Pharmaceutical composition for preventing or treating sarcopenia

Abstract

The present application relates to a pharmaceutical composition for preventing or treating sarcopenia, comprising estramustine phosphate sodium (EPS) as an active ingredient.

Description

Pharmaceutical composition for the prevention or treatment of sarcopenia

[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of sarcopenia.

[0002] Skeletal muscle accounts for 40-50% of total body weight and plays an important role in maintaining normal physiological states, such as movement, metabolic homeostasis, and heat generation. In addition, as a major energy metabolic tissue, it participates in the absorption and storage of energy metabolic substrates such as glucose, lipids, and amino acids.

[0003] Under normal circumstances, muscle function is regulated through a balance between the rates of protein synthesis and breakdown; however, sarcopenia is induced when the rate of breakdown exceeds the rate of synthesis. Sarcopenia is a disease characterized by a decrease in the size of tissues or organs due to changes in the external and internal environments of muscle tissue, exhibiting features such as muscle fiber contraction, changes in myosin or fiber types, and a net loss of cellular organelles and total protein. Muscle fibers affected by sarcopenia are smaller than normal muscle fibers and appear rounded or angular in shape.

[0004] Mediators of sarcopenia include various factors such as increased fatty acids, increased inflammatory cytokines (TNF-α, IL6, IL-1), increased endogenous endocrine hormones such as glucocorticoid (GC), increased TGFβ superfamily lineage such as myostatin or bone morphogenetic protein (BMP), decreased growth hormone such as insulin-like growth factor-1 (IGF-1), and increased activity of HDAC.

[0005] Glucocorticoids are a type of corticosteroid that acts as an endogenous endocrine hormone released in response to various stress conditions and are widely used as anti-inflammatory agents. However, side effects inducing muscle loss have been reported when used as anti-inflammatory agents. Glucocorticoids induce sarcopenia by decreasing the rate of protein synthesis and increasing the rate of protein degradation; they are known to cause sarcopenia particularly by affecting fast-twitch or type 2 muscle fibers. Types of synthetic glucocorticoids include prednisone, methylprednisolone, and dexamethasone (DEX), among which DEX is frequently used as a sarcopenia-inducing drug.

[0006] Meanwhile, estramustine phosphate sodium (EPS) is known to be a drug that exerts an inhibitory effect on prostate cancer by selectively absorbing into prostate cells, interfering with microtubule dynamics, and reducing plasma levels of testosterone. However, studies regarding sarcopenia caused by DEX are not yet known.

[0007] Accordingly, while conducting research to develop a new drug for the prevention or treatment of sarcopenia, the inventors confirmed that EPS is effective in the prevention or treatment of sarcopenia, thereby completing the present invention.

[0008] Korean Registered Patent No. 10-2625873, which is the background technology of the present invention, relates to a composition for preventing, treating, or improving sarcopenia and a method for diagnosing sarcopenia.

[0009] The present invention provides a pharmaceutical composition for the prevention or treatment of sarcopenia, which is intended to solve the problems of the aforementioned prior art.

[0010] In addition, a kit for the prevention or treatment of sarcopenia comprising the above pharmaceutical composition is provided.

[0011] In addition, a health functional food for the prevention or improvement of sarcopenia is provided.

[0012] However, the technical problems that the embodiments of the present invention aim to solve are not limited to the technical problems described above, and other technical problems may exist.

[0013] As a technical means to achieve the above-mentioned technical problem, the first aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of sarcopenia comprising estramustine phosphate sodium (EPS) as an active ingredient.

[0014] According to one embodiment of the present invention, the pharmaceutical composition may inhibit muscle reduction, but is not limited thereto.

[0015] According to one embodiment of the present invention, the expression of one or more selected from the group consisting of MuRF1, Atrogin-1, myostatin, FoxO1, FoxO3, and FoxO4 may be inhibited by the estramustine phosphate sodium, but is not limited thereto.

[0016] According to one embodiment of the present invention, the size of a myotube induced by sarcopenia may be improved by the estramustine phosphate sodium, but is not limited thereto.

[0017] According to one embodiment of the present invention, the sarcopenia may be induced by dexamethasone, but is not limited thereto.

[0018] According to one embodiment of the present invention, the sarcopenia may be selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscle degenerative atrophy, amyotrophic lateral sclerosis, spinal cord muscle atrophy, and myasthenia gravis, but is not limited thereto.

[0019] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may additionally comprise a pharmaceutically acceptable carrier, but is not limited thereto.

[0020] According to one embodiment of the present invention, the carrier may comprise, but is not limited to, a substance selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, menthol, mineral oil, and combinations thereof.

[0021] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may additionally include a component selected from the group consisting of preservatives, solubilizers, stabilizers, humectants, sweeteners, coloring agents, flavoring agents, salts, buffers, antioxidants, lubricants, emulsifiers, suspending agents, preservatives, and combinations thereof, but is not limited thereto.

[0022] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may be administered by a method selected from the group consisting of intraperitoneal administration, oral administration, inhalation administration, intravenous administration, intramuscular administration, subcutaneous administration, dermal administration, intrauterine administration, tumor administration, rectal administration, and combinations thereof, but is not limited thereto.

[0023] In addition, the second aspect of the present invention provides a kit for the prevention or treatment of sarcopenia comprising a pharmaceutical composition for the prevention or treatment of sarcopenia according to the first aspect of the present invention.

[0024] According to one embodiment of the present invention, the sarcopenia may be induced by dexamethasone, but is not limited thereto.

[0025] According to one embodiment of the present invention, the sarcopenia may be selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscle degenerative atrophy, amyotrophic lateral sclerosis, spinal cord muscle atrophy, and myasthenia gravis, but is not limited thereto.

[0026] In addition, a third aspect of the present invention provides a health functional food for preventing or improving sarcopenia comprising estramustine phosphate sodium (EPS) as an active ingredient.

[0027] The means for solving the problem described above are merely exemplary and should not be interpreted as intended to limit the present invention. In addition to the exemplary embodiments described above, additional embodiments may exist in the drawings and the detailed description of the invention.

[0028] The present invention discovers a new use for estramustine sodium phosphate (EPS), known as a treatment for prostate cancer, and can present it as a preventive or therapeutic agent for sarcopenia. Specifically, the EPS can effectively improve the size of myotubes in dexamethasone-induced sarcopenia, thereby improving the pathological condition of various sarcopenic diseases.

[0029] Furthermore, the aforementioned EPS can effectively prevent or treat sarcopenia by suppressing the expression of sarcopenia-related genes, including MuRF1, Atrogin-1, myostatin, FoxO1, FoxO3, and FoxO4. This implies that more effective therapeutic effects can be expected by regulating genes directly involved in the pathogenesis of sarcopenia.

[0030] Furthermore, since the aforementioned EPS is a drug already approved for the treatment of prostate cancer, drug repurposing could shorten the development process and reduce costs for a treatment for sarcopenia, which could ultimately contribute to the rapid clinical application of the new treatment and improved patient access.

[0031] However, the effects obtainable from this invention are not limited to those described above, and other effects may exist.

[0032] FIG. 1 is a diagram showing the reduction in root canal size in C2C12 myotubes by dexamethasone (DEX) according to one embodiment of the present invention.

[0033] FIG. 2 is a figure showing the increase in expression of MuRF1 and Atrogin-1 at the RNA and protein levels in C2C12 myotubes by dexamethasone (DEX) according to one embodiment of the present invention.

[0034] FIG. 3 is a diagram showing the effect of improving root canal size by estramustine sodium phosphate (EPS) in C2C12 myotubes induced by dexamethasone (DEX) according to one embodiment of the present invention.

[0035] FIG. 4 is a figure showing the inhibitory effect of estramustine sodium phosphate (EPS) on the expression of myostatin, MuRF1, Atrogin-1, FoxO1, FoxO3, and FoxO4 in C2C12 myotubes induced by dexamethasone (DEX) according to one embodiment of the present invention.

[0036] Embodiments of the present invention are described below with reference to the attached drawings so that those skilled in the art can easily implement them. However, the present invention may be embodied in various different forms and is not limited to the embodiments described herein. Furthermore, in order to clearly explain the present invention in the drawings, parts unrelated to the explanation have been omitted, and similar parts throughout the specification are denoted by similar reference numerals.

[0037] Throughout this specification, when a part is described as being "connected" to another part, this includes not only cases where they are "directly connected," but also cases where they are "electrically connected" with other elements interposed between them.

[0038] Throughout the entire specification, when a component is described as being located "on," "on top," "on top," "under," "on bottom," or "on bottom" of another component, this includes not only cases where the component is in contact with the other component but also cases where another component exists between the two components.

[0039] Throughout this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0040] As used herein, terms of degree such as “about,” “substantially,” etc., are used to mean at or near the stated value when inherent manufacturing and material tolerances are presented in the stated meaning, and are used to prevent unscrupulous infringers from unfairly exploiting the disclosure in which precise or absolute values ​​are mentioned to aid in understanding the present invention. Furthermore, throughout this specification, “a step of” or “a step of” does not mean “a step for”.

[0041] Throughout this specification, the term “combination thereof” included in the Markush-type expression means one or more mixtures or combinations selected from the group consisting of the components described in the Markush-type expression, and means including one or more selected from the group consisting of said components.

[0042] Throughout the entire specification, the description "A and / or B" means "A, B, or A and B".

[0043] Hereinafter, the composition for the prevention or treatment of sarcopenia of the present invention will be described in detail with reference to the embodiments, examples, and drawings. However, the present invention is not limited to these embodiments, examples, and drawings.

[0044]

[0045] As a technical means to achieve the above-mentioned technical problem, the first aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of sarcopenia comprising estramustine phosphate sodium (EPS) as an active ingredient.

[0046] The present invention discovers a new use for estramustine sodium phosphate (EPS), known as a treatment for prostate cancer, and can present it as a preventive or therapeutic agent for sarcopenia. Specifically, the EPS can effectively improve the size of myotubes in dexamethasone-induced sarcopenia, thereby improving the pathological condition of various sarcopenic diseases.

[0047] Furthermore, the aforementioned EPS can effectively prevent or treat sarcopenia by suppressing the expression of sarcopenia-related genes, including MuRF1, Atrogin-1, myostatin, FoxO1, FoxO3, and FoxO4. This implies that more effective therapeutic effects can be expected by regulating genes directly involved in the pathogenesis of sarcopenia.

[0048] Furthermore, since the aforementioned EPS is a drug already approved for the treatment of prostate cancer, drug repurposing could shorten the development process and reduce costs for a treatment for sarcopenia, which could ultimately contribute to the rapid clinical application of the new treatment and improved patient access.

[0049] According to one embodiment of the present invention, the pharmaceutical composition may inhibit muscle reduction, but is not limited thereto.

[0050] The pharmaceutical composition of the present invention can effectively inhibit muscle loss by inhibiting protein degradation of skeletal muscle and promoting protein synthesis. This muscle loss-inhibiting effect can help maintain overall muscle mass and preserve muscle strength.

[0051] According to one embodiment of the present invention, the expression of one or more selected from the group consisting of MuRF1, Atrogin-1, myostatin, FoxO1, FoxO3, and FoxO4 may be inhibited by the estramustine phosphate sodium, but is not limited thereto.

[0052] The estramustine phosphate sodium of the present invention can regulate the expression of major genes associated with sarcopenia. In particular, it can exhibit a preventive or therapeutic effect against sarcopenia by regulating the expression of ubiquitin ligases such as MuRF1 and Atrogin-1, which are involved in muscle protein degradation, myostatin, a muscle growth inhibitor, and transcription factors FoxO1, FoxO3, and FoxO4.

[0053] According to one embodiment of the present invention, the size of a myotube induced by sarcopenia may be improved by the estramustine phosphate sodium, but is not limited thereto.

[0054] The estramustine phosphate sodium of the present invention can improve the morphological characteristics of root canals induced by sarcopenia. By restoring the diameter and size of root canals reduced due to sarcopenia, it can contribute to the maintenance of normal muscle structure and function.

[0055] According to one embodiment of the present invention, the sarcopenia may be induced by dexamethasone, but is not limited thereto.

[0056] The present invention can be applied to the prevention or treatment of sarcopenia induced by glucocorticoids such as dexamethasone. Glucocorticoids are used to treat various diseases but can cause sarcopenia, so the composition of the present invention can be usefully used to reduce side effects caused by this.

[0057] According to one embodiment of the present invention, the sarcopenia may be selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscle degenerative atrophy, amyotrophic lateral sclerosis, spinal cord muscle atrophy, and myasthenia gravis, but is not limited thereto.

[0058] The pharmaceutical composition of the present invention can be applied to the prevention or treatment of sarcopenia caused by various factors. For example, it can be applied to the treatment of primary muscle diseases such as muscular atrophy, myasthenia gravis, and muscular dystrophy, as well as secondary muscle diseases such as muscle weakness, muscular degenerative atrophy, amyotrophic lateral sclerosis, spinal muscular atrophy, and myasthenia gravis.

[0059] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may additionally comprise a pharmaceutically acceptable carrier, but is not limited thereto.

[0060] The pharmaceutical composition of the present invention may be formulated with a pharmaceutically acceptable carrier to ensure effective drug delivery and stability. The use of such a carrier can improve the bioavailability of the drug and increase the convenience of administration.

[0061] According to one embodiment of the present invention, the carrier may comprise, but is not limited to, a substance selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, menthol, mineral oil, and combinations thereof.

[0062] The carrier used in the present invention can be appropriately selected according to the characteristics of the drug and the route of administration. For example, various sugars, sugar alcohols, binders, inorganic salts, fillers, disintegrants, solvents, etc., may be used, and these may be used alone or in combination.

[0063] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may additionally include a component selected from the group consisting of preservatives, solubilizers, stabilizers, humectants, sweeteners, coloring agents, flavoring agents, salts, buffers, antioxidants, lubricants, emulsifiers, suspending agents, preservatives, and combinations thereof, but is not limited thereto.

[0064] The pharmaceutical composition of the present invention may include various additives to improve the stability and efficacy of the formulation. These additives may help improve the stability, solubility, and bioavailability of the drug, and improve the physical properties of the formulation.

[0065] According to one embodiment of the present invention, the pharmaceutical composition for the prevention or treatment of sarcopenia may be administered by a method selected from the group consisting of intraperitoneal administration, oral administration, inhalation administration, intravenous administration, intramuscular administration, subcutaneous administration, dermal administration, intrauterine administration, tumor administration, rectal administration, and combinations thereof, but is not limited thereto.

[0066] The pharmaceutical composition of the present invention may be administered via various routes depending on the therapeutic purpose and the patient's condition. Such routes of administration may be selected to achieve effective drug delivery and optimal therapeutic effect, and two or more routes of administration may be used in combination as needed.

[0067]

[0068] In addition, the second aspect of the present invention provides a kit for the prevention or treatment of sarcopenia comprising a pharmaceutical composition for the prevention or treatment of sarcopenia according to the first aspect of the present invention.

[0069] Regarding the kit for the prevention or treatment of sarcopenia according to the second aspect of the present invention, detailed descriptions of parts that overlap with the first aspect of the present invention have been omitted, but even if such descriptions are omitted, the contents described in the first aspect of the present invention may be applied equally to the second aspect of the present invention.

[0070] According to one embodiment of the present invention, the sarcopenia may be induced by dexamethasone, but is not limited thereto.

[0071] According to one embodiment of the present invention, the sarcopenia may be selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscle degenerative atrophy, amyotrophic lateral sclerosis, spinal cord muscle atrophy, and myasthenia gravis, but is not limited thereto.

[0072] In addition, a third aspect of the present invention provides a health functional food for preventing or improving sarcopenia comprising estramustine phosphate sodium (EPS) as an active ingredient.

[0073] Regarding the health functional food for preventing or improving sarcopenia according to the third aspect of the present invention, detailed descriptions of parts that overlap with the first and / or second aspects of the present invention have been omitted, but even if such descriptions have been omitted, the contents described in the first and / or second aspects of the present invention may be applied equally to the third aspect of the present invention.

[0074] The present invention is to be explained in more detail through the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0075]

[0076] [Experimental Method]

[0077] Cell lines and cell cultures

[0078] Myoblast C2C12 was purchased from the American Type Culture Collection (ATCC) and cultured in Dulbecco's Modified Eagle's Medium (DMEM-high glucose) supplemented with 10% Fetal bovine serum (FBS) and antibiotics (10 μg / mL Streptomycin and 100 IU / mL Penicillin) in an incubator at 37°C under 5% CO2 conditions. Subsequently, to induce differentiation into myotubes, the medium was replaced daily for 5 days with DMEM-high glucose supplemented with 2% Horse serum.

[0079] Phalloidin and DAPI staining

[0080] C2C12 myotubes were fixed with PBS containing 4% paraformaldehyde and stained with Phalloidin and DAPI solution.

[0081] Reverse Transcriptase-quantitative polymerase chain reaction (RT-qPCR)

[0082] Total RNA was purified from C2C12 using RNAiso Plus reagent (Takara Bio, Shiga, Japan). cDNA was synthesized using the AMV reverse transcriptase and random 9-mer provided with the TaKaRa RNA PCR Kit (Version 3.0; TaKaRa Bio, Shiga, Japan). The primer set for PCR amplification is listed in Table 1 below, and RT-qPCR was performed using SYBR Green (TaKaRa Bio) on the Thermo Fisher Scientific QuantStudio 1 Real-Time PCR system. The relative amount of amplified DNA was analyzed using the software bundled with the Thermo Fisher Scientific QuantStudio 1 Real-Time PCR system and quantified to the level of mouse 36B4 mRNA.

[0083] GeneGenBank Accession NoForward (5'-3')Reverse (5'-3')FoxO3aNM_019740.2TGGATAGTCTGCATGGGTGA CTTCCCATATACCGCCAAGAAtrogin1NM_026346.3GCAAACACTGCCACATTCTCT CTTGAGGGGGAAAGTGAGACGMuRF1NM_001039048.2AGGACTCCTGCAGAGTGACCA TTCTCGTCCAGGATGGCGTAMyostatinNM_010834.3GCAGTCAAGCCCAAAGTCTCCTGTAACCTTCCCAGGACCA36B4NM_007475.5CTGGAGAAACTGCTGCCTCA TCCACAGACAATGCCAGGACFoxO1NM_019739.3TGCTCATAAAGTCGGTGCTGAACCAGTCCAACTCGACCACFoxO4NM_018789.2ACCCTTCTCTGCTGACAAAGGTCTCTCCGGCTTCTCTTT

[0084] [Example 1] Construction of a sarcopenia model

[0085] To establish a sarcopenia model induced by DEX treatment, C2C12 cells were first fully differentiated for 5 days. Subsequently, C2C12 myotubes were treated with DEX for 36 hours, and Phalloidin and DAPI staining were performed. Analysis was then conducted using a confocal microscope.

[0086] FIG. 1 is a diagram showing the reduction in root canal size in C2C12 myotubes by dexamethasone (DEX) according to one embodiment of the present invention.

[0087] Referring to Figure 1, it was confirmed that the width and size of the root canal were reduced in the C2C12 root canal induced by dexamethasone (DEX).

[0088] [Example 2] Confirmation of sarcopenia-related gene expression

[0089] Experiments were conducted to confirm changes in the expression of sarcopenia-related genes induced by DEX. First, differentiated C2C12 myotubes were treated with 5, 10, and 20 μM of DEX for 36 hours. Subsequently, RNA was extracted from C2C12 myotubes, and RT-qPCR was performed using MuRF1 and Atrogin-1 primers. *P < 0.05. **P<0.01.***P<0.001.

[0090] FIG. 2 is a figure showing the increase in expression of MuRF1 and Atrogin-1 at the RNA and protein levels in C2C12 myotubes by dexamethasone (DEX) according to one embodiment of the present invention.

[0091] Referring to Figure 2, it was confirmed that the expression of MuRF1 and Atrogin-1 was increased at the RNA and protein levels by DEX.

[0092] [Example 3] Confirmation of the sarcopenia-improving effect of EPS

[0093] Experiments were conducted to confirm the therapeutic effect of EPS on DEX-induced sarcopenia. First, C2C12 cells were fully differentiated for 5 days. Subsequently, C2C12 myotubes were treated with DEX and EPS (2 μM and 4 μM) for 36 hours. Afterward, Phalloidin and DAPI staining were performed, and analysis was conducted using a confocal microscope.

[0094] FIG. 3 is a diagram showing the effect of improving root canal size by estramustine sodium phosphate (EPS) in C2C12 myotubes induced by dexamethasone (DEX) according to one embodiment of the present invention.

[0095] Referring to Figure 3, it was confirmed that the width and size of the root canal were improved in the C2C12 root canal induced by DEX with estramustine sodium phosphate (EPS).

[0096] [Example 4] Confirmation of the regulatory effect of EPS on sarcopenia-related genes

[0097] Experiments were conducted to confirm the regulatory effects of EPS on sarcopenia-related gene expression. First, differentiated C2C12 myotubes were pretreated with 2 μM and 4 μM EPS, followed by treatment with DEX for 36 hours. Subsequently, RNA was extracted from C2C12 myotubes, and RT-qPCR was performed using MuRF1, Atrogin-1, FoxO1, FoxO3, and FoxO4 primers. **P < 0.01.

[0098] FIG. 4 is a figure showing the inhibitory effect of estramustine sodium phosphate (EPS) on the expression of myostatin, MuRF1, Atrogin-1, FoxO1, FoxO3, and FoxO4 in C2C12 myotubes induced by dexamethasone (DEX) according to one embodiment of the present invention.

[0099] Referring to Figure 4, it was confirmed that EPS inhibited the increase in expression of myostatin, MuRF1, Atrogin-1, FoxO1, FoxO3, and FoxO4 induced by DEX in C2C12 myocardial canals.

[0100] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical concept or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. For example, each component described as a single unit may be implemented in a distributed manner, and components described as distributed may likewise be implemented in a combined form.

[0101] The scope of the present invention is defined by the claims set forth below rather than by the detailed description above, and all modifications or variations derived from the meaning and scope of the claims and the concept of equivalents thereof should be interpreted as being included within the scope of the present invention.

Claims

1. Containing estramustine phosphate sodium (EPS) as an active ingredient, Pharmaceutical composition for the prevention or treatment of sarcopenia.

2. In Paragraph 1, The above pharmaceutical composition inhibits muscle reduction, Pharmaceutical composition for the prevention or treatment of sarcopenia.

3. In Paragraph 1, The expression of one or more selected from the group consisting of MuRF1, Atrogin-1, myostatin, FoxO1, FoxO3, and FoxO4 is inhibited by the above-mentioned estramustine phosphate sodium, Pharmaceutical composition for the prevention or treatment of sarcopenia.

4. In Paragraph 1, The improvement in the size of the myotube induced by sarcopenia due to the above-mentioned estramustine sodium phosphate, Pharmaceutical composition for the prevention or treatment of sarcopenia.

5. In Paragraph 1, The above sarcopenia is induced by dexamethasone, Pharmaceutical composition for the prevention or treatment of sarcopenia.

6. In Paragraph 1, The above sarcopenia is selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscular degenerative atrophy, amyotrophic lateral sclerosis, spinal muscular atrophy, and myasthenia gravis. Pharmaceutical composition for the prevention or treatment of sarcopenia.

7. In Paragraph 1, A pharmaceutical composition for the prevention or treatment of sarcopenia, wherein the above pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

8. In Paragraph 7, A pharmaceutical composition for the prevention or treatment of sarcopenia, wherein the carrier comprises a substance selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, menthol, mineral oil, and combinations thereof.

9. In Paragraph 7, The above pharmaceutical composition for the prevention or treatment of sarcopenia further comprises a component selected from the group consisting of preservatives, solubilizers, stabilizers, humectants, sweeteners, coloring agents, flavoring agents, salts, buffers, antioxidants, lubricants, emulsifiers, suspending agents, preservatives, and combinations thereof.

10. In Paragraph 7, The above pharmaceutical composition for the prevention or treatment of sarcopenia is administered by a method selected from the group consisting of intraperitoneal administration, oral administration, inhalation administration, intravenous administration, intramuscular administration, subcutaneous administration, dermal administration, intrauterine administration, tumor administration, rectal administration, and combinations thereof.

11. A kit for the prevention or treatment of sarcopenia comprising a pharmaceutical composition for the prevention or treatment of sarcopenia according to any one of claims 1 to 10.

12. In Paragraph 11, The above sarcopenia is induced by dexamethasone, Kit for the prevention or treatment of sarcopenia.

13. In Paragraph 11, The above sarcopenia is selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscle weakness, muscular degenerative atrophy, amyotrophic lateral sclerosis, spinal muscular atrophy, and myasthenia gravis. Kit for the prevention or treatment of sarcopenia.

14. Containing Estramustine phosphate sodium (EPS) as an active ingredient, Health functional food for the prevention or improvement of sarcopenia.

Images