] The term "in vitro", as used herein refers to outside a living cell or organism, including, without limitation, for example, in a microwell plate, a tube, a flask, a beaker, a tank, a reactor and the like.
[0017] The term "in planta", as used herein refers to within a plant or plant cell.
[0018] The term "substrate" refers to a molecule that can bind to and be recognized by thetransporter polypeptide of the present disclosure, e.g. within a cell or in the cell membrane. The substrate is capable of being transported across a cellular membrane via this transporter polypeptide, facilitating its movement out of the cell. The transporter polypeptide typically recognizes specific structural features of the substrate, such as size, charge, and molecular configuration, allowing the substrate to engage in a reversible binding interaction with the transporter, thereby enabling its translocation through the cell membrane.
[0019] The term "tolerance" as used herein refers to an organism's ability to replicate and divide in the presence of harmful or toxic compounds.
[0020] The term "increased tolerance" as used herein refers to an organism's ability to replicate and divide under conditions not typically possible, owing to for example expression of the transporter polypeptide of the present disclosure, as shown for example by an increase in growth rate across concentrations of the added toxic compound(s) supplemented to the growth media, compared to a reference.
[0021] The term "endogenous" or "native" as used herein refers to a gene or a polypepetide in a host cell which originates from the same host cell.
[0022] The term "deletion" as used herein refers to manipulation of a gene so that it is no longer expressed in a host cell.
[0023] The term "disruption" as used herein refers to manipulation of a gene or any of the machinery participating in the expression the gene, so that it is no longer expressed in a host cell.
[0024] The term "attenuation" as used herein refers to manipulation of a gene or any of the machinery participating in the expression the gene, so that it the expression of the gene is reduced as compared to expression without the manipulation.
[0025] The terms "substantially" or "approximately" or "about", as used herein refers to a reasonable deviation around a value or parameter such that the value or parameter is not significantly changed. These terms of deviation from a value should be construed as including a deviation of the value where the deviation would not negate the meaning of the value deviated from. For example, in relation to a reference numerical value the terms of degree can include a range of values plus or minus 10% from that value. For example, deviation from a value can include a specified value plus or minus a certain percentage from that value, such as plus or minus 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from the specified value.
[0026] The term "and / or" as used herein is intended to represent an inclusive "or". The wording X and / or Y is meant to mean both X or Y and X and Y. Further the wording X, Y and / or Z is intended to mean X, Y and Z alone or any combination of X, Y, and Z.
[0027] The term "isolated" as used herein about a compound, refers to any compound, which bymeans of human intervention, has been put in a form or environment that differs from the form or environment in which it is found in nature. Isolated compounds include but is no limited to compounds of the disclosure for which the ratio of the compounds relative to other constituents with which they are associated in nature is increased or decreased. In an important embodiment the amount of compound is increased relative to other constituents with which the compound is associated in nature. In an embodiment the compound of the disclosure may be isolated into a pure or substantially pure form. In this context a substantially pure compound means that the compound is separated from other extraneous or unwanted material present from the onset of producing the compound or generated in the manufacturing process. Such a substantially pure compound preparation contains less than 10%, such as less than 8%, such as less than 6%, such as less than 5%, such as less than 4%, such as less than 3%, such as less than 2%, such as less than 1 %, such as less than 0.5% by weight of other extraneous or unwanted material usually associated with the compound when expressed natively or recombinantly. In an embodiment the isolated compound is at least 90% pure, such as at least 91% pure, such as at least 92% pure, such as at least 93% pure, such as at least 94% pure, such as at least 95% pure, such as at least 96% pure, such as at least 97% pure, such as at least 98% pure, such as at least 99% pure, such as at least 99.5% pure, such as 100 % pure by weight.
[0028] The term "non-naturally occurring" as used herein about a substance, refers to any substance that is not mally found in nature or natural biological systems. In this context the term "found in nature or in natural biological systems" does not include the finding of a substance in nature resulting from releasing the substance to nature by deliberate or accidental human intervention. Non-naturally occurring substances may include substances completely or partially synthetized by human intervention and / or substances prepared by human modification of a natural substance.
[0029] The term "% sequence identity" is used herein about the relatedness between two amino acid sequences or between two nucleotide sequences.
[0030] The term "% sequence identity" as used herein about amino acid sequences refers to the degree of identity in percent between two amino acid sequences obtained when using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:identical amino acid residues- x 100 Length of alignment — total number of gaps in alignment
[0031] The term "% sequence identity" as used herein about nucleotide sequences refers to the degree of identity in percent between two nucleotide sequences obtained when using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:identical deoxyribonucleotides- - - x 100 Length of alignment — total number of gaps in alignment
[0032] The protein sequences of the present disclosure can further be used as a "query sequence" to perform a search against sequence databases, for example to identify other family members or related sequences. Such searches can be performed using the BLAST programs. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov). BLASTP is used for amino acid sequences and BLASTN for nucleotide sequences. The BLAST program uses as defaults:Cost to open gap: default= 5 for nucleotides / 11 for proteinsCost to extend gap: default = 2 for nucleotides / 1 for proteinsPenalty for nucleotide mismatch: default = -3Reward for nucleotide match: default= 1Expect value: default = 10Wordsize: default = 11 for nucleotides / 28 for megablast / 3 for proteins.
[0033] Furthermore, the degree of local identity between the amino acid sequence query or nucleic acid sequence query and the retrieved homologous sequences is determined by the BLAST program. However only those sequence segments are compared that give a match above a certain threshold. Accordingly, the program calculates the identity only for these matching segments. Therefore, the identity calculated in this way is referred to as local identity.
[0034] The term "mature polypeptide" or "mature enzyme" as used herein refers to a polypeptide inits final active form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and / or N-terminal amino acid) expressed by the same polynucleotide.
[0035] The term "cDNA" refers to a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
[0036] The term "coding sequence" refers to a nucleotide sequence, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
[0037] The term "control sequence" as used herein refers to a nucleotide sequence necessary for expression of a polynucleotide encoding a polypeptide. A control sequence may be native (i.e., from the same gene) or heterologous or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide. Control sequences include, but are not limited to leader sequences, polyadenylation sequence, pro-peptide coding sequence, promoter sequences, signal peptide coding sequence, translation terminator (stop) sequences and transcription terminator (stop) sequences. To be operational control sequences usually must include promoter sequences, transcriptional and translational stop signals. Control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with a coding region of a polynucleotide encoding a polypeptide.
[0038] The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion.
[0039] The term "expression vector" refers to a DNA molecule, either single- or double stranded, either linear or circular, which comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression. Expression vectors include expression cassettes for the integration of genes into a host cell as well as plasmids and / or chromosomes comprising such genes.
[0040] The term "host cell" refers to any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotideof the present disclosure. Host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
[0041] The term "polynucleotide construct" refers to a polynucleotide, either single- or double stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, and which comprises a polynucleotide encoding a polypeptide and one or more control sequences.
[0042] The term "operably linked" refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding polynucleotide such that the control sequence directs expression of the coding polynucleotide.
[0043] The terms "nucleotide sequence and "polynucleotide" are used herein interchangeably.
[0044] The term "comprise" and "include" as used throughout the specification and the accompanying items as well as variations such as "comprises", "comprising", "includes" and "including" are to be interpreted inclusively. These words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows.
[0045] The articles "a" and "an" are used herein refers to one or to more than one (i.e. to one or at least one) of the grammatical object of the article. By way of example, "an element" may mean one element or more than one element.
[0046] Terms like "preferably", "commonly", "particularly", and "typically" are not utilized herein to limit the scope of the itemed disclosure or to imply that certain features are critical, essential, or even important to the structure or function of the itemed disclosure. Rather, these terms are merely intended to highlight alternative or additional features that can or cannot be utilized in a particular embodiment of the present disclosure.
[0047] The term "cell culture" as used herein refers to a culture medium comprising a plurality of host cells of the disclosure. A cell culture may comprise a single strain of host cells or may comprise two or more distinct host cell strains. The culture medium may be any medium that may comprise a recombinant host, e.g., a liquid medium (i.e., a culture broth) or a semi-solid medium, and may comprise additional components, e.g., a carbon source such as dextrose, sucrose, glycerol, or acetate; a nitrogen source such as ammonium sulfate, urea, or amino acids; a phosphate source; vitamins; trace elements; salts; amino acids; nucleobases; yeast extract; aminoglycoside antibiotics such as G418 and hygromycin B.
[0048] In some embodiments, the transporter polypeptide of the present disclosure includes a "functional homolog" thereof. Functional homologs are sometimes designated in the literature as homologs, or orthologs, or paralogs. Variants of a naturally occurring functional homolog, such as polypeptides encoded by mutants of a wild type coding sequence, can themselves be functionalhomologs. Functional homologs can also be created via site-directed mutagenesis of the coding sequence for a polypeptide, or by combining domains from the coding sequences for different naturally-occurring polypeptides ("domain swapping"). An aspect of the disclosure describes a functional homologue that has at least 20% sequence identity with an amino acid or nucleic acid sequence of the transporter polypeptide mentioned herein, such as 30 % sequence identity, such as 40 % sequence identity, such as 50 % sequence identity, such as 60 % sequence identity, such as 70 % sequence identity, such as 75 % sequence identity, such as 80 % sequence identity, such as 85 % sequence identity, such as 90 % sequence identity, such as 75 % sequence identity, such as 97 % sequence identity, such as 98 % sequence identity, such as 99 % sequence identity.Exporter
[0049] In one embodiment, the present disclosure provides a transporter polypeptide which has at least 50% sequence identity to a polypeptide of EamA of SEQ ID NO: 4, or an ortholog or paralog thereof, wherein the transporter polypeptide has one or more amino acid mutations relative to the polypeptide of EamA.
[0050] In one embodiment, the transporter polypeptide of the present disclosure when comprised in a host cell has enhanced activity of substrate transport across a cell membrane relative to EamA of SEQ ID NO: 4. Various methods known in the art for determining substrate transport activity across a cell membrane, directly or indirectly, include radiolabel or fluorescent-tag assays, liquid chromatography (LC), mass spectrometry (MS), imaging techniques such as fluorescence microscopy, as well as methods relying on increased tolerance of cells sensitive to the substrate being transported or enhanced production levels of the substrate, such as in cells engineered to produce specific amino acids. For example, the methods disclosed herein including the method of Example 2 can be used to assess exporter activity.
[0051] In some embodiments, the transporter polypeptide is provided wherein the one or more mutations are in the plurality of alpha-helices, the interhelical loops, and / or in the binding pocket.Binding pocket
[0052] In some embodiments, the present disclosure provides a transporter polypeptide comprising a structural domain defining a binding pocket for binding a substrate, such as an amino acid, said structural domain comprising amino acid sequences having at least 60% sequence identity to the amino acid sequence defined by amino acid residues 15-17, 19-20, 39, 41-44, 66-76, 79, 89-90, 92-97, 147-148, 151-152, 154-156, 178, 189, 225, 229, 252, 254-256, and 259 of SEQ ID NO: 4, and wherein the polypeptide when expressed in a host cell is capable of transporting the substrate across a cellmembrane.
[0053] In some embodiments, the present disclosure provides a transporter polypeptide comprising a structural domain defining a binding pocket for binding a substrate, such as an amino acid, wherein said structural domain is defined by one, or more, or all of amino acid residues 15-17, 19-20, 39, 41-44, 66-76, 79, 89-90, 92-97, 147-148, 151-152, 154-156, 178, 189, 225, 229, 252, 254-256, and 259 of the transporter polypeptide, wherein the polypeptide when expressed in a host cell is capable of transporting the substrate across a cell membrane. In some embodiments, the structural domain comprises one or more of amino acid residues 38 to 43, such as amino acid residue 39 of the transporter polypeptide.
[0054] In some embodiments, the binding pocket comprises one or more mutations. In some embodiments, the binding pocket comprises one or more mutations selected from the group consisting of: V15X, N19X, A71X, F73X, L76X, and T225X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ. ID NO: 4.
[0055] In some embodiments, the binding pocket comprises one or more mutations selected from the group consisting of:a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E;b) N19X, wherein X is any one of T, K, Y, S, F, C, and I;c) A71X, wherein X is S;d) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;e) L76X, wherein X is R; andf) T225X, wherein X is any one of I and M.
[0056] In some embodiments, the binding pocket comprises one or more mutations selected from the group consisting of:a) N19X, wherein X is any one of T, K, Y, S, F, C, and I;b) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;c) L76X, wherein X is R; andd) T225X, wherein X is any one of I and M.Alpha-helices
[0057] In some embodiments, the transporter polypeptide comprises a plurality of alpha-helices when part of a cell membrane. In some embodiments, the plurality of alpha-helices comprises 10 alpha-helices separated by interhelical loops. In some embodiments, the plurality of alpha-helices comprises alpha-helices TMl, TM2, TM3, TM4, TM5, TM6, TM7, TM8, TM9, and TM10 each separated by interhelical loops.
[0058] In some embodiments, the transporter polypeptide when part of a cell membrane comprises one or more of:a) an alpha-helix TM1 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 6 to 23 of SEQ ID NO: 4;b) an alpha-helix TM2 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 33 to 51 of SEQ ID NO: 4;c) an alpha-helix TM3 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 61 to 81 of SEQ ID NO: 4;d) an alpha-helix TM4 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 87 to 107 of SEQ ID NO: 4;e) an alpha-helix TM5 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 117 to 132 of SEQ ID NO: 4;f) an alpha-helix TM6 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 145 to 160 of SEQ ID NO: 4;g) an alpha-helix TM7 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 177 to 195 of SEQ ID NO: 4;h) an alpha-helix TM8 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 213-233 of SEQ ID NO: 4;i) an alpha-helix TM9 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 244-259 of SEQ ID NO: 4;j) an alpha-helix TM10 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 272-287 of SEQ ID NO: 4; andk) one or more interhelical loops comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 1-5, 24-32, 52-60, 82-86, 108-116, 133-144, 161-176, 196-212, 234-243, 260-271, and 288-299 of SEQ ID NO: 4.
[0059] In some embodiments, the alpha-helix TMl comprises one or more mutations selected from the group consisting of: V15X, and N19X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0060] In some embodiments, the alpha-helix TMl comprises one or more mutations selected from the group consisting of:a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E; andb) N19X, wherein X is any one of T, K, Y, S, F, C, and I.
[0061] In some embodiments, the alpha-helix TM2 comprises one or more mutations selected from the group consisting of: V38X, N46X, and V51X, wherein X is any amino acid other than thecorresponding amino acid residue in SEQ ID NO: 4.
[0062] In some embodiments, the alpha-helix TM2 comprises one or more mutations selected from the group consisting of:a) L38X, wherein X is S;b) P46X, wherein X is any one of A, S, and L; andc) V51X, wherein X is any one of G, L, R, and D.
[0063] In some embodiments, the alpha-helix TM3 comprises one or more mutations selected from the group consisting of: A71X, F73X, L76X, and C78X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0064] In some embodiments, the alpha-helix TM3 comprises one or more mutations selected from the group consisting of:a) A71X, wherein X is S;b) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;c) L76X, wherein X is R; andd) C78X, wherein X is A.
[0065] In some embodiments, the alpha-helix TM4 comprises one or more mutations selected from the group consisting of: T100X, M102X, L103X, F106X, and T107X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0066] In some embodiments, the alpha-helix TM4 comprises one or more mutations selected from the group consisting of:a) T100X, wherein X is any one of S, W, I, and A;b) M102X, wherein X is any one of V, R, I, T, and A;c) L103X, wherein X is any one of A, S, P, and F;d) F106X, wherein X is any one of L, P, S, and Q; ande) T107X, wherein X is any one of S, P, L, V, A, I, and F.
[0067] In some embodiments, the alpha-helix TM5 comprises one or more mutations selected from the group consisting of: L117X, L122X, and G126X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0068] In some embodiments, the alpha-helix TM5 comprises one or more mutations selected from the group consisting of:a) L117X, wherein X is any one of V, W, G, A, and F;b) L122X, wherein X is any one of F, P, and S; andc) G126X, wherein X is any one of V, A, S, N, and P.
[0069] In some embodiments, the alpha-helix TM7 comprises one or more mutations selected fromthe group consisting of: S181X, and F190X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0070] In some embodiments, the alpha-helix TM7 comprises one or more mutations selected from the group consisting of:a) S181X, wherein X is any one of G and R; andb) F190X, wherein X is any one of P, L, and S.
[0071] In some embodiments, the alpha-helix TM8 comprises one or more mutations selected from the group consisting of: M218X, L220X, T225X, I226X, and V227X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0072] In some embodiments, the alpha-helix TM8 comprises one or more mutations selected from the group consisting of:a) M218X, wherein X is any one of R, I, T, L, V, Y, and A;b) L220X, wherein X is M;c) T225X, wherein X is any one of I and M;d) I226X, wherein X is any one of V and M; ande) V227X, wherein X is any one of F, M, L, K, and G.
[0073] In some embodiments, the alpha-helix TM9 comprises one or more mutations selected from the group consisting of: A257X, and A258R, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0074] In some embodiments, the alpha-helix TM9 comprises one or more mutations selected from the group consisting of:a) A257X, wherein X is any one of S, P, L, E, Q, G, and D; andb) A258R, wherein X is any one of R, C, F, I, T, and M.
[0075] In some embodiments, the alpha-helix TM10 comprises one or more mutations selected from the group consisting of: M279X, and N285X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0076] In some embodiments, the alpha-helix TM10 comprises one or more mutations selected from the group consisting of:a) M279X, wherein X is any one of V, R, and W; andb) N285X, wherein X is any one of K, H, V, M, L, A, I, D, and S.Interhelical loops
[0077] In some embodiments, the one or more interhelical loops separating the alpha-helices comprises amino acid sequences having at least 60% sequence identity to the amino acid sequencedefined by amino acid residues 1-5, 24-32, 52-60, 82-86, 108-116, 133-144, 161-176, 196-212, 234-243, 260-271, and 288-299 of SEQ ID NO: 4.
[0078] In some embodiments, the one or more interhelical loops comprise one or more mutations selected from the group consisting of: P57X, L58X, L60X, M84X, F106X, T107X, F108X, L112X, H113X, G137X, V140X, S169X, V174X, S199X, I209X, L262X, L267X, K296X, and S299X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0079] In some embodiments, the transporter polypeptide is provided wherein the one or more interhelical loops comprise one or more mutations selected from the group consisting of:a) P57X, wherein X is S;b) L58X, wherein X is any one of V, F, and M;c) L60X, wherein X is any one of V, W, and R;d) M84X, wherein X is any one of I and L;e) T107X, wherein X is any one of S, P, L, V, A, I, and F;f) F108X, wherein X is any one of L, and Y;g) L112X, wherein X is any one of M and P;h) H113X, wherein X is any one of N, T, P, Y, D, E, Q, and R;i) G137X, wherein X is any one of R, T, E, and S;j) V140X, wherein X is any one of A, E, and L;k) S169X, wherein X is any one of C, Y, E, and P;l) V174X, wherein X is any one of E and A;m) S199X, wherein X is any one of Y, T, C, D, G, A, and P;n) I209X, wherein X is any one of N and S;o) L262X, wherein X is any one of V, W, G, F, K, M, Q, S, and G;p) L267X, wherein X is any one of I, V, F, and A;q) K296X, wherein X is any one of V, M, L, R; andr) S299X, wherein X is any one of N, A, and R.
[0080] In some embodiments, the interhelical loops are defined by one or more amino acid residues 1-5, 24-32, 52-60, 82-86, 108-116, 133-144, 161-176, 196-212, 234-243, 260-271, and 288-299 of the transporter polypeptide.Mutations
[0081] In some embodiments, the transporter polypeptide is provided wherein the one or more amino acid mutations are selected from the group consisting of: V15X, N19X, L38X, P46X, V51X, P57X, L58X, L60X, A71X, F73X, L76X, C78X, F82X, M84X, A86X, T100X, M102X, L103X, F106X, T107X, F108X,L112X, H113X, Q116X, L117X, L122X, G126X, G137X, V140X, S169X, V174X, S181X, F190X, S199X, I209X, M218X, L220X, T225X, I226X, V227X, A257X, A258X, L262X, L267X, M279X, N285X, K296X, and S299X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
[0082] In some embodiments, the transporter polypeptide comprises a plurality of amino acid mutations.
[0083] In some embodiments, the transporter polypeptide comprises from 1 to 17 of the amino acid mutations, such as from 2 to 6, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.
[0084] In some embodiments, the transporter polypeptide has at least 60% sequence identity, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the polypeptide EamA of SEQ ID NO: 4.
[0085] In some embodiments, the one or more amino acid mutations are selected from the group consisting of:a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E;b) N19X, wherein X is any one of T, K, Y, S, F, C, and I;c) L38X, wherein X is S;d) P46X, wherein X is any one of A, S, and L;e) V51X, wherein X is any one of G, L, R, and D;f) P57X, wherein X is S;g) L58X, wherein X is any one of V, F, and M;h) L60X, wherein X is any one of V, W, and R;i) A71X, wherein X is S;j) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;k) L76X, wherein X is R;l) C78X, wherein X is A;m) F82X, wherein X is any one of S and L;n) M84X, wherein X is any one of I and L;o) A86X, wherein X is V;p) T100X, wherein X is any one of S, W, I, and A;q) M102X, wherein X is any one of V, R, I, T, and A;r) L103X, wherein X is any one of A, S, P, and F;s) F106X, wherein X is any one of L, O, S, and Q;t) T107X, wherein X is any one of S, P, L, V, A, I, and F;u) F108X, wherein X is any one of L, and Y;v) L112X, wherein X is any one of M and P;w) H113X, wherein X is any one of N, T, P, Y, D, E, Q, and R;x) Q116X, wherein X is any one of L, A, and P;y) L117X, wherein X is any one of V, W, G, A, and F;z) L122X, wherein X is any one of F, P, and S;aa) G126X, wherein X is any one of V, A, S, N, and P;bb) G137X, wherein X is any one of R, T, E, and S;cc) V140X, wherein X is any one of A, E, and L;dd) S169X, wherein X is any one of C, Y, E, and P;ee) V174X, wherein X is any one of E and A;ff) S181X, wherein X is any one of G and R;gg) F190X, wherein X is any one of P, L, and S;hh) S199X, wherein X is any one of Y, T, C, D, G, A, and P;ii) I209X, wherein X is any one of N and S;jj) M218X, wherein X is any one of R, I, T, L, V, Y, and A;kk) L220X, wherein X is M;ll) T225X, wherein X is any one of I and M;mm) I226X, wherein X is any one of V and M;nn) V227X, wherein X is any one of F, M, L, K, and G;oo) A257X, wherein X is any one of S, P, L, E, Q, G, and D;pp) A258X, wherein X is any one of R, C, F, I, T, and M;qq) L262X, wherein X is any one of V, W, G, F, K, M, Q, S, and G;rr) L267X, wherein X is any one of I, V, F, and A;ss) M279X, wherein X is any one of V, R, and W;tt) N285X, wherein X is any one of K, H, V, M, L, A, I, D, and S;uu) K296X, wherein X is any one of V, M, L, R, and N; andvv) S299X, wherein X is any one of N, A, and R.
[0086] In some embodiments, the one or more amino acid mutations are selected from the group consisting of:a) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;b) F108X, wherein X is any one of L, and Y;c) S181X, wherein X is any one of G and R;d) L220X, wherein X is M;e) L267X, wherein X is any one of I, V, F, and A; andf) M279X, wherein X is any one of V, R, and W.
[0087] In some embodiments, the one or more amino acid mutations are selected from the group consisting of: L38S, F82L, A86V, F108L, H113R, G137S, V140A, S169P, V174A, S181G, S199P, L220M, A257S, L267I, M279V, N285I, and S299R.
[0088] In some embodiments, the transporter polypeptide comprises one or more of the amino acid mutations selected from the group consisting of: L38S, F82L, A86V, H113R, G137S, S169P, V174A, S181G, S199P, A257S, M279V, N285I, and S299R.
[0089] In some embodiments, the transporter polypeptide comprises the amino acid mutations of F108L, V140A, S181G, L220M, L267I, and M279V.
[0090] In some embodiments, the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 5-122, for example wherein the transporter polypeptide has at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 5-122.
[0091] In some embodiments, the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 74-87, for example wherein the transporter polypeptide has at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 74-87.
[0092] In some embodiments, the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in SEQ ID NO: 85 or SEQ ID NO: 82, for example wherein the transporter polypeptide has at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in SEQ ID NO: 85 or in SEQ ID NO: 82, for example wherein the transporter polypeptide is SEQ ID NO: 85 or is SEQ ID NO: 82.
[0093] In some embodiments, the transporter polypeptide is encoded by a polynucleotide having at least 50% identity to a polynucleotide comprised in any one of SEQ ID NO: 292-296, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the polynucleotide comprised in any one of SEQ ID NO: 292-296.Recombinant cell
[0094] In some embodiments, a genetically modified host cell is provided comprising a heterologous polynucleotide encoding a transporter polypeptide capable of exporting a substrate, such as an aminoacid across a cell membrane, such as out of a cell. In some embodiments, the transporter polypeptide of the genetically modified host cell is as defined herein.
[0095] In some embodiments, the transporter polypeptide is derived from E. coli.
[0096] In some embodiments, the cell is of a fungus or a bacterium.
[0097] In some embodiments, the cell is of a bacterium of the order of enterobacterales.
[0098] In some embodiments, the cell is of a Gram-negative bacterium.
[0099] In some embodiments, the Gram-negative bacterium is of a genus selected from: Shigella, Citrobacter, Escherichia, Franconibacter, Klebsiella, Cedecea, Raoultella, Buttiauxella, Scandinavium, Pseudocitrobacter, Leclercia, Enterobacter cloacae, and Silvania.
[0100] In some embodiments, the cell is E. coli.
[0101] In some embodiments, the cell is of a Gram-positive bacterium.
[0102] In some embodiments, the cell is of a bacterium of the order of Mycobacteriales.
[0103] In some embodiments, the cell is of Corynebacterium Glutamicum.
[0104] In some embodiments, the cell is of a filamentous fungus.
[0105] In some embodiments, the cell is of a white muscardine disease fungus, such as Beauveria Bassiana D1-5.
[0106] In some embodiments, the cell is of a Gram-negative bacterium.
[0107] In some embodiments, the Gram-negative bacterium is of a genus selected from: Shigella, Citrobacter, Escherichia, Franconibacter, Klebsiella, Cedecea, Raoultella, Buttiauxella, Scandinavium, Pseudocitrobacter, Leclercia, Enterobacter cloacae, and Silvania.
[0108] In some embodiments, the cell comprises a polypeptide, for example a transporter polypeptide, as defined herein.
[0109] In some embodiments, the genetically modified host cell is provided wherein the polynucleotide encoding the transporter polypeptide comprises a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the polynucleotide comprised in any one of SEQ ID NO: 292-296.
[0110] In some embodiments, the genetically modified host cell is provided wherein the transporter polypeptide comprises a plurality of alpha-helices separated by interhelical loops, wherein the alphahelices and / or the interhelical loops comprise at least one mutation increasing activity of export of a substrate, such as an amino acid, such as serine.
[0111] In some embodiments, the genetically modified host cell is provided wherein the transporter polypeptide and / or the polynucleotide encoding said transporter polypeptide is heterologous to thecell.
[0112] In some embodiments, the genetically modified host cell is provided further comprising an operative metabolic pathway comprising one or more polypeptides capable of producing the substrate, such as the amino acid, for example serine, from one or more precursors.
[0113] In some embodiments, the operative L-serine metabolic pathway comprises one or more polypeptides selected from:a) a D-3-phosphoglycerate dehydrogenase (PGDH) capable of converting 3-phospho-D-glycerate into 3-phosphooxypyruvate; andb) a 3-phosphoserine aminotransferase (PSAT) capable of converting 3-phosphooxypyruvate and L- glutamate into O-phospho-L-serine and L-glutamine; andc) a phosphoserine phosphatase (PSPH) converting O-phospho-L-serine into L-serine.
[0114] In some embodiments, the operative S-sulfo-cysteine metabolic pathway comprises the L-serine metabolic pathway, in addition to one or more polypeptides selected from:a) a serine acetyltransferase (SAT) capable of converting L-serine into O-acetyl-serine; and b) a cysteine synthase capable of converting O-acetyl-serine into S-sulfocysteine
[0115] In some embodiments, the genetically modified host cell is provided wherein the corresponding:a) D-3-phosphoglycerate dehydrogenase (PGDH) has at least 70% identity to the amino acid sequence of any one of SEQ ID NO: 285 or SEQ ID NO: 287;b) 3-phosphoserine aminotransferase (PSAT) has at least 70% identity to the amino acid sequence of SEQ ID NO: 289; and / orc) phosphoserine phosphatase (PSPH) has at least 70% identity to the amino acid sequence of SEQ ID NO: 291;d) Serine acetyltransferase (SAT) has at least 70% identity to the amino acid sequence of SEQ ID NO: 297 or seq ID NO: 301;e) Cysteine synthase B has at least 70% identity to the amino acid sequence of SEQ ID NO: 299
[0116] In some embodiments, the genetically modified host cell is provided comprising one or more polynucleotides selected from the group of:a) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a D-3-phosphoglycerate dehydrogenase (PGDH)comprised in any one of SEQ ID NO: 284 or SEQ ID NO: 286;b) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a 3-phosphoserine aminotransferase (PSAT) comprised in SEQ ID NO: 288; andc) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a phosphoserine phosphatase (PSPH) comprised in SEQ ID NO: 290.d) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a serine acetyltransferase (SAT) comprised in SEQ ID NO: 298 or SEQ ID 302.e) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a cysteine synthase B comprised in SEQ ID NO: 300.
[0117] In some embodiments, a plurality of polypeptides comprised in the operative biosynthetic metabolic pathway are heterologous to the host cell.
[0118] In some embodiments, one or more native or endogenous genes of the cell is or has been attenuated, disrupted and / or deleted.
[0119] In some embodiments, the genetically modified host cell is provided comprising one or more polypeptides capable of producing the substrate, such as the amino acid, for example serine, from one or more precursors, co-localized to the transporter polypeptide.
[0120] In some embodiments, the genetically modified host cell is provided comprising the operative metabolic pathway as defined herein co-localized to the transporter polypeptide.
[0121] In some embodiments, the operative metabolic pathway as defined herein is provided as soluble polypeptides in the genetically modified host cell.
[0122] In some embodiments, the genetically modified host cell has been further genetically modified to provide an increased amount of the substrate, such as the amino acid, for example serine.
[0123] In some embodiments, the genetically modified host cell defined herein has been further genetically modified to exhibit increased tolerance towards one or more substrates, intermediates, or product molecules from the operative metabolic pathway producing the substrate, such as the amino acid, for example serine, optionally wherein the operative metabolic pathway is as defined herein.Genetic constructs
[0124] In some embodiments, a polynucleotide construct is provided comprising a polynucleotide sequence encoding the transporter polypeptide defined herein, operably linked to one or more control sequences.
[0125] In some embodiments, the control sequence is heterologous to the polynucleotide.
[0126] In some embodiments, the cell as defined herein is provided comprising the polynucleotide construct as defined herein.Cell culture
[0127] In some embodiments, a cell culture is provided comprising the cell as defined herein and a growth medium.Methods for substrate production
[0128] In some embodiments, the present disclosure provides a method for producing a substrate, such as an amino acid, for example serine comprisinga) culturing the cell culture of the present disclosure at conditions allowing the cell to produce the substrate; andb) optionally recovering and / or isolating the substrate.
[0129] In some embodiments, the recovering and / or isolation step comprises separating a liquid phase of the cell or cell culture from a solid phase of the cell or cell culture to obtain a supernatant comprising the substrate and subjecting the supernatant to one or more steps selected from:a) contacting the supernatant with one or more adsorbent resins in order to obtain at least a portion of the produced substrate;b) contacting the supernatant with one or more ion exchange or reversed-phase chromatography columns in order to obtain at least a portion of the substrate; and c) crystallizing or extracting the substrate from the supernatant; andd) evaporating the solvent of the supernatant to concentrate or precipitate the substrate; thereby recovering and / or isolating the substrate.
[0130] In some embodiments, the method further comprises one or more elements selected from:a) culturing the cell culture in a nutrient medium;b) culturing the cell culture under aerobic or anaerobic conditionsc) culturing the cell culture under agitation;d) culturing the cell culture at a temperature of between 25 to 50 °C;e) culturing the cell culture at a pH of between 3-9; andf) culturing the cell culture for between 10 hours to 30 days.Fermentation composition
[0131] In some embodiments, a fermentation composition is provided comprising the cell culture defined herein and the substrate, such as the amino acid, for example serine, comprised therein.
[0132] In some embodiments, the fermentation composition is provided wherein at least 50%, such as at least 75%, such as at least 95%, such as at least 99% of the cells are lysed.
[0133] In some embodiments, the fermentation composition is provided wherein at least 50%, such as at least 75%, such as at least 95%, such as at least 99% of solid cellular material has separated from the liquid.
[0134] In some embodiments, the fermentation composition is provided further comprising one or more compounds selected from trace metals, vitamins, salts, yeast nitrogen base, carbon source, YNB, and / or amino acids of the fermentation; wherein the concentration of the substrate is at least 1 mg / kg composition.
[0135] In some embodiments, a composition is provided comprising the fermentation composition and one or more carriers, agents, additives and / or excipients.Substrates
[0136] In the context of the present disclosure, a "substrate" refers to a molecule that can bind to and be recognized by the transporter polypeptide of the present disclosure, e.g. within a cell or in the cell membrane. The substrate is capable of being transported across a cellular membrane via this transporter polypeptide, facilitating its movement out of the cell. The transporter polypeptide typically recognizes specific structural features of the substrate, such as size, charge, and molecular configuration, allowing the substrate to engage in a reversible binding interaction with the transporter, thereby enabling its translocation through the cell membrane.
[0137] In some embodiments, the substrate is an amino acid. In some embodiments, the substrate is selected from the group consisting of: L-serine, O-acetyl-Serine, S-sulfocysteine, L-Cysteine, L-glutamine, and L-asparagine. In some embodiments, the substrate is L-serine or S-sulfocysteine, for example L-serine. In some embodiments, the substrate is S-sulfocysteine.Sequence listings
[0138] The present application contains a Sequence Listing prepared in Patentin included below but also submitted electronically in ST26 format which is hereby incorporated by reference in its entirety.Table ASeq no. DescriptionSEQ ID NO: 1 EamA reference nt sequenceSEQ ID NO: 2 EamA plasmid (+ve plasmid)) pSC101_eamA plasmidSEQ ID NO: 3 pSC101 plasmid (-ve plasmid) pSC101_empty plasmidSEQ ID NO: 4 EamA AA reference AA sequenceSEQ ID NO: 5 EamA mutant EamA(V12A)SEQ ID NO: 6 EamA mutant EamA(V13G)SEQ ID NO: 7 EamA mutant EamA(V13D)SEQ ID NO: 8 EamA mutant EamA(V14E)SEQ ID NO: 9 EamA mutant EamA(V15L)SEQ ID NO: 10 EamA mutant EamA(W16L)SEQ ID NO: 11 EamA mutant EamA(G17T)SEQ ID NO: 12 EamA mutant EamA(L18G)SEQ ID NO: 13 EamA mutant EamA(N19I)SEQ ID NO: 14 EamA mutant EamA(F20L)SEQ ID NO: 15 EamA mutant EamA(M34T)SEQ ID NO: 16 EamA mutant EamA(L38S)SEQ ID NO: 17 EamA mutant EamA(M41V)SEQ ID NO: 18 EamA mutant EamA(M41T)SEQ ID NO: 19 EamA mutant EamA(F49L)SEQ ID NO: 20 EamA mutant EamA(V56A)SEQ ID NO: 21 EamA mutant EamA(N59S)SEQ ID NO: 22 EamA mutant EamA(F73S)SEQ ID NO: 23 EamA mutant EamA(A74T)SEQ ID NO: 24 EamA mutant EamA(N81D)SEQ ID NO: 25 EamA mutant EamA(N81S)SEQ ID NO: 26 EamA mutant EamA(F82L)SEQ ID NO: 27 EamA mutant EamA(F82S)SEQ ID NO: 28 EamA mutant EamA(F82Y)SEQ ID NO: 29 EamA mutant EamA(A86V)SEQ ID NO: 30 EamA mutant EamA(M102T)SEQ ID NO: 31 EamA mutant EamA(A105T)SEQ ID NO: 32 EamA mutant EamA(G109R)SEQ ID NO: 33 EamA mutant EamA(G109E)SEQ ID NO: 34 EamA mutant EamA(H113R)SEQ ID NO: 35 EamA mutant EamA(K115R)SEQ ID NO: 36 EamA mutant EamA(E132G)SEQ ID NO: 37 EamA mutant EamA(E132V)SEQ ID NO: 38 EamA mutant EamA(S134G)SEQ ID NO: 39 EamA mutant EamA(G137S)SEQ ID NO: 40 EamA mutant EamA(L143R)SEQ ID NO: 41 EamA mutant EamA(G144S)SEQ ID NO: 42 EamA mutant EamA(M146T)SEQ ID NO: 43 EamA mutant EamA(I160V)SEQ ID NO: 44 EamA mutant EamA(S169P)SEQ ID NO: 45 EamA mutant EamA(R171C)SEQ ID NO: 46 EamA mutant EamA(V174A)SEQ ID NO: 47 EamA mutant EamA(M175T)SEQ ID NO: 48 EamA mutant EamA(S181G)SEQ ID NO: 49 EamA mutant EamA(I187V)SEQ ID NO: 50 EamA mutant EamA(V191A)SEQ ID NO: 51 EamA mutant EamA(S199P)SEQ ID NO: 52 EamA mutant EamA(T201A)SEQ ID NO: 53 EamA mutant EamA(T212A)SEQ ID NO: 54 EamA mutant EamA(T212I)SEQ ID NO: 55 EamA mutant EamA(A224R)SEQ ID NO: 56 EamA mutant EamA(I226T)SEQ ID NO: 57 EamA mutant EamA(V227L)SEQ ID NO: 58 EamA mutant EamA(G230E)SEQ ID NO: 59 EamA mutant EamA(T241I)SEQ ID NO: 60 EamA mutant EamA(A257T)SEQ ID NO: 61 EamA mutant EamA(A257S)SEQ ID NO: 62 EamA mutant EamA(S258N)SEQ ID NO: 63 EamA mutant EamA(A259T)SEQ ID NO: 64 EamA mutant EamA(D264N)SEQ ID NO: 65 EamA mutant EamA(L267I)SEQ ID NO: 66 EamA mutant EamA(L270Q)SEQ ID NO: 67 EamA mutant EamA(I278V)SEQ ID NO: 68 EamA mutant EamA(M279V)SEQ ID NO: 69 EamA mutant EamA(M279T)SEQ ID NO: 70 EamA mutant EamA(T280I)SEQ ID NO: 71 EamA mutant EamA(I284V)SEQ ID NO: 72 EamA mutant EamA(N285I)SEQ ID NO: 73 EamA mutant EamA(S299R)SEQ ID NO: 74 EamA mutant EamA(F108L)SEQ ID NO: 75 EamA mutant EamA(V140A)SEQ ID NO: 76 EamA mutant EamA(L220M)SEQ ID NO: 77 EamA mutant EamA(F108L, V140A)SEQ ID NO: 78 EamA mutant EamA(F108L, L267I)SEQ ID NO: 79 EamA mutant EamA(V140A, L267I)SEQ ID NO: 80 EamA mutant EamA(S181G, M279V)SEQ ID NO: 81 EamA mutant EamA(L220M, L267I)SEQ ID NO: 82 EamA mutant EamA(F108L, V140A, L220M, L267I) SEQ ID NO: 83 EamA mutant EamA(F108L, V140A, L220M, L267I, S181G)SEQ ID NO: 84 EamA mutant EamA(F108L, V140A, L220M, L267I, M279V) SEQ ID NO: 85 EamA mutant EamA(F108L, V140A, L220M, L267I, S181G, M279V) SEQ ID NO: 86 EamA mutant EamA(V15I, P57A, F73G, F190I)SEQ ID NO: 87 EamA mutant EamA(V15S, L262R, N285T)SEQ ID NO: 88 EamA mutant EamA(V15I)SEQ ID NO: 89 EamA mutant EamA(V15V)SEQ ID NO: 90 EamA mutant EamA(N19S, T100C, G126L)SEQ ID NO: 91 EamA mutant EamA(N19R, V174Q, S258T)SEQ ID NO: 92 EamA mutant EamA(P46R, S258T)SEQ ID NO: 93 EamA mutant EamA(V51R, G126S)SEQ ID NO: 94 EamA mutant EamA(V51T, F106T)SEQ ID NO: 95 EamA mutant EamA(V51E, H113L)SEQ ID NO: 96 EamA mutant EamA(P57T, G126W, S199D, M218I)SEQ ID NO: 97 EamA mutant EamA(L58Q, S169R, T225E, L262R)SEQ ID NO: 98 EamA mutant EamA(L58F, F73S)SEQ ID NO: 99 EamA mutant EamA(L58V)SEQ ID NO: 100 EamA mutant EamA(L60D)SEQ ID NO: 101 EamA mutant EamA(T67V, M102P, S169R)SEQ ID NO: 102 EamA mutant EamA(F73G)SEQ ID NO: 103 EamA mutant EamA(F73S, Q116A, G137Q)SEQ ID NO: 104 EamA mutant EamA(F73I, M279Q)SEQ ID NO: 105 EamA mutant EamA(F73V)SEQ ID NO: 106 EamA mutant EamA(F73A)SEQ ID NO: 107 EamA mutant EamA(M102C)SEQ ID NO: 108 EamA mutant EamA(G104G)SEQ ID NO: 109 EamA mutant EamA(F106C)SEQ ID NO: 110 EamA mutant EamA(T107S)SEQ ID NO: 111 EamA mutant EamA(L117T, M218L)SEQ ID NO: 112 EamA mutant EamA(L117G, S199R, L262Q)SEQ ID NO: 113 EamA mutant EamA(L122F)SEQ ID NO: 114 EamA mutant EamA(L122D, S258S)SEQ ID NO: 115 EamA mutant EamA(G126G)SEQ ID NO: 116 EamA mutant EamA(G126I, L220E, L267T)SEQ ID NO: 117 EamA mutant EamA(V227H)SEQ ID NO: 118 EamA mutant EamA(V227T)SEQ ID NO: 119 EamA mutant EamA(S258S)SEQ ID NO: 120 EamA mutant EamA(S258C, N285L)SEQ ID NO: 121 EamA mutant EamA(L262V)SEQ ID NO: 122 EamA mutant EamA(N285T)SEQ ID NO: 123 EamA mutant EamA(V15X)SEQ ID NO: 124 EamA mutant EamA(N19X)SEQ ID NO: 125 EamA mutant EamA(P46X)SEQ ID NO: 126 EamA mutant EamA(V51X)SEQ ID NO: 127 EamA mutant EamA(P57X)SEQ ID NO: 128 EamA mutant EamA(L58X)SEQ ID NO: 129 EamA mutant EamA(L60X)SEQ ID NO: 130 EamA mutant EamA(T67X)SEQ ID NO: 131 EamA mutant EamA(A71X)SEQ ID NO: 132 EamA mutant EamA(F73X)SEQ ID NO: 133 EamA mutant EamA(L76X)SEQ ID NO: 134 EamA mutant EamA(C78X)SEQ ID NO: 135 EamA mutant EamA(N81X)SEQ ID NO: 136 EamA mutant EamA(F82X)SEQ ID NO: 137 EamA mutant EamA(M84X)SEQ ID NO: 138 EamA mutant EamA(T100X)SEQ ID NO: 139 EamA mutant EamA(M102X)SEQ ID NO: 140 EamA mutant EamA(L103X)SEQ ID NO: 141 EamA mutant EamA(G104X)SEQ ID NO: 142 EamA mutant EamA(F106X)SEQ ID NO: 143 EamA mutant EamA(T107X)SEQ ID NO: 144 EamA mutant EamA(F108X)SEQ ID NO: 145 EamA mutant EamA(L112X)SEQ ID NO: 146 EamA mutant EamA(H113X)SEQ ID NO: 147 EamA mutant EamA(Q116X)SEQ ID NO: 148 EamA mutant EamA(L117X)SEQ ID NO: 149 EamA mutant EamA(L122X)SEQ ID NO: 150 EamA mutant EamA(G126X)SEQ ID NO: 151 EamA mutant EamA(G137X)SEQ ID NO: 152 EamA mutant EamA(V140X)SEQ ID NO: 153 EamA mutant EamA(S169X)SEQ ID NO: 154 EamA mutant EamA(V174X)SEQ ID NO: 155 EamA mutant EamA(S181X)SEQ ID NO: 156 EamA mutant EamA(F190X)SEQ ID NO: 157 EamA mutant EamA(V191X)SEQ ID NO: 158 EamA mutant EamA(S199X)SEQ ID NO: 159 EamA mutant EamA(I209X)SEQ ID NO: 160 EamA mutant EamA(M218X)SEQ ID NO: 161 EamA mutant EamA(L220X)SEQ ID NO: 162 EamA mutant EamA(T225X)SEQ ID NO: 163 EamA mutant EamA(I226X)SEQ ID NO: 164 EamA mutant EamA(V227X)SEQ ID NO: 165 EamA mutant EamA(A257X)SEQ ID NO: 166 EamA mutant EamA(S258X)SEQ ID NO: 167 EamA mutant EamA(L262X)SEQ ID NO: 168 EamA mutant EamA(L267X)SEQ ID NO: 169 EamA mutant EamA(M279X)SEQ ID NO: 170 EamA mutant EamA(N285X)SEQ ID NO: 171 EamA mutant EamA(K296X)SEQ ID NO: 172 EamA mutant EamA(S299X)SEQ ID NO: 173 recombineering plasmid pACYC-pBAD_ara_dam SEQ ID NO: 174 eamA promoter region eamA upstream DNA SEQ ID NO: 175 eamA promoter eamA native promoter- 1 -SEQ ID NO: 176 promoter library synthetic promoter library SEQ ID NO: 177 eamA synthetic promoter variant eamA promoter, 11.7 kAU SEQ ID NO: 178 eamA synthetic promoter variant eamA promoter, 12.7 kAU SEQ ID NO: 179 eamA synthetic promoter variant eamA promoter, 16.5 kAU SEQ ID NO: 180 eamA synthetic promoter variant eamA promoter, 16.7 kAU SEQ ID NO: 181 eamA synthetic promoter variant eamA promoter, 19.0 kAU SEQ ID NO: 182 eamA synthetic promoter variant eamA promoter, 37.3 kAU SEQ ID NO: 183 eamA synthetic promoter variant eamA promoter, 48.0 kAU SEQ ID NO: 184 small linker region eamA-serB-linkerSEQ ID NO: 185 eamA-serB fusion eamA_wt_serB_fusion SEQ ID NO: 186 cloning primer Oligo 01, eamA_FSEQ ID NO: 187 cloning primer Oligo 02, eamA_RSEQ ID NO: 188 cloning primer Oligo 03, pSC101_FSEQ ID NO: 189 cloning primer Oligo 04, pSC101_RSEQ ID NO: 190 cloning primer Oligo 05, eamA_mut_FSEQ ID NO: 191 cloning primer Oligo 06, eamA_mut_RSEQ ID NO: 192 cloning primer Oligo 07, pSC101_eamA_mut_FSEQ ID NO: 193 cloning primer Oligo 08, pSC101_eamA_mut_RSEQ ID NO: 194 sequencing primer Oligo 09, pSEVA_seq_F (oSER_100) SEQ ID NO: 195 sequencing primer Oligo 10, pSEVA_seq_R (oSER_101) SEQ ID NO: 196 cloning primer Oligo 11, TARSYN_FSEQ ID NO: 197 cloning primer Oligo 12, TARSYN_RSEQ ID NO: 198 cloning primer Oligo 13, pSC101_eamA_TARSYN_F SEQ ID NO: 199 cloning primer Oligo 14, pSC101_eamA_TARSYN_R SEQ ID NO: 200 cloning primer Oligo 15, eamA_dinD_yicG_FSEQ ID NO: 201 cloning primer Oligo 16, eamA_dinD_yicG_RSEQ ID NO: 202 sequencing primer Oligo 17, dinD_seq_FSEQ ID NO: 203 sequencing primer Oligo 18, dinD_seq_RSEQ ID NO: 204 KO primer Oligo 19, eamA_KO_FSEQ ID NO: 205 KO primer Oligo 20, eamA_KO_RSEQ ID NO: 206 cloning primer Oligo 21, eamA_promoter_lib_F SEQ ID NO: 207 cloning primer Oligo 22, eamA_F108L_FSEQ ID NO: 208 cloning primer Oligo 23, eamA_F108L_RSEQ ID NO: 209 cloning primer Oligo 24, eamA_L220M_FSEQ ID NO: 210 cloning primer Oligo 25, eamA_L220M_RSEQ ID NO: 211 cloning primer Oligo 26, eamA_L267I_FSEQ ID NO: 212 cloning primer Oligo 27, eamA_L267I_RSEQ ID NO: 213 cloning primer Oligo 28, eamA_M279V_FSEQ ID NO: 214 cloning primer Oligo 29, eamA_M279V_RSEQ ID NO: 215 cloning primer Oligo 30, eamA_S181G_FSEQ ID NO: 216 cloning primer Oligo 31, eamA_S181G_RSEQ ID NO: 217 cloning primer Oligo 32, eamA_V140A_FSEQ ID NO: 218 cloning primer Oligo 33, eamA_V140A_RSEQ ID NO: 219 recombineering primer Oligo 34, eamA_V15_NNN SEQ ID NO: 220 recombineering primer Oligo 35, eamA_N19_NNN SEQ ID NO: 221 recombineering primer Oligo 36, eamA_P46_NNNSEQ ID NO: 222 recombineering primer Oligo 37, eamA_V51_NNN SEQ ID NO: 223 recombineering primer Oligo 38, eamA_P57_NNN SEQ ID NO: 224 recombineering primer Oligo 39, eamA_L58_NNN SEQ ID NO: 225 recombineering primer Oligo 40, eamA_L60_NNN SEQ ID NO: 226 recombineering primer Oligo 41, eamA_T67_NNN SEQ ID NO: 227 recombineering primer Oligo 42, eamA_A71_NNN SEQ ID NO: 228 recombineering primer Oligo 43, eamA_F73_NNN SEQ ID NO: 229 recombineering primer Oligo 44, eamA_L76_NNN SEQ ID NO: 230 recombineering primer Oligo 45, eamA_C78_NNN SEQ ID NO: 231 recombineering primer Oligo 46, eamA_N81_NNN SEQ ID NO: 232 recombineering primer Oligo 47, eamA_F82_NNN SEQ ID NO: 233 recombineering primer Oligo 48, eamA_M84_NNN SEQ ID NO: 234 recombineering primer Oligo 49, eamA_T100_NNN SEQ ID NO: 235 recombineering primer Oligo 50, eamA_M102_NNN SEQ ID NO: 236 recombineering primer Oligo 51, eamA_L103_NNN SEQ ID NO: 237 recombineering primer Oligo 52, eamA_G104_NNN SEQ ID NO: 238 recombineering primer Oligo 53, eamA_F106_NNN SEQ ID NO: 239 recombineering primer Oligo 54, eamA_T107_NNN SEQ ID NO: 240 recombineering primer Oligo 55, eamA_F108_NNN SEQ ID NO: 241 recombineering primer Oligo 56, eamA_L112_NNN SEQ ID NO: 242 recombineering primer Oligo 57, eamA_H113_NNN SEQ ID NO: 243 recombineering primer Oligo 58, eamA_Q116_NNN SEQ ID NO: 244 recombineering primer Oligo 59, eamA_L117_NNN SEQ ID NO: 245 recombineering primer Oligo 60, eamA_L122_NNN SEQ ID NO: 246 recombineering primer Oligo 61, eamA_G126_NNN SEQ ID NO: 247 recombineering primer Oligo 62, eamA_G137_NNN SEQ ID NO: 248 recombineering primer Oligo 63, eamA_V140_NNN SEQ ID NO: 249 recombineering primer Oligo 64, eamA_S169_NNN SEQ ID NO: 250 recombineering primer Oligo 65, eamA_V174_NNN SEQ ID NO: 251 recombineering primer Oligo 66, eamA_S181_NNN SEQ ID NO: 252 recombineering primer Oligo 67, eamA_F190_NNN SEQ ID NO: 253 recombineering primer Oligo 68, eamA_V191_NNN SEQ ID NO: 254 recombineering primer Oligo 69, eamA_S199_NNN SEQ ID NO: 255 recombineering primer Oligo 70, eamA_I209_NNN SEQ ID NO: 256 recombineering primer Oligo 71, eamA_M218_NNN SEQ ID NO: 257 recombineering primer Oligo 72, eamA_L220_NNN SEQ ID NO: 258 recombineering primer Oligo 73, eamA_T225_NNN SEQ ID NO: 259 recombineering primer Oligo 74, eamA_I226_NNN SEQ ID NO: 260 recombineering primer Oligo 75, eamA_V227_NNN SEQ ID NO: 261 recombineering primer Oligo 76, eamA_A257_NNN SEQ ID NO: 262 recombineering primer Oligo 77, eamA_S258_NNN SEQ ID NO: 263 recombineering primer Oligo 78, eamA_L262_NNN SEQ ID NO: 264 recombineering primer Oligo 79, eamA_L267_NNN SEQ ID NO: 265 recombineering primer Oligo 80, eamA_M279V_NNN SEQ ID NO: 266 recombineering primer Oligo 81, eamA_N285_NNN SEQ ID NO: 267 recombineering primer Oligo 82, eamA_K296_NNNSEQ ID NO: 268 recombineering primer Oligo 83, eamA_S299_NNNSEQ ID NO: 269 cloning primer Oligo 84, pSC101_eamA_fusion_UFSEQ ID NO: 270 cloning primer Oligo 85, pSC101_eamA_fusion_URSEQ ID NO: 271 cloning primer Oligo 86, serB_eamA_fusion_UFSEQ ID NO: 272 cloning primer Oligo 87, serB_eamA_fusion_URSEQ ID NO: 273 partial SSC production plasmid pACYC_pBAD_ara_cysESEQ ID NO: 274 SSC production plasmid pACYC_pBAD_ara_cysEMSEQ ID NO: 275 cloning primer Oligo 88, cysE_UFSEQ ID NO: 276 cloning primer Oligo 89, cysE_URSEQ ID NO: 277 cloning primer Oligo 90, ara_UFSEQ ID NO: 278 cloning primer Oligo 91, ara_URSEQ ID NO: 279 cloning primer Oligo 92, pACYC_UFSEQ ID NO: 280 cloning primer Oligo 93, pACYC_URSEQ ID NO: 281 cloning primer Oligo 94, cysM_UFSEQ ID NO: 282 cloning primer Oligo 95, cysM_URSEQ ID NO: 283 cloning primer Oligo 96, pACYC_cysM_URSEQ ID NO: 284 C. glutamicum serA(A285G, Y483A), (D-3-phosphoglycerate dehydrogenase PGDH) DNA SEQ ID NO: 285 C. glutamicum serA(A285G, Y483A), (D-3-phosphoglycerate dehydrogenase PGDH) AA SEQ ID NO: 286 E. coli serA (D-3-phosphoglycerate dehydrogenase PGDH) DNASEQ ID NO: 287 E. coli serA (D-3-phosphoglycerate dehydrogenase PGDH) AASEQ ID NO: 288 E. coli serC (3-phosphoserine aminotransferase, PSAT), DNASEQ ID NO: 289 E. coli serC (3-phosphoserine aminotransferase, PSAT), AASEQ ID NO: 290 E. coli serB (Phosphoserine phosphatase PSPH), DNASEQ ID NO: 291 E. coli serB (Phosphoserine phosphatase PSPH), AASEQ ID NO: 292 E. coli EamA (F108L, V140A, L220M, L267I), DNASEQ ID NO: 293 E. coli EamA (S181G), DNASEQ ID NO: 294 E. coli EamA (M279V), DNASEQ ID NO: 295 E. coli EamA (F73G), DNASEQ ID NO: 296 E. coli EamA(F108L, V140A, S181G, L220M, L267I, M279V), DNASEQ ID 297 E coli cysE(R89H, T90V, P93A, A94T) serine acetyltransferase (SAT), AASEQ ID 298 E coli cysE(R89H, T90V, P93A, A94T) serine acetyltransferase (SAT), DNASEQ ID 299 E. coli cysM (cysteine synthase B), AASEQ ID 300 E. coli cysM (cysteine synthase B), DNASEQ ID 301 E coli cysE serine acetyltransferase (SAT), AASEQ ID 302 E coli cysE serine acetyltransferase (SAT), DNAExamplesIntroduction
[0139] EcEamA (formerly YdeD and orf299) has been shown to transport a variety of substrates such as L-cysteine and related metabolites, including O-acetyl serine and L-serine [1], [9], the amino acids L-glutamine and L-asparagine, and the purine base analogue 8-azaadenine
[0010] , It has been shown that E. coli strains sensitive to L-serine due to deletion of the serine degradation pathway can be made tolerant by overexpression of EcEamA [1], [2], The fitness benefit offered by expression of EcEamA in the presence of serine paves the way for a screening strategy wherein mutants of EcEamA with improved activity are selected for on increasing doses of L-serine. In this body of work, random mutagenesis and site directed mutagenesis are used to improve the activity of EcEamA. The activity increases caused by the identified mutations are demonstrated using growth assays in the presence of serine, acting as a proxy for EcEamA export activity, and through fermentations using mutated EcEamA to drive export of produced L-serine and S-sulfocysteine (SSC). It is demonstrated that the identified EamA mutants confer improved serine tolerance (example 1 & 2) which translates into improved serine production in E. coli L-serine cell factories (example 3). A proposed structure-activity relationship of the identified residues is discussed and related to the EamA structural model (example 4). Furthermore, through co-localization of the serine biosynthetic pathway to the EamA protein by the creation of fusion polypeptides, production of L-serine is shown to be improved further (example 5). Lastly, it is demonstrated that the EamA protein can be used to improve production of the uncommon amino acid, S-sulfocysteine (example 6).Example 1: Exploring genetic diversity in E. coli EamA (EcEamA) through random mutagenesis
[0140] Previous studies aiming at improving the activity of transport proteins have demonstrated the use of random mutagenesis and directed evolution for the improvement of transport protein activity [8],
[0011] ,
[0012] , Inspired by these examples, an EcEamA mutant library containing 1-4 mutations per kbp was constructed on the low-copy plasmid, pSClOl, using error-prone PCR, as described in the following sections.1.1 PCR methods1.1.1 PCRs for cloning
[0141] Cloning and verification of pSClOl-EamA plasmids was done using oligos 1-10. All oligos were ordered and synthesized by Integrated DNA Technologies (IDT). Polymerase chain reactions (PCRs) were performed using 2x Phusion HotStart polymerase master mixes, manufactured by ThermoFisher Scientific. Each 50 pL reaction consisted of 25 pL 2x Phusion HS II HF Master mix, 2.5 pL forward primer(10 pM), 2.5 pL reverse primer (10 pM), 0.5 pL template DNA, and 20 pL of autoclaved MilliQ (MQ) water. PCR was performed in a thermocycler using the following cycling instructions:
[0142] Annealing temperatures were determined using the New England Biolabs TM calculator, https: / / tmcalculator.neb.com / #! / main.
[0143] PCR products were verified by gel electrophoresis on a 1% agarose gel, run at 100 V for 22 minutes. Confirmed products were digested using FastDigest Dpnl at 37°C for 2 h by addition of 0.5 pL FastDigest Dpnl directly to 50 pL PCR product. Following digestion, the PCR product was purified using PCR purification kits from Macherey Nagel.1.1.2 Error-prone PCR
[0144] Mutagenesis of eamA via error-prone PCR (epPCR) was done using Mutazyme II from Agilent technologies, following the manufacturer's specifications to achieve a mutation rate of 1 - 4.5 mutations per kbp. Each 50 pL reaction consisted of 5 pL lOx Mutazyme II reaction buffer, 1 pL40 mM dNTP mix, 1 pL forward primer (10 pM), 1 pL reverse primer (10 pM), 1 pL Mutazyme, and 500 - 1000 ng of template DNA. Final volume was adjusted to 50 pL by addition of autoclaved MQ water.Error-prone PCR was performed in a thermocycler using the following cycling instructions:Oligo Name Sequence (51-> 3‘)Oligo 01 eamA_F gcggctgaggatacctcagcatacattaatgccgtcgtaaccggc Oligo 02 eamA_R ccgctgaggcgacctcaggccccgacatctcggggcOligo 03 pSC101_F tgaggtcgcctcagcggOligo 04 pSC101_R tatgctgaggtatcctcagccgcOligo 05 eamA_mut_F atgtcgcgaaaagatggggtgOligo 06 eamA_mut_R ttaacttcccacctttaccgctttacgOligo 07 pSC101_eamA_mut_F cgtaaagcggtaaaggtgggaagttaataagOligo 08 pSC101_eamA_mut_R caccccatcttttcgcgacattcOligo 09 pSEVA_seq_F AGGGCGGCGGATTTGTCCOligo 10 pSEVA_seq_R GCGGCAACCGAGCGTTC1.2 Cloning using NEBuilder HiFi DNA assembly
[0145] The eamA gene (SEQ ID NO: 01) expressed from its native promoter was amplified by PCR from the genome of E. coli K-12 MG1655 using oligos 1 / 2 and cloned into the pSClOl plasmid backbone (SEQ ID NO: 02), linearized via PCR using oligos 3 / 4 as explained in section 1.1.1. Cloning was done using NEBuilder HiFi DNA assembly kits from New England Biolabs, by mixing 2.5 pL 2x HiFi DNA assembly with 1.25 pL of each PCR fragment, followed by incubation at 50°C for 1 h. The clonal product was transformed into chemically competent DH5a E. coli cells, acquired from New England Biolabs.1.3 Chemical transformation
[0146] 50 pL of competent cells were mixed on ice with 2.5 pL assembly mix and left on ice for 30 minutes. The cell / DNA mixture was heat-shocked at 42°C for 30 seconds, followed by a 2-minute incubation on ice. Finally, the cell / DNA mixture was resuspended in 1 mL 37°C 2xYT media (16 g / L tryptone, 10 g / L yeast extract, 5 g / L NaCI) and incubated at 37°C for 1 h with agitation. Single colonies were obtained by plating 100-200 pL of the transformation culture on LB-agar plates supplemented with 50 pg / mL kanamycin. The plates were incubated overnight at 37°C to allow single colonies to form.1.4 Sanger sequencing
[0147] Obtained single colonies were picked into 10 mL 2xYT with kanamycin and grown overnight. The following day, plasmids were harvested using a plasmid purification kit from Macherey Nagel. Assembly of plasmids was verified by Sanger sequencing using the Eurofins Mix2Seq ON service. 7.5 pL purified plasmid was mixed with 2.5 pL 10 pM oligo 9 or 2.5 pL 10 pM oligo 10 in separate reactions for Sanger sequencing. Construction of plasmid pSClOl-EamA was verified in this way.1.5 eamA library construction
[0148] Following verification of plasmid assembly, mutagenesis of eamA proceeded via epPCR as described in section 1.1.1. The eamA gene was amplified with epPCR using oligos 5 / 6, and the pSClOl plasmid backbone was linearized using Phusion polymerase using oligos 7 / 8. Subsequent work on themutagenized eamA fragment proceeded as described in sections 1.2 - 1.3. After purification, the mutagenized fragment was PCR amplified using Phusion polymerase using oligos 5 / 6 in a 100 pL reaction. The resulting fragment was purified and cloned into the pSClOl backbone as described, by pooling 5 clonings and transformations. The resulting library was plated on a single LB-agar plate, and the obtained colonies were pooled by washing in 10 mL 2xYT+kanamycin. The colonies were grown overnight as described, and the contained plasmids were purified as described.1.6 Transformation via electroporation
[0149] The mutant eamA plasmid library was transformed into a screening strain by electroporation. The selected strain (described in 1.1.7) was made electrocompetent by growing the strain at 37°C with agitation in a 250 mL baffled shake flask containing 25 mL 2xYT media until mid-exponential phase, corresponding to ODgoo 0.3 - 0.6. The cells were then placed in an ice bath and rapidly chilled. The cells were centrifuged at 7000 g for 5 minutes at 4°C, the supernatant was removed and replaced with 25 mL 10% chilled glycerol and the cell pellet was resuspended. Centrifugation and washing were repeated twice, and the final cell pellet was resuspended in 250 pL 10% glycerol. The cells, now electrocompetent, were transformed by electroporation by mixing 50 pL cells with 2.5 pL purified DNA in a chilled electrocuvette with a 2 mm gap and applying a 2kV pulse. Immediately after pulsing, 950 pL 37°C heated 2xYT media was added to the cuvette, and the cell suspension was transferred to 10 mL culture tubes for recovery at 37°C for 1 h with agitation. Finally, the cells were plated as described, and the library was pooled together.1.7 Choice and construction of screening strain
[0150] The eamA mutant library was transformed into an E. coli strain made serine sensitive through knockout of the serine degradation pathways and the native eamA gene (E. coli MG1655 AsdaA, AtdcG, AsdaB, AeamA). The parent of the strain was obtained from Mundhada et al. [1], and the eamA knockout was introduced into the strain using lambda-red recombineering using the pSIM19 recombineering plasmid. Recombineering was done by preparing electrocompetent cells as described in 1.1.6, but with growth at 30C, and by addition of spectinomycin instead of kanamycin, with further addition of a 15-minute heat shock at 42 C prior to cell washing. The electrocompetent cells were transformed with 2.5 pL of 10 pM oligo 27 and oligo 28 to introduce the eamA knockout. The cells were recovered for 2 h at 30C prior to plating on LB-spec. Single colonies obtained after overnight growth were screened by colony PCR using oligos 29 / 30, using a 2x HotStart OneTaq master mix from New England Biolabs. Each 50 pL reaction contained 25 pL 2x PCR mix, 1 pL forward primer (10 pM), 1 pL reverse primer (10 pM), 23 pL autoclaved MQ water, and a small number of cells from a colony. Colony PCR was performed in a thermocycler using the following cycling instructions:a a gggcgctggta ga gcgtcgta ggga ta a gttca tttgtctgtca a a eta ca ta gcgtgttga tta ta a t a gggca cgccga gcgca t Oligo 27 eamA_KO_F cOligo 28 eamA_KO_R gatgcgctcggcgtgccctattataatcaacacgctatgtagtttgacagacaaatgaacttatccctacgacgctctaccagcgccctt Oligo 29 eamA_gDNA_seq_F GGAAACGCGGAACAGATAGCeamA_gDNA_seq_OligO 30 R CTCCAAATGGCACCTGCAAC
[0151] The PCR products were visualized on agarose gels as described to reveal if colonies contained eamA knockouts. Colonies containing eamA knockouts were picked and grown at 42°C overnight to remove the pSIM19 plasmid
[0013] , prior to transforming the strain with the eamA plasmid library as described in 1.1.6. The plasmids pSClOl-EamA and pSClOl were similarly transformed to act as wild type and negative controls, respectively, during screening. Kanamycin was added at all steps of cultivation to maintain the plasmids.1.7 Screening of epPCR mutant library by deep sequencing
[0152] The eamA mutant library, transformed into the screening strain, was subjected to increasing doses of serine to select for mutants with increased EamA activity by cultivating the mutant library in minimal media supplemented with 0, 2, 6 or 8 g / L of L-serine. The mutant library was first cultivated in M9 minimal media overnight. The following morning, a set of 250 mL baffled shake flasks containing 25 mL M9 media, supplemented with L-serine, were inoculated to OD 0.1 using the preculture. Following overnight growth, the plasmid eamA libraries were harvested as described and subjected to analysis by deep Illumina sequencing, resulting in ~10 million 150 bp reads per library. The Eurofins InView Resequencing service was used for Illumina sequencing. The obtained reads with minimal quality of Q30 were trimmed and mapped to the pSClOl-EamA reference plasmid (SEQ. ID NO: 02), using Geneious Prime (version 2023.1.1) and Geneious Prime was used for variant calling to identify nucleotide polymorphisms in the eamA gene for each library. Variants were called if they showed a minimum coverage of 5 reads, a maximum P-value of 10-6, and a minimum strand-bias P-value of 10-5, when exceeding 65% bias. For data processing, the read coverage for each detected mutation was used to filter false positive mutations, stemming from sequencing errors. A mutation was considered relevant if the read coverage exceeded that of the 25thpercentile (Qi) for the corresponding dataset.
[0153] Variant calling revealed 1187, 389, 346 and 246 unique mutations in the libraries supplemented with 0, 2, 6 and 8 g / L of L-serine, respectively, showing that the addition of 2 g / L L-serine had eliminated nearly 75% of the detected mutations, and that further supplementation of L-serine eliminated additional mutations. Mutations in EamA that showed an increased mutation frequency in the supplemented libraries, compared to the non-supplemented library, were considered activity-increasing. These mutations, and their corresponding read frequencies, are given in table 1, showing 71 mutations considered enriched, corresponding to 69 amino acid changes, which mapped to 59 codons in EamA (SEQ. ID NO: 1 and 4). These 69 mutants correspond to SEQ ID NO: 5-73.Table 1 SNP frequencies observed in eamA error-prone PCR libraries, after subjection to indicated concentrations of L-serine. 69 unique mutations were found to be enriched-for, when L-serine was applied, shown below, indicated as amino acid substitution and codon substitutions.1.3 Screening of eamA epPCR library by growth screening
[0154] Following enrichment on L-serine, the plasmid libraries were streaked onto LB-agar plates, and single colonies were isolated and screened for improved serine tolerance. 96 colonies from the 6 g / L and 8 g / L enriched libraries were grown in 96-well microtiter plates containing M9 minimal media supplemented with 6 or 8 g / L of L-serine, and growth was monitored by measuring ODgoo continuously over 24 hours. A SpectraMax i3x was used for growth monitoring and temperature control. 20 colonies that showed the ability to grow in higher concentrations of L-serine than a control expressing wild type EamA had their pSEVA27-EamA plasmids isolated and sequenced to identify mutations within eamA that conferred increased activity. Of the 20 clones, 5 carried the quadruple mutation (F108L, V140A, L220M, L267I), 5 carried the S181G mutation in combination with other mutations, 1 variant contained the M279V mutation, and 1 contained the V174A mutation. Other mutations observed were V14A, A260S, G137S, S199P, A86V, and V174A. The activity-increasing effect of the quadruple EamA mutation (F108L, V140A, L220M, L267I) and of the single mutations S181G and M279V wasverified by microtiter plate screening in the presence of varying concentrations of L-serine. The mutations were introduced into pSEVA27-EamA individually, and in simple combinations, using PCR with oligos 11-22, to test the individual and pooled contributions to EamA activity of the mutations, the results of which are shown in table 2, corresponding to SEQ ID NO:s 74 - 85.Oligo 11 eamA_F108L_F cgtttactCtcggggagcgactgcOligo 12 eamA_F108L_R cccgaGagtaaacgcgccaagOligo 13 eamA_L220M_F ctgatgtatAtggcgtttgtggcgacOligo 14 eamA_L220M_R cgccaTatacatcagagacaagatggtggtcatatcgOligo 15 eamA_L267I_F gttggatgaacgcAtaacgggtctgOligo 16 eamA_L267I_R taTgcgttcatccaacaatagtgccgOligo 17 eamA_M279V_F gcggtgctcattGtgaccgggctgOligo 18 eamA_M279V_R gtcaCaatgagcaccgcacctaaaaattgcagOligo 19 eamA_S181G_F gctggtaatctggGgcgctttaatcccaatcOligo 20 eamA_S181G_R gcCccagattaccagcgacatcacOligo 21 eamA_V140A_F gtcagcatgCggcgatgctcggcOligo 22 eamA_V140A_R ccGcatgctgaccgttcagactatcTable 2 Growth rate of single and combinatorial EamA mutants identified through error-prone PCR, grown in minimal media supplemented with indicated concentrations of L-serine. Growth rates indicated are relative to the growth rate observed without serine supplementation.
[0155] Based on the results obtained by Illumina sequencing of whole plasmids, the EamA mutations L38S, F82L, A86V, H113R, G137S, S169P, V174A, S181G, S199P, A257S, M279V, N285I, and S299R,appear to be activity-increasing. Moreover, based on the results of growth screening shown in table 2, the EamA(F108L, V140A, L220M, L267I, S181G, M279V) and its mutant constituents also appeared to improve the activity of EamA. The combinatorial mutant, named M6 in later writing, was studied further for its ability to improve serine and sulfocysteine production in fermentation, as described in examples 3, 4 and 5.Example 2: Random mutagenesis of EcEamA through massive saturation mutagenesis
[0156] Example 1 identified several residues that could be mutated to improve the activity of EamA, however, random mutagenesis strategies such as error-prone PCR rarely explore the whole possible sequence space due to mutational bias
[0014] , Methods such as site-saturation mutagenesis can be used to explore all possible nucleotide substitutions for a given codon. To fully explore the sequence space of the identified codons, a strategy was conceived to fully saturate the codons in eamA that were deemed interesting based on enrichment-status from the previous Illumina sequencing data.
[0157] Codons were chosen for mutagenesis if they showed enrichment across the acquired Illumina datasets from example 1; from 0 - 8 g / L L-serine, from 0 - 2 g / L L-serine, from 2 - 8 g / L L-serine, etc, or if they had been found to improve EamA activity during growth assays in section 1.3. The following 50 eamA codons were targeted for saturation mutagenesis, with the previously characterized mutations underlined: 15, 19, 46, 51, 57, 58, 60, 67, 71, 73, 76, 78, 81, 82, 84, 100, 102, 103, 104, 106, 107, 108, 112, 113, 116, 117, 122, 126, 137, 140, 169, 174, 181, 190, 191, 199, 209, 218, 220, 225, 226, 227, 257, 258, 262, 267, 279, 285, 296, and 299.
[0158] The eamA residues were targeted for site-saturation mutagenesis with the degenerate "NNN" codon, encoding 64 codons. Codon replacement was done on an E. coli strain carrying the eamA gene in a single copy on the chromosome by recombineering of oligos. The genotype of the strain used was E. coli MG1655 AsdaA, AtdcG, AsdaB, AeamA, dinD_yicG::eamA, which was constructed from the screening strain used in example 1, by knock-in of eamA into the chromosomal dinD_yicG locus. The knock-in was done using a dsDNA cassette prepared using PCR with oligos 23 / 24 using pSClOl-EamA as template. Recombineering was performed as described in example 1.1.7, and successful knock-in were confirmed by colony PCR using oligos 25 / 26.Oligo 23 eamA_dinD_yicG_F ggcagcacagcaagctggggtagcgacagctactgatttcgccatatttcagaatcatggttaccaggggagggcgg cggatttgtccOligo 24 eamA_dinD_yicG_R caacctgtgccccgatgatagaaaagaccaccagtccgagcgcatcgagcaccagaaaggggacccctggattctc accaataaaaaacgOligo 25 dinD_seq_F gcaggagcttgctgacgatgOligo 26 dinD_seq_R ataattgggccgtgcccc
[0159] Once the knock-in was verified, the resulting strain was plasmid cured of pSIM19, and transformed with the recombineering plasmid, pACYC_pBAD_ara_dam. A single population of cellstransformed with pACYC_pBAD_ara_dam was maintained over 5 consecutive days and was transformed 13 times using two pools of recombineering oligos to perform saturation mutagenesis of the targeted codons. Induction of the recombineering system was done by the addition of D-arabinose to a concentration of 0.2% during mid-exponential growth of the host strain, after which the cell mass was washed twice, and electroporated with either an oligo pool containing all 50 oligos (oligos 34-83), or another pool containing 44 oligos, by omitting the 6 previously characterized mutations in residues 108, 140, 181, 220, 267 and 279. All oligo pools contained each constituent oligo at a concentration of 2 pM.Oligo 34 eamA_V15_NNN TGGGGTGTTGGCGCTACTGgtagtggtcNNNtgggggctaaattttgtggtcatcaaagt Oligo 35 eamA_N19_NNN GCTACTGgtagtggtcgtatgggggctaNNNtttgtggtcatcaaagtggggcttcataaOligo 36 eamA_P46_NNN cggtttgcgctttatgctggtcgcttttNNNgctatcttttttgtcgcacgaccgaaagtOligo 37 eamA_V51_NNN gctggtcgcttttccggctatcttttttNNNgcacgaccgaaagtaccactgaatttgctOligo 38 eamA_P57_NNN tatcttttttgtcgcacgaccgaaagtaNNNctgaatttgctgctggggtatggattaacOligo 39 eamA_L58_NNN cttttttgtcgcacgaccgaaagtaccaNNNaatttgctgctggggtatggattaaccatOligo 40 eamA_L60_NNN tgtcgcacgaccgaaagtaccactgaatNNNctgctggggtatggattaaccatcagtttOligo 41 eamA_T67_NNN actgaatttgctgctggggtatggattaNNNatcagttttgcgcagtttgcttttcttttOligo 42 eamA_A71_NNN gctggggtatggattaaccatcagttttNNNcagtttgcttttcttttttgtgccattaaOligo 43 eamA_F73_NNN gtatggattaaccatcagttttgcgcagNNNgcttttcttttttgtgccattaacttcggOligo 44 eamA_L76_NNN aaccatcagttttgcgcagtttgcttttNNNttttgtgccattaacttcggtatgcctgcOligo 45 eamA_C78_NNN cagttttgcgcagtttgcttttctttttNNNgccattaacttcggtatgcctgctggactOligo 46 eamA_N81_NNN gcagtttgcttttcttttttgtgccattNNNttcggtatgcctgctggactggcttcgctOligo 47 eamA_F82_NNN gtttgcttttcttttttgtgccattaacNNNggtatgcctgctggactggcttcgctggtOligo 48 eamA_M84_NNN ttttcttttttgtgccattaacttcggtNNNcctgctggactggcttcgctggtgttacaOligo 49 eamA_T100_NNN gctggtgttacaggcacaggcgttttttNNNatcatgcttggcgcgtttactttcggggaOligo 50 eamA_M102_NNN gttacaggcacaggcgttttttactatcNNNcttggcgcgtttactttcggggaAcgactOligo 51 eamA_L103_NNN acaggcacaggcgttttttactatcatgNNNggcgcgtttactttcggggaAcgactgcaOligo 52 eamA_G104_NNN ggcacaggcgttttttactatcatgcttNNNgcgtttactttcggggaAcgactgcatggOligo 53 eamA_F106_NNN ggcgttttttactatcatgcttggcgcgNNNactttcggggaAcgactgcatggcaaacaOligo 54 eamA_T107_NNN gttttttactatcatgcttggcgcgtttNNNttcggggaAcgactgcatggcaaacaattOligo 55 eamA_F108_NNN ttttactatcatgcttggcgcgtttactNNNggggaAcgactgcatggcaaacaattggcOligo 56 eamA_L112_NNN gcttggcgcgtttactttcggggaAcgaNNNcatggcaaacaattggcggggatcgccttOligo 57 eamA_H113_NNN tggcgcgtttactttcggggaAcgactgNNNggcaaacaattggcggggatcgccttagcOligo 58 eamA_Q116_NNN tactttcggggaAcgactgcatggcaaaNNNttggcggggatcgccttagcgatttttggOligo 59 eamA_L117_NNN tttcggggaAcgactgcatggcaaacaaNNNgcggggatcgccttagcgatttttggcgtOligo 60 eamA_L122_NNN gcatggcaaacaattggcggggatcgccNNNgcgatttttggcgtactggtgttaatcgaOligo 61 eamA_G126_NNN attggcggggatcgccttagcgatttttNNNgtactggtgttaatcgaagatagtctgaaOligo 62 eamA_G137_NNN actggtgttaatcgaagatagtctgaacNNNcagcatgtggcgatgctcggctttatgttOligo 63 eamA_V140_NNN aatcgaagatagtctgaacggtcagcatNNNgcgatgctcggctttatgttgaccctggcOligo 64 eamA_S169_NNN catcttcaataaaaagatcatgtcgcacNNNacgcgtccggcggtgatgtcgctggtaatOligo 65 eamA_V174_NNN gatcatgtcgcactcaacgcgtccggcgNNNatgtcgctggtaatctggagcgctttaat Oligo 66 eamA_S181_NNN tccggcggtgatgtcgctggtaatctggNNNgctttaatcccaatcattcccttctttgtOligo 67 eamA_F190_NNN gagcgctttaatcccaatcattcccttcNNNgttgcctcgctgattctcgatggttccgcOligo 68 eamA_V191_NNN cgctttaatcccaatcattcccttctttNNNgcctcgctgattctcgatggttccgcaacOligo 69 eamA_S199_NNN ctttgttgcctcgctgattctcgatggtNNNgcaaccatgattcacagtctggttactatOligo 70 eamA_I209_NNN cgcaaccatgattcacagtctggttactNNNgatatgaccaccatcttgtctctgatgtaOligo 71 eamA_M218_NNN tatcgatatgaccaccatcttgtctctgNNNtatctggcgtttgtggcgacaattgttggOligo 72 eamA_L220_NNN tatgaccaccatcttgtctctgatgtatNNNgcgtttgtggcgacaattgttggttatggOligo 73 eamA_T225_NNN gtctctgatgtatctggcgtttgtggcgNNNattgttggttatgggatctgggggacgttOligo 74 eamA_I226_NNN tctgatgtatctggcgtttgtggcgacaNNNgttggttatgggatctgggggacgttactOligo 75 eamA_V227_NNN gatgtatctggcgtttgtggcgacaattNNNggttatgggatctgggggacgttactgggOligo 76 eamA_A257_NNN atcgttactggtgcccgtagtaggactgNNNagtgcggcactattgttggatgaacgcttOligo 77 eamA_S258_NNN gttactggtgcccgtagtaggactggcaNNNgcggcactattgttggatgaacgcttaacOligo 78 eamA_L262_NNN cgtagtaggactggcaagtgcggcactaNNNttggatgaacgcttaacgggtctgcaattOligo 79 eamA_L267_NNN aagtgcggcactattgttggatgaacgcNNNacgggtctgcaatttttaggtgcggtgctOligo 80 eamA_M279_NNN tctgcaatttttaggtgcggtgctcattNNNaccgggctgtatatcaatgtatttggcttOligo 81 eamA_N285_NNN ggtgctcattatgaccgggctgtatatcNNNgtatttggcttgcggtggcgtaaaGCGGTOligo 82 eamA_K296_NNN atttggcttgcggtggcgtaaaGCGGTANNNGTGGGAAGTTGACATAGGAGGTCCTCCTa Oligo 83 eamA_S299_NNN gcggtggcgtaaaGCGGTAAAGGTGGGANNNTGACATAGGAGGTCCTCCTatgtcaattc
[0160] Following mutagenesis by repeated transformation, the EcEamA mutant library was enriched for on 1 – 4 g / L of L-serine as described in example 1.2. 96 single colonies were subsequently isolated, the chromosomally encoded eamA gene was sequenced and the colonies were tested for EamA activity in growth assays, with supplementation of 5 and 10 g / L of L-serine. Of the 96 colonies, 52 showed mutations in the genomically encoded eamA gene, whereof 44 contained intact eamA open reading frames. 34 of the obtained mutants were able to grow when L-serine was supplemented, see table 3, indicating improved EamA activity. The results of the growth assays are shown in table 3, showing the calculated growth rate for each functional mutant.
[0161] To assess the mutational spectrum found within the generated mutant library, deep sequencing of the mutated eamA gene, followed by variant calling, was performed on each obtained library. The mutational spectrum was compared between the non-enriched library, subjected to no L-serine, and the enriched libraries, subjected to 1 – 4 g / L of serine. The results of the analysis are shown in table 4, showing that 12 and 18 of the targeted residues were fully saturated to the possible 63 possible codon substitutions, and that the unenriched libraries contained 36 and 44 possible substitutions, per position, on average. As all oligos were transformed in equimolar amounts, it was expected to observe equal saturation at all positions. The lack of full saturation in some positions may be due to insufficient read depth of the eamA gene. It is further observed that, as the libraries were enriched on L-serine, the number of observed mutations decreased from 1822 and 2196 (unenriched)to 1002 and 1078 mutations (enriched on 4 g / L L-serine), indicating that nearly half of the mutations had been selected against by the addition of L-serine.
[0162] To identify activity-increasing mutations, the mutations that appeared with a high read depth (>5x median of read depth per library) were considered for further analysis. The read frequency for each mutant codon was calculated and compared for each library. The calculated mutation frequencies were used as indication of the effect of each mutation, with mutations being present at high serine concentrations expected to be activity-improving, and vice versa. The results are seen in tables 5 and 6, showing mutation frequencies across serine enrichment levels, for the mutant libraries made by transformation of 44 and 50 oligos targeting eamA. As seen in tables 5 and 6, several mutations are enriched for, by showing high read frequencies at the highest concentration of L-serine used for selection, indicating that these mutations confer increased activity to the EamA protein. As intended, the use of site-saturation mutagenesis also offers deeper exploration of the sequence space, as whole codon substitutions were observed in many cases. This allowed for the discovery of several novel mutations, not explored in the error-prone PCR library described in example 1, such as F73X substitutions, which appeared with high frequency.Table 3 Results from growth assays of colonies identified following massive saturation mutagenesis, followed by enrichment on 1 – 4 g / L of L-serine. The individual colonies were grown in 5 g / L and 10 g / L of L-serine, and the growth rate was calculated and used as an indication of EamA activity. Mutants in boldface were able to grow at the highest tested L-serine concentration of 10 g / L.Table 4 Mutational diversity found in MSM library. For each enrichment level, the number of substituted codons identified in eamA is listed, with 63 indicating full saturation, and 0 indicating no substitutions. Diversity is indicated for the mutant libraries containing mutations in 44 EamA codons, and a library containing mutations in 50 EamA codons. Rows in boldface indicate the additional 6 codons targeted in the 50-oligo mutant library.Table 5 SNP frequencies identified via Illumina sequencing of EcEamA mutant library made by repeated recombineering of 44 oligos, targeting the EcEamA residues mentioned in table 4.Table 6 SNP frequencies identified via Illumina sequencing of EcEamA mutant library made by repeated recombineering of 50 oligos, targeting the EcEamA residues mentioned in table 4.Table 6 (continued)Table 6 (continued)
[0163] Based on the obtained Illumina dataset, near-full saturation of the 50 mentioned positions was achieved, revealing numerous mutations in EamA that, based on selection on L-serine, improve the activity of the protein. Moreover, deep mutagenesis was achieved, resulting in exploration of the full sequence space of the 50 EamA residues targeted for mutagenesis as single mutants, and in combinations of up to 4 mutations per isolated strain, as shown in tables 2 and 3. This is the first mention of activity-increasing mutations in E. coli EamA.
[0164] Moreover, as the whole mutagenic libraries were subjected to selection on L-serine, it is argued that the whole sequence space of the targeted residues was constructed, and tested for improved EamA activity, using the described Illumina-based sequencing method. SEQ. ID NO:s 122-171 correspond to the single mutants of EamA, carrying any amino acid (shown as X), in place of the targeted residues.Example 3: Overexpression of mutant EcEamA to improve production of L-serine
[0165] Having identified activity-increasing EamA mutations in examples 1 and 2, two EamA mutants were tested for their ability to improve the production of the amino acid L-serine in E. coli cell factories. An industrial L-serine producing E. coli K-12 MG1655 strain was modified by removal of the native eamA gene as described, and by subsequent introduction of the wildtype eamA gene or of the EamA(F108L, V140A, S181G, L220M, L267I, M279V) mutant into the dinD_yicG locus, as described. The wild type eamA gene was similarly integrated to act as production reference. It was desired to overexpress the introduced eamA gene to further facilitate export of produced L-serine. However, gross overexpression of membrane proteins is known to lead to cellular stress. It was therefore desired to find an intermediate expression level for eamA, which could facilitate product export, without causing cellular stress. For this reason, a synthetic eamA promoter library was designed based on the J23119-family of promoters, composed of 20 constitutive E. coli promoters that cover a wide range of transcriptional activities. A consensus sequence was determined, which contained 10 degenerate nucleotide positions, encoding a total of 1024 promoter variants.Table 7: Y = T / C, K = T / G, R = A / G, W = T / A.Promoter / motif -35 -10BBa_J23119 TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCBBa_J23112 CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCBBa_J23103 CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCBBa_J23113 CTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCBBa_J23109 TTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGCBBa_J23117 TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCBBa_J23114 TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGCBBa_J23115 TTTATAGCTAGCTCAGCCCTTGGTACAATGCTAGCBBa_J23116 TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCBBa_J23105 TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGCBBa_J23110 TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCBBa_J23107 TTTACGGCTAGCTCAGCCCTAGGTATTATGCTAGCBBa_J23106 TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCBBa_J23108 CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCBBa_J23118 TTGACGGCTAGCTCAGTCCTAGGTATTGTGCTAGCBBa_J23111 TTGACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCBBa_J23101 TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGCBBa_J23104 TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCBBa_J23102 TTGACAGCTAGCTCAGTCCTAGGTACTGTGCTAGCBBa_J23100 TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCConsensus YTKAYRGCTAGCTCAGYCCTWGGKAYWRTGCTAGC
[0166] eamA promoter replacement necessitated locating the native promoter, which has not been characterized in literature. The De Novo DNA webserver (https: / / www.denovodna.com / software / ) was used to locate the transcriptional start site from the eamA promoter using the built-in promoter calculator. The DNA upstream (SEQ ID NO: 174) of the eamA gene was submitted for promoter search, which revealed a promoter with a strength of approximately 1000 arbitrary units (AU), SEQ ID NO: 175. A recombineering oligo was designed to replace the native promoter with the synthetic promoter library (SEQ ID NO: 176).OligO 21 CATTAATGCCGTCGTAACCGGcgactaYTKAYRGCTAGCTCAGYCCTWGGKAYWRTGCTAGCcagctaagttgattgcttacaaaagatg
[0167] The strain carrying EamA(F108L, V140A, S181G, L220M, L267I, M279V) was made electrocompetent and prepared for recombineering as described. 2.5 μL of 100 μM oligo 21 was transformed into the strain, the strain was recovered in 2xYT+spec at 30C for 2 hours, washed twice in 2mL M9 media, before resuspension in 1 mL M9 media. 200 μL cell suspension was plated on M9-agar plates supplemented with 0, 25, 50, 75 and 100 g / L L-serine, and the plates were incubated for 2 days at 30C. After growth, single colonies were picked from the 100 g / L L-serine plate, and the eamA promoter region was analysed by colony PCR of the dinD_yicG locus and sequenced using the previously mentioned oligos. 7 colonies showed changes to the promoter of eamA, matching the mutations encoded by the recombineering oligo. Using De Novo DNA, the calculated promoter strengths were in the range of 11 - 48 x that of the wild type eamA promoter, SEQ ID NOs: 177-183. The strains were subsequently tested for their ability to produce L-serine.
[0168] L-serine production was promoted by transformation of the low-copy pSClOl-serACB plasmid, expressing a feedback resistant L-serine biosynthetic pathway from a strong constitutive promoter. The constructed strains, carrying eamA promoters of wildtype, 12.7 kAU and 19 kAU strengths were used for L-serine production in 1 L bench-scale bioreactors in a fed-batch setup. The results, given as biomass-normalized productivities, are seen in Figure 1, showing that the use of a 19x upregulated eamA promoter resulted in a 30-40% increase in specific productivity over 48 hours. Similarly, the useof a 12.7x upregulated eamA promoter resulted in a 10-15% increase in L-serine titers. This effect is exacerbated by also using a mutant EamA, as seen in Figure 1. Compared to the wild type EamA, expressed from a wild type promoter, the variant EamA(F108L, V140A, S181G, L220M, L267I, M279V), expressed from a 19 kAU promoter, had nearly tripled the specific produvtivity of the strain in fermentation, indicating a biomass of greatly increased production capacity.
[0169] To also evaluate the effects of the characterized F73G eamA mutant, the mutant was genome-integrated with a wild type and a 19 kAU promoter. Fed-batch fermentation was performed on the strains indicated in table 8. Surprisingly, The F73G EamA variants showed reduced L-serine production, contrary to the expectation. However, the carbon balance for the fermentation of the F73G mutant did not close, indicating a significant buildup of byproducts, indicating that the F73G mutation had altered the substrate specificity of EamA. HPLC analysis revealed a series of peaks unique to the F73G mutant, whose increased retention times indicate increased hydrophobicity, compared to L-serine. As it is known that L-serine inhibits branched chain amino acid biosynthesis, it was further investigated if the products stem from the L-methionine or L-threonine pathways in a subsequent study.
[0170] Table 8: Fermentation setup to show effect of using EamA mutants with varying degrees of overexpression.
[0171] Due to the growth-defect exhibited by the F73G mutant, unless supplemented with L-serine, it was investigated if other amino acid compounds could rescue the growth of the mutant. In case an amino acid, externally supplied, could restore normal growth, it would indicate that the amino acid itself is an export product of EamA(F73G), or that EamA(F73G) is exporting one of the precursors for said amino acid, thereby limiting the strain of essential metabolites. As proof of concept, the EamA(F73G) mutant was expressed from a low-copy plasmid in a serine-sensitive background strain, and grown in 200 μL M9 minimal media supplemented with kanamycin and one of the known export substrates of EamA in triplicate in concentrations of 0.25 g / L (N-acetyl serine), 0.5 g / L (cysteine) or 1 g / L. Growth was monitored by measuring OD600 over 20 hours in a SpectraMax i3x platerader (Molecular devices), with strong agitation and temperature maintained at 37C. The results are shown in Figure 2, showing that intermediates of the cysteine pathway (N-acetyl serine, S-sulfocysteine) and L-serine and L-cysteine could rescue growth, as was expected. Amino acids stemming from thebranched amino acid biosynthetic route (L-threonine and L-asparagine) could also restore growth, unexpectedly, whereas L-glutamine could not.
[0172] Next, the experiment was repeated with individual supplementation of the remaining 14 common amino acids in concentrations of 0.25 - 1 g / L.. The results of this study are shown in Figure 3, showing that the EamA(F73G) mutant fails to grow without supplementation of either L-methionine, L-arginine, L-alanine, or L-isoleucine. The growth rescuing effect was greatest for methionine, derived from the branched chain amino acid pathway, together with isoleucine. It is unknown why alanine or arginine might rescue growth. Taken together, the results of Figure 2 and Figure 3 indicate that EamA(F73G) mutant growth can be restored through amino acids or amino acid intermediates from the cysteine and branched chain amino acid pathways. This indicates that the mutant exporter is actively exporting intermediates from both pathways. As EamA is only characterized as an exporter of cysteine-pathway intermediates, the feature of this mutant is novel.Example 4: Structure-activity relationship of activity-increasing mutations in EcEamA
[0173] The structure of E. coli EamA and other EamA-like proteins has not been well studied in literature. Structural knowledge is available about the related YddG protein, and the related SLC35-family of eukaryotic transport proteins
[0015] ,
[0016] , EcEamA and the mentioned protein families share characteristic topologies, each consisting of 10 transmembrane alpha-helices protruding into- and out of the cell membrane [3],
[0017] , With the release of artificial intelligence models such as AlphaFold, it has become possible to predict the structures of proteins with high accuracy
[0018] , allowing for structure-activity relationship studies for proteins of unknown structure. The AlphaFold model of E. coli EamA was therefore used to investigate the identified mutations in EamA. A structural and sequence comparison of EcEamA to related EamA proteins, with sequence identities down to 75%, was also performed to identify conserved sequence motifs and structural motifs.
[0174] EcEamA is represented in the UniProtKB database by the ID P31125. Using the built-in "Similar sequences" function of UniProt, the protein sequences of 491 EamA homologues were retrieved, and aligned using Clustal Omega 1.2.2 in Geneious Prime 2023 v 1.1. A phylogenetic tree was constructed using the generated alignment file using EcEamA as root, see Figure 4. Subtrees containing proteins of high similarity were clustered, and representatives from 5 subtrees, representing protein identities to EcEamA from 78% to 99% were picked for structural analysis. The sequence identity matrix of the selected proteins is shown in Figure 5. The AlphaFold v4 protein models for the chosen EamA proteins were retrieved and investigated in PyMol 2.5.8. The protein models superimposed onto EcEamA with RMSD values of 0.475 - 0.71 A, indicating significant structural similarity between the proteins. The superimposed structures are shown in Figure 6, showing that the protein structures are near identical, with each protein consisting of 10 transmembrane alpha-helices separated by unstructured interhelical loops. A central pocket could be seen in each of the proteins which connected to an opening on the cytoplasmic side of each protein. Based on structural alignment with YddG, this pocket is assumed to be responsible for substrate binding
[0015] ,
[0175] The DeepTMHMM tool (https: / / dtu.biolib.com / DeepTM HMM) was used to validate the topological orientation of EamA, showing that the both the NTD and CTD of the protein was oriented towards the cytoplasm, see Figure 7.
[0176] The locations of the 50 targeted residues in the EamA protein model (based on AlphaFold) are shown in Figures 8 and 9, showing that most of the mutations map to peripheral regions of the protein, exceptions being the Asnl9 and Phe73 residues, which map to the centre of the EamA cavity. As the functionality of EamA proteins has not been explored in-depth in literature, the finding that mutations located outside of the cavity (and expected binding site for transport substrates) could benefit EamA activity was unexpected.
[0177] Sequence analysis of EcEamA homologues was performed using the EVcouplings webserver (https: / / evcouplings.org / ), producing an alignment of 137.600 EamA-like proteins, the results of which are shown in Figure 10.Table 9: Activity-increasing mutations in EcEamA identified and their placement within the protein structure.
[0178] As seen in Table 9, activity-increasing mutations in EamA residues Asnl9, Phe73, Leu76 and Thr225, were identified in the substrate binding pocket of EcEamA. As shown in Figure 6 and 12 the binding pocket of the EamA-like proteins are structurally conserved. Based on obtained screening results, it appears that substitutions in EamA residues Asnl9, Phe73, Leu76, and Leu225 benefit serine export activity. Inspection of the EamA structure in PyMol showed the mentioned residues neighbouring the strongly conserved Arg39 (see Figure 10), located in the binding pocket. These mutations therefore likely positively affect the binding of amino acids, such as L-serine, to the EamA proteins. As shown in Figure 10, residues 19 and 73 of EcEamA are not well conserved. However, the fold of the binding pocket does appear to be conserved in EamA proteins, and in the related YddG proteins.
[0179] The crystal structure of YddG from Starkeya Novella (SnYddG) has been solved in an outward open conformation (cytoplasmic face closed, PDB ID 5120), whereas the AlphaFold model of EcEamA models EamA in the inward open conformation (cytoplasmic face open). The region surrounding the binding pockets of the proteins appear similar, although inverted due to the differing conformations, as seen in Figure 12, showing the binding pocket of EcEamA (black), overlapped with the bindingpocket of the S. novella YddG (grey). It is known that the SnYddG residues 17, 40, 78, 79, 82, 99, 101,163, 244, 251, 225 and constitute the binding pocket of SnYddG
[0015] , Based on this, the binding pocket of the EamA proteins was defined as EcEamA residues within 2.6 A distance of the binding pocket residues of SnYddG, when the two protein structures are superimposed. In EcEamA, these residues correspond to V15, W16, G17, N19, F20, R39, M41, L42, V43, A44, L66, T67, 168, S69, F70, A71, N72, F73, A74, F75, L76, A79, A89, S90, V92, L93, N94, A95, N96, A97, L147, T148, A151, A152, S154, W155, A156, V178, F189, T225, Y229, P252, V254, G255, L256 and A259.
[0180] For a variable protein structure, the analysis can be repeated by running the following code in PyMol, replacing "EAMA_MODEL" for the name of the loaded structure in the code.fetch 5120sele chainA, chain Aextract 5l20_monomer, chainAhide everythingshow cartoon, 5l20_monomercolor grey, 5l20_monomeropen "EAMA_MODEL"set_name "EAMA_MODEL", eamA_variantsuper 5l20_monomer, eamA_variantcolor black, eamA_variantsele yddG_binding_pocket, resi 17+78+82+99+79+101 +163+244+251 +225+40 in 5l20_monomersele yddG_binding_homologues, byres yddG_binding_pocket around 2.6 in eamA_variantiterate yddg_binding_homologues and name CA, print (resi, resn, model)
[0181] As also seen in Table 9, activity increasing mutations were found in Leul22, Glyl26 and Met279, which are contained within the conserved GX6G motifs, conserved within EamA proteins
[0016] , see Figure 10 and Figure 11. In EcEamA, these motifs are present between Glyll9 - Glyl26, and Gly274 - Gly281, which are strongly conserved. A well-known function of this motif is not well established in literature, and the nature of the mutations therefore remains unknown and unexpected. Moreover, as shown in Figure 10, the constituent glycine residues are strongly conserved. As such, the observation that mutations in the most conserved Glyl26 could benefit EamA activity also surprising. As seen in Figure 10, the location of the motifs may be determined by multiple sequence alignment, evident by highly conserved glycine residues separated by 6 variable residues located in the transmembrane helices 5 and 10.
[0182] Several residues that showed amino acid substitutions with an activity-increasing effect were located outside of the transmembrane helixes of the EcEamA protein, being either placed in theunstructured interhelical regions, or at the surface-exposed regions of the helixes. As shown in table 9, activity-increasing mutations could be identified in all the interhelical regions of EcEamA, except for the interhelical region of TM8 / TM9. As seen in Figure 10, these regions are not conserved but can be identified based on sequence analysis using the DeepTMHMM tool, as seen in Figure 7, as can each of the 10 constituent transmembrane helices, that make up the EcEamA protein. As previous studies on EamA-family proteins have focused on the binding pocket mutations, it was unexpected that mutations in the unstructured regions could benefit EamA activity. Specifically, in EcEamA, this constitutes residues 1-6, 24-33, 52-59, 81-87, 107-116, 133-142, 158-176, 196-213, 235-243, 263-268, and 299-299.Example 5: Co-localization of EcEamA to serine biosynthetic pathway to improve production of L-serine
[0183] As demonstrated in example 3, the production of L-serine could be improved by increasing the total EamA activity of the individual cells, either by using improved EamA mutants, by overexpression, or a combination thereof. An additional way to improve EamA activity would be to ensure saturation of the EamA protein of transport substrate. Assuming Michaelis-Menten kinetics, the activity of EamA should improve non-linearly with increasing L-serine concentrations in the vicinity of the EamA protein. One way to ensure this, would be to co-localize the serine biosynthetic pathway to the EamA protein, promoting L-serine production adjacent to EamA. Similar results have been achieved in academic literature by using affinity tags to attract components of the serine biosynthetic pathway to EamA [4], [5], However, the use of single polypeptide fusion proteins, which offer advantages over affinity-based fusion proteins, has never been demonstrated. One advantage of a fusion polypeptide could be that diffusion and attraction of protein subunits is eliminated as a factor. The use of fusion polypeptides also allows for simpler balancing of pathways and ensures that all produced EamA proteins have a partnering protein component, herein SerB.
[0184] L-serine is produced from glycolytic intermediates in E. coli, through the catalytic actions of SerA, SerC, and finally, SerB. As the final step in the pathway, SerB was chosen for fusion to EamA to promote co-localization of the L-serine pathway to EamA. The fusion protein was created through USER cloning using oligos 84-87 for PCR, using Phusion U polymerase from ThermoFisher Scientific. Thermocycler instructions and PCR setup were similar to those used for Phusion PCRs, see example 1. Oligo 84 pSC101_eamA_fusion_UF agctgaggUcgcctcagcgOligo 85 pSC101_eamA_fusion_UR ACCTCCTATGUCACTTCCCACCTTTACCGCtttacgOligo 86 serB_eamA_fusion_UF ACATAGGAGGUCCTCCTATGcctaacattacctggtgcgacc Oligo 87 serB_eamA_fusion_UR acctcagcUcacttctgattcaggctgcctgag
[0185] eamA was amplified from the E. coli K-12 genome using oligo84 / 85, and pSClOl-se CB was linearized by PCR to accept the eamA gene fusion to serB using oligo 86 / 87. The obtained PCR fragments were fused using USER enzyme from New England Biolabs, with each 5 pL reaction containing 0.5 pL lOx CutSmart buffer, 0.5 pL USER enzyme, 2 pL serB fragment, and 2 pL pSClOl-eamA fragment. The components were mixed and incubated at 37C for 30 min, then cooled stepwise to 4 C over 30 minutes. Finally, the USER mixture was transformed into chemically competent cells as described.
[0186] The resulting plasmid, pSClOl-serAC-eamA-serB, was tested for EamA and SerB activity in small shake-flask cultivations. The screening strain used was AeomA, meaning that the only EamA activity in the production strain would stem from the EamA-SerB fusion protein. A control expressing serB and eamA from separate promoters on the same plasmid was included as a control, and an industrial L-serine producing strain was included as a reference. Screening was done in MOPS buffered media supplemented with 15 g / L of glucose. The involved strains were precultured in 2xYT media supplemented with 50 pg / mL kanamycin. The following day, 200 pL of preculture was used to inoculate 20 mL MOPS minimal media. Growth was monitored by measuring OD600, and supernatant was harvested for analysis of L-serine production by HPLC. As seen in figure 13, high yields of L-serine production were observed for the strain expressing the EamA-SerB fusion protein after 24 h, indicating both functional EamA and SerB components, whose fusion resulted in a 36% yield increase compared to the industrial production reference, and an almost doubling of yield compared to the strain expressing serB and eamA separately. This is the first case of polypeptide fusions being successful on EamA-like proteins and indicates that co-localization of the L-serine pathway to EamA has benefitted production of L-serine.
[0187] To validate the results, the EamA-SerB fusion strains, combined with beneficial EamA mutations, were tested in 1 L fed-batch fermentation setups. The results, shown in Figure 14, demonstrate the ability of the EamA-SerB fusion protein to improve L-serine production. When combined with the use of improved EamA mutations, the beneficial effects were further exaggerated. The EamA-SerB fusion alone contributed almost equally to the use of the EamA(M6) mutant in terms of production. When combined, the best producing L-serine strain was produced.
[0188] Example 6: Overexpression of EcEamA to improve production of S-sulfocysteine
[0189] EamA has been previously shown to transport the common amino acids L-serine and L-cysteine across the cell membrane. EamA has also been reported to export O-acetyl serine, an intermediate in the conversion pathway from L-serine to L-cysteine, and the hydrophilic amino acidsglutamine and asparagine. It was of interest to test if EamA could export additional amino acids to promote production. For this reason, a plasmid overexpressing feedback resistant cysE and native cysM of f. coli MG1655 was constructed and used to test if eamA could be used to drive export of the unnatural amino acid, S-sulfocysteine (SSC).
[0190] SSC is the product of the CysM-catalyzed reaction, involving condensation of O-acetyl serine (OAS) with thiosulfate, supplied externally. A production plasmid for SSC was constructed via USER cloning. pACYC_pBad-beta-dam was amplified in a Phusion U PCR, as described, using oligos ara_UF and ara_UR, and oligos pACYC_UF and pACYC_UR in another reaction. cysE was amplified from the genome of E. coli K-12 MG1655 using Phusion U PCR, using the oligos CysE_UF and CysE_UR. The fragments were assembled using USER cloning as described, generating the plasmid pACYC_pBAD_CysE (seq ID 273). Next, the cysM gene was amplified from the E. coli K-12 MG1655 genome using the oligos cysM_UF and cysM_UR, which was USER cloned into pACYC_ara_cysE, linearized by PCR using oligos pACYC_cysM_UR and cysE_UR.Oligo 88, cysE_UF a tgtcgtgU a aga a ctgga a a ttgtcOligo 89, cysE_UR attagatcccaUccccatactcaaatgOligo 90, ara_UF AACTTACAUattctgcaaaccctatgctacOligo 91, ara_UR ACACGACAUtgaattcctcctgctagcccaOligo 92, pACYC_UF ATGGGAT CTAAUatta acctaggctgctgcca cOligo 93, pACYCJJR atgtaagtUagctcactcattaggcaccOligo 94, cysM_UF agcttggtUgataaaagaaggagacTTCCACatgAGTACATTAGAACAAACAATAGGC Oligo 95, cysM_UR attagatcccaUttaAATCCCCGCCCCCTGGOligo 96, pACYC_cysM_UR ATTtaatgaUattaacctaggctgctgccac
[0191] The S-sulfocysteine production plasmid (SEQ ID 274) was transformed into an E. coli strain used for L-serine production, as described, either carrying no copies of eamA, or a copy of eamA(M6) expressed genomically from the 19 kAU promoter. The resulting strains were co-transformed with a plasmid allowing for L-serine production, allowing for full biosynthesis of SSC from glucose. The strains were grown in MOPS media as described, and the expression of cysEM was induced by the addition of anhydrotetracycline to a concentration of 20 pM during mid-exponential phase. Thiosulfate, used as substrate in the CysE-catalyzed reaction, was added together with inducer to a concentration of 30 mM. After 24 hours of growth, the supernatant was collected and analyzed for SSC on HPLC. The resulting SSC titers are shown in Figure 15, showing that overexpression of eamA strongly drove the production of SSC. This indicates that mutant EamA also is capable of exporting SSC from the E. coli, which has never been demonstrated to date, and, given the electrochemical and physiochemical property differences between the natural substrates of EamA, and of SSC, was unexpected.
Claims
1. Claims1. A transporter polypeptide which has at least 50% sequence identity to a polypeptide of EamA of SEQ ID NO: 4, or an ortholog or paralog thereof, wherein the transporter polypeptide has one or more amino acid mutations relative to the polypeptide of EamA.
2. The transporter polypeptide of claim 1, wherein the transporter polypeptide when comprised in a host cell has enhanced activity of substrate transport across a cell membrane relative to EamA of SEQ ID NO: 4.
3. The transporter polypeptide of any one of the preceding claims, comprising a structural domain defining a binding pocket for binding a substrate, such as an amino acid, said structural domain comprising amino acid sequences having at least 60% sequence identity to the amino acid sequence defined by amino acid residues 15-17, 19-20, 39, 41-44, 66-76, 79, 89-90, 92-97, 147-148, 151-152, 154-156, 178, 189, 225, 229, 252, 254-256, and 259 of SEQ ID NO: 4, and wherein the polypeptide when expressed in a host cell is capable of transporting the substrate across a cell membrane.
4. The transporter polypeptide of any of the preceding claims, comprising a structural domain defining a binding pocket for binding a substrate, such as an amino acid, wherein said structural domain is defined by one, or more, or all of amino acid residues 15-17, 19-20, 39, 41-44, 66-76, 79, 89-90, 92-97, 147-148, 151-152, 154-156, 178, 189, 225, 229, 252, 254-256, and 259 of the transporter polypeptide, wherein the polypeptide when expressed in a host cell is capable of transporting the substrate across a cell membrane.
5. The transporter polypeptide of claim 4, wherein said structural domain comprises one or more of amino acid residues 38 to 43, such as amino acid residue 39 of the transporter polypeptide.
6. The transporter polypeptide of any one of the preceding claims, comprising a plurality of alphahelices when part of a cell membrane.
7. The transporter polypeptide of claim 6, wherein the plurality of alpha-helices comprises 10 alphahelices separated by interhelical loops.
8. The transporter polypeptide of any of claims 6-7, wherein the plurality of alpha-helices comprises alpha-helices TM1, TM2, TM3, TM4, TM5, TM6, TM7, TM8, TM9, and TM10 each separated byinterhelical loops.
9. The transporter polypeptide of any of claims 6-8, wherein the transporter polypeptide when part of a cell membrane comprises one or more of:11.a) an alpha-helix TM1 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 6 to 23 of SEQ ID NO: 4;12.b) an alpha-helix TM2 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 33 to 51 of SEQ ID NO: 4;13.c) an alpha-helix TM3 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 61 to 81 of SEQ ID NO: 4;14.d) an alpha-helix TM4 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 87 to 107 of SEQ ID NO: 4;15.e) an alpha-helix TM5 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 117 to 132 of SEQ ID NO: 4;16.f) an alpha-helix TM6 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 145 to 160 of SEQ ID NO: 4;17.g) an alpha-helix TM7 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 177 to 195 of SEQ ID NO: 4;18.h) an alpha-helix TM8 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 213-233 of SEQ ID NO: 4;19.i) an alpha-helix TM9 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 244-259 of SEQ ID NO: 4;20.j) an alpha-helix TM10 comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 272-287 of SEQ ID NO: 4; and21.k) one or more interhelical loops comprising an amino acid sequence having at least 60% sequence identity to the amino acid sequence defined by positions 1-5, 24-32, 52-60, 82-86, 108-116, 133- 144, 161-176, 196-212, 234-243, 260-271, and 288-299 of SEQ ID NO: 4.
10. The transporter polypeptide of any of claims 7-9, wherein the one or more interhelical loops comprises amino acid sequences having at least 60% sequence identity to the amino acid sequence defined by amino acid residues 1-5, 24-32, 52-60, 82-86, 108-116, 133-144, 161-176, 196-212, 234-243, 260-271, and 288-299 of SEQ ID NO: 4.
11. The transporter polypeptide of any of claims 7-10, wherein the one or more interhelical loopscomprise one or more mutations selected from the group consisting of: P57X, L58X, L60X, M84X, F108X, L112X, H113X, G137X, V140X, S169X, V174X, S199X, I209X, L262X, L267X, K296X, and S299X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ. ID NO: 4.
12. The transporter polypeptide of any of claims 7-11, wherein the one or more interhelical loops comprise one or more mutations selected from the group consisting of:25.a) P57X, wherein X is S;26.b) L58X, wherein X is any one of V, F, and M;27.c) L60X, wherein X is any one of V, W, and R;28.d) M84X, wherein X is any one of I and L;29.e) F108X, wherein X is any one of L, and Y;30.f) L112X, wherein X is any one of M and P;31.g) H113X, wherein X is any one of N, T, P, Y, D, E, Q, and R;32.h) G137X, wherein X is any one of R, T, E, and S;33.i) V140X, wherein X is any one of A, E, and L;34.j) S169X, wherein X is any one of C, Y, E, and P;35.k) V174X, wherein X is any one of E and A;36.l) S199X, wherein X is any one of Y, T, C, D, G, A, and P;37.m) I209X, wherein X is any one of N and S;38.n) L262X, wherein X is any one of V, W, G, F, K, M, Q, S, and G;39.o) L267X, wherein X is any one of I, V, F, and A;40.p) K296X, wherein X is any one of V, M, L, R; and41.q) S299X, wherein X is any one of N, A, and R.
13. The transporter polypeptide of any of claims 7-10, wherein the interhelical loops are defined by one or more amino acid residues 1-5, 24-32, 52-60, 82-86, 108-116, 133-144, 161-176, 196-212, 234-243, 260-271, and 288-299 of the transporter polypeptide.
14. The transporter polypeptide of any of claims 8-10, wherein the one or more mutations are in the plurality of alpha-helices, the interhelical loops, and / or in the binding pocket.
15. The transporter polypeptide of any of claims 3-14, wherein the binding pocket comprises one or more mutations.
16. The transporter polypeptide of any of claims 3-15, wherein the binding pocket comprises one or more mutations selected from the group consisting of: V15X, N19X, A71X, F73X, L76X, and T225X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
17. The transporter polypeptide of any of claims 3-16, wherein the binding pocket comprises one or more mutations selected from the group consisting of:46.a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E;47.b) N19X, wherein X is any one of T, K, Y, S, F, C, and I;48.c) A71X, wherein X is S;49.d) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;50.e) L76X, wherein X is R; and51.f) T225X, wherein X is any one of I and M.
18. The transporter polypeptide of any of claims 3-17, wherein the binding pocket comprises one or more mutations selected from the group consisting of:53.a) N19X, wherein X is any one of T, K, Y, S, F, C, and I;54.b) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;55.c) L76X, wherein X is R; and56.d) T225X, wherein X is any one of I and M.
19. The transporter polypeptide of any of claims 8-18, wherein the alpha-helix TMl comprises one or more mutations selected from the group consisting of: V15X, and N19X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
20. The transporter polypeptide of any of claims 8-19, wherein the alpha-helix TMl comprises one or more mutations selected from the group consisting of:59.a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E; and60.b) N19X, wherein X is any one of T, K, Y, S, F, C, and I.
21. The transporter polypeptide of any of claims 8-20, wherein the alpha-helix TM2 comprises one or more mutations selected from the group consisting of: V38X, N46X, and V51X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
22. The transporter polypeptide of any of claims 8-21, wherein the alpha-helix TM2 comprises one ormore mutations selected from the group consisting of:63.a) L38X, wherein X is S;64.b) P46X, wherein X is any one of A, S, and L; and65.c) V51X, wherein X is any one of G, L, R, and D.
23. The transporter polypeptide of any of claims 8-22, wherein the alpha-helix TM3 comprises one or more mutations selected from the group consisting of: A71X, F73X, L76X, and C78X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
24. The transporter polypeptide of any of claims 8-23, wherein the alpha-helix TM3 comprises one or more mutations selected from the group consisting of:68.a) A71X, wherein X is S;69.b) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;70.c) L76X, wherein X is R; and71.d) C78X, wherein X is A.
25. The transporter polypeptide of any of claims 8-24, wherein the alpha-helix TM4 comprises one or more mutations selected from the group consisting of: T100X, M102X, L103X, F106X, and T107X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
26. The transporter polypeptide of any of claims 8-25, wherein the alpha-helix TM4 comprises one or more mutations selected from the group consisting of:74.a) T100X, wherein X is any one of S, W, I, and A;75.b) M102X, wherein X is any one of V, R, I, T, and A;76.c) L103X, wherein X is any one of A, S, P, and F;77.d) F106X, wherein X is any one of L, P, S, and Q; and78.e) T107X, wherein X is any one of S, P, L, V, A, I, and F.
27. The transporter polypeptide of any of claims 8-26, wherein the alpha-helix TM5 comprises one or more mutations selected from the group consisting of: L117X, L122X, and G126X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
28. The transporter polypeptide of any of claims 8-27, wherein the alpha-helix TM5 comprises one or more mutations selected from the group consisting of:a) L117X, wherein X is any one of V, W, G, A, and F;81.b) L122X, wherein X is any one of F, P, and S; and82.c) G126X, wherein X is any one of V, A, S, N, and P.
29. The transporter polypeptide of any of claims 8-28, wherein the alpha-helix TM7 comprises one or more mutations selected from the group consisting of: S181X, and F190X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
30. The transporter polypeptide of any of claims 8-29, wherein the alpha-helix TM7 comprises one or more mutations selected from the group consisting of:85.a) S181X, wherein X is any one of G and R; and86.b) F190X, wherein X is any one of P, L, and S.
31. The transporter polypeptide of any of claims 8-30, wherein the alpha-helix TM8 comprises one or more mutations selected from the group consisting of: M218X, L220X, T225X, I226X, and V227X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
32. The transporter polypeptide of any of claims 8-31, wherein the alpha-helix TM8 comprises one or more mutations selected from the group consisting of:89.a) M218X, wherein X is any one of R, I, T, L, V, Y, and A;90.b) L220X, wherein X is M;91.c) T225X, wherein X is any one of I and M;92.d) I226X, wherein X is any one of V and M; and93.e) V227X, wherein X is any one of F, M, L, K, and G.
33. The transporter polypeptide of any of claims 8-32, wherein the alpha-helix TM9 comprises one or more mutations selected from the group consisting of: A257X, and A258R, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
34. The transporter polypeptide of any of claims 8-33, wherein the alpha-helix TM9 comprises one or more mutations selected from the group consisting of:96.a) A257X, wherein X is any one of S, P, L, E, Q, G, and D; and97.b) A258R, wherein X is any one of R, C, F, I, T, and M.
35. The transporter polypeptide of any of claims 8-34, wherein the alpha-helix TM10 comprises one or more mutations selected from the group consisting of: M279X, and N285X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
36. The transporter polypeptide of any of claims 8-35, wherein the alpha-helix TM10 comprises one or more mutations selected from the group consisting of:99.a) M279X, wherein X is any one of V, R, and W; and100.b) N285X, wherein X is any one of K, H, V, M, L, A, I, D, and S.
37. The transporter polypeptide of any one of the preceding claims, wherein the one or more amino acid mutations are selected from the group consisting of: V15X, N19X, L38X, P46X, V51X, P57X, L58X, L60X, A71X, F73X, L76X, C78X, F82X, M84X, A86X, T100X, M102X, L103X, F106X, T107X, F108X, L112X, H113X, Q116X, L117X, L122X, G126X, G137X, V140X, S169X, V174X, S181X, F190X, S199X, I209X, M218X, L220X, T225X, I226X, V227X, A257X, A258X, L262X, L267X, M279X, N285X, K296X, and S299X, wherein X is any amino acid other than the corresponding amino acid residue in SEQ ID NO: 4.
38. The transporter polypeptide of any one of the preceding claims, wherein the transporter polypeptide comprises a plurality of amino acid mutations.
39. The transporter polypeptide of any of claims 37-38, wherein the transporter polypeptide comprises from 1 to 17 of the amino acid mutations, such as from 2 to 6, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.
40. The transporter polypeptide of any one of the preceding claims, wherein the transporter polypeptide has at least 60% sequence identity, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the polypeptide EamA of SEQ ID NO: 4.
41. The transporter polypeptide of any one of the preceding claims, wherein the one or more amino acid mutations are selected from the group consisting of:106.a) V15X, wherein X is any one of G, L, F, K, C, I, T, and E;107.b) N19X, wherein X is any one of T, K, Y, S, F, C, and I;108.c) L38X, wherein X is S;109.d) P46X, wherein X is any one of A, S, and L; e) V51X, wherein X is any one of G, L, R, and D;110.f) P57X, wherein X is S;111.g) L58X, wherein X is any one of V, F, and M;112.h) L60X, wherein X is any one of V, W, and R;113.i) A71X, wherein X is S;114.j) F73X, wherein X is any one of G, I, C, L, S, T, A, and W; k) L76X, wherein X is R;115.l) C78X, wherein X is A;116.m) F82X, wherein X is any one of S and L;117.n) M84X, wherein X is any one of I and L;118.o) A86X, wherein X is V;119.p) T100X, wherein X is any one of S, W, I, and A;120.q) M102X, wherein X is any one of V, R, I, T, and A;121.r) L103X, wherein X is any one of A, S, P, and F;122.s) F106X, wherein X is any one of L, O, S, and Q;123.t) T107X, wherein X is any one of S, P, L, V, A, I, and F; u) F108X, wherein X is any one of L, and Y;124.v) L112X, wherein X is any one of M and P;125.w) H113X, wherein X is any one of N, T, P, Y, D, E, Q, and R; x) Q116X, wherein X is any one of L, A, and P;126.y) L117X, wherein X is any one of V, W, G, A, and F;127.z) L122X, wherein X is any one of F, P, and S;128.aa) G126X, wherein X is any one of V, A, S, N, and P;129.bb) G137X, wherein X is any one of R, T, E, and S;130.cc) V140X, wherein X is any one of A, E, and L;131.dd) S169X, wherein X is any one of C, Y, E, and P;132.ee) V174X, wherein X is any one of E and A;133.ff) S181X, wherein X is any one of G and R;134.gg) F190X, wherein X is any one of P, L, and S;135.hh) S199X, wherein X is any one of Y, T, C, D, G, A, and P; ii) I209X, wherein X is any one of N and S;136.jj) M218X, wherein X is any one of R, I, T, L, V, Y, and A; kk) L220X, wherein X is M;137.ll) T225X, wherein X is any one of I and M; mm) I226X, wherein X is any one of V and M;138.nn) V227X, wherein X is any one of F, M, L, K, and G;139.oo) A257X, wherein X is any one of S, P, L, E, Q, G, and D;140.pp) A258X, wherein X is any one of R, C, F, I, T, and M;141.qq) L262X, wherein X is any one of V, W, G, F, K, M, Q, S, and G;142.rr) L267X, wherein X is any one of I, V, F, and A;143.ss) M279X, wherein X is any one of V, R, and W;144.tt) N285X, wherein X is any one of K, H, V, M, L, A, I, D, and S;145.uu) K296X, wherein X is any one of V, M, L, R, and N; and146.vv) S299X, wherein X is any one of N, A, and R.
42. The transporter polypeptide of any one of the preceding claims, wherein the one or more amino acid mutations are selected from the group consisting of:148.a) F73X, wherein X is any one of G, I, C, L, S, T, A, and W;149.b) F108X, wherein X is any one of L, and Y;150.c) S181X, wherein X is any one of G and R;151.d) L22OX, wherein X is M;152.e) L267X, wherein X is any one of I, V, F, and A; and153.f) M279X, wherein X is any one of V, R, and W.
43. The transporter polypeptide of any one of the preceding claims, wherein the one or more amino acid mutations are selected from the group consisting of: L38S, F82L, A86V, F108L, H113R, G137S, V140A, S169P, V174A, S181G, S199P, L220M, A257S, L267I, M279V, N285I, and S299R.
44. The transporter polypeptide of claim 43, wherein the transporter polypeptide comprises one or more of the amino acid mutations selected from the group consisting of: L38S, F82L, A86V, H113R, G137S, S169P, V174A, S181G, S199P, A257S, M279V, N285I, and S299R.
45. The transporter polypeptide according to any one of the preceding claims, wherein the transporter polypeptide comprises the amino acid mutations of F108L, V140A, S181G, L220M, L267I, and M279V.
46. The transporter polypeptide according to any one of the preceding claims, wherein the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in any one of SEQ. ID NO: 5-122, for example wherein the transporter polypeptide has at least 70%, such as at least80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 5-122.
47. The transporter polypeptide according to any one of the preceding claims, wherein the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 74-87, for example wherein the transporter polypeptide has at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in any one of SEQ ID NO: 74-87.
48. The transporter polypeptide according to any one of the preceding claims, wherein the transporter polypeptide has at least 60% sequence identity to the amino acid sequence comprised in SEQ ID NO: 85 or SEQ ID NO: 82, for example wherein the transporter polypeptide has at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence comprised in SEQ ID NO: 85 or in SEQ ID NO: 82, for example wherein the transporter polypeptide is SEQ ID NO: 85 or is SEQ ID NO: 82.
49. The transporter polypeptide according to any one of the preceding claims, wherein the transporter polypeptide is encoded by a polynucleotide having at least 50% identity to a polynucleotide comprised in any one of SEQ ID NO: 292-296, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the polynucleotide comprised in any one of SEQ ID NO: 292-296.
50. A genetically modified host cell comprising a heterologous polynucleotide encoding a transporter polypeptide capable of exporting a substrate, such as an amino acid across a cell membrane, such as out of a cell.
51. The genetically modified host cell of claim 50, wherein the transporter polypeptide is derived from E. coli.
52. The genetically modified host cell of claim 51, wherein the cell is of a fungus or a bacterium.
53. The genetically modified host cell of claim 52, wherein the cell is of a bacterium of the order of enterobacterales.
54. The genetically modified host cell of any one of claims 52-53, wherein the cell is of a Gram-negative bacterium.
55. The genetically modified host cell of claim 54, wherein the Gram-negative bacterium is of a genus selected from: Shigella, Citrobacter, Escherichia, Franconibacter, Klebsiella, Cedecea, Raoultella, Buttiauxella, Scandinavium, Pseudocitrobacter, Leclercia, Enterobacter cloacae, and Silvania.
56. The genetically modified host cell of any of claim 51 to 55, wherein the cell is E. coli.
57. The genetically modified host cell of claim 52, wherein the cell is of a Gram-positive bacterium.
58. The genetically modified host cell of claim 57, wherein the cell is of a bacterium of the order of Mycobacteriales.
59. The genetically modified host cell of claim 58, wherein the cell is of Corynebacterium Glutamicum.
60. The genetically modified host cell of claim 52, wherein the cell is of a filamentous fungus.
61. The genetically modified host cell of claim 60, wherein the cell is of a white muscardine disease fungus, such as Beauveria Bassiana D1-5.
62. The genetically modified host cell of any one of claims 52-53, wherein the cell is of a Gram-negative bacterium.
63. The genetically modified host cell of claim 54, wherein the Gram-negative bacterium is of a genus selected from: Shigella, Citrobacter, Escherichia, Franconibacter, Klebsiella, Cedecea, Raoultella, Buttiauxella, Scandinavium, Pseudocitrobacter, Leclercia, Enterobacter cloacae, and Silvania.
64. The cell of any of claims 51 to 56, wherein the cell comprises a polypeptide as defined in any one of claims 1-49.
65. The genetically modified host cell of any of claims 51 to 64, wherein the polynucleotide encoding the transporter polypeptide comprises a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the polynucleotide comprised in any one of SEQ ID NO: 292-296.
66. The genetically modified host cell of any of claims 50 to 65, wherein the transporter polypeptide comprises a plurality of alpha-helices separated by interhelical loops, wherein the alpha-helices and / or the interhelical loops comprise at least one mutation increasing activity of export of a substrate, such as an amino acid, such as serine.
67. The genetically modified host cell of claim any of claims 50-66, wherein the transporter polypeptide and / or the polynucleotide encoding said transporter polypeptide is heterologous to the cell.
68. The genetically modified host cell of any preceding claim, further comprising an operative metabolic pathway comprising one or more polypeptides capable of producing the substrate, such as the amino acid, for example serine, from one or more precursors.
69. The genetically modified host cell of claim 68, wherein the operative metabolic pathway comprises one or more polypeptides selected from:179.a) a D-3-phosphoglycerate dehydrogenase (PGDH) capable of converting 3-phospho-D-glycerate into 3-phosphooxypyruvate; and180.b) a 3-phosphoserine aminotransferase (PSAT) capable of converting 3-phosphooxypyruvate and L-glutamate into O-phospho-L-serine and L-glutamine; and181.c) a phosphoserine phosphatase (PSPH) converting O-phospho-L-serine into L-serine.182.d) a serine acetyltransferase (SAT) converting L-serine into O-acetyl-serine183.e) a cysteine synthase B converting O-acetyl-serine into S-sulfo-cysteine70. The genetically modified host cell of claim 69, wherein the corresponding:185.f) D-3-phosphoglycerate dehydrogenase (PGDH) has at least 70% identity to the amino acid sequence of any one of SEQ ID NO: 285 or SEQ ID NO: 287; and / or186.g) 3-phosphoserine aminotransferase (PSAT) has at least 70% identity to the amino acid sequence of SEQ ID NO: 289; and / or h) phosphoserine phosphatase (PSPH) has at least 70% identity to the amino acid sequence of SEQ ID NO: 291; and / or187.i) serine acetyltransferase (SAT) has at least 70% identity to the amino acid sequences of SEQ ID 297 and 301; and / or188.j) cysteine synthase B has at least 70% identity to the amino acid sequence of SEQ ID 29971. The genetically modified host cell of any preceding claim comprising one or more polynucleotides selected from the group of:190.a) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a D-3-phosphoglycerate dehydrogenase (PGDH) comprised in any one of SEQ ID NO: 284 or SEQ ID NO: 286;191.b) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a 3-phosphoserine aminotransferase (PSAT) comprised in SEQ ID NO: 288; and192.c) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a phosphoserine phosphatase (PSPH) comprised in SEQ ID NO:
290. d) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a serine acetyltransferase comprised in SEQ ID NO: 298 or SEQ ID NO: 302.193.e) a polynucleotide which is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to a polynucleotide encoding a cysteine synthase B comprised in SEQ ID NO: 300.
72. The genetically modified host cell of any preceding claim, wherein a plurality of polypeptides comprised in the operative biosynthetic metabolic pathway are heterologous to the host cell.
73. The genetically modified host cell of any preceding claim, wherein one or more native or endogenous genes of the cell is attenuated, disrupted and / or deleted.
74. The genetically modified host cell of any preceding claim, comprising one or more polypeptides capable of producing the substrate, such as the amino acid, for example serine, from one or more precursors, co-localized to the transporter polypeptide.
75. The genetically modified host cell of any preceding claim, comprising the operative metabolic pathway as defined in any one of claims 68-71 co-localized to the transporter polypeptide.
76. The genetically modified host cell of any preceding claim, comprising the operative metabolic pathway as defined in any one of claims 68-71 as soluble polypeptides in the genetically modified host cell.
77. The genetically modified host cell of any preceding claim further genetically modified to provide an increased amount of the substrate, such as the amino acid, for example serine.
78. The genetically modified host cell of any preceding claim further genetically modified to exhibit increased tolerance towards one or more substrates, intermediates, or product molecules from the operative metabolic pathway producing the substrate, such as the amino acid, for example serine, optionally wherein the operative metabolic pathway is as defined in any one of claims 68-71.
79. A polynucleotide construct comprising a polynucleotide sequence encoding the transporter polypeptide of any of claims 1-49, operably linked to one or more control sequences.
80. The polynucleotide construct of claim 79 wherein the control sequence is heterologous to the polynucleotide.
81. The cell of any of claims 50-78 comprising the polynucleotide construct of any of claims 79 to 80.
82. A cell culture, comprising the cell of any of claims 50-78, or 81, and a growth medium.
83. A method for producing a substrate, such as an amino acid, for example serine comprisinga) culturing the cell culture of claim 82 at conditions allowing the cell to produce the substrate; and205.b) optionally recovering and / or isolating the substrate.
84. The method of claim 83, wherein the recovering and / or isolation step comprises separating a liquid phase of the cell or cell culture from a solid phase of the cell or cell culture to obtain a supernatant comprising the substrate and subjecting the supernatant to one or more steps selected from:207.a) contacting the supernatant with one or more adsorbent resins in order to obtain at least a portion of the produced substrate;208.b) contacting the supernatant with one or more ion exchange or reversed-phase chromatography columns in order to obtain at least a portion of the substrate; and209.c) crystallizing or extracting the substrate from the supernatant; and210.d) evaporating the solvent of the supernatant to concentrate or precipitate the substrate; thereby recovering and / or isolating the substrate.
85. The method of claims 83 to 84, further comprising one or more elements selected from:212.a) culturing the cell culture in a nutrient medium;213.b) culturing the cell culture under aerobic or anaerobic conditions214.c) culturing the cell culture under agitation;215.d) culturing the cell culture at a temperature of between 25 to 50 °C;216.e) culturing the cell culture at a pH of between 3-9; and217.f) culturing the cell culture for between 10 hours to 30 days.
86. A fermentation composition comprising the cell culture of claim 82 and the substrate, such as the amino acid, for example serine, comprised therein.
87. The fermentation composition of claim 86, wherein at least 50%, such as at least 75%, such as at least 95%, such as at least 99% of the cells are lysed.
88. The fermentation composition of claims 86 to 87, wherein at least 50%, such as at least 75%, such as at least 95%, such as at least 99% of solid cellular material has separated from the liquid.
89. The fermentation composition of claim 86 to 88, further comprising one or more compoundsselected from trace metals, vitamins, salts, yeast nitrogen base, carbon source, YNB, and / or amino acids of the fermentation; wherein the concentration of the substrate is at least 1 mg / kg composition.
90. A composition comprising the fermentation composition of any of claims 86-89, and one or more carriers, agents, additives and / or excipients.