Extracellular vesicle comprising surface FGF21 and internal mirna, and use thereof
Recombinant extracellular vesicles with surface-bound FGF21 and encapsulated miRNA address the limitations of current treatments by efficiently delivering therapeutic agents to the liver, improving NASH symptoms and avoiding side effects.
Patent Information
- Application Number
- PCT/KR2025/006345
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-06
- Filing Date
- 2025-05-12
- Publication Date
- 2026-05-15
AI Technical Summary
Current treatments for non-alcoholic steatohepatitis (NASH) are limited due to the involvement of multiple pathways in its pathogenesis, and existing drug delivery methods, such as nanoparticles and liposomes, face issues like immunogenicity and toxicity, while FGF21 and miRNAs have challenges in effective delivery and clinical utility.
Development of recombinant extracellular vesicles with FGF21 attached to the surface and miRNA encapsulated inside, designed to target liver diseases like NASH, utilizing a transmembrane domain and linker for FGF21 attachment and optimizing delivery.
The recombinant extracellular vesicles effectively deliver FGF21 and miRNA to the liver, improving steatosis, reducing inflammation and fibrosis, and overcoming bone density side effects, providing a therapeutic option for NASH.
Smart Images

Figure KR2025006345_15052026_PF_FP_ABST
Abstract
Description
Extracellular vesicles containing surface FGF21 and internal MIRNA and their uses
[0001] The present invention relates to a novel extracellular vesicle and its uses.
[0002] Non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH) encompass a series of liver diseases in which fat accumulates in the liver in the absence of almost any alcohol intake. Recently, there has been a proposal to name these diseases metabolic dysfunction-associated steatotic liver disease (MASLD) and metabolic dysfunction-associated steatohepatitis (MASH) to more clearly indicate their association with metabolic dysfunction.
[0003] MASLD is the most common liver disease, with a global incidence rate reaching 25%; despite its high prevalence and severe health impact, only one drug has been approved for treatment. The slow pace of therapeutic development is attributed to the involvement of multiple pathways in the disease's pathogenesis, and according to the so-called "multiple hit theory," four or more complex mechanisms are known to contribute to its development. Consequently, there is growing interest in combination therapies that target multiple mechanisms simultaneously.
[0004] Recently, nanoparticles (NPs) have emerged as promising carriers capable of simultaneously delivering various drugs. Due to their small size (10–500 nm), nanoparticles can penetrate deep into tissues and can be designed to easily transport various substances. Furthermore, they are primarily delivered to organs with well-developed reticuloendothelial systems, such as the liver, spleen, and kidneys. Therefore, Epaxal, designed to treat hepatitis A and severe invasive fungal infections ® and Abelcet ® Early approved nanoparticles such as liposomes have been primarily used for liver and infectious diseases. However, unlike bio-derived materials, liposomes and other chemically synthesized nanoparticles can be immunogenic or toxic, and these side effects can induce excessive or unnecessary immune responses in various diseases.
[0005] On the other hand, cell-derived extracellular vesicles (EVs) are being increasingly studied as drug delivery vehicles due to their low toxicity and unique ability to efficiently transport functional biomolecules between cells. While unmodified EVs have limited therapeutic potential, engineered EVs that maximize therapeutic effects by actively incorporating functional substances or passively encapsulating them are emerging as new drug delivery vectors.
[0006] Fibroblast growth factor 21 (FGF21) is a metabolic hormone primarily produced in the liver and induced during fasting or stress. FGF21 plays a crucial role in regulating glucose and lipid homeostasis by interacting with a dimeric receptor complex composed of the FGF receptor (FGFR) and β-klotho, which are expressed in the liver, adipose tissue, pancreas, and brain, and partially expressed in skeletal muscle and bone. Over the past decade, there has been a focus on developing FGF21 derivatives or specific FGF21 receptor agonists as therapeutic agents for metabolic disorders such as type 2 diabetes, obesity, and particularly MASLD / MASH; however, the clinical utility of the FGF21 peptide itself has been limited due to issues such as high aggregation and bone-related side effects. Overcoming these limitations through FGF21 engineering could enable the effective application of FGF21 in the treatment of MASH.
[0007] MicroRNAs (miRNAs) are known to play a significant role in disease biology as post-transcriptional repressors of target gene expression, particularly contributing to the onset and progression of liver disease. Among these, miR-223 is a highly conserved miRNA that regulates inflammation and fibrosis and plays an important role in both mice and humans. However, there are significant challenges in effectively delivering miRNAs due to factors such as reduced intracellular uptake, difficulty in endosome escape, immunogenicity, degradation in the bloodstream, and rapid renal excretion.
[0008] The inventors have conducted research efforts to develop a MASH therapeutic agent and completed the present invention by confirming that recombinant extracellular vesicles, in which FGF21 is attached to the surface and miRNA is encapsulated inside, are effective for the prevention, improvement, or treatment of liver diseases including MASH.
[0009] One aspect is providing extracellular vesicles with FGF21 (fibroblast growth factor 21) attached to their surface.
[0010] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of liver disease comprising the above-mentioned extracellular vesicles.
[0011] Another aspect is to provide a health functional food for the prevention or treatment of liver disease or for improving liver function, comprising the above-mentioned extracellular vesicles.
[0012] Another aspect is to provide a feed composition for the prevention or treatment of liver disease comprising the above-mentioned extracellular vesicles; or for improving liver function.
[0013] Another aspect provides a method for preventing, improving, or treating liver disease or liver function, comprising the step of administering an effective amount of the extracellular vesicles to an individual in need thereof.
[0014] Another aspect is to provide the use of the said extracellular vesicles for the prevention, improvement, or treatment of liver disease or liver function.
[0015] Another aspect is to provide the use of the said extracellular vesicles for use in the manufacture of preparations for the prevention, improvement, or treatment of liver disease or liver function.
[0016] One aspect provides extracellular vesicles with FGF21 (fibroblast growth factor 21) attached to their surface.
[0017] In this specification, 'FGF21 (fibroblast growth factor 21)' is a member of the fibroblast growth factor family and is a hormone primarily produced in the liver that plays an important role in regulating metabolism and maintaining energy balance. It is induced during fasting or stress and regulates glucose and lipid homeostasis by interacting with a bihoming receptor complex composed of FGF receptor (FGF receptor; FGFR) and β-klotho, which are expressed in the liver, adipose tissue, pancreas, brain, and partially in skeletal muscle and bone.
[0018] In this specification, "extracellular vesicle (EV)" refers to a nano-sized membrane-bound structure and means any type of membrane-bound vesicle that is generated outside the cell, formed in the endosome compartment of most eukaryotic cells. Terms such as “extracellular vesicle,” “extracellular vesicle,” and “vesicle or vesicle released outside the cell” are used interchangeably, and extracellular vesicles may include a number of different species, such as exosomes, ectosomes, microvesicles, microparticles, and exosome-like vesicles. The extracellular vesicles may originate from a plasma membrane or multivesicular bodies (MVBs) and be released or secreted outside the cell.
[0019] The above extracellular vesicles are recombinant extracellular vesicles (recombinant EVs) with FGF21 linked to their surface. This can refer to engineered extracellular vesicles, which are the opposite of naturally produced EVs. They refer to artificial extracellular vesicles manufactured by a recombinant method in which a foreign gene is introduced into a host cell to produce a foreign protein expressed by said foreign gene, thereby containing the said foreign protein inside or on its membrane surface.
[0020] The diameter of the extracellular vesicle may be about 30 nm to about 500 nm, about 30 nm to about 400 nm, about 30 nm to about 300 nm, about 30 nm to about 200 nm, about 50 nm to about 200 nm, about 50 nm to about 180 nm, about 75 nm to about 180 nm, or about 100 nm to 150 nm.
[0021] In one embodiment, the FGF21 of the present invention may include the amino acid sequence described as SEQ ID NO. 1, or an amino acid sequence having 80% or more homology or identity therewith, but is not limited thereto. Specifically, the amino acid may include SEQ ID NO. 1 and an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 1. Furthermore, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is included within the scope of the present application, provided that the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein.
[0022] The phospholipid bilayer constituting the extracellular vesicle includes a transmembrane domain, and the FGF21 can be connected to the extracellular vesicle through the transmembrane domain.
[0023] In this specification, 'transmembrane domain' or 'transmembrane domain' refers to a domain located on the cell membrane that connects the extracellular domain and the intracellular domain. The transmembrane domain in this specification refers to a region that serves to connect and fuse the antibody and antigen binding fragments with the extracellular vesicles and to immobilize the antibody and antigen binding fragments. The transmembrane domain may be derived from natural, synthetic, semi-synthetic, or recombinant sources.
[0024] Typically, transmembrane domains exist in various types of transmembrane proteins, and these transmembrane proteins include various immune-related cell surface proteins such as transporters, ion channels, GPCRs, receptor tyrosine kinases (RTKs), T cell receptors, and clusters of differentiation (CDs). Transmembrane domains include single-pass domains found in RTKs and 7-pass domains found in GPCRs. These transmembrane proteins are classified into Type 1 to Type 4 depending on their topology, that is, whether the N-terminus is located in the cytoplasm or outside the cell. Specifically, Type 1 transmembrane proteins have the N-terminus located outside the cell and the cytoplasmic domain portion located in the cytoplasm, whereas Type 2 transmembrane proteins have the C-terminus located outside the cell and the N-terminus portion becoming the cytoplasmic domain. Type III and Type IV transmembrane proteins are a type of anchor protein. In Type III transmembrane proteins, the C-terminus forms an extracellular domain, while the N-terminus is adjacent to the cell membrane and does not form a specific domain. In Type IV transmembrane proteins, although the C-terminus is located outside the cytoplasm, the terminal portion is adjacent to the cell membrane and does not form an extracellular domain; conversely, the N-terminus forms a cytoplasmic domain. Therefore, to present FGF21 outside the cell, it is preferable to use the transmembrane domain of Type I transmembrane proteins.As such type 1 transmembrane domains, transmembrane domains of RTKs, transmembrane domains of immune receptors (beta or zeta chains) such as TCRs, and transmembrane domains of various CDs (clusters of differentiation), such as CD3ε, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD63, CD64, CD80, CD86, CD134, CD137, or CD154, or parts thereof, may be used.
[0025] In one embodiment, the transmembrane domain may be a transmembrane domain of CD63 or a part thereof. The transmembrane domain may preferably be TM1 (transmembrane domain-1), TM2 (transmembrane domain-2), TM3 (transmembrane domain-3), or TM4 (transmembrane domain-4) of CD63, and more preferably may include CD63 TM3 described as SEQ ID NO. 2, or an amino acid sequence having at least 80% homology or identity therewith, but is not limited thereto. Specifically, the amino acid may include SEQ ID NO. 2 and an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO. 2. Furthermore, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of this application, provided that the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the said protein.
[0026] In one embodiment, the FGF21 may be connected to the transmembrane domain directly or through a linker. Specifically, the FGF21 may be bound to the C-terminus of the transmembrane domain through a linker. The linker may be a short oligopeptide or polypeptide linker, and is not particularly limited in its length or type; any linker known in the art may be applied without limitation.
[0027] The linker may be a rigid linker, a flexible linker, or a combination thereof. The linker can minimize interference between the FGF21 and the transmembrane domain and stabilize the spatial structure.
[0028] The above rigid linker may be a peptide linker having a repeating structure of amino acids composed of glutamic acid (E), alanine (A), or lysine (K). For example, it may be (EK)n, (EAAAK)n, or A(EAAAK)nA, but is not limited thereto. The copy number “n” is any natural number and can be adjusted considering the optimization of the linker.
[0029] The above flexible linker may be a peptide linker having a repeating structure of amino acids composed of glycine (G), serine (S), alanine (A), or proline (P), and more specifically, may be (GS)n, (GGGGS)n, (GGGGA)n, (GGGGP)n, (GGGA)n, (GGS)n, (GSGGS)n, or (GGGS)n, etc. The copy number “n” is any natural number and can be adjusted considering the optimization of the linker.
[0030] In one embodiment, the linker of the present invention may be a linker that repeats EAAAK (SEQ No. 3) or GGGGS (SEQ No. 5) 1 to 10 times, 1 to 5 times, preferably 5 times, or a combination thereof.
[0031] In one embodiment, the extracellular vesicle may further include a fluorescent protein tag. The tag may be included for purposes such as improving the solubility of the recombinant protein, increasing yield, maintaining structural stability, and facilitating easy separation and purification. The fluorescent protein may be located between the FGF21 and the transmembrane domain.
[0032] In one embodiment, the fluorescent protein may be one or more selected from the group consisting of mCherry, DsRed2, mScarlet, mStrawberry, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, mKate2, mNeptune, CFP, GFP, Emerald, Superfolder GFP, TagGFP2, mClover2, mClover3, and mEos2, but is not limited thereto.
[0033] In one embodiment, the fluorescent protein may comprise the amino acid sequence of SEQ ID NO. 4, a part thereof, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with these.
[0034] In one embodiment, the extracellular vesicle may be a recombinant extracellular vesicle connected to a structure having an amino acid sequence described as SEQ ID NO. 6, or an amino acid sequence having 80% or more homology or identity therewith. Specifically, the amino acid may include SEQ ID NO. 6 and an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 6. Furthermore, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is included within the scope of this application, provided that the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein.
[0035] In one embodiment, the extracellular vesicle of the present invention may contain miRNA inside.
[0036] In this specification, 'miR (MicroRNAs; miRNA)' refers to a small non-expressed RNA molecule composed of 21 to 25 nucleotides found in plants, animals, viruses, etc., and is a post-transcriptional inhibitor of target gene expression, such as performing functions like RNA silencing and post-transcriptional gene expression regulation.
[0037] The miRNAs of this specification may include, without limitation, miRNAs that play an important role in disease biology by contributing to the development and progression of liver disease for therapeutic purposes.
[0038] In one embodiment, the miRNA is selected from any one of miR-1, miR-21, miR-26a, miR-27a, miR-27b, miR-29, miR-29a, miR-34a, miR-96-5p, miR-103, miR-107, miR-122, miR-125b, miR-130, miR-130a-3p, miR-146-5p, miR-152, miR-155, miR-192, miR-194, miR-206, miR-214, miR-223, miR-296, miR-451, miR-542-3p, miR-613, and miR-696 for the treatment of metabolic dysfunction-associated steatohepatitis (MASH). It may be possible. Preferably, the miRNA may be miR-223. miR-223 refers to a highly conserved miRNA that regulates inflammation and fibrosis.
[0039] The above miRNA may be miR-3p or miR-5p. For example, miR-223 may be miR-223-3p or miR-223-5p.
[0040] In one embodiment, the miR-223 of the present invention preferably has a nucleotide sequence described as 5'-UGUCAGUUUGUCAAAUACCCCA-3' (3p) (SEQ No. 8) or 5'-CGUGUAUUUGACAAGCUGAGUU-3' (5p) (SEQ No. 9), and may include a nucleotide sequence having 80% or more homology or identity, but is not limited thereto. In addition, it is obvious that miRs having nucleotide sequences in which some sequences are deleted, modified, substituted, or added are also included within the scope of the present application.
[0041] In one embodiment, the recombinant extracellular vesicle of the present invention may be isolated or produced from a protein-producing cell line or mesenchymal stem cell into which a foreign gene has been transfected. The protein-producing cell line is preferably selected from the group consisting of CHO, HKB11, BHK21, HeLa, HEK293, HEK293FT, HT-1080, PER.C6, and F2N78 cell lines, and the mesenchymal stem cell may be a cord-derived, cord blood-derived, bone marrow-derived, placenta-derived, or adipose-derived mesenchymal stem cell, but is not limited thereto.
[0042] The above-mentioned recombinant extracellular vesicle may be prepared through the following steps, but is not limited thereto:
[0043] 1) A step of preparing a first vector comprising a gene encoding FGF21, a gene encoding a linker, and a gene sequence encoding a transmembrane domain;
[0044] 2) A step of preparing a second vector containing the miR-223 nucleotide sequence;
[0045] 3) a step of transforming cells with the first vector and the second vector using a lentivirus; and
[0046] 4) A step of isolating extracellular vesicles from a culture medium in which cells transformed with the first vector and the second vector have been cultured.
[0047] In one embodiment, it is preferable to separate the extracellular vesicles from the culture medium in which the cells were cultured using ultracentrifugation or Tangential Flow Filtration (TFF) after the transformation of the recombinant extracellular vesicles of the present invention in step 3), by isolating the transformed cells using FACS, establishing a stable cell line through an antibiotic selection process, and then separating the extracellular vesicles from the culture medium in which the cells were cultured.
[0048] The recombinant extracellular vesicles of the present invention can improve steatosis and reduce inflammation and fibrosis by means of FGF21 or miR-223.
[0049]
[0050] Another aspect provides a pharmaceutical composition for the prevention or treatment of liver disease comprising the above-mentioned extracellular vesicles.
[0051] The details regarding the extracellular vesicles above also apply to the above composition.
[0052] In this specification, the term “prevention” refers to any act of suppressing or delaying the onset of a disease through the administration of the above composition.
[0053] In this specification, the term “treatment” means any form of treatment that provides effects, including improvement of the individual’s condition (e.g., one or more symptoms), delay of disease progression, delay of symptom onset, or slowing of symptom progression, to an individual suffering from a disease or at risk of developing a disease. Accordingly, “treatment” and “prevention” are not intended to mean the cure or complete elimination of symptoms. “Individual” means a subject requiring treatment for a disease, and more specifically, means mammals such as humans or non-human primates, mice, dogs, cats, horses, and cattle.
[0054] In one embodiment, the liver disease may be any one or more selected from the group consisting of metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic dysfunction-associated steatohepatitis (MASH), alcoholic fatty liver disease (AFLD), alcoholic steatohepatitis (ASH), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and liver fibrosis.
[0055] The composition comprising the recombinant extracellular vesicle of the present invention improves steatosis and reduces inflammation and fibrosis in vitro by means of FGF21 and / or miRNA, and can also exhibit significant effects in animal models exhibiting steatosis, inflammation, and fibrosis. Since the recombinant extracellular vesicle does not exhibit a decrease in bone density, which is a side effect of using FGF21 alone, it has a significant preventive or therapeutic effect on liver diseases, including metabolic disorder-related steatohepatitis.
[0056] The above pharmaceutical composition may include a pharmaceutically acceptable carrier. The term "carrier" is used to mean including excipients, diluents, or adjuvants. The carrier may be selected from the group consisting of, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, physiological saline, buffer solutions such as PBS, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition may include fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, or combinations thereof.
[0057] The above pharmaceutical composition may be prepared in any dosage form according to conventional methods. The composition may be formulated, for example, into an oral dosage form (e.g., powder, tablet, capsule, syrup, pill, or granule) or a parenteral dosage form (e.g., injection).
[0058] Additionally, the above composition may be prepared as a systemic or topical formulation. The pharmaceutical composition may be administered orally, intravenously, intratumorally, intramuscularly, orally, transdermally, mucosally, nasally, intratracheally, subcutaneously, or a combination thereof.
[0059] The above pharmaceutical composition may contain an effective amount of the recombinant extracellular vesicle of the present invention according to one aspect. The term “effective amount” refers to an amount sufficient to produce a preventive or therapeutic effect when administered to an individual requiring prevention or treatment. The effective amount may be appropriately selected by a person skilled in the art depending on the selected cell or individual. It may be determined based on factors including the severity of the disease, the patient’s age, weight, health, gender, the patient’s sensitivity to the drug, the time of administration, the route of administration and elimination rate, the duration of treatment, drugs combined with or used concurrently with the composition used, and other factors well known in the medical field. The effective amount may be about 0.1 μg to about 2 g, about 0.5 μg to about 1 g, about 1 μg to about 500 mg, about 10 μg to about 100 mg, or about 100 μg to about 50 mg per pharmaceutical composition.
[0060] The dosage of the above pharmaceutical composition may be, for example, within the range of about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.1 mg / kg to about 1 mg / kg based on an adult. The administration may be once a day, multiple times a day, or once a week, once every two weeks, once every three weeks, or once every four weeks to once a year.
[0061] Another aspect provides a method for preventing, improving, or treating liver disease or liver function, comprising the step of administering an effective amount of the extracellular vesicles to an individual in need thereof.
[0062] Another aspect provides the use of the above extracellular vesicles for the prevention, improvement, or treatment of liver disease or liver function.
[0063] Another aspect provides the use of the extracellular vesicles for use in the manufacture of preparations for the prevention, improvement, or treatment of liver disease or liver function.
[0064]
[0065] Another aspect provides a health functional food for the prevention or treatment of liver disease or for improving liver function, comprising the above-mentioned extracellular vesicles.
[0066] The above information regarding extracellular vesicles also applies to the above health functional food.
[0067] The above-described health functional food may use the recombinant extracellular vesicle of the present invention alone or in combination with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient mixture may be appropriately determined according to the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the composition of this specification may be added in an amount of 15 parts by weight or less relative to the raw materials. There are no special restrictions on the types of the above-described health functional food. Among the types of health functional foods, beverage compositions may contain various flavoring agents or natural carbohydrates, etc., as additional ingredients, similar to ordinary beverages. The above-described natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as taumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The above health food composition may also contain nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, or combinations thereof. The above health functional food composition may also contain fruit pulp for the production of natural fruit juice, fruit juice beverages, vegetable beverages, or combinations thereof.
[0068] The above health functional food comprises, based on the total weight of the health functional food, 0.00001 wt% to 80 wt%, for example, 0.00001 wt% to 60 wt%, 0.00001 wt% to 40 wt%, 0.00001 wt% to 30 wt%, 0.00001 wt% to 20 wt%, 0.00001 wt% to 10 wt%, 0.00001 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 It may contain exosomes of the present invention in an amount of 30% to 30% by weight, 0.1% to 20% by weight, 0.1% to 10% by weight, or 0.1% to 5% by weight.
[0069]
[0070] Another aspect provides a feed composition for the prevention or treatment of liver disease or for improving liver function, comprising the above-mentioned extracellular vesicles.
[0071] The terms and methods described in the above extracellular vesicles and the above compositions, etc., also apply equally to the above feed compositions.
[0072] The terms and methods described in the above exosomes and compositions, etc., apply equally to the above feed compositions.
[0073] In this specification, the term “feed” may refer to any natural or artificial prescribed food, single meal, etc., or the ingredients thereof, intended for or suitable for animals to eat, consume, and digest. The type of feed is not particularly limited, and feed commonly used in the relevant technical field may be used.
[0074] Non-limiting examples of the above feed include plant-based feeds such as grains, root vegetables, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products, etc.; and animal-based feeds such as proteins, inorganic substances, oils and fats, minerals, oils and fats, single-cell proteins, zooplankton, or food waste.
[0075] The feed composition can be prepared by adding the extracellular vesicles at an appropriate effective concentration range according to various feed manufacturing methods known in the art, and can be used for the purpose of preventing or improving bone diseases.
[0076] In the above feed, the extracellular vesicles may be added to the feed as is or mixed with other feed or feed ingredients, and may be used appropriately according to conventional methods. The mixing amount of the extracellular vesicles may be appropriately determined according to the purpose of use (prevention or improvement of metabolic diseases and improvement of metabolic function).
[0077]
[0078] The present invention is capable of various modifications and may have various embodiments. Specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present invention to specific embodiments, and it should be understood that it includes all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention. In describing the present invention, detailed descriptions of related prior art are omitted if it is determined that such detailed descriptions may obscure the essence of the present invention.
[0079] Extracellular vesicles with FGF21 attached to their surface according to one pattern can improve steatosis and reduce inflammation and fibrosis, and can also alleviate the decrease in bone density that is a side effect of using FGF21 alone, making them useful for the prevention and treatment of liver diseases, including metabolic disorder-related fatty liver hepatitis.
[0080] FIG. 1 is a schematic diagram of an experiment verifying the effect of the engineered EV (223 / F-EVs) of the present invention and a schematic diagram showing the mechanism of MASH treatment thereof.
[0081] Figure 2 is a schematic diagram showing the structure of 223 / F-EVs.
[0082] Figure 3 shows the nanoparticle trace analysis (NTA) results of 223 / F-EVs.
[0083] Figure 4 is a representative transmission electron microscope (TEM) image showing the size distribution and average diameter of 223 / F-EVs.
[0084] Figure 5 shows the results of Western blotting analysis of the levels of FGF21, GM130, Alix, TSG101, and β-actin in control cells or cells expressing miR-223 and FGF21, or EVs secreted from said cells.
[0085] Figure 6 shows the Western blotting results for 223 / F-EVs after treatment with proteinase K (10 μg / mL) and / or 1% Triton X-100.
[0086] Figure 7 shows the results of analyzing the number of GFP molecules per single EV through a photobleaching experiment and a representative image of GFP in 223 / F-EVs.
[0087] Figure 8 shows the results of the analysis of the relative expression of miR-223-3p miRNA in control cells, cells expressing miR-223 and FGF21, and EVs released from said cells through qRT-PCR analysis.
[0088] Figure 9 shows the photobleaching trace of GFP in 223 / F-EV.
[0089] Figure 10 shows the results of measuring the levels of FGF21 in control EV (Con-EV) and 223 / F-EV by ELISA and the standard curve of FGF21 used in the ELISA analysis.
[0090] Figure 11 shows the results of measuring the copy number of miR-223-3p in control EV and 223 / F-EV by qRT-PCR analysis and the standard curve of miR-223-3p mimics.
[0091] Figure 12 shows representative transmission electron microscope (TEM) images and graphs showing the size distribution and average diameter of 223 / F-EVs under various storage conditions.
[0092] Figure 13 shows the results of nanoparticle trace analysis (NTA) of 223 / F-EVs under various storage conditions.
[0093] Figure 14 shows the results of Western blotting analysis of the levels of FGF21, Alix, and TSG101 under various storage conditions.
[0094] Figure 15 shows the results of the analysis of the relative expression of miR-223-3p miRNA under various storage conditions.
[0095] Figure 16 shows the results of Western blotting to confirm the levels of phospho-ACC1 / 2 (S79), ACC1 / 2, phospho-AKT (S473), AKT, and β-actin in HepG2 cells after treatment with the indicated concentrations of control-EVs or 223 / F-EVs for 1 hour.
[0096] Figure 17 shows representative fluorescence images of HepG2 cells stained with Nyle Red and their relative fluorescence intensities after treating HepG2 cells with PBS, control-EVs, 223 / F-EVs, elafibranor, or resmentirom for 1 hour.
[0097] Figure 18 shows representative fluorescence images and their relative fluorescence intensities of HepG2 cells stained with Nile Red after pre-treating HepG2 cells with a control or FGF21 blocking antibody, followed by further treatment with control-EVs, 223 / F-EVs, or recombinant FGF21 (rFGF21) for 1 hour.
[0098] Figure 19 shows the nanoparticle trace analysis (NTA) results showing the number of EV particles with size distributions of control-EVs, FGF21-EVs, or miR-223-EVs.
[0099] Figure 20 is a representative transmission electron microscope (TEM) image showing the size distribution and average diameter of control-EVs, FGF21-EVs, or miR-223-EVs.
[0100] Figure 21 shows the results of Western blotting analysis of the levels of FGF21, GM130, Alix, and TSG101 in control-EVs, FGF21-EVs, or miR-223-EVs.
[0101] Figure 22 shows the results of the analysis of the relative expression of miR-223-3p miRNA in control-EVs, FGF21-EVs, or miR-223-EVs.
[0102] Figure 23 shows the results of Western blotting to determine the levels of phospho-ACC1 / 2 (S79), ACC1 / 2, phospho-AKT (S473), AKT, and β-actin in HepG2 cells after treatment with control-EVs, FGF21-EVs, or miR-223-EVs at indicated concentrations for 1 hour.
[0103] Figure 24 shows representative fluorescence images of HepG2 cells stained with Nyle Red and their relative fluorescence intensities after treating HepG2 cells with PBS, control-EVs, FGF21-EVs, or miR-223-EVs for 1 hour.
[0104] Figure 25 shows the relative mRNA expression of lipid metabolism-related genes after 24 hours of treatment of HepG2 cells with PBS, a control EV (Con-EV), or an EV expressing miR-223 and FGF21 (223 / F-EV).
[0105] Figure 26 shows the results of Western blotting analysis of phospho-ACC1 / 2 (S79), ACC1 / 2, and β-actin levels and their relative band intensities after treating HepG2 cells with PBS, control-EVs, or 223 / F-EVs and / or palmitate (palmitate; PA) for 24 hours.
[0106] Figure 27 shows representative fluorescence images of HepG2 cells stained with Ny Red after 24 hours of treatment with PBS, control-EVs, or 223 / F-EVs and / or palmitate (PA), and their relative fluorescence intensities.
[0107] Figure 28 shows the relative mRNA expression levels of CCL2, CCL5, CXCL1, CXCL2, and CXCL10 after treating LX-2 cells with PBS, a control EV (Con-EV), or an EV expressing miR-223 and FGF21 (223 / F-EV) for 24 hours.
[0108] Figure 29 shows the relative mRNA expression levels of CCL2, CXCL2, and CXCL10 after infecting LX-2 cells with a negative control inhibitor (NCI) or miR-223-3p inhibitor (223I) for 24 hours, followed by treatment with Con-EV or 223 / F-EV for 24 hours.
[0109] Figure 30 shows the relative mRNA expression levels of CCL2, CXCL2, CXCL10, ACTA2, COL1A1, and COL3A1 in LX-2 cells transfected with a negative control miRNA mimic (NC mimic) or a miR-223-3p mimic (miR-223-3p mimic) for 24 hours.
[0110] Figure 31 shows the relative mRNA expression levels of ACTA2, COL1A1, and COL3A1 after treating LX-2 cells with PBS, control-EVs, or 223 / F-EVs for 24 hours.
[0111] Figure 32 shows the Western blotting results of α-SMA and β-actin levels and the relative band intensity of α-SMA / β-actin after treating LX-2 cells with PBS, control-EVs, or 223 / F-EVs for 24 hours.
[0112] Figure 33 shows representative fluorescence images of collagen type 1 and collagen type 3 and their relative fluorescence intensities after treating LX-2 cells with PBS, control-EVs, or 223 / F-EVs for 24 hours.
[0113] Figure 34 shows the relative mRNA expression levels of ACTA2, COL1A1, and COL3A1 after infecting LX-2 cells with a negative control inhibitor (NCI) or miR-223 inhibitor (223I) for 24 hours, followed by treatment with Con-EVs or 223 / F-EVs for 24 hours.
[0114] Figure 35 shows the Western blotting results of α-SMA and β-actin levels and the relative band intensity of α-SMA / β-actin after infecting LX-2 cells with NCI or 223I for 24 hours and then treating them with Con-EVs or 223 / F-EVs for 24 hours.
[0115] Figure 36 shows representative fluorescence images of collagen type 1 and collagen type 3 and their relative fluorescence intensities after infecting LX-2 cells with NCI or 223I for 24 hours and then treating them with Con-EVs or 223 / F-EVs for 24 hours.
[0116] Figure 37 shows the relative mRNA expression levels of inflammation markers (CCL2, CCL5, CXCL1, CXCL2, CXCL10) and fibrosis markers (ACTA2, COL1A1, COL3A1) after treating LX-2 cells with PBS, control-EVs, or miR-223-EVs for 24 hours.
[0117] Figure 38 shows the Western blotting results of α-SMA and β-actin levels and the relative band intensity of α-SMA / β-actin after treating LX-2 cells with PBS, control-EVs, or miR-223-EVs for 24 hours.
[0118] Figure 39 shows representative fluorescence images of collagen type 1 and collagen type 3 and their relative fluorescence intensities after treating LX-2 cells with PBS, control-EVs, or miR-223-EVs for 24 hours.
[0119] Figure 40 shows the relative mRNA expression levels of ACTA2 after treating LX-2 cells with PBS, control-EVs, 223 / F-EVs, and 5 ng / mL TGF-β1 or obeticholic acid (OCA) for 24 hours.
[0120] Figure 41 shows the Western blotting results of α-SMA and β-actin levels and the relative band intensity of α-SMA / β-actin after treating LX-2 cells with PBS, control-EVs, 223 / F-EVs, OCA, and 5 ng / mL TGF-β1 for 24 hours.
[0121] Figure 42 is a schematic diagram of an experimental plan to establish a MASH induction model using a high-fat diet (CDAHFD) defined with 0.1% methionine and no choline added, and administer PBS, control-EV, or 223 / F-EV by intravenous injection.
[0122] Figure 43 shows representative images confirming biodistribution via in vitro fluorescence imaging 24 hours after intravenous injection of DiR-labeled control-EV and 223 / F-EV, and quantification of fluorescence intensity measured in in vitro organs of mice.
[0123] Figure 44 shows representative liver photographs and H&E-stained liver micrographs of the control and treatment groups, and the NAFLD activity score (NAS) of the experimental group.
[0124] Figure 45 shows the liver weight, hepatic triglyceride (TG) levels, and plasma ALT levels of the control and experimental groups.
[0125] Figure 46 shows representative images of the proximal tibia of the control and experimental groups and the quantification of the bone volume fraction (BV / TV) of the trabecular bone volume.
[0126] Figure 47 shows the quantification of fluorescence intensity of in vitro organs in mice injected with a specified diet and either the experimental or control group.
[0127] Figure 48 shows the body weight curves of rats treated with a specified PBS, control EV (Con-EV), or EV expressing miR-223- and FGF21 (223 / F-EV) under a normal diet (NC) or a high-fat diet (CDAHFD) defined with 0.1% methionine and choline added.
[0128] Figure 49 shows representative images of Oil-Red-O, Picrosirius Red (PSR), and α-SMA staining and CD11b immunohistochemistry (IHC), as well as the quantification of the positive area.
[0129] Figure 50 shows plasma TNF-α and IL-6 levels in control and experimental mice.
[0130] Figure 51 shows the relative mRNA expression levels of Ccl2, Cxcl2, Cxcl10, Acta2, Col1a1, and Col3a1 in the livers of mice in the control and experimental groups.
[0131] Figure 52 shows the ELISA results of plasma CCL2, CXCL2, and CXCL10.
[0132] Figure 53 shows the Western blotting results of α-SMA, phospho-ACC1 / 2 (S79), ACC1 / 2, and β-actin in mouse liver and their relative band intensities.
[0133] The following examples will be explained in more detail. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.
[0134]
[0135] Example 1. Cell line
[0136] HEK293FT (ATCC, USA) and LX-2 cells (provided by Professor Young-Eun Cho of Andong National University, Korea) were cultured in DMEM medium (Hyclone, USA) containing 10% FBS (Hyclone) and 1% penicillin-streptomycin (Hyclone) at 37°C in a 5% CO2 environment. HepG2 cells (ATCC) were cultured in RPMI 1640 medium (Hyclone) under the same conditions as other cell lines.
[0137]
[0138] Example 2. Preparation of 223 / F-EVs
[0139] To generate a DNA vector expressing human FGF21 on the cell surface, a pMG vector encoding mCherry linked to the transmembrane domain-3 (TM3) of CD63 was obtained from Macrogen (Seoul, South Korea) and introduced into the pLenti-C-mGFP-P2A-Puro vector (Origene, USA).
[0140] The TagGFP2 sequence was introduced between CD63 TM3 and mCherry via two linkers (rigid linker (EAAAK × 5) and flexible linker (GGGGS × 5)), and the final construct consisted of a rigid linker-TagGFP2-flexible linker-SfiI-mCherry-SfiI fragment linked to the C-terminus of CD63 TM3. This construct contained mCherry and was used as a control. Additionally, a pMG vector encoding the human FGF21 sequence was purchased from Macrogen, cleaved with SfiI, and replaced with mCherry.
[0141] To generate lentiviruses expressing miRNA, two pMIRNA1 vectors were purchased from SBI System Biosciences (CA, USA). The scrambled miRNA expression vector was used as a control (Cat#.PMIRH000PA-1), and the vector expressing miR-223 was used as an experimental group (Cat#.PMIRH223PA-1).
[0142] Lentiviruses were generated by the method disclosed in H. Cho, I. Jung, H. Ju, MC Baek, K. Yea, Cytokine 2023, 169, 156249. Specifically, a lentivirus mixture containing pCMVD, pVSVg, and pMIRNA1 or pCMVD, pVSVg, and pLenti-C-mGFP-P2A-Puro plasmids in a 1:1:1 ratio was transfected into HEK293FT cells according to the manufacturer's protocol. Subsequently, HEK293FT cells were infected with lentiviruses containing pLenti-C-mGFP-P2A-Puro or pMIRNA1 to induce monoexpression of FGF21 or miR-223, respectively.
[0143] To generate dual-expression cells, HEK293FT cells were first infected with a lentivirus expressing pMIRNA1. After infection, miR-control and miR-223 expressing cells with identical GFP intensities were selected via flow cytometry to obtain cells with similar expression levels. Subsequently, the high-expression cell population was additionally infected with the pLenti-C-mGFP-P2A-Puro lentivirus. To establish a stable cell line, cells were selected with puromycin (10 μg / mL) until uninfected cells were completely eliminated, and then maintained cultured at a puromycin concentration of 5 μg / mL.
[0144]
[0145] Example 3. Separation and Purification of EV
[0146] To ensure a puromycin-free environment for EV collection, HEK293FT cells were inoculated into a puromycin-free medium. After overnight (O / N) incubation, the culture medium was replaced with fetal bovine serum (FBS)-free DMEM (Dulbecco's modified Eagle medium) in accordance with the MISEV (Minimal Information for Studies of Extracellular Vesicles) 2023 guidelines to isolate EVs from HEK293FT cells. After 48 hours, the cell culture supernatant was centrifuged at 300 × g for 5 minutes, 2,500 × g for 20 minutes, and 10,000 × g for 30 minutes to remove large particles and cell debris. Subsequently, the supernatant was filtered through a 0.22 μm pore filter and concentrated using a tangential flow apparatus equipped with a hollow fiber membrane (Cat#.D02-S05U-05-N; Repligen, USA) with a 0.5 mm fiber ID. Prior to filtration and concentration, the filter was washed with sterile PBS (BioSesang, South Korea), and after concentration, the buffer was replaced with 10 × 100 volume of PBS. For staining, EVs were stained with DiR solution (Cat#.D12731; Invitrogen™) for 30 minutes. Additionally, EVs were analyzed immediately or stored at -80°C if necessary.
[0147]
[0148] Example 4. Nanoparticle tracking analysis (NTA)
[0149] The particle size and concentration of the samples were measured using NTA with the NM10 equipped with a 405 nm laser and NTA 2.2 analysis software (NanoSight, UK). The samples were diluted with PBS before analysis. Three 30-second videos were recorded for each sample, and the camera level was set to 10-12. The software settings for analysis were kept constant for all measurements.
[0150]
[0151] Example 5. Transmission Electron Microscopy (TEM)
[0152] 1.25% glutaraldehyde (Sigma-Aldrich, MA, USA) and 2.65% formaldehyde (Sigma-Aldrich) were mixed with 0.2 M sodium cacodylate buffer solution (SC; pH 7.2) and used as a fixative. The prepared fixative was cooled to below 4°C and added to the EV emulsion in a 1:1 ratio. The mixed EV emulsion was stored at below 4°C for 1 hour and pipetted every 10 minutes to maintain homogeneity. Before loading the fixed EV solution, the Ni TEM grid (200 mesh, TED Pella) was plasma cleaned for 1 minute under flowing O2 and Ar using an advanced plasma cleaner (Gatan, 950M). Subsequently, 10 μL of the fixed EV solution was loaded onto the plasma-cleaned grid for 10 minutes. The remaining solution was removed using filter paper, and 10 μL of SC was loaded for washing. The fixative was removed by repeating the process of removing the solution with filter paper and washing with SC at 10-minute intervals for at least 15 times. Residual salts in the SC were removed using deionized water instead of filter paper and SC, and this process was also repeated at 10-minute intervals for at least 15 times. The Ni TEM grid loaded with the fixed EV was slowly dried under atmospheric pressure. All loading and washing processes were performed at a temperature of 4°C or lower, and the prepared EV was analyzed using a TEM (FEI, Tecnai G2 F20 TWIN TMP) with an acceleration voltage of 200 keV.
[0153]
[0154] Example 6. Quantitative analysis of TagGFP2 in a single EV using photobleaching assay.
[0155] EV is a final concentration of 1×10 9The particles were diluted in PBS at a particle / mL ratio and applied to a 35-mm glass-bottom dish (MatTek, P35G-0-10-C) for microscopic observation. EVs were imaged using a total internal reflection fluorescence (TIRF) microscope. Fluorescence intensity trajectories were analyzed using Prism 8.0 (GraphPad Software, Inc.). The average value derived from the histograms of the bleaching trajectories in stages 1, 2, and 3 was defined as the fluorescence intensity of a single TagGFP2 molecule (Fig. 9). The number of TagGFP2 molecules expressed in a single EV could be quantified using the defined intensity. This quantification was made possible through the fluorescence intensity distribution of 223 / F-EVs observed under a TIRF microscope. The TIRF microscope used was an inverted microscope (ECLPSE Ti2-E; Nikon) equipped with a perfect focus system (PFS, TI2-N-ND-P), a motorized stage (TI2-S-SE-E), an electron-multiplying charge-coupled device (EM CCD, Andor, iXorn Ultra 897), and a spectroscopic detector (Andor, Newton DU-971). A 488 nm wavelength laser (Nikon, LU-N4 Laser Unit) was used as the light source for the TIRF experiment. Imaging was performed using a 100x objective lens (Nikon, 1.49 NA, oil immersion, CFI SR HP Apochromat TIRF), and the EV acquisition time was set to 100 ms without delay.
[0156]
[0157] Example 7. Western Blotting
[0158] Cells or EVs were lysed in cell lysis buffer (Cat#9803, Cell Signaling Technology) containing a protease / phosphatase inhibitor (Cat#.5872S, Cell Signaling Technology). Subsequently, sample proteins were electrophoresed using Bolt™ Bis-Tris Plus Mini Protein Gels, 4–12% (Cat#.NW0412; Invitrogen) and transferred to iBlot™ 2 Transfer Stacks, nitrocellulose (Cat#.IB23002; Invitrogen). The membranes were blocked with PBST containing 5% skim milk for 1 hour, incubated with an appropriate primary antibody, and then incubated with an HRP (horseradish peroxidase)-conjugated secondary antibody. To visualize proteins, a chemiluminescent substrate (ECL; Cat#.34095, Thermo Fisher Scientific) was applied to the membranes. Blot images were captured using a ChemiDoc XRS+ system (Bio-Rad) and analyzed with Image Lab (version 6.1; Bio-Rad) and ImageJ (version 1.54g; National Institutes of Health, USA) software.
[0159]
[0160] Example 8. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
[0161] To analyze intracellular mRNA expression levels, total RNA was extracted using the MiniBEST Universal RNA Extraction Kit (#.9767; TaKaRa) and reverse transcribed using the PrimeScript™ 1st strand cDNA Synthesis Kit (Cat#.6110A; TaKaRa) according to the manufacturer's instructions. qRT-PCR was performed using TB Green® Premix Ex Taq™ II (Cat#.RR820B; TaKaRa). The primers used for qRT-PCR are listed in Table 1.
[0162] In addition, to analyze miRNA expression levels in cells or EVs, total RNA was extracted using Direct-zol™ RNA Microprep (Cat#.R2062; Zymo Research) and reverse transcribed using the TaqMan™ MicroRNA Reverse Transcription Kit (Cat#.4366596; Applied Biosystems™) and oligonucleotides specific to each gene. qRT-PCR was performed using the TaqMan™ Fast Advanced Master Mix for qPCR (Cat#.4444557; Applied Biosystems™) with qRT-PCR oligonucleotides specific to each gene. All qRT-PCR analyses were performed using an ABI StepOne Plus instrument (Applied Biosystems) and analyzed with StepOne software. The relative mRNA and miRNA expression of each target gene was analyzed using the delta-delta Ct method and normalized against Gapdh, 18 srRNA, or cel-miR-39. The primers used are listed in Table 1.
[0163]
[0164] Gene name Species Forward (5'-3') Reverse (5'-3') ACTA2 Human CCGACCGAATGCAGAAGGA (Sequence No. 10) ACAGAGTATTTGCGCTCCGAA (Sequence No. 11) CCL2 Human CAGCCAGATGCAATCAATGCC (Sequence No. 12) TGGAATCCTGAACCCACTTCT (Sequence No. 13) CCL5 Human CCTGCTGCTTTGCCTACATTGC (Sequence No. 14) ACACACTTGGCGGTTCTTTCGG (Sequence No. 15) COL1A1 Human ATCAACCGGAGGAATTTCCGT (Sequence No. 16) CACCAGGACGACCAGGTTTTC (Sequence No. 17) COL3A1 Human TGGTCTGCAAGGAATGCCTGGA (Sequence No. 18) TCTTTCCCTGGGACACCATCAG (Sequence No. 19)CPT1HumanCCTCCGTAGCTGACTCGGTA (Sequence No. 20)GGAGTGACCGTGAACTGAAA(Sequence No. 21)CXCL1HumanAGCTTGCCTCAATCCTGCATCC (Sequence No. 22)TCCTTCAGGAACAGCCACCAGT(Sequence No. 23)CXCL2HumanGGCAGAAAGCTTGTCTCAACCC (Sequence No. 24)CTCCTTCAGGAACAGCCACCAA(Sequence No. 25)CXCL10HumanGGTGAGAAGAGATGTCTGAATCC (Sequence No. 26)GTCCATCCTTGGAAGCACTGCA(Sequence No. 27)DGAT2HumanGCTACAGGTCATCTCAGTGCTC (Sequence No. 28)GTGAAGTAGAGCACAGCGATGAG(Sequence No. 29)GAPDHHumanGAATTTGGCTACAGCAACAG (Sequence No. 30)TGAGGGTCTCTCTCTTCCTC(Sequence No. 31)PPARAHumanACGATTCGACTCAAGCTGGT (Sequence No. 32)GTTGTGTGACATCCCGACAG(Sequence No. 33)SCDHumanCCTGGTTTCACTTGGAGCTGTG (Sequence No. 34)TGTGGTGAAGTTGATGTGCCAGC(Sequence No35)SREBF1HumanACTTCTGGAGGCATCGCAAGCA (Sequence No. 36)AGGTTCCAGAGGAGGCTACAAG(Sequence No. 37)Acta2MouseTGCTGACAGAGGCACCACTGAA (Sequence No. 38)CAGTTGTACGTCCAGAGGCATAG(Sequence No. 39)Ccl2MouseTTAAAAACCTGGATCGGAACCAA (Sequence No. 40)GCATTAGCTTCAGATTTACGGGT(Sequence No. 41)Col1a1MouseGGAGAGAGCATGACCGATGG (Sequence No. 42)AAGTTCCGGTGTGACTCGTG(Sequence No. 43)Col3a1MouseCTAAAATTCTGCCACCCCGAA (Sequence No. 44)AGGATCAACCCAGTATTCTCCACTC(Sequence No. 45)Cxcl2MouseAGACAGAAGTCATAGCCACTCTCAAG (Sequence No. 46)CCTCCTTTCCAGGTCAGTTAGC(Sequence No. 47)Cxcl10MouseCCAAGTGCTGCCGTCATTTTC (Sequence No. 48)GGCTCGCAGGGATGATTTCAA(Sequence No. 49)GapdhMouseTCACCACCATGGAGAAGGC (Sequence No. 50)GCTAAGCAGTTGGTGGTGCA(Sequence No. 51)18sRNA-ACGGAAGGGCACCACCAGGA (Sequence No. 52)CACCACCACCCACGGAATCG(Sequence No. 53)
[0165]
[0166] Example 9. Enzyme-linked immunosorbent assay (ELISA)
[0167] To measure chemokine levels in mouse plasma, collected mouse blood samples were immediately centrifuged at 1,000 × g for 15 minutes at 4°C to separate plasma from blood cells and platelets. The supernatant was separated and stored at -80°C until further analysis. Mouse alanine aminotransferase (ALT) ELISA kit (Cat#.ab282882, Abcam), mouse monocyte chemotactic protein 1 ELISA kit (Cat#.RK00381, Abclonal), mouse MIP-2 / CXCL2 ELISA kit (Cat#.RK04208, Abclonal), and mouse CXCL10 / IP10 ELISA kit (Cat#.RK00056, Abclonal) were used according to the manufacturer's instructions. To measure FGF21 expression in EVs, a human FGF21 ELISA kit (Cat#.RK00084, Abclonal) was used according to the manufacturer's protocol.
[0168]
[0169] Example 10. Immunocytochemistry (ICC) and Nile Red staining
[0170] Cells were fixed in 4% formaldehyde in PBS for 10 minutes. To analyze fibrosis, LX-2 cells were permeated with 0.1% Triton X-100 in PBS and blocked with 5% bovine serum albumin and 5% normal goat serum in PBST for 1 hour. After washing, cells were incubated with an appropriate primary antibody, followed by incubation with a secondary antibody conjugated with a fluorescent dye, and stained with DAPI for 5 minutes. To evaluate steatosis, HepG2 cells were stained with Ny Red solution at 37°C for 15 minutes. Images were acquired using an inverted confocal microscope (LSM 900; Carl Zeiss). The microscope exposure time was optimized to capture the signal when the signal difference was most pronounced. Confocal microscope images were analyzed using ZEN 2009 and ImageJ software.
[0171]
[0172] Example 11. Transformation of miRNA mimics or inhibitors
[0173] To transform LX-2 cells with miRNA mimics or inhibitors, AccuTarget Human miRNA mimics and inhibitors were purchased from Bioneer (Daejeon, South Korea). LX-2 cells were inoculated and stabilized overnight. Subsequently, the mimics or inhibitors were transformed using Lipofectamine™ 3000 according to the manufacturer's instructions. After 24 hours, cells transformed with miRNA mimics were collected and analyzed. Cells transformed with miRNA inhibitors were harvested and analyzed 24 hours after treatment with PBS, control-EV, or 223 / F-EV.
[0174]
[0175] Example 12. Animal experiment
[0176] Male C57BL / 6 mice were purchased from Orient Bio (Seongnam, South Korea) and used for all animal experiments. Mice were housed in an animal facility maintaining a 12-hour dark-light cycle (7:00 AM to 7:00 PM) and were allowed free access to food and water.
[0177] Mice used in the experiment were fed a normal chow diet (NCD) (Cat#.5053, Labdiet) or an L-amino acid-defined, high-fat diet (CDAHFD) without supplemented methionine and choline at 4 weeks of age. After 10 weeks, mice were fed PBS, control EVs, or 223 / F EVs (5 × 10⁶). 10 Particles (mice) were intravenously injected twice a week, and an FGF21 analog (PF-05231023) (Cat#.A18949, AdooQ Bioscience) was subcutaneously injected once a week (10 mg / kg). After 10 weeks, mice were anesthetized, blood samples were collected in EDTA-treated tubes, mice were euthanized, and designated tissues were collected at the end of each experiment.
[0178] To analyze EV delivery, mice fed NCD or CDAHFD were randomly grouped. For EV delivery analysis, mice fed NCD or CDAHFD were randomly assigned, and PBS-stained EV was injected via the tail vein at a particle dose of 5 × 10¹° per mouse. After 24 hours, lung, heart, liver, spleen, kidney, brain, adipose tissue, pancreas, and hind leg tissues were rapidly excised. All tissues were washed with PBS, and fluorescence was measured using an in vivo optical imaging system (IVIS) (Perkin Elmer, IVIS Spectrum). All animal experiments and animal care were performed with the approval of the DGIST Institutional Animal Care and Use Committee (IACUC# DGIST-IACUC-24022807-0001).
[0179]
[0180] Example 13. Histopathological analysis
[0181] Histological analysis of the liver was performed using hematoxylin (Cat#.CS700; Dako, Glostrup, Denmark), eosin (Cat#.CS701, Dako), Oil-Red-O (Cat#.O1391; Sigma, SG, Switzerland), and the Picrosirius red staining kit (Cat#.ab150681, Abcam) according to the manufacturer's instructions. Specifically, for Oil-Red-O staining, liver specimens were immediately excised from mice, placed in FSC 22 frozen section medium (Cat#.3801480; Leica Biosystems, Nussloch, Germany), and rapidly frozen in LN2. Subsequently, fresh frozen sections were cut into 10 μm sections using a frozen sectioning machine (CM3050S; Leica Biosystems), fixed in ice-cold 4% paraformaldehyde solution (Cat#.PC2031; BioSesang) for 15 minutes, and stained with Oil-Red-O. For H&E, Picrosirius red, and CD11b staining, liver specimens were fixed in 4% paraformaldehyde solution and placed in paraffin blocks according to standard protocols. Then, they were cut into 5 μm thick sections using a rotary microtome (Cat#.RM2255; Leica Biosystems) and stained according to the manufacturer's instructions. Liver morphology, hepatic steatosis, fibrosis, and inflammation were evaluated using Eclipse Ni-E (Nikon, Japan) and NIS-Elements software. Images were analyzed blindly using ImageJ software.
[0182]
[0183] Example 14. Measurement of liver triglycerides (TGs)
[0184] The TG content of the liver was evaluated using a triglyceride analysis kit (Cat#.ab65336, Abcam). Specifically, liver tissue was weighed and homogenized in a 1 mL solution of 5% NP-40 Alternative (Cat#.492018, Merck Millipore) in water. Subsequently, the liver was heated to 80–100°C and then cooled to room temperature, repeating this process twice. Insoluble residues were removed by centrifugation at 16,000 × g for 2 minutes. The extracted TG was diluted six-fold with distilled water, and the concentration was determined according to the manufacturer's instructions. Individual TG values were standardized to the liver weight.
[0185]
[0186] Example 15. Bone Analysis
[0187] To evaluate the bone volume and structure of mouse tibias via micro-computed tomography (μCT), mouse tibias were fixed in 70% ethanol and scanned using a Quantum GX μCT instrument (Perkin Elmer) for overall tibial evaluation and structural analysis. To analyze the bone scan of the trabecular region located just below the proximal tibial growth plate, trabecular bone parameters were calculated using Quantum GX μCT imaging system software (Perkin Elmer).
[0188]
[0189] Example 16. Reagents and Antibodies
[0190] Obeticholic acid (OCA) (Cat#.HY-12222, Medchemexpress, NJ, USA), recombinant human FGF21 protein (Cat#.ab283483, Abcam, UK), or recombinant human TGF-β1 (Cat#.Ab50036, Abcam, UK) were treated to the cells initiated in each experimental example. EVs were treated with specified concentrations of protease K (Cat#.1014023, QIAGEN) and / or Triton X-100 (Cat#.T1020, BioSesang, Seongnam, Korea), and the list of antibodies used in the present invention is listed in Table 2.
[0191]
[0192] Target antigenIsotypeDilutionSourceApplicationAlixMouse1:1000Abcam (#ab117600)WBα-SMAMouse1:200 (IHC)1:2000 (WB)Invitrogen (#14-9760-82)IHC, WBPhospho-ACC 1 / 2 (S79)Rabbit1:1000Sigma (#07-303)WBACC 1 / 2Rabbit1:1000Abcam (#ab109368)WBPhospho-AKT (S473)Rabbit1:1000Cell Signaling Technology (#9271)WBAKTRabbit1:1000Cell Signaling Technology (#9272)WBβ-actinRabbit1:2000Cell Signaling Technology (#4970)WBCD11bMouse1:100Invitrogen (#14-0112-82)IHCCollagen type IRabbit1:500Novus (#NB600-408)ICCCollagen type IIIMouse1:500Abcam (#ab6310)ICCFGF21RabbitGoat1:1000(WB)1:100(Nt)Invitrogen (#PA5-79255),R&D systems (#MAB25373)WB, NtGM130Mouse1:3000BD biosciences (#610822)WBTSG101Rabbit1:1000Abcam (#ab30871)WBRabbit IgG-HRPGoat1:3000 (WB)Cell Signaling Technology (#7074)WBMouse IgG-HRPHorse1:200 (IHC), 1:3000 (WB)Cell Signaling Technology (#7076)IHC, WBMouse IgG-Alexa Fluor 488Goat1:500Invitrogen (#A-11001)ICCRabbit IgG-Alexa Fluor 594Goat1:2000Invitrogen (#A-11012)ICC
[0193] WB: Western blot, IHC: Immunohistochemistry, ICC: Immunocytochemistry, Nt: Neutralizing
[0194]
[0195] Example 17. Statistical Analysis
[0196] Statistical analysis was performed using PRISM 8 software (GraphPad Software, Inc.). Results were expressed as mean ± standard error of the mean (SEM), as shown in the figure. The sample size is indicated in the description of the corresponding graph or figure. Student's t-test or analysis of covariance (ANCOVA) was used when the normality assumption was satisfied. Statistical significance was defined as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, and specific p-values are indicated in the figure.
[0197]
[0198] Experimental Example 1. Experimental design to confirm the therapeutic effect of engineered EVs on MASH
[0199] As disclosed in Fig. 1, the effect of engineered EVs on MASH was confirmed in in vitro and in vivo models.
[0200] Specifically, the anti-fatty liver effects of 223 / F-EVs and the effects mediated by FGF21 were evaluated. In addition, to confirm the anti-inflammatory and anti-fibrotic effects of 223 / F-EVs, the effects were evaluated using a miR-223 inhibitor to determine whether miR-223 mediates the effects of 223 / F-EVs.
[0201] In addition, in vitro experiments were performed using HEK293FT, LX-2, and HepG2 cell lines, and in vivo experiments were performed by administering control-EVs and 223 / F-EVs to a CDAHFD mouse model to confirm the therapeutic effect on MASH.
[0202]
[0203] Experimental Example 2. Generation and Characterization of EVs
[0204] 2.1 Manufacture of 223 / F-EVs
[0205] Since genetically engineered cells secrete EVs that reflect specific characteristics, engineered EVs were produced by sequentially infecting HEK293FT cells with two lentiviruses containing FGF21 or miR-223 constructs (Fig. 2).
[0206] To immobilize FGF21 on the surface of EVs, the transmembrane domain (TM) of CD63, a membrane protein abundant in EVs, was used. FGF21 was fused to the C-terminus of CD63 TM while exposing the C-terminus of FGF21, which plays a crucial role in binding to the FGF21 receptor.
[0207] Since the linker type and length between fusion proteins are important, a rigid linker (EAAAK × 5) was inserted between GFP and CD63™ to maintain separation between GFP and the membrane, and a flexible linker (GGGGS × 5) was added between the N-terminus of GFP and FGF21 to enable flexible binding. To load miR-223 into the EV, previous studies [F. Vakhshiteh et al, Exosomes derived from miR-34a-overexpressing mesenchymal stem cells inhibit in vitro tumor growth: a new approach for drug delivery, Life Sci. 266 (2021) 118871, Y. Zhao, et al., Exosomes from MSCs overexpressing microRNA-223-3p attenuate cerebral ischemia through inhibiting microglial M1 polarization mediated inflammation, Life Sci. Cells were infected with a lentivirus overexpressing miR-223 according to the method established in 260 (2020) 118403., W. Zhu, et al, Exosomes derived from mir-214-3p overexpressing mesenchymal stem cells promote myocardial repair, Biomater. Res. 27 (1) (2023) 77. ].
[0208]
[0209] 2.2 Verification of Dimensions and Shapes of 223 / F-EVs
[0210] After isolating EVs from engineered cells, their physical properties were confirmed using nanoparticle trace analysis (NTA) and transmission electron microscopy (TEM). NTA results confirmed that the size distribution of control EVs (Con-EVs) and engineered EVs containing FGF21 and miR-223 (223 / F-EVs) fell within the typical EV size range (30–150 nm). Additionally, no significant difference in secretion rates was observed between the two groups (Fig. 3). Furthermore, TEM results confirmed that the morphology of both EV groups was round and intact. Moreover, the average diameters of the two EV groups (control-EVs (106.88 ± 17.74 nm) and 223 / F-EVs (107.77 ± 17.23 nm)) were consistent with the NTA results and showed no distinct differences (Fig. 4).
[0211]
[0212] 2.3 Confirmation of Overexpression of FGF21 and miR-223 in 223 / F-EVs
[0213] In addition, Western blotting confirmed the overexpression of FGF21 and miR-223 in EVs, and it was confirmed that FGF21 was detected only in cells and EVs (223 / F-EVs) that overexpressed FGF21, and that the molecular weight matched the designed structure. Furthermore, when compared with cell lysate samples, typical EV markers (Alix and TSG101) were detected in the EV samples, while the Golgi apparatus marker GM130 was not detected, confirming that the EVs of the present invention were effectively isolated (Fig. 5).
[0214] To further confirm whether FGF21 is expressed on the EV surface, Western blotting was performed after treating 223 / F-EVs with the membrane-impermeable protease proteinase K (PK) alone or with Triton X-100 for exosome lysis. As a result, it was confirmed that FGF21 is expressed on the EV surface, as FGF21 is degraded only by PK alone (Fig. 6).
[0215]
[0216] In addition, the number of FGF21 molecules per EV was quantified. Since FGF21 was designed to bind directly to GFP in a 1:1 ratio, the number of FGF21 molecules in a single EV was determined using a single-molecule photobleaching assay of GFP. Based on the fluorescence intensity of a single GFP molecule (3801.62 ± 542.01) (Fig. 9), it was confirmed that approximately 3.09 FGF21 molecules were expressed in a single 223 / F-EV (Fig. 7). Subsequently, the amount of FGF21 in EVs was determined using an FGF21 ELISA, revealing the presence of approximately 1.8 FGF21 molecules per EV, which was found to be similar to the results of the photobleaching experiment (Fig. 10).
[0217]
[0218] Additionally, the overexpression of miR-223 was confirmed via quantitative real-time polymerase chain reaction (qRT-PCR). As a result of introducing the miR-223 precursor, the main form, miR-223-3p, was approximately 10 in cells 5 It was confirmed that it was overexpressed with a doubling. In addition, it was confirmed that miR-223-3p was significantly overexpressed in 223 / F-EVs compared to control EVs (Fig. 8). To determine the number of miR-223-3p copies per EV unit, qRT-PCR was performed using EV samples and miR-223-3p mimics. Based on the standard curve, approximately 10 per single 223 / F-EV -1It was confirmed that it contained several copies of miR-223-3p (Fig. 11).
[0219]
[0220] 2.4 Verification of Stability of 223 / F-EVs Under Various Storage Conditions
[0221] Finally, to evaluate the stability of the EV and ensure consistent performance in subsequent experiments, the physical characteristics of the EV and the retention of the payload were evaluated under various storage conditions. EVs are typically stored at 4°C or -80°C. Accordingly, a newly acquired operational EV was compared with an EV stored at 4°C or -80°C. TEM and NTA analysis results showed that the EVs stored at 4°C and -80°C were similar to the newly acquired EV in terms of shape and size distribution, and the average size was maintained within the standard range (30-150 nm) (Figs. 12, 13). These results suggest that storage conditions do not affect the physical characteristics of the operational EV.
[0222] Next, to determine whether storage affects the payload stability of the EV, the levels of FGF21 and miR-223 in EVs stored at different temperatures were quantified. Western blot and qRT-PCR analysis revealed no significant difference in FGF21 and miR-223 levels between the newly acquired EVs and the stored EVs (Figs. 14, 15). These results demonstrate that storage at 4°C and -80°C does not affect the structural stability or payload efficiency of the engineered EVs. Based on these results, the stored EVs were used in subsequent experiments, ensuring consistency in EV characteristics across various experimental conditions.
[0223]
[0224] Based on the above results, it was confirmed that an EV expressing FGF21 on the surface and carrying miR-223 internally was successfully generated, and that it possesses stability and functional completeness.
[0225]
[0226]
[0227] Experimental Example 3. Confirmation of steatosis alleviation effect through surface-expressed FGF21 in 223 / F-EVs
[0228] 3.1 Confirmation of Functional Activity of FGF21
[0229] First, to determine whether FGF21 expressed on the surface of EVs exhibits functional activity, the phosphorylation of downstream molecules of FGFR in HepG2 cells was evaluated. Western blotting results confirmed that the phosphorylation of AKT (S473) and ACC (S79) increased in a concentration-dependent manner upon treatment with 223 / F-EVs (Fig. 16).
[0230]
[0231] 3.2 Confirmation of the steatosis-improving effect of 223 / F-EVs
[0232] The effects of 223 / F-EVs on steatosis, a major symptom of MASH, were investigated. To determine the effects of EVs on steatosis, HepG2 cells were treated with each EV type and positive controls (elafibranor, resmetirom), which are well-known MASH treatments, followed by Nyle Red staining. The Nyle Red staining results confirmed that neutral lipid content was significantly reduced in the 223 / F-EVs treatment group of the present invention compared to PBS or control-EVs treatment (Fig. 17). The positive controls, elafibranor and resmetirom, were also found to reduce lipid accumulation compared to the PBS treatment group.
[0233]
[0234] To determine whether the reduction in lipid content is mediated by FGF21 on the surface of EVs, cells were pretreated with an FGF21 blocking antibody before treatment with 223 / F-EVs or recombinant FGF21 (rFGF21). Nyle Red staining results showed that inhibition of FGF21 inhibited the steatosis reduction effect induced by rFGF21 or 223 / F-EVs, thereby confirming that the reduction in lipid content is FGF21-dependent (Fig. 18).
[0235]
[0236] 3.3 Verification of the effects of FGF21-EV and miR-223-EV
[0237] To further verify the mediating effect of FGF21, the generation and characterization of EVs expressing only miR-223 or only FGF21 were additionally performed. First, the same experiments as in Experimental Examples 2.2, 2.3, 3.1, and 3.2 were conducted. Physical properties were confirmed using nanoparticle trace analysis (NTA) and transmission electron microscopy (TEM) (Figs. 19 and 20), the overexpression of FGF21 and miR-223 in EVs was confirmed through Western blotting (Figs. 21 and 22), and the effect of improving steatosis was confirmed (Figs. 23 and 24).
[0238] As a result, unlike EVs expressing only miR-223 (miR-223-EV), FGF21-EV exhibited effects similar to 223 / F-EV, which included phosphorylation of FGFR downstream signaling factors ACC and Akt and a reduction in lipid content (Fig. 23). Taken together, these results confirmed that the engineered 223 / F-EV exerts a lipid-lowering effect in HepG2 cells through FGF21 expressed on its surface.
[0239]
[0240] 3.4 Confirmation of Increased Expression of Lipid Metabolism-Related Genes in 223 / F-EVs
[0241] To determine the effects of 223 / F-EVs on various genes (DGAT2, SREBF1, PPARα, CPT1, SCD) related to lipid metabolism, mRNA expression was checked by qRT-PCR after treating HepG2 cells with PBS, control-EVs, or 223 / F-EVs. As a result, it was confirmed that 223 / F-EVs decreased the expression of SREBF1, a transcription factor involved in fatty acid synthesis, and increased the expression of PPARα, a transcription factor related to lipid oxidation (Fig. 25).
[0242]
[0243] 3.5 Confirmation of the effect of 223 / F-EVs in improving exacerbated steatosis
[0244] We investigated whether 223 / F-EVs could improve exacerbated steatosis. To this end, we mimicked an in vivo MASH model by treating HepG2 cells with EVs and palmitate (PA), a saturated fatty acid. Western blotting results confirmed that the inhibitory phosphorylation site of ACC (S79), a major enzyme in fatty acid synthesis, decreased with PA treatment alone but significantly increased with 223 / F-EVs treatment (Fig. 26). Additionally, Ny Red staining results confirmed that the increase in neutral lipid content induced by PA was significantly reduced by 223 / F-EVs treatment (Fig. 27).
[0245]
[0246] As a result of the above, it was confirmed that the 223 / F-EVs of the present invention can significantly improve MASH phenotypes, as 223 / F-EVs reduce basal steatosis levels in a FGF21-dependent manner and alleviate exacerbated steatosis.
[0247]
[0248] Experimental Example 4. Confirmation of the effect of miR-223 in reducing inflammation and fibrosis in 223 / F-EVs
[0249] 4.1 Confirmation of the Inflammatory and Fibrosis-Reducing Effects of 223 / F-EVs
[0250] As a result of confirming the inflammation and fibrosis-reducing effects of miR-223, it was confirmed that mRNA expression of various chemokines (CCL2, CXCL2, CXCL10; Fig. 28) and major fibrosis markers (ACTA2, COL1A1, COL3A1) in LX-2 cells, a human hepatic stellate cell line, was significantly reduced in the group treated with 223 / F-EVs compared to the PBS or control-EV treated groups (Fig. 31).
[0251] Consistent with these mRNA expression results, Western blotting also confirmed a decrease in α-SMA (alpha smooth muscle actin) protein levels (Fig. 32), and immunocytochemistry (ICC) results confirmed a significant decrease in collagen type 1 and collagen type 3 protein levels after 223 / F-EV treatment (Fig. 33).
[0252]
[0253] 4.2 Confirmation of Functional Activity of Internally Loaded miRNA
[0254] To determine whether these anti-inflammatory and anti-fibrotic effects are mediated by miR-223 contained in EVs, LX-2 cells were transformed with a miR-223-3p inhibitor (223I), which has a sequence complementary to miR-223-3p, prior to treatment with 223 / F-EVs. The transformation with 223I inhibited the reduction in mRNA expression of chemokines and fibrosis markers (CCL2, CXCL2, CXCL10, ACTA2, COL1A1, COL3A1) induced by 223 / F-EVs, thereby confirming that the anti-inflammatory and anti-fibrotic effects of 223 / F-EVs are dependent on miR-223 (Figs. 29 and 34). In addition, Western blotting and ICC also confirmed that the protein levels of α-SMA and collagen types 1 and 3 were consistent with the mRNA expression results under miR-223-3p inhibitor treatment conditions (Figs. 35 and 36).
[0255]
[0256] To further confirm whether these mRNA changes were miR-223 dependent, LX-2 cells were transformed with a miR-223-3p mimic, and changes in the mRNA levels of the markers were observed. As a result, transformation with the miR-223-3p mimic induced a reduction in inflammation (CLL2, CXCL2, CXCL10) and fibrosis markers (ACTA2, COL1A1, COL3A1), similar to 223 / F-EVs treatment, thereby confirming that the anti-inflammatory and anti-fibrotic effects are mediated by miR-223-3p (Fig. 30).
[0257]
[0258] Additionally, miR-223-EVs expressing only miR-223 without FGF21 were generated and treated to LX-2 cells to evaluate their effects. As a result of this treatment, mRNA expression of inflammation-related markers (CCL2, CXCL2, CXCL10) and fibrosis-related markers (ACTA2, COL1A1, COL3A1) decreased (Fig. 37). Western blot analysis and immunofluorescence staining (ICC) also confirmed that miR-223-EVs reduced the protein expression levels of α-SMA, a fibrosis marker, and collagen types I and III (Figs. 38 and 39). Taken together, these results confirmed that miR-223 loaded onto EVs effectively inhibits inflammation and fibrosis.
[0259]
[0260] 4.3 Confirmation of the effect of 223 / F-EVs in improving exacerbated fibrosis
[0261] In addition, we investigated whether 223 / F-EVs could improve exacerbated fibrosis similar to that observed in an in vivo MASH model. We increased the levels of fibrosis markers by treating LX-2 cells with TGF-β1, a major cytokine that increases in the MASH state. Furthermore, when cells were treated with obeticholic acid (OCA), an established therapeutic agent for MASH, and compared with the 223 / F-EVs treatment group, it was confirmed that the mRNA and protein levels of α-SMA, which were increased by TGF-β1, were significantly reduced in both the 223 / F-EVs and OCA treatment groups (Figures 40 and 41).
[0262]
[0263] As a result of the above, it was confirmed that the 223 / F-EVs of the present invention can significantly improve MASH phenotypes, as 223 / F-EVs reduce the levels of underlying inflammation and fibrosis markers through miR-223-3p and alleviate exacerbated fibrosis.
[0264]
[0265] Experimental Example 5. Effect of the CDAHFD equation of 223 / F-EVs on the MASH model
[0266] To confirm the effects of 223 / F-EVs in a mouse model, a CDAHFD model exhibiting steatosis, inflammation, and fibrosis was established. After rearing on a CDAHFD diet for 10 weeks, the mice were intravenously injected with PBS, control EVs, or the 223 / F-EVs of the present invention for 10 weeks (Fig. 42). After EV injection, the organ distribution of the EVs labeled with DiR was evaluated for 24 hours. As a result, in the 223 / F-EV injection group, delivery was primarily to the liver compared to other organs (Figs. 43, 47), and it was confirmed that 223 / F-EVs were delivered to the liver more than control EVs (Fig. 43).
[0267]
[0268] After intravenously injecting PBS, control EVs, or the 223 / F-EVs of the present invention for 10 weeks, mice were sacrificed, and the MASH phenotype was analyzed. Representative liver images showed that jaundice due to fat accumulation was observed in mice fed CDAHFD and injected with PBS; however, when treated with 223 / F-EVs, this jaundice was reversed, indicating an improvement in steatosis. Furthermore, analysis of hematoxylin and eosin (H&E) staining images and the NAFLD activity score (NAS) further confirmed improvements in liver ballooning, steatosis, and inflammation (Fig. 44). Liver weight and intrahepatic triglyceride (TG) levels also decreased, suggesting a reduction in fat content. In addition, the decrease in plasma alanine aminotransferase (ALT) levels, an indicator of liver damage, meant that the improvement in steatosis contributed to the enhancement of liver health (Fig. 45).
[0269]
[0270] In addition, to determine whether FGF21 contained in 223 / F-EV causes side effects such as a decrease in bone density, the tibia of mice was analyzed using micro-CT. As a result, the bone volume fraction of the CDAHFD diet group decreased compared to the normal diet group, which was consistent with results reported in a steatosis-induced liver disease model, and it was confirmed that the bone volume fraction was not affected in the 223 / F-EV injection group of the present invention and the PBS or control-EVs treatment groups (Fig. 46). On the other hand, it was confirmed that the bone volume fraction decreased significantly in mice injected with an FGF21 mimetic (PF-05231023) (Fig. 46).
[0271]
[0272] Based on the above results, it was confirmed that 223 / F-EVs significantly inhibited the progression of MASH in a mouse model fed the CDAHFD diet.
[0273]
[0274] Experimental Example 6. Evaluation of 223 / F-EV for the Treatment of Hepatic Steatosis, Inflammation, and Fibrosis
[0275] Histological changes related to steatosis, fibrosis, and inflammation in the liver were identified after 223 / F-EV treatment.
[0276] Through Oil-Red-O, Picrosirius red, α-SMA, and CD11b staining results, it was confirmed that increased triglyceride content, collagen and α-SMA accumulation, and Kupffer cell recruitment in the CDAHFD model were significantly improved by the 223 / F-EV treatment of the present invention (Fig. 49).
[0277] Changes in mRNA levels of inflammation and fibrosis markers after 223 / F-EV treatment were confirmed using qRT-PCR. It was confirmed that the hepatic levels of inflammation markers (Ccl2, Cxcl2, Cxcl10) and fibrosis markers (Acta2, Col1a1, Col3a1), which were increased by the CDAHFD diet, were significantly reduced by 223 / F-EV treatment (Fig. 51).
[0278] When plasma chemokine concentrations were evaluated by ELISA, it was confirmed that they showed a similar trend to the mRNA levels (Fig. 52). This may be because chemokines derived from tissues other than the liver were detected together, potentially masking changes in liver-derived chemokines.
[0279] To more clearly evaluate systemic inflammation, plasma levels of major inflammatory cytokines TNF-α and IL-6 were measured (Fig. 50). As a result, both cytokines were significantly reduced in the 223 / F-EV treatment group, which supports the anti-inflammatory effect of 223 / F-EV.
[0280] In addition, Western blotting of α-SMA levels confirmed that the increased α-SMA protein levels in the livers of mice fed the CDAHFD diet were significantly reduced after treatment with 223 / F-EV (Fig. 53). Furthermore, the phosphorylation level of ACC1 / 2 (S79) increased with treatment with 223 / F-EV, suggesting that the inhibition of fatty acid biosynthesis contributed to the alleviation of fatty liver disease.
[0281]
[0282] As a result of the above, it was confirmed that the 223 / F-EVs of the present invention can be usefully used for the treatment of MASH because they reduce steatosis, inflammation, and fibrosis markers in a MASH mouse model in the same way as in in vitro experiments.
[0283]
[0284] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.
Claims
1. Extracellular vesicles with FGF21 (fibroblast growth factor 21) attached to their surface.
2. The extracellular vesicle of Claim 1, wherein the FGF21 is connected to the extracellular vesicle through a transmembrane domain.
3. The extracellular vesicle of claim 2, wherein the transmembrane domain comprises one or more transmembrane domains selected from the group consisting of receptor proteins, ion channels, transporters, CDs (cluster of differentiation), and membrane-bound enzymes, or a part thereof.
4. The extracellular vesicle of claim 3, wherein the CD is any one selected from the group consisting of CD3ε, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD63, CD64, CD80, CD86, CD134, CD137, and CD154.
5. The extracellular vesicle of claim 2, wherein the FGF21 is connected to the transmembrane domain directly or through a linker.
6. The extracellular vesicle of Claim 1, comprising one or more miRNAs selected from the group consisting of: miR-1,miR-21,miR-26a,miR-27a,miR-27b,miR-29,miR-29a,miR-34a,miR-96-5p,miR-103,miR-107,miR-122,miR-125b,miR-130,miR-130a-3p,miR-146-5p,miR-152,miR-155 miR-192,miR-194,miR-206,miR-214,miR-223,miR-296,miR-451,miR-542-3p,miR-613,miR-696.
7. The extracellular vesicle of Claim 1, wherein the FGF21 comprises an amino acid sequence represented by SEQ ID NO.
1.
8. The extracellular vesicle of claim 6, wherein the miRNA comprises a nucleotide sequence represented by SEQ ID NO. 8 or 9.
9. The extracellular vesicle of Claim 1, wherein the extracellular vesicle improves steatosis and reduces inflammation and fibrosis.
10. The extracellular vesicle of Claim 1, wherein the extracellular vesicle is isolated from a protein-producing cell line or a mesenchymal stem cell.
11. The extracellular vesicle of claim 10, wherein the cell line for protein production is one or more selected from the group consisting of CHO, HKB11, BHK21, HeLa, HEK293, HEK293FT, HT-1080, PER.C6 and F2N78 cell lines.
12. A pharmaceutical composition for the prevention or treatment of liver disease comprising an extracellular vesicle of any one of claims 1 to 11.
13. A composition according to claim 12, wherein the liver disease is one or more selected from the group consisting of metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic dysfunction-associated steatohepatitis (MASH), alcoholic fatty liver disease (AFLD), alcoholic steatohepatitis (ASH), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and liver fibrosis.
14. Prevention or improvement of liver disease comprising an extracellular vesicle of any one of claims 1 to 11; or a health functional food for improving liver function.
15. Prevention or improvement of liver disease comprising an extracellular vesicle of any one of claims 1 to 11; or a feed composition for improving liver function.