Codon optimization technology for high gene expression and applications thereof

The codon optimization method enhances recombinant protein expression by prioritizing cytosine and guanine in specific codon positions, addressing the inconsistency of previous methods and improving translation efficiency for diverse plant hosts, facilitating cost-effective production of pharmaceuticals.

WO2026101240A1PCT designated stage Publication Date: 2026-05-15POSTECH ACADEMY INDUSTRY FOUNDATION +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/018089
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-05
Filing Date
2025-11-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing codon optimization methods for recombinant protein expression in host cells are not universally effective, as they rely solely on tRNA frequency and do not account for factors like mRNA secondary structure and protein folding, leading to inconsistent expression levels across different host systems.

Method used

A codon optimization method prioritizing cytosine (C) for the third base of specific codons and guanine (G) for others, such as Ala, Leu, Ile, Val, Ser, Pro, Thr, Tyr, His, Asn, Asp, Cys, Arg, Phe, and Gly, and guanine (G) for Gln and Glu, to enhance translation efficiency.

Benefits of technology

Significantly improves recombinant protein expression levels in various plant species by maximizing translation efficiency, overcoming limitations of previous methods and enabling cost-effective mass production of pharmaceuticals like vaccines and antibodies in plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025018089_15052026_PF_FP_ABST
    Figure KR2025018089_15052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a codon optimization technology for achieving high expression of recombinant proteins and applications thereof. Specifically, the expression efficiency of recombinant proteins in host cells, particularly plant cells, can be dramatically improved by systematically modifying the third nucleotide of codons constituting a gene. The present invention enables large-scale production of vaccines or therapeutic protein drugs that have been difficult to commercialize due to low expression levels in the past, thereby providing new possibilities for the development of protein-based therapeutics.
Need to check novelty before this filing date? Find Prior Art

Description

Codon Optimization Technology for High Gene Expression and Its Applications

[0001] The present invention relates to a technology for producing recombinant proteins in host cells, and more specifically, to a codon optimization technology that dramatically enhances the expression of recombinant proteins in host cells by systematically changing specific bases of codons that constitute genes, and the application thereof.

[0002] Generally, genes are converted into mRNA through the process of transcription, and this mRNA is translated by ribosomes to synthesize proteins. During this process, the base sequence of mRNA is converted into the amino acid sequence of a protein, which is accomplished by a codon consisting of three bases specifying one amino acid. That is, starting from the first start codon (ATG) in the gene's base sequence, every three bases form a codon, and these codons are arranged continuously in a non-overlapping manner to determine the amino acid sequence of the protein.

[0003] There are a total of 20 types of amino acids that make up proteins, including stop codons that terminate translation. However, there are a total of 64 possible codon combinations, which is more than the number of amino acids. Therefore, a single amino acid can be specified by two or more codons, and in some cases, up to six codons may specify a single amino acid. Multiple codons that encode the same amino acid in this way are called synonymous codons, and due to the existence of these synonymous codons, the gene base sequences of the same protein can vary. In most cases, synonymous codons differ at the third base, but amino acids with six codons, such as arginine, serine, and leucine, also differ at the first and second bases.

[0004] To date, no clear rules regarding which codons are selected for specific amino acids during the gene generation process are known. However, it is well known that protein expression efficiency varies depending on the combination of codons used, even when encoding the same protein. In particular, some synonymous codons exhibit higher protein production efficiency compared to others, and expression levels can be enhanced by reconstructing the gene sequence using these codons. This process is generally referred to as codon optimization. Codon optimization is a widely used strategy when redesigning genes to express recombinant proteins in specific host cells.

[0005] Previously known codon optimization methods are primarily based on the frequency of tRNAs expressed in host cells. That is, they analyze the gene copy number or expression level of tRNAs with anticodons complementary to specific codons, and then replace rare codons with low usage frequency with more frequently used codons. This approach has been reported to increase protein productivity in various cases, such as the expression of insect control proteins in tomatoes and tobacco, human proteins in E. coli, and photoproteins and luciferases in mammalian cells.

[0006] However, codon optimization is not always successful. For example, there have been reported cases where HPV-16 L1 protein expression in plants did not improve compared to the version using human codons, despite the application of plant-specifically optimized codons (Maclean et al., 2007, Journal of General Virology, 88(5), 1460-1469). As such, there are cases where it is difficult to predict expression levels using only simple codon frequency-based approaches; accordingly, new concepts such as codon harmonization, which considers mRNA secondary structure, protein folding, and function, have been proposed (Webster et al., 2017, Biotechnology and Bioengineering, 114(2), 492-502; Mauro, 2018, BioDrugs, 32(3), 183-191).

[0007] In summary, despite various studies and attempts made to date, universal rules for codon optimization have not yet been established, and in particular, general principles applicable to recombinant protein expression across different host systems are not known.

[0008] The present invention aims to provide a codon optimization method capable of enhancing recombinant protein expression in host cells and a method for utilizing the same.

[0009] To achieve the above objective, the present invention provides a gene sequence encoding a recombinant protein, wherein the third base of the codon constituting the gene sequence is cytosine (C) in priority and guanine (G) in second priority.

[0010] In the present invention, the gene sequence may be characterized in that the third base of a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) is cytosine (C), and the third base of a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K), and Glu(E) is guanine (G).

[0011] In the present invention, the gene sequence may be characterized in that the third base of the codon encoding Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) is cytosine (C), and the third base of the codon encoding Gln(Q), Lys(K), and Glu(E) is guanine (G).

[0012] In the present invention, the gene sequence may be characterized in that the base sequence of the codon encoding Ser(S) is TCC.

[0013] The present invention also provides a codon optimization method for redesigning a gene sequence encoding the same amino acid sequence, comprising the step of replacing a codon in which the third base in the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) or guanine (G) among synonymous codons of the amino acid encoded by the codon.

[0014] In the present invention, the codon optimization method may be characterized by including the step of replacing a codon in which the third base in the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon.

[0015] The present invention may be characterized by including the step of preferentially substituting a codon in which the third base of the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon, and secondarily substituting the codon not substituted with cytosine (C) with a codon in which the third base is guanine (G).

[0016] In the present invention, the codon optimization method may be characterized by including the step of replacing a codon in which the third base in the gene sequence is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon.

[0017] In the present invention, the codon optimization method may be characterized by including the step of preferentially substituting a codon in which the third base in the gene sequence is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon, and secondarily substituting a codon that is not substituted with cytosine (C) with a codon in which the third base is guanine (G).

[0018] In the present invention, the codon optimization method may be characterized by including the step of replacing the codon that encrypts Ser(S) with TCC.

[0019] In the present invention, the codon optimization method may be characterized by including the step of substituting a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) with a synonymous codon in which the third base is cytosine (C).

[0020] In the present invention, the codon optimization method may be characterized by including the step of substituting a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K), and Glu(E) with a synonymous codon in which the third base is guanine (G).

[0021] In the present invention, the codon optimization method may be intended to enhance protein expression by improving gene translation efficiency in a host cell.

[0022] In the present invention, the host cell may be characterized as being a plant cell.

[0023] In the present invention, the plant cell may be characterized as being a plant cell derived from one or more plants selected from food crops including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot; special crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanuts, and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, grapes, citrus fruits, persimmons, plums, apricots, lemons, and bananas; and floricultural plants including roses, carnations, chrysanthemums, lilies, sunflowers, cosmos, and tulips.

[0024] The present invention also provides a recombinant expression vector loaded with the gene sequence or the gene sequence redesigned by the codon optimization method.

[0025] The present invention also provides a transformed plant cell or a transformed plant body into which the recombinant expression vector is introduced.

[0026] In the present invention, the transformed plant cell or transformed plant is

[0027] (i) Reprogramming of plant traits;

[0028] (ii) gene editing; and / or

[0029] (iii) It may be characterized as being for the production of recombinant proteins.

[0030] The present invention also provides a method for producing a recombinant protein, comprising the following steps:

[0031] (a) a step of culturing the above-mentioned transformed plant cell or transformed plant body; and

[0032] (b) A step of recovering recombinant protein from the cultured transformed plant cells or transformed plants.

[0033] In the present invention, the plant may be characterized as being one or more plants selected from food crops including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot; special crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut, and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, grapes, citrus fruits, persimmons, plums, apricots, lemons, and bananas; and floricultural plants including roses, carnations, chrysanthemums, lilies, sunflowers, cosmos, and tulips.

[0034] According to the present invention, the expression efficiency of recombinant proteins in plant cells can be dramatically improved by optimizing the codons of genes. This allows for a significant increase in the productivity of proteins that were previously difficult to commercialize due to low expression levels, and can be utilized as a new platform technology for safely and inexpensively mass-producing various pharmaceuticals, such as vaccines, antibodies, and therapeutic proteins, in plants. Therefore, the present invention has the advantage of overcoming the limitations of plant-based protein production systems and functioning as an innovative production platform for the production of next-generation biopharmaceuticals.

[0035] Figure 1 shows that an increase in A and T content at the third base of a codon in Nicotiana benthamiana reduces protein expression. Figure 1A shows the DNA length, codon adaptation index (CAI), total GC content (%GC), GC content at the first base position (%GC1), GC content at the second base position (%GC2), and GC content at the third base position (%GC3) of the GFP wild type (GFP_V1) and variants (GFP_V2, GFP_V3, respectively), and these values ​​were calculated using the CAIcal program (http: / genomes.urv.es / CAIcal). Figure 1B shows the results of a Western blot comparison of GFP protein expression levels according to the GFP wild type (GFP_V1) and variants (GFP_V2, GFP_V3, respectively), and Figure 1C shows a graph of the quantitative analysis of Western blot band intensity.

[0036] Figure 2 shows that the decrease in GFP protein expression in Figure 1 in Nicotiana benthamiana is independent of transcription levels. Figure 2A shows the results of comparing the transcription levels of the GFP genes in V1, V2, and V3, respectively, using qRT-PCR. Figure 2B shows the results of measuring the transcription levels of the BiP gene using the same samples used in Figure 2A.

[0037] Figure 3 shows that an increase in C and G content at the third base of a codon increases protein expression in Nicotiana benthamiana. Figure 3A displays the DNA length, Codon Adaptation Index (CAI), total GC content (%GC), GC content at the first base position (%GC1), GC content at the second base position (%GC2), and GC content at the third base position (%GC3) of conventionally codon-optimized GFP (GFP_V4) and variants (GFP_V5 and GFP_V6, respectively), and these values ​​were calculated using the CAIcal program (http: / genomes.urv.es / CAIcal). Figure 3B shows the results of a Western blot comparison of GFP protein expression levels according to GFP_V4, GFP_V5, and GFP_V6, respectively.

[0038] Figure 4 shows the design of synonymous codon variants of the H9N2 HA gene. Figure 4A is a graph comparing the change in the composition of the first bases (A1, T1, C1, G1) of the codons in the conventionally codon-optimized sequence of H9N2 HA (H9N2_V1) and its variants (H9N2_V2 - H9N2_V6) with the wild-type sequence, and Figure 4B is a graph comparing the change in the composition of the third bases (A3, T3, C3, G3) of the codons in the H9N2 HA codon-optimized sequence (V1) and its variants (V2 - V6) with the wild-type sequence.

[0039] Figure 5 compares protein expression levels according to synonym codon variants of the H9N2 HA gene in Nicotiana benthamiana. Figure 5A shows the results of comparing H9N2 HA protein expression levels according to the H9N2 HA codon optimized sequence (V1) and its variants (V2-V6) using Western blot, and Figure 5B shows a graph of quantitative analysis of Western blot band intensity.

[0040] Figure 6 shows that the decrease in H9N2 HA protein expression in Figure 5 in Nicotiana benthamiana is independent of transcription levels. Figure 6A shows the results of comparing the transcription levels of the H9N2 HA gene in V1–V6 respectively using qRT-PCR. Figure 6B shows the results of measuring the transcription levels of the BiP gene using the same samples used in Figure 6A.

[0041] Figure 7 shows the design of synonymous codon variants of the H5N6 HA gene and a comparison of protein expression levels in Nicotiana benthamiana. Figure 7A shows the DNA length, codon adaptation index (CAI), total GC content (%GC), GC content at the first base position (%GC1), GC content at the second base position (%GC2), and GC content at the third base position (%GC3) of the conventionally codon-optimized sequence of H5N6 HA (H5N6_V1) and its variants (H5N6_V2 - H5N6_V6), and these values ​​were calculated using the CAIcal program (http: / genomes.urv.es / CAIcal). Figure 7B shows the results of comparing the H5N6 HA protein expression levels according to the H5N6 HA codon optimized sequence (V1) and its variants (V2-V6) using Western blot, and Figure 7C shows a graph of the quantitative analysis of Western blot band intensity.

[0042] Figure 8 shows the design of synonymous codon variants of the H7N9 HA gene and a comparison of protein expression levels in Nicotiana benthamiana. Figure 8A shows the DNA length, codon adaptation index (CAI), total GC content (%GC), GC content at the first base position (%GC1), GC content at the second base position (%GC2), and GC content at the third base position (%GC3) of the conventionally codon-optimized sequence of H7N9 HA (H7N9_V1) and its variants (H7N9_V2 - H7N9_V7), and these values ​​were calculated using the CAIcal program (http: / genomes.urv.es / CAIcal). Figure 8B shows the results of comparing the H7N9 HA protein expression levels according to the H7N9 HA codon optimized sequence (V1) and its variants (V2-V7) using Western blot, and Figure 8C shows a graph of the quantitative analysis of Western blot band intensity.

[0043] Figure 9 shows the results of comparing protein expression levels in Nicotiana benthamiana by Western blot after codon optimization (L1R-C) of the gene encoding the vaccinia virus antigen protein L1R in the conventional manner or in the manner of the present invention (L1R-CC).

[0044] Figure 10 shows the results of comparing protein expression levels in Nicotiana benthamiana by Western blot after codon optimization (DAL-C) of the gene encoding the vaccinia virus antigen protein DAL in the conventional way or in the way of the present invention (DAL-CC).

[0045] Figure 11 shows the results of comparing protein expression levels in Nicotiana benthamiana by CBC staining after codon optimization (L1R-C) of the gene encoding porcine circovirus antigen protein PCV2d in the conventional manner or in the manner of the present invention (L1R-CC).

[0046] FIG. 12 shows a graph of quantitative analysis of band intensities and comparison of protein expression levels by Western blot in Oryza sativa after codon optimization of the H5N6 HA gene using a conventional method (H5N6_V1) or the method of the present invention (H5N6_V6).

[0047] FIG. 13 shows a graph of the quantitative analysis of band intensity and comparison of protein expression levels in Oryza sativa using Western blot after codon optimization (L1R-C) of the gene encoding the vaccinia virus antigen protein L1R in the conventional manner or in the manner of the present invention (L1R-CC).

[0048] The present invention will be described in more detail below.

[0049] Previously known codon optimization methods were based on the frequency of tRNA expressed in host cells, analyzing the number of gene copies or expression levels of tRNAs with anticodons complementary to specific codons to replace rare codons with more frequently used codons. However, this approach alone had limitations in improving the expression levels of recombinant proteins to a commercially useful range.

[0050] In this invention, a new codon optimization technique was developed to dramatically improve the expression of recombinant proteins by maximizing the translation efficiency of genes in host cells, particularly plant cells. This invention revealed that the increase in protein expression is not directly correlated with the mRNA transcription level, and that the composition of the third base of a codon is a key determinant of translation efficiency.

[0051] Specifically, when applying the 'C3 preference rule' which preferentially substitutes codons with adenine (A), thymine (T), and / or guanine (G) as the third base of codons encoding Ala (A), Leu (L), Ile (I), Val (V), Ser (S), Pro (P), Thr (T), Tyr (Y), His (H), Asn (N), Asp (D), Cys (C), Arg (R), Phe (F), and Gly (G) with codons with cytosine (C) as the third base among synonymous codons of the corresponding amino acid, a significant improvement in expression compared to the conventional codon optimization method was confirmed in various proteins such as GFP protein, influenza HA (H9N2, H5N6, H7N9), vaccinia virus antigen (L1R, DAL), and porcine circovirus antigen (PCV2d).

[0052] In addition, as a result of applying the sequence optimized in this manner (H5N6 HA and L1R), protein expression levels were significantly increased in the expression system of not only tobacco (Nicotiana benthamiana) but also rice (Oryza sativa), which proved that the principle of the present invention is a universal technology applicable to all plant species.

[0053] Accordingly, in one aspect, the present invention relates to a codon-optimized gene sequence.

[0054] The above codon-optimized gene sequence may be characterized as a gene sequence redesigned to enhance protein expression levels in host cells.

[0055] In the present invention, the gene sequence may be a gene sequence encoding a recombinant protein, wherein the third base of a codon constituting the gene sequence is preferentially substituted with cytosine (C) when possible, and substituted with guanine (G) when substitution with cytosine (C) is impossible because no synonymous codon exists.

[0056] Specifically, the gene sequence may be a gene sequence encoding a recombinant protein, which preferentially includes a synonym codon in which the third base of the codon constituting the gene sequence is cytosine (C), and secondarily includes a synonym codon in which the third base of the codon is guanine (G) in the case of amino acids for which cytosine (C) cannot be used as a synonym codon (e.g., Gln (Q), Lys (K), and Glu (E)).

[0057] In an embodiment, the third base of a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) in the gene sequence may be cytosine (C), and the third base of a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K), and Glu(E) may be guanine (G).

[0058] In a more specific embodiment, the third base of the codons encoding Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) in the gene sequence may be cytosine (C), and the third base of the codons encoding Gln(Q), Lys(K), and Glu(E) may be guanine (G).

[0059] In the present invention, the term “one or more amino acids” may mean one or more groups of amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), Gly(G), Gln(Q), Lys(K), and Glu(E) (e.g., Ala(A) group, Leu(L) group, Ile(I) group, etc., or any combination thereof) or one or more individual amino acids belonging to said group (e.g., Ala(A), Leu(L), Ile(I), etc., or any combination thereof).

[0060] In one embodiment, the gene sequence may have a codon encoding Ser(S) that is TCC. Specifically, in the gene sequence information redesigned according to the present invention, if the codon encoding Ser(S) is AGC, the codon may be replaced with TCC.

[0061] The preferred gene sequence information according to the present invention is such that the codons encoding Ala(A), Leu(L), Ile(I), Val(V), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) are synonymous codons in which the third base is cytosine (C), the codons encoding Gln(Q), Lys(K), and Glu(E) are synonymous codons in which the third base is guanine (G), and the codon encoding Ser(S) may be a TCC.

[0062] When recombinant proteins are produced in host cells by introducing such gene sequence information, the expression level of the recombinant protein within the host cell can be significantly enhanced.

[0063] In the present invention, the gene sequence may be provided as gene sequence information.

[0064] Accordingly, the present invention relates, in another aspect, to a codon optimization method for enhancing recombinant protein expression in host cells.

[0065] Specifically, the codon optimization method of the present invention, in a codon optimization method for redesigning a gene sequence encoding the same amino acid sequence, comprises the step of replacing a codon in which the third base in the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) or guanine (G) among synonymous codons of the amino acid encoded by the said codon.

[0066] In the present invention, the codon optimization method may include the step of replacing a codon in which the third base in the gene sequence is adenine (A) and / or a thymine (T) codon with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon.

[0067] In the present invention, the codon optimization method may include the step of preferentially substituting a codon in which the third base in the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon, and in the case of a codon that is not substituted with cytosine (C) due to the absence of a corresponding synonymous codon (e.g., a codon encoding Gln (Q), Lys (K), and Glu (E)), substituting it with a codon in which the third base is guanine (G).

[0068] In the present invention, the codon optimization method may include the step of replacing a codon in which the third base in the gene sequence is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon.

[0069] In the present invention, the codon optimization method may include the step of preferentially substituting a codon in which the third base in the gene sequence is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among the synonymous codons of the amino acid encoded by the codon, and in the case of a codon that is not substituted with cytosine (C) due to the absence of a corresponding synonymous codon (e.g., a codon encoding Gln (Q), Lys (K), and Glu (E)), substituting it secondarily with a synonymous codon in which the third base is guanine (G).

[0070] In the present invention, the codon optimization method may additionally include the step of substituting the codon with TCC when the codon in the gene sequence is AGC.

[0071] In one embodiment, the codon optimization method may include the step of substituting a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) with a synonymous codon in which the third base is cytosine (C).

[0072] In another embodiment, the codon optimization method may include the step of substituting a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K) and Glu(E) with a synonymous codon in which the third base is guanine (G).

[0073] In another aspect, the codon optimization method may include the step of replacing a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Phe(F), Arg(R), and Gly(G) with a synonymous codon in which the third base is cytosine (C), and replacing a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K), and Glu(E) with a synonymous codon in which the third base is guanine (G).

[0074] In another aspect, the codon optimization method may be to replace codons encoding Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) with synonymous codons in which the third base is cytosine (C), and to replace codons encoding Gln(Q), Lys(K), and Glu(E) with synonymous codons in which the third base is guanine (G).

[0075] In another aspect, the codon optimization method of the present invention may include the step of replacing each codon encoding Ala(A), Leu(L), Ile(I), Val(V), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) with a synonym codon in which the third base is cytosine (C), replacing each codon encoding Gln(Q), Lys(K), and Glu(E) with a synonym codon in which the third base is guanine (G), and replacing the codon encoding Ser(S) with TCC.

[0076] In another aspect, the codon optimization method of the present invention may include the step of substituting at least some of the codons encoding Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Phe(F), Arg(R) and Gly(G) with synonymous codons in which the third base is cytosine (C).

[0077] In another aspect, the codon optimization method of the present invention may include the step of substituting at least some of the codons encoding Gln(Q), Lys(K), and Glu(E) with synonymous codons in which the third base is guanine (G).

[0078] In another aspect, the codon optimization method of the present invention may include the step of replacing at least some of the codons that encrypt Ser(S) with TCC.

[0079] In the present invention, substitution with a synonymous codon of cytosine (C) and / or a synonymous codon of guanine (G) may be performed for the entire group of amino acids or for some amino acids selected from the group of amino acids.

[0080] In the present invention, substitution with the synonymous codon of cytosine (C) and / or synonymous codon of guanine (G) may be selectively performed for only some codons within each amino acid.

[0081] In the present invention, substitution with the synonymous codon of cytosine (C) and / or the synonymous codon of guanine (G) may be performed in various forms that are arbitrary or combinatorial for the amino acid or codon.

[0082] In the present invention, if the third base of a codon encoding Ala (A), Leu (L), Ile (I), Val (V), Pro (P), Thr (T), Tyr (Y), His (H), Asn (N), Asp (D), Cys (C), Arg (R), Phe (F), and Gly (G) is already cytosine (C), each codon or some of the codons may not be substituted. In the present invention, if the third base of a codon encoding Gln (Q), Lys (K), and Glu (E) is already guanine (G), each codon or some of the codons may not be substituted. In the present invention, if a codon encoding Ser (S) is already TCC, the corresponding codon or some of the corresponding codons may not be substituted.

[0083] In one embodiment, when the third base in the present invention is substituted with a synonymous codon in which the third base is cytosine (C) or guanine (G), the first and / or second base of the codon may be maintained as the same base.

[0084] In another embodiment, when the third base in the present invention is substituted with a synonymous codon in which the third base is cytosine (C) or guanine (G), the first and / or second bases of the codon may be substituted together. For example, in the case of Leu (L), when the codon encoding it, UUA or UUG, is substituted with CTC, the first base of the codon is substituted together. As another example, in the case of Arg (R), when the codon encoding it, AGA or AGG, is substituted with CGC, the first base of the codon may be substituted together. As yet another example, in the case of Ser (S), when the codon encoding it, AGU or AGC, is substituted with TCC, the first and second bases of the codon may be substituted together.

[0085] In the present invention, whether to substitute the first and / or second bases of a codon in which there are multiple synonymous codons in a single amino acid and two or more of them have C3 and / or G3 can be appropriately selected by a person skilled in the art, for example, by selecting without priority, or by referring to a previously known codon optimization method (e.g., a method based on the frequency of tRNA expressed in a host cell, which analyzes the number of gene copies or expression levels of tRNA having an anticodon complementary to a specific codon, thereby replacing rare codons with low usage frequency with more frequently used codons).

[0086] In the present invention, the codon optimization method may enhance protein expression by improving gene translation efficiency in a host cell.

[0087] In the present invention, the codon optimization method may be utilized to enhance gene expression for (i) reprogramming of plant traits, (ii) gene editing, and / or (iii) production of recombinant proteins, but is not limited thereto.

[0088] In the present invention, the host cell may be a plant cell. The plant may be any one selected from food crops including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot; specialty crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanuts, and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, grapes, citrus fruits, persimmons, plums, apricots, lemons, and bananas; and floricultural plants including roses, carnations, chrysanthemums, lilies, sunflowers, cosmos, and tulips, and the plant cell may be a cell derived from the plant, but is not limited thereto. In a preferred embodiment, the plant may be rice, and in another preferred embodiment, the plant may be tobacco.

[0089] In the present invention, the redesigned gene sequence or the codon optimization method can be utilized to enhance protein expression in vitro in a host cell.

[0090] In another aspect, the present invention relates to a base sequence (or gene sequence) optimized by the codon optimization method.

[0091] In another aspect, the present invention relates to a recombinant expression vector loaded with the gene sequence or the base sequence.

[0092] In another aspect, the present invention relates to a transgenic plant cell or transgenic plant body into which the recombinant expression vector is introduced.

[0093] In the present invention, the transgenic plant cell or transgenic plant may comprise a codon-optimized nucleotide sequence to increase the expression of an exogenous gene, and as a result, may be characterized as being used for (i) reprogramming of plant traits, (ii) gene editing, and / or (iii) production of recombinant proteins, but is not limited thereto.

[0094] In the present invention, the transgenic plant cell or transgenic plant body may have a codon-optimized gene introduced to increase the expression efficiency of a gene involved in the process of reprogramming a plant's metabolic pathway or trait-related pathway.

[0095] In addition, in the present invention, the transgenic plant cell or transgenic plant may have a codon-optimized gene introduced to increase the expression efficiency of an introduced foreign gene in order to improve editing efficiency during the process of performing gene editing using CAS / CRISPR or a similar system.

[0096] Therefore, the codon optimization technology of the present invention can be applied not only to the production of recombinant proteins but also to various purposes such as synthetic biology-based metabolic pathway control, plant trait improvement, and enhancement of gene editing efficiency.

[0097] The term "recombinant" refers to a cell that replicates a heterogeneous nucleic acid, expresses said nucleic acid, or expresses a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the natural form of said cell in either a sense or antisense form. Additionally, a recombinant cell may express a gene found in a cell in its natural state, provided that said gene is modified and has been reintroduced into the cell by artificial means.

[0098] The term "recombinant expression vector" refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. Generally, any plasmid and vector may be used if they can replicate and stabilize within a host. An important characteristic of the recombinant expression vector is that it possesses a replication origin, a promoter, a marker gene, and a translation control element. An expression vector containing a suitable transcriptional / translational regulatory signal may be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombinant techniques. The recombinant expression vector of the present invention comprises one or more regulatory sequences (e.g., promoter, 5'UTR, intron, leader sequence, 3'UTR, species, etc.) and a target gene (for producing a recombinant protein), thereby enabling efficient and stable recombinant protein expression within a specific host cell or tissue.

[0099] The above "operably linked" may be a gene and an expression control sequence linked in such a way that gene expression is enabled when an appropriate molecule binds to the expression control sequence. An "expression control sequence" means a DNA sequence that controls the expression of an operably linked sequence in a specific host cell. Such a control sequence includes a promoter for carrying out transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that controls the termination of transcription and translation.

[0100] In another aspect, the present invention provides a method for producing a transgenic plant cell or a transgenic plant, comprising the step of introducing the recombinant expression vector into a plant cell or a plant body.

[0101] The introduction of the above plant expression vector into a plant cell or plant body may be performed using any one selected from the group consisting of Agrobacterium sp.-mediated methods, particle gun bombardment, sonication, electroporation, and PEG (polyethylene glycol)-mediated transformation methods.

[0102] According to the present invention, a codon-optimized sequence can be effectively linked to a suitable promoter within an expression vector to lead to mRNA synthesis. Suitable vectors for expressing the codon-optimized gene according to the present invention in plant cells include the pCAMBIA1300 series, pRTVn, pRI 101, and pGreenII series, which are plasmids expressible in plants, but are not limited thereto; any vector capable of expressing the codon-optimized gene according to the present invention in plant cells may be selected and used.

[0103] A preferred example of the recombinant expression vector of the present invention is a Ti-plasmid vector capable of transferring a portion of itself, the so-called T-region, into a plant cell when present in a suitable host, such as Agrobacterium tumafaciens or Agrobacterium rhizogenes. Other types of Ti-plasmid vectors are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced by appropriately inserting the hybrid DNA into the plant genome. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce DNA according to the present invention into a plant host may be selected from viral vectors, such as those derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Gemini viruses, etc., for example, incomplete plant viral vectors. The use of such vectors can be advantageous, especially when it is difficult to properly transform plant hosts.

[0104] More specifically, the recombinant expression vector is a recombinant expression vector in which a promoter and a codon-optimized gene according to the present invention, designed to enhance the expression level of a recombinant protein, are sequentially and operably linked using an existing vector used for protein expression as a basic framework.

[0105] In addition, the recombinant expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

[0106] The recombinant expression vector will preferably include one or more selectable markers. The markers are nucleic acid sequences having characteristics that can typically be selected by chemical methods, and include all genes capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, and the aadA gene.

[0107] In the recombinant expression vector of the present invention, the promoter may be, but is not limited to, a double enhancer CaMV, MacT, RbcS, Glu13a, GluB1, Glub4, Prolamin, Fmm, CaMV 35S, actin, ubiquitin, pEMU, amylase, or Clp promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions, developmental states, or cell differentiation. Since the selection of transformants can be made by various tissues at various stages, a constitutive promoter may be preferred in the present invention. Therefore, a constitutive promoter does not limit the possibility of selection.

[0108] In the present invention, the terms "terminator" or "termination factor" refer to a regulatory sequence that improves gene expression efficiency by inducing the precise termination and stabilization of transcribed mRNA. The terminator functions to prevent unnecessary transcriptional prolongation by providing a transcription termination signal, and to maintain a constant protein expression level by increasing the stability of the generated mRNA.

[0109] The recombinant expression vector of the present invention may further include a sequence encoding a tag peptide in the 5' or 3' direction of the sequence encoding the recombinant protein. The tag peptide may be any tag peptide known in the art for the purpose of isolating and purifying the recombinant protein without limitation. Specifically, the protein tag may be one or more selected from the group consisting of Avi tag, Calmodulin tag, polyglutamate tag, E tag, FLAG tag, HA tag, His tag, Myc tag, S tag, SBP tag, IgG-Fc tag, CTB tag, Softag 1 tag, Softag 3 tag, Strep tag, TC tag, V5 tag, VSV tag, and Xpress tag.

[0110] Any host cell known in the art that can stably and continuously clone and express the recombinant expression vector of the present invention in a prokaryotic cell may be used, for example, strains of the genus Bacillus such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, and Bacillus churingensis, as well as intestinal bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

[0111] In another aspect, the present invention relates to a method for producing a recombinant protein comprising the following steps:

[0112] (a) a step of culturing the above-mentioned transformed plant cell or transformed plant body; and

[0113] (b) A step of recovering recombinant protein from the cultured transformed plant cells or transformed plants.

[0114] In the present invention, the plant may be any one selected from food crops including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum; vegetable crops including Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot; specialty crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut, and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, grapes, citrus fruits, persimmons, plums, apricots, lemons, and bananas; and floricultural plants including roses, carnations, chrysanthemums, lilies, sunflowers, cosmos, and tulips, and the plant cell may be a cell derived from the plant, but is not limited thereto. In a preferred embodiment, the plant may be rice, and in another preferred embodiment, the plant may be tobacco.

[0115] In the present invention, the recombinant protein is a term referring to a protein intended to be produced in a host cell, and may be any type of protein that can be expressed as a recombinant protein. For example, the recombinant protein may be one or more selected from the group consisting of GLP-1 analog, thaumatin, lactoferrin, transferrin, interleukin, transcription factor, membrane protein, insulin, cytokinin, growth factor, toxin protein, hormone, hormone analog, cytokine, movement protein, lysozyme, vaccine, enzyme, enzyme inhibitor, transport protein, structural protein, receptor, receptor fragment, biological defense inducer, storage protein, exploitative protein, reporter protein, artificially designed protein, hydrophobin, antigen, antibody, and antibody fragment. The gene encoding such a recombinant protein may include a "cloning site," which is a nucleic acid sequence into which a restriction enzyme or cleavage site is introduced so that it can be inserted into a vector.

[0116] Specifically, the method for producing a recombinant protein according to the present invention may comprise: (a) a step of producing the recombinant expression vector; (b) a step of introducing the recombinant expression vector into a plant to produce a transgenic plant cell or plant body; (c) a step of culturing the transgenic plant cell or plant body; and (d) a step of isolating and purifying the recombinant protein from the transgenic plant cell or plant body or the culture medium thereof.

[0117] The method for producing a recombinant protein from the above-described transformed plant cell or plant body involves transforming a plant cell or plant body with a recombinant expression vector according to the present invention, culturing the transformed cell or plant body for an appropriate period of time to express the desired recombinant protein, and then obtaining the protein from the transformed cell or plant body. At this time, any method known in the art for expressing the recombinant protein may be used.

[0118] In a method for producing a recombinant protein, in order to introduce the recombinant expression vector into a plant, a culture of a transformant into which the recombinant expression vector has been introduced may be introduced into a plant cell or a plant body. For example, the culture of the transformant may be introduced by syringe infiltration into the leaves of a plant or by vacuum infiltration. The Agrobacterium introduced in this way receives a signal from the acetosyringone substance and delivers a construct containing the promoter-target protein-terminator of the vector into the plant cell.

[0119] In a method for producing recombinant proteins, the recombinant protein can be recovered through various separation and purification methods known in the art. Typically, to remove cell debris, the cell lysate may be centrifuged, followed by precipitation, e.g., salting out (precipitation of ammonium sulfate and sodium phosphate), solvent precipitation (precipitation of protein fractions using acetone, ethanol, etc.), and dialysis, electrophoresis, and various types of column chromatography may be performed. The target protein of the present invention may be purified by applying techniques such as ion exchange chromatography, gel-permeation chromatography, HPLC, reverse-phase HPLC, affinity column chromatography, or ultrafiltration, either individually or in combination.

[0120]

[0121] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0122]

[0123] Example 1. Design of GFP synonymous codon variants and analysis of protein expression in N. benthamiana

[0124] GFP is known to exhibit very high expression efficiency in plants, and sequencing analysis confirmed that the third base of each codon is mostly composed of cytosine (C) or guanine (G). Based on GFP having a C-rich sequence, genetic variants were produced to verify the hypothesis established in the present invention.

[0125] GFP_V1: Wild-type GFP sequence

[0126] Variant GFP_V2: In order to prove the hypothesis that the third base of each codon plays an important role, variants were constructed by changing the third base from C to A or T for 16 randomly selected codons based on wild-type sequences.

[0127] Variant GFP_V3: To analyze the effects of A / T and G / C at the third base of a codon more systematically, 38 codons were randomly selected from a total of 208 codons based on the wild-type sequence, consisting of 149 codons with C at the third position and 59 codons with G, and converted to have A for the 38 codons and T for the remaining codons.

[0128]

[0129]

[0130]

[0131]

[0132] GFP_V1 to GFP_V3 were synthesized by Geneuniversal (USA) using a chemical synthesis method. During synthesis, a BamHI restriction enzyme recognition sequence was added to the 5' end, and CACCACCACCACCACCAC (6xHis tag) (SEQ No. 12), CACGACGAGCTC (HDEL) (SEQ No. 13), a termination codon (TAA), and an XhoI restriction enzyme recognition sequence were added to the 3' end, respectively. The synthesized DNA was cleaved with BamHI and XhoI restriction enzymes (NEB, USA), and then ligated with the DNA fragments produced by treating the expression vector pTEX1L (see WO 2021 / 187750 A1) containing a BiP leader sequence with the same restriction enzymes. T4 DNA Ligase was purchased from Takara Bio Inc. (Japan) and used for this purpose.

[0133]

[0134]

[0135]

[0136]

[0137] The constructed expression vector was introduced by transforming the Agrobacterium tumefaciens strain GV3101 (GoldBio, USA). The obtained transformants were cultured to prepare a suspension until an OD600 of 0.8 was reached, and this suspension was infiltrated into 3.5-week-old Nicotiana benthamiana leaves using a syringe with the needle removed. The leaves were harvested 3 days after infiltration and crushed under liquid nitrogen.

[0138] Protein extraction from a portion of the crushed leaves was performed using Protein Extraction Buffer (Thermo Fisher Scientific, USA). N. benthamiana (wild type, WT) not infiltrated with Agrobacterium suspension was used as a negative control.

[0139] The extracted proteins were quantified using the Bradford Protein Quantification Kit (Bio-Rad Laboratories, USA), and 100 ng of the calculated total soluble protein was developed on an SDS-PAGE Gel System (Bio-Rad Laboratories, USA). The developed proteins were transferred to a PVDF membrane (Millipore, USA), using an anti-GFP antibody (Abcam, ab290, UK) as the primary antibody and HRP-conjugated anti-rabbit IgG (Cell Signaling Technology, USA) as the secondary antibody. Signal detection was performed using an ECL Substrate Kit (Thermo Fisher Scientific, USA). 5 μg of Rubisco complex (RbcL) was used as a loading control in each sample.

[0140] Western blot band intensities were quantified using the ImageJ program (NIH, USA). For statistical analysis, the same experiment was performed independently a total of 6 times, and data were expressed as mean ± standard error (SE, n=6). Protein expression levels between V1 and variants with base substitutions were analyzed using a two-tailed Student's t-test; *P ≤ 0.05 and **P ≤ 0.01 were considered statistically significant, and ns indicated no statistical significance.

[0141] As shown in Figure 1, it was confirmed that the expression level of GFP protein in N. benthamiana decreases significantly as the third base of each codon is changed to A or T.

[0142] Example 2. Analysis of GFP mRNA levels in N. benthamiana

[0143] Leaf tissues of the transgenic plants prepared in Example 1 were ground under liquid nitrogen, and total RNA was extracted using RNAiso Plus (Takara, Shiga, Japan). DNA contamination was removed using DNase I (DNA-free™Kit, Invitrogen, Thermo Fisher Scientific, USA). cDNA was synthesized by reverse transcribing 0.75 μg of total RNA from each sample using ImProm-II Reverse Transcriptase (Promega, Madison, WI, USA).

[0144] qRT-PCR was performed using SYBR Premix Ex Taq (Takara, Kyoto, Japan) and the ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). For the reaction, 2 μM of each forward and reverse primer was added to achieve a final concentration of 0.4 μM. The PCR conditions consisted of initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing at 60°C for 1 minute. Subsequently, melting curve analysis was performed by increasing the temperature in 0.3°C increments within the 60°C range.

[0145] To quantify the GFP transcript, 104 bp DNA fragments were amplified using a common forward primer (BiP_F1) located in the BiP region and a reverse primer specific to each GFP variant. BiP expression was measured using BiP_F / BiP_R. Actin was used as an internal control, and to correct for transformation efficiency, the expression of the co-transformed Hygromycin resistance gene was measured by qRT-PCR using Hyg-F / Hyg-R.

[0146] Name Sequence (5'-> 3') Sequence Number BiP_F1GGCGAGTGCGAGTGCGTCTTC GGATGTTTATTTGC14GFP_V1_RCCTCGCCCTTGCTCACCTTATCA15GFP_V2_RCCTCGCCCTTGCTCACCTTATCA16GFP_V3_RCTTCACCCTTAGAAACCTTATCATCATCATCTTGG17BiP_F2ATGGCTCGCTCGTTTGGAGC18BiP_ R2GGATCCTTAACTTCGTAGCCTCTTCTATTG19Actin_FATGGAAACATTGTGCTCAGTG20Actin_RGGTGCTGAGAGAAGCCAAG21Hygromycin_FCCGCAAGGAATCGGGTCAATA22Hygromycin_RGGTGTCGTCCATCACAGTTT23

[0147] Data normalization was performed in two steps. First, the transcript amounts of GFP and hygromycin (transformation efficiency control) were first normalized based on the actin gene, and then the GFP transcript levels were re-normalized to the hygromycin transcript levels to correct for differences in transformation efficiency between samples. All results were expressed as the mean ± standard error (SE, n=4) of four samples obtained from two biological replicates, and similar results were confirmed in at least three independent experiments.

[0148] As shown in Figure 2A, the mRNA levels of the GFP variants did not correspond to the protein expression levels. For example, the transcript amount of V1 was similar to that of V3, but the protein expression was approximately 282 times higher than that of V3. In Figure 2B, BiP transcript levels were measured in the same samples. No difference in BiP expression was observed between the GFP variants, which implies that the phenomenon of high protein expression in variants with high C / G content is not due to differences in transcription levels. Therefore, GFP protein expression in N. benthamiana is not directly correlated with mRNA levels, and it suggests that the phenomenon of high protein expression in variants with high C / G content, in particular, despite low transcript levels, is determined by translation efficiency or regulation at subsequent steps.

[0149] Example 3. Design of additional synonymous codon variants of GFP and analysis of protein expression in N. benthamiana

[0150] In Example 1, it was confirmed that the third base of each codon significantly affects the expression of GFP. To further verify this, the following variants were additionally produced.

[0151] The entire codon sequence was modified using the conventional method (commissioned to Genscript) to optimize expression in the variant GFP_V4:N. benthamiana.

[0152] Variant GFP_V5: Based on the V4 sequence, if the third base of each codon was A (A3), T (T3), or G (G3), it was replaced with C (C3).

[0153] Variant GFP_V6: Based on the V5 sequence, if the third base of five codons is C (C3), it was replaced with G (G3). This was created to increase the possibility of synthesis by replacing some of the C bases with G bases, as gene synthesis becomes difficult when C is excessively consecutive.

[0154]

[0155]

[0156]

[0157] After chemically synthesizing the variant designed in this way, an expression vector was constructed in the same manner as in Example 1 and transformed into N. benthamiana, and the GFP protein expression level was analyzed by Western blot.

[0158] As shown in Figure 3, expression in N. benthamiana was significantly higher when the third base of each codon was substituted with C or G compared to GFP_V4, which has codons optimized for plants. Through this, it was verified that the C / G content is a decisive factor in the expression of recombinant proteins in plants, rather than whether or not optimal frequency codons are used.

[0159] Example 4. Design of synonymous codon variants of H9N2 HA and analysis of base composition ratios

[0160] In order to analyze in depth the changes in expression levels according to the codon variants of Example 1 or Example 3, several variants were constructed for the HA gene of H9N2 in which the third base of each codon was mutated, and the protein expression levels were confirmed.

[0161] The entire codon sequence was modified using the conventional method (commissioned to Genscript) to optimize expression in H9N2_V1:Nicotiana benthamiana.

[0162] H9N2_V2: Variants with high G / C content were constructed based on the V1 sequence. When the third base of each codon was A (A3) or T (T3), it was randomly substituted with C (C3) or G (G3) without any specific preference.

[0163] H9N2_V3: Based on the V1 sequence, if the third base of each codon is A (A3), it was substituted with C (C3) if the substitution with C is possible without changing the amino acid, such as with threonine (T), alanine (A), valine (V), glycine (G), and proline (P); otherwise, it was substituted with G (G3).

[0164] H9N2_V4: Based on the V1 sequence, if the third base of each codon was T (T3), it was all replaced with C (C3).

[0165] H9N2_V5: Based on the V1 sequence, if the third base of each codon was A (A3) or T (T3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0166] H9N2_V6: Based on the V1 sequence, if the third base of each codon was A (A3), T (T3), or G (G3), it was replaced with C (C3) whenever possible, and otherwise, it was replaced with G (G3).

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174] Example 5. Analysis of protein expression of H9N2 HA in N. benthamiana

[0175] The H9N2_V1 to H9N2_V6 genes designed in Example 4 were synthesized by Geneuniversal (USA) using a chemical synthesis method. During synthesis, a BamHI restriction enzyme recognition sequence was added to the 5' end, and CACCACCACCACCACCAC (6xHis tag), CACGACGAGCTC (HDEL), a termination codon (TAA), and an XhoI restriction enzyme recognition sequence were added to the 3' end, respectively.

[0176] An expression vector was constructed in the same manner as in Example 1 and transformed into N. benthamiana, after which the protein expression level was analyzed by Western blot. An anti-His antibody (Novusbio NB100-64768) was used as the primary antibody. HRP-conjugated anti-mouse IgG (Cell Signaling Technology, USA) was used as the secondary antibody.

[0177] As confirmed in Figure 5, a comparison of H9N2 HA protein expression in Nicotiana benthamiana revealed that the third base composition of each codon had a decisive influence on the expression level. In particular, a high overall G / C content in the third base composition of each codon did not necessarily lead to improved expression. For example, although V2 had a very high G / C ratio of 99.8%, it showed lower expression than V3 (72.7%) or V4 (67.4%). This suggests that, contrary to the existing hypothesis that expression improves simply as the G / C ratio increases, other factors have a greater influence on expression efficiency.

[0178] Protein expression levels were significantly enhanced in variants in which codons ending in A and / or T were removed and replaced with C as much as possible, and protein expression levels were further enhanced in variants in which codons ending in G were also replaced with C as much as possible. This demonstrates that protein expression efficiency is maximized not by simple GC content, but by optimizing the removal of A / T from the third base of the codon and replacement with C as much as possible.

[0179] Example 6. Analysis of H9N2 HA mRNA levels in N. benthamiana

[0180] qRT-PCR was performed on H9N2_V1 to H9N2_V6 produced in Example 4 using the same method as in Example 2. The primer sequences used are shown in Table 2.

[0181] Name sequence (5'-> 3') SEQ ID NO: H9N2_V1_RGGAGTTTGTTGACTGGTAGCCAATGC31H9N2_V2_RGGAGTTGGTCGACTGGTAGCCG32H9N2_V3_RGGAGTTGGTGGACTGGTAGCCAA TG33H9N2_V4_RGGAGTTTGTTGACTGGTAGCCGATG34H9N2_V5_RGGAGTTGGTGGACTGGTAGCCGA35H9N2_V6_RGGAGTTGGTGGACTGGTAGCCGAT36

[0182] As confirmed in Fig. 6A, the H9N2 HA transcription level did not correspond to the protein expression level. For example, in the case of variants V5 and V6, the amount of H9N2 transcript was similar to or relatively lower than that of V1, but the protein expression levels were approximately 162 times and 168 times higher, respectively. As confirmed in Fig. 6B, to confirm that there was no change in qRT-PCR values ​​depending on the mRNA region, mRNA levels were measured using qRT-PCR on the same samples using the BiP region at the N-terminus rather than the HA region of these mRNAs; even then, no significant difference was observed compared to the results obtained by performing qRT-PCR on the HA region. This implies that the phenomenon of high protein expression in the variants produced according to the present invention is not due to differences in transcription levels.

[0183] Example 7. Design of synonymous codon variants of H5N6 HA and analysis of protein expression in N. benthamiana

[0184] To determine whether the design of synonym codon variants that enhance protein expression in N. benthamiana is specific to H9N2 HA, synonym codon variants of H5N6 HA were designed in the same way.

[0185] The entire codon sequence was modified using the conventional method (commissioned to Genscript) to optimize expression in variant H5N6_V1:Nicotiana benthamiana.

[0186] Variant H5N6_V2: Based on the V1 sequence, if the third base of each codon was A (A3) or T (T3), it was randomly substituted with C (C3) or G (G3) without any specific preference.

[0187] Variant H5N6_V3: Based on the V1 sequence, if the third base of each codon was A (A3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0188] Variant H5N6_V4: Based on the V1 sequence, if the third base of each codon was T (T3), it was all replaced with C (C3).

[0189] Variant H5N6_V5: Based on the V1 sequence, if the third base of each codon was A (A3) or T (T3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0190] Variant H5N6_V6: Based on the V1 sequence, if the third base of each codon was A (A3), T (T3), or G (G3), it was replaced with C (C3) whenever possible, and otherwise with G (G3).

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198] An expression vector was constructed in the same manner as in Example 1 and transformed into N. benthamiana, after which the protein expression level was analyzed by Western blot. An anti-His antibody (Novusbio NB100-64768) was used as the primary antibody.

[0199] As confirmed in Figure 7, in the H5N6 HA protein, the protein expression level was significantly increased in variants in which codons ending in A and / or T were removed and the third base was substituted with C in all possible cases, and the protein expression level was highest in variants in which codons ending in G were additionally substituted with C.

[0200] In H5N6 HA, the effect of enhancing expression upon G3→C3 substitution was more pronounced than in H9N2 HA, suggesting that substituting the third base with C as much as possible is a key factor in maximizing protein expression.

[0201] As such, it was confirmed that the 'C3 preference rule' is applicable to H5N6 HA as well, and this codon design rule can be proposed as a generalized codon optimization principle applicable to different HA proteins in N. benthamiana.

[0202] Example 8. Design of synonymous codon variants of H7N9 HA and analysis of protein expression in N. benthamiana

[0203] Additionally, synonymous codon variants were designed for H7N9 HA.

[0204] The entire codon sequence was modified using the conventional method (commissioned to Genscript) to optimize expression in variant H7N9_V1:Nicotiana benthamiana.

[0205] Variant H7N9_V2: Based on the V1 sequence, if the third base of each codon was A (A3) or T (T3), it was randomly substituted with C (C3) or G (G3) without any specific preference.

[0206] Variant H7N9_V3: Based on the V1 sequence, if the third base of each codon was A (A3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0207] Variant H7N9_V4: Based on the V1 sequence, if the third base of each codon was T (T3), it was all replaced with C (C3).

[0208] Variant H7N9_V5: Based on the V1 sequence, if the third base of each codon was A (A3) or T (T3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0209] Variant H7N9_V6: Based on the V1 sequence, if the third base of each codon was A (A3), T (T3), or G (G3), it was replaced with C (C3) whenever possible, and otherwise with G (G3).

[0210] Variant H7N9_V7: Based on the V6 sequence, all AGCs were additionally replaced with TCCs.

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219] An expression vector was constructed in the same manner as in Example 1 and transformed into N. benthamiana, after which the protein expression level was analyzed by Western blot. An anti-His antibody (Novusbio NB100-64768) was used as the primary antibody.

[0220] As shown in Figure 8, the expression of H7N9 HA protein in N. benthamiana showed the same trend as that of H9N2 HA protein and H5N6 HA protein, and the expression level increased as A and T were avoided and replaced with C in the third base of the codon. In particular, stronger expression was observed in the V6 variant in which all cases where the third base was A, T, or G were replaced with C, and the highest expression was observed in the V7 variant in which AGC among the serine-coding codons was additionally replaced with TCC.

[0221] These results support the fact that C content itself, rather than simple GC content, is a key factor in determining protein expression efficiency, and thus once again prove that the 'C3 preference rule' is a universal expression optimization strategy applicable to various subtypes of HA proteins.

[0222] Example 9. Optimization of Vaccinia Virus Protein L1R Codon and Analysis of Protein Expression in N. benthamiana

[0223] We confirmed whether the protein expression level is enhanced by applying the codon optimization technology of the present invention not only to various subtypes of HA proteins but also to the L1R protein of vaccinia virus.

[0224] L1R-C: The entire codon sequence was modified in a conventional manner to optimize expression in Nicotiana benthamiana (produced by Genscript).

[0225] L1R-CC: Based on the L1R-C sequence, if the third base of each codon is A (A3), T (T3), or G (G3), it was substituted with C (C3) if possible, and G (G3) otherwise.

[0226]

[0227]

[0228]

[0229] L1R-C and L1R-CC were synthesized by the chemical synthesis method at Genscript (USA). During synthesis, a BamHI restriction enzyme recognition sequence was added to the 5' end, and CACCACCACCACCACCAC (6xHis tag), CACGACGAGCTC (HDEL), termination codon TAA, and an XhoI restriction enzyme recognition sequence were added to the 3' end, respectively. The synthesized DNA was cleaved with BamHI and XhoI restriction enzymes (NEB, USA), and then ligated with the DNA fragments produced by treating the expression vector pTEX1L (WO 2021 / 187750 A1), which contains a BiP leader sequence, with the same restriction enzymes. T4 DNA Ligase was purchased from Takara Bio Inc. (Japan).

[0230] After transforming N. benthamiana using the same method as in Example 1, protein expression levels were analyzed by Western blot. An anti-His antibody (Novusbio NB100-64768) was used as the primary antibody.

[0231] As shown in Figure 9, when the codon optimization technique of the C-preference principle of the present invention was applied to the antigen protein L1R gene of vaccinia virus, it was confirmed that the expression level in N. benthamiana was significantly improved compared to the case where codon optimization was performed in a conventional manner.

[0232] Thus, it has been proven that this codon optimization technology is equally applicable not only to various subtypes of influenza HA proteins but also to L1R, a vaccinia virus antigen protein that can be used as a smallpox vaccine, and it has been confirmed that it functions as a universal expression enhancement principle applicable regardless of the type of protein.

[0233] Example 10. Optimization of Vaccinia Virus Protein DAL Codon and Analysis of Protein Expression in N. benthamiana

[0234] The effectiveness of the codon optimization technology of the present invention was verified on the antigen protein gene DAL of the smallpox vaccine.

[0235] The entire codon sequence was modified using the conventional method (commissioned to Genscript) to optimize expression in DAL-C:Nicotiana benthamiana.

[0236] DAL-CC: Based on the DAL-C sequence, if the third base of each codon is A (A3), T (T3), or G (G3), it was substituted with C (C3) if possible, and with G (G3) otherwise.

[0237]

[0238]

[0239]

[0240] DAL-C and DAL-CC were synthesized by the chemical synthesis method at Genscript (USA). During synthesis, a BamHI restriction enzyme recognition sequence was added to the 5' end, and CACCACCACCACCACCAC (6xHis tag), CACGACGAGCTC (HDEL), a termination codon (TAA), and an XhoI restriction enzyme recognition sequence were added to the 3' end, respectively. The synthesized DNA was cleaved with BamHI and XhoI restriction enzymes (NEB, USA), and then ligated with the DNA fragments produced by treating the expression vector pTEX1L (WO 2021 / 187750 A1), which contains a BiP leader sequence, with the same restriction enzymes. T4 DNA Ligase was purchased from Takara Bio Inc. (Japan).

[0241] After transforming N. benthamiana using the same method as in Example 1, protein expression levels were analyzed by Western blot. An anti-His antibody (Novusbio NB100-64768) was used as the primary antibody.

[0242] As shown in Figure 10, DAL-CC exhibited a much stronger signal intensity compared to DAL-C. These results demonstrate that the codon optimization technology of the present invention can effectively improve the translation efficiency and accumulation of DAL, a vaccinia virus antigen protein that can be utilized as a smallpox vaccine in plant expression systems.

[0243] Example 11. Optimization of porcine circovirus protein PCV2d codons and analysis of protein expression in N. benthamiana

[0244] We also verified whether the protein expression level is enhanced by applying the codon optimization technology of the present invention to the PCV2d gene of porcine circovirus.

[0245] The entire codon sequence was modified in a conventional manner to optimize expression in PCV2d-C:Nicotiana benthamiana (produced by Genscript).

[0246] PCV2d-CC: Based on the PCV2d-C sequence, if the third base of each codon was A (A3), T (T3), or G (G3), it was substituted with C (C3) if possible, and with G (G3) otherwise.

[0247]

[0248]

[0249]

[0250] PCV2d-C and PCV2d-CC were synthesized by Genscript (USA) using a chemical synthesis method. During synthesis, an XmaI restriction enzyme recognition sequence and a CACCACCACCACCACCAC (6x His tag) sequence were added to the 5' end, and an XhoI restriction enzyme recognition sequence was added to the 3' end. Additionally, to position the transit peptide at the N-terminus of PCV2d, an XbaI restriction enzyme recognition sequence and a 5' UTR sequence (tctagaattattacatcaaaacaaaaa) (Sequence No. 61) were added to the 5' end, and an XmaI restriction enzyme recognition sequence was added to the 3' end, and DNA was chemically synthesized to include the transit peptide sequence between them (Genescript). Two DNA fragments were cleaved with XbaI, XmaI, and XhoI restriction enzymes (NEB, USA), and a recombinant vector was constructed by ligating them to an expression vector pTEX1L treated with XbaI and XhoI.

[0251]

[0252]

[0253] After SDS-PAGE, the gel was immersed in a 0.1% (w / v) Coomassie Brilliant Blue R-250 (Bio-Rad) solution [40% methanol, 10% acetic acid, 50% distilled water] and stained at room temperature for 1 hour. Subsequently, the gel was decolorized by repeated washing (approximately 3–4 times, 15 minutes each) with a decolorizing solution containing 10% acetic acid and 30% methanol. After the gel was completely decolorized, it was washed with distilled water, and the protein expression level was qualitatively evaluated by comparing the intensities of the major protein bands.

[0254] As shown in Fig. 11, the target protein band was identified at approximately 25 kDa as a result of staining. The codon-optimized sequence (CC) of the present invention showed a significantly higher level of protein expression in N. benthamiana compared to the conventional codon-optimized sequence (C). These results demonstrate that the codon-optimization technology of the present invention can effectively improve the translation efficiency and accumulation of antigen proteins that can be utilized in porcine circovirus vaccines in plant expression systems.

[0255] Example 12. H5N6 HA Codon Optimization and Protein Expression Analysis in O. sativa

[0256] A 1,754 bp cassette consisting of a CaMV 35S promoter, hpt gene, and NOS terminator with BsrGI and KpnI restriction enzyme recognition sequences added to the 5' and 3' ends, respectively, was chemically synthesized and then cleaved with BsrGI and KpnI restriction enzymes (NEB). The p38 sequence was removed by cleaving it with BsrGI and KpnI restriction enzymes in the pTEX1L transformation vector into which the V1 and V6 variants of the H5N6 HA gene constructed in Example 7 were introduced. A recombinant vector was constructed by ligating the cleaved vector and the synthesized DNA fragment using T4 DNA ligase (NEB).

[0257] The constructed expression vector was introduced into Agrobacterium tumefacienss strain EHA105 using electroporation (Electroporator, Bio-Rad, USA), and the introduced cells were cultured for 2 days at 28°C on LB solid medium (Luria-Bertani agar, Difco Laboratories, USA) containing kanamycin (Sigma-Aldrich, USA) and rifampicin (Sigma-Aldrich, USA) to select transformed colonies.

[0258] Callus was induced from mature rice seeds (Oryza sativacv. Dongjin) and induced for 3 weeks at 30°C in N6D medium containing 2,4-D (2.5 mg / L, Sigma-Aldrich, USA) [Chu's N6 salts (PhytoTechnology Laboratories, USA), 30 g / L sucrose (Duchefa Biochemie, Netherlands), 0.3% Gelrite (Duchefa Biochemie, Netherlands)].

[0259] The induced callus was co-cultured with transformed Agrobacterium under dark conditions (23℃) for 3 days. After co-culture, the callus was transferred to selective medium [N6D + 2,4-D + Hygromycin (Hygromycin B, MBcell, Korea) 100 mg / L + Carbenicillin (Carbenicillin, Duchefa Biochemie, Netherlands) 250 mg / L] and cultured at 30℃ under a light / dark photoperiod of 16 / 8 hours.

[0260] After 3 weeks, calluses exhibiting antibiotic resistance were selected as transformed callus lines and transferred to regeneration medium [MS medium (Murashige and Skoog medium, Duchefa Biochemie, Netherlands) + NAA (α-Naphthaleneacetic acid, Sigma-Aldrich, USA) + Kinetin (Sigma-Aldrich, USA) + Hygromycin 100 mg / L + Carbenicillin 250 mg / L] and cultured for 3 weeks under the same conditions (30℃, 16-hour photoperiod).

[0261] Afterward, the transformed plants were transferred to a rooting medium [MS + hygromycin 50 mg / L]. After the acclimatization process, the transformed rice lines were grown under greenhouse conditions (30 ℃, humidity 70%) until flowering.

[0262] Rice seeds were obtained from these transformed plants and named T1 seeds.

[0263] Four independent T1 seeds were ground under liquid nitrogen, and total protein was extracted using Protein Extraction Buffer (Thermo Fisher Scientific, USA).

[0264] After developing the extracted total protein by SDS-PAGE, protein expression was analyzed using an anti-His antibody as the primary antibody.

[0265] Since genes are randomly inserted into each rice line, the expression level varies significantly depending on the insertion location. Accordingly, after Western blot analysis, the band intensity of each line was measured to calculate the average value, and the expression levels according to two codon optimization methods were compared.

[0266] As shown in Fig. 12, the codon-optimized sequence (H5N6_V6) of the present invention significantly increased the expression level of H5N6 HA protein in the O. sativa expression system compared to the conventional codon-optimized sequence (H5N6_V1). This is consistent with the results from the previous N. benthamiana expression system and demonstrates that the codon optimization principle of the present invention works universally across plant species.

[0267] Example 13. L1R Codon Optimization and Protein Expression Analysis in O. sativa

[0268] The L1R-C and L1R-CC vectors constructed in Example 9 were cleaved with XbaI and XhoI restriction enzymes to obtain L1R-C and L1R-CC DNA fragments, respectively. The fragments obtained in this way were ligated by cleaving the vector constructed in Example 12 with the same restriction enzymes (XbaI, XhoI) to construct the final vector to be used for rice transformation.

[0269] Afterward, O. Savita was transformed using the same method as in Example 12, and the protein expression level was analyzed by Western blot.

[0270] As shown in Fig. 13, it was confirmed that the codon optimization sequence (L1R_CC) of the present invention can significantly increase the expression amount of protein in the O. sativa expression system compared to the conventional codon optimization sequence (L1R_C). Therefore, it was confirmed that the codon optimization principle of the present invention is applicable across plant species regardless of the type of recombinant protein.

[0271]

[0272] This study was conducted with the support of the following project.

[0273] 1. "Bio-Medical Technology Development (R&D)" project supported by the Ministry of Science and ICT and managed by the National Research Foundation of Korea

[0274] - Project ID: 2710001865

[0275] - Sub-project number: 00235511

[0276] - Research Project Title: Discovery, Engineering, and Establishment of a Mass Production System for Next-Generation Therapeutic / Diagnostic Biosimilars Utilizing Hagfish Acquired Immunity

[0277] - Implementing Agency: Pohang University of Science and Technology

[0278] - Research Period: 2024.01.01.–2024.12.31.

[0279] 2. Supported by the Ministry of Health and Welfare, managed by the Korea Health Industry Development Institute "Korean ARPA-H Project"

[0280] - Project ID: 2460002716

[0281] - Sub-project number: RS-2024-00507523

[0282] - Research Project Title: Development of Ultra-Long-Term Stockpiling Technology for Smallpox / Empox Vaccines Using Plant Seeds

[0283] - Implementing Agency: BioApp Co., Ltd.

[0284] - Research Period: September 1, 2024 – December 31, 2028

Claims

1. A gene sequence encoding a recombinant protein, wherein the third base of the codon constituting the gene sequence is cytosine (C) first and guanine (G) second.

2. The gene sequence of claim 1, wherein the third base of a codon encoding one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) is cytosine (C), and the third base of a codon encoding one or more amino acids selected from the group consisting of Gln(Q), Lys(K), and Glu(E) is guanine (G).

3. The gene sequence of claim 1, wherein the third base of the codon encoding Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F) and Gly(G) is cytosine (C), and the third base of the codon encoding Gln(Q), Lys(K) and Glu(E) is guanine (G).

4. In paragraph 3, the gene sequence is a gene sequence in which the base sequence of the codon encoding Ser(S) is TCC.

5. A codon optimization method for redesigning a gene sequence encoding the same amino acid sequence, A step comprising replacing a codon in the gene sequence in which the third base is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) or guanine (G) among synonymous codons of the amino acid encoded by the said codon. Codon optimization method.

6. In paragraph 5, the above codon optimization method is, A codon optimization method characterized by including the step of replacing a codon in which the third base in the gene sequence is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the codon.

7. In paragraph 6, the above codon optimization method is, A step comprising preferentially substituting a codon in the gene sequence in which the third base is adenine (A) and / or thymine (T) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the said codon, and secondarily substituting the codon not substituted with cytosine (C) with a codon in which the third base is guanine (G). Codon optimization method.

8. In paragraph 5, the above codon optimization method is, A method comprising the step of replacing a codon in the gene sequence in which the third base is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the said codon. Codon optimization method.

9. In paragraph 8, the above codon optimization method is, A method comprising the step of preferentially substituting a codon in the gene sequence in which the third base is adenine (A), a codon in which the third base is thymine (T), and / or a codon in which the third base is guanine (G) with a codon in which the third base is cytosine (C) among synonymous codons of the amino acid encoded by the said codon, and secondarily substituting a codon not substituted with cytosine (C) with a codon in which the third base is guanine (G). Codon optimization method.

10. In paragraph 5, the above codon optimization method is, A step comprising replacing the codons that encrypt Ser(S) with TCCs, Codon optimization method.

11. In paragraph 5, the above codon optimization method A step comprising substituting a codon encoding any one or more amino acids selected from the group consisting of Ala(A), Leu(L), Ile(I), Val(V), Ser(S), Pro(P), Thr(T), Tyr(Y), His(H), Asn(N), Asp(D), Cys(C), Arg(R), Phe(F), and Gly(G) with a synonymous codon in which the third base is cytosine (C). Codon optimization method.

12. In Paragraph 5, The above codon optimization method A method comprising the step of substituting a codon encoding any one or more amino acids selected from the group consisting of Gln(Q), Lys(K) and Glu(E) with a synonymous codon in which the third base is guanine (G). Codon optimization method.

13. In paragraph 5, the codon optimization method is for enhancing protein expression by improving gene translation efficiency in a host cell, Codon optimization method.

14. In Paragraph 13, The above host cell is a plant cell, Codon optimization method.

15. A recombinant expression vector loaded with a gene sequence of any one of claims 1 to 4 or a gene sequence redesigned by a codon optimization method of any one of claims 5 to 14.

16. Transformed plant cell or transformed plant body into which the recombinant expression vector of paragraph 15 has been introduced.

17. In paragraph 16, the transformed plant cell or transformed plant is (i) Reprogramming of plant traits; (ii) gene editing; and / or (iii) Transformed plant cells or transformed plants for the production of recombinant proteins.

18. A method for producing a recombinant protein comprising the following steps: (a) a step of culturing the transformed plant cell or transformed plant body of claim 16; and (b) A step of recovering recombinant protein from the cultured transformed plant cells or transformed plants.

19. In paragraph 18, the above-mentioned plant is, Food crops including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum; Vegetable crops including Arabidopsis thaliana, napa cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanuts, and rapeseed; Fruit trees including apple trees, pear trees, jujube trees, peaches, grapes, citrus fruits, persimmons, plums, apricots, lemons, and bananas; and Selected from floricultural plants including roses, carnations, chrysanthemums, lilies, sunflowers, cosmos, and tulips, Method for producing recombinant proteins.