Lactic acid bacteria composition for treating nosemosis

A composition of specific Lactobacillus strains inhibits Nosema bacteria in honeybees, enhancing immune and growth factors to improve health and productivity.

WO2026101295A1PCT designated stage Publication Date: 2026-05-15REPUBLIC OF KOREA (ANIMAL AND PLANT QUARANTINE AGENCY)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
REPUBLIC OF KOREA (ANIMAL AND PLANT QUARANTINE AGENCY)
Filing Date
2025-11-06
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Honeybees are highly susceptible to Nosema bacteria, which cause digestive issues and reduce survival and productivity, and existing probiotics may increase susceptibility to this pathogen.

Method used

A composition comprising specific strains of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, and Lactobacillus melliventris, or combinations thereof, is developed to inhibit Nosema bacteria and enhance immune and growth factors in honeybees.

Benefits of technology

The composition effectively inhibits Nosema bacteria, increases expression of growth and immune factors, and improves the health and productivity of honeybees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025018224_15052026_PF_FP_ABST
    Figure KR2025018224_15052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to lactic acid bacteria strains effective in protecting against honeybee nosemosis and, specifically, to probiotics of a combination of six strains of lactic acid bacteria in the intestines of honeybees, the probiotics exhibiting a therapeutic effect on nosemosis associated with honeybee diarrhea and post-overwintering mass mortality. When the composition of the present invention is used, nosemosis can be effectively prevented or inhibited.
Need to check novelty before this filing date? Find Prior Art

Description

Lactic acid bacteria composition for treating nosema

[0001] The present invention was carried out under project number B-1543081-2020-24-0104 with the support of the Ministry of Agriculture, Food and Rural Affairs of the Republic of Korea, the specialized research management agency for the said project is the Animal and Plant Quarantine Agency, the research project name is "Development of Animal and Plant Quarantine Inspection Technology," the research project name is "Establishment and Utilization of Sacbrood Virus Gene Database," the lead agency is the Animal and Plant Quarantine Agency, and the research period is 2020.01.01 ~ 2024.12.31.

[0002] This patent application claims priority to Korean Patent Application No. 10-2024-0159099, filed with the Korean Intellectual Property Office on November 11, 2024, the disclosures of said patent application are incorporated herein by reference.

[0003] The present invention relates to lactic acid bacteria strains effective in defending against honeybee nosema, and more specifically, to six strains of intestinal lactic acid bacteria for honeybees that show a therapeutic effect against nosema, which is associated with honeybee diarrhea and mass mortality after overwintering, or to a probiotic of a combination thereof.

[0004]

[0005] Honeybees are livestock that possess significant public value as pollinating insects and create added value through the production of beekeeping products. Due to their characteristic of living in large colonies within confined spaces, honeybees are highly susceptible to various infectious diseases; when an outbreak occurs, the disease spreads to the entire colony and neighboring colonies, leading to widespread damage. Recently, damage from viral diseases has been rapidly increasing as a result of weakened immunity caused by environmental changes, such as pesticide poisoning and a decline in nectar sources.

[0006] Gut bacteria can have various effects on efficient digestion, nutritional supplementation, detoxification, productivity, survival, and lifespan. Recently, positive effects on the identification of honeybee bacterial communities and disease defense have been reported. Probiotics are reported to demonstrate protective capabilities and disease improvement effects against bacterial diseases such as American foulbrood and European foulbrood, as well as fungal diseases such as chalkbrood and white mold.

[0007] Immunostimulants for beekeeping using Lactobacillus bifidus, L. lactis, Streptococcus lactis, Bacillus subtilis, Fructobacillus, etc., have been developed in Japan and the United States. However, there are reports that commercialized probiotics and prebiotics increase susceptibility to nosema, so it is necessary to acquire information on various strains in new drug development.

[0008]

[0009] The inventors have made diligent research efforts to develop a microbiome composition capable of inhibiting nosema in honeybees. As a result, they identified that a specific strain or combination derived from honeybees has an excellent effect in inhibiting nosema, thereby completing the present invention.

[0010] Accordingly, the object of the present invention is to provide a composition for inhibiting Nosema bacteria comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0011] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of nosema comprising the above composition.

[0012] Another objective of the present invention is to provide a food composition for improving nosema comprising the above composition.

[0013] Another objective of the present invention is to provide a method for treating nosema, comprising the step of administering the composition to a bee.

[0014] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims, and drawings.

[0015]

[0016] According to one aspect of the present invention, the present invention provides a composition for inhibiting Nosema bacteria comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0017] The inventors have made diligent research efforts to develop a microbiome composition capable of inhibiting nosema in honeybees. As a result, they have identified that specific strains or combinations derived from honeybees have excellent effects in inhibiting nosema.

[0018] In this specification, the term "microbiome" refers to a community of microorganisms existing in a specific environment (such as the human body) and includes various microorganisms such as bacteria, viruses, fungi, and protozoa. The microbiome is primarily found in the gut, and these microorganisms assist in digestion and nutrient absorption, regulate the immune system, and play important roles in other bodily functions. The balance of the microbiome is critical to health; for example, intestinal microbiome dysbiosis is associated with various diseases, such as obesity, diabetes, and autoimmune diseases. In one embodiment of the present invention, intestinal microbiome dysbiosis was found in honeybees infected with Nosema bacteria compared to normal honeybees.

[0019] In this specification, the term "Lactobacillus" refers to one of the beneficial bacteria found in the digestive system, oral cavity, and vagina of humans and animals. Lactobacillus is one of the main components of probiotics and helps maintain the normal functioning of the digestive system. Some studies suggest that Lactobacillus also plays a role in strengthening the immune system, and it is a bacterium known to be safe to take in food and supplements. Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus reuteri, etc., are actively utilized commercially.

[0020] Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, and Lactobacillus kimbladii are all types of Lactobacillus found in honeybees. These bacteria are known to aid in digestion and nutrient absorption.

[0021] In this specification, the term "Nosema" refers to a bacterium well known to cause nosema in honeybees. This pathogen primarily infects the digestive system of honeybees. "Nosema" is a disease caused by Nosema, and infected bees suffer from various health problems, including digestive issues and impaired nutrient absorption. Early symptoms include abnormal excrement and digestive system abnormalities. It is known that as the infection becomes severe, the survival rate and productivity of honeybees within the hive are significantly reduced.

[0022] In one embodiment of the present invention, the strain is as follows:

[0023] (a) The above Lactobacillus kullabergensis is Lactobacillus kullabergensis OMG2-B25 with accession number KCTC 16079BP;

[0024] (b) The above Lactobacillus apis is Lactobacillus apis HSY8-B25 with accession number KCTC 16077BP;

[0025] (c) The above Lactobacillus panisapium is Lactobacillus panisapium PKH2-L3 with accession number KCTC 16082BP;

[0026] (d) The above Lactobacillus mellis is Lactobacillus mellis OMG2-B33 with accession number KCTC 16080BP;

[0027] (e) The above Lactobacillus melliventris is Lactobacillus melliventris HSY3-B5 with accession number KCTC 16081BP; or

[0028] (f) Lactobacillus kimbladii is Lactobacillus kimbladii AHS3-B36 with accession number KCTC 16078BP.

[0029] In one embodiment of the present invention, the composition has the characteristics of increasing the expression of growth factors in honeybees, increasing the expression of immune factors in honeybees, or a combination thereof.

[0030] Honeybee growth factors refer to internal proteins, hormones, and other substances involved in the growth of honeybees, signifying factors necessary for their normal development. Examples include vitellogenin, juvenile hormone (JH), and ecdysteroid hormone, but are not limited to these.

[0031] In this specification, the term "bee immune factor" refers to proteins and genes involved in the immune system of honeybees. Examples include, but are not limited to, abecin, dorsal-1, defensin, hymenoptaecin, or PPP (prophenoloxidase).

[0032] In this specification, “gene expression” may refer to the transcription of a gene into a polynucleotide, translation into a polypeptide, or modification of a polynucleotide and / or polypeptide (e.g., including post-translational modification of a polypeptide). “Expressed gene” includes a gene that is transcribed as mRNA and subsequently translated into a polypeptide, or transcribed into RNA but not translated into a polypeptide (e.g., tRNA and rRNA).

[0033] In this specification, "increase in expression" of a protein or gene means a case where the quantitative expression value of a gene or protein in the test group increases to a measurable level compared to the control group. For example, it may mean a case where the expression amount of a gene or protein in the test group is 110% or more, 120% or more, or 130% or more compared to the control group, but is not limited thereto.

[0034] In one embodiment of the present invention, the growth factor is vitellogenin.

[0035] In this specification, the term vitellogenin refers to a protein found in various animals, including insects, fish, and birds. Vitellogenin plays a particularly important role in honeybees. It is involved in energy storage for survival during the winter, is known to be associated with increased resistance to pathogens, and is also known to play an important role in the reproduction of the queen bee.

[0036] In paragraph 3, the immune factor is abaecin, dorsal-1, or a combination thereof. In this specification, the term "abaecin" refers to one of the antimicrobial peptides used by honeybees to respond to infection. It acts as part of the defense mechanism against pathogenic microorganisms and plays a significant role, particularly in defense against bacteria. "Dorsal-1" refers to a gene that plays a significant role in the major immune response pathway called the Toll pathway in honeybees. The Toll pathway performs the function of recognizing pathogenic microorganisms and, in response, activating an immune response (particularly the production of antimicrobial peptides). Dorsal-1 acts as a nuclear factor in this pathway to regulate the expression of immune response genes.

[0037]

[0038] In one aspect of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of nosema comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0039] In this specification, the term “prevention” means the prevention or protective treatment of a disease or diseased state. In this specification, the term “treatment” means the reduction, suppression, soothing, or eradication of a diseased state.

[0040] The pharmaceutical composition of the present invention may be prepared in a unit volume form or contained in a multi-dose container by formulation using a pharmaceutically acceptable carrier and / or excipient, according to a method that can be easily carried out by a person skilled in the art to which the invention belongs. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, suppository, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer.

[0041] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0042]

[0043] In one aspect of the present invention, a food composition for improving nosema is provided, comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0044] The food composition of the present invention may be manufactured in the form of powder, granules, tablets, capsules, or beverages. Examples include various types of candies, beverages, gum, tea, vitamin complexes, or health supplements.

[0045] The food composition of the present invention may include allithiamine, fursultiamine, benfotiamine, or salts thereof, as well as ingredients that are typically added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as conventional sugars like dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents, natural flavoring agents [taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) may be used. For example, when the food composition of the present invention is prepared as a drink, in addition to allithiamine, fursultiamine, benfotiamine, or salts thereof, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc. may be additionally included.

[0046] In one aspect of the present invention, the present invention provides a feed composition for improving nosema comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0047] When the strain of the present invention is used in a feed composition or a feed additive composition, the composition may be prepared as a highly concentrated liquid of 20 to 90% or in the form of a powder or granules. The feed additive may additionally include one or more of organic acids such as citric acid, fumaric acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, and acidic pyrophosphate, or antioxidants such as polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, and phytic acid.

[0048] In the present invention, when the strain is used as feed, the composition may be formulated into a conventional feed form and may include conventional feed ingredients. The feed additive and feed may further include grains, for example, ground or crushed wheat, oats, barley, corn, and rice; plant protein feed, for example, feed with rapeseed, soybeans, and sunflowers as main ingredients; animal protein feed, for example, blood meal, meat meal, bone meal, and fish meal; sugars and dairy products, for example, dried ingredients consisting of various sugars, milk powder, and whey powder, and may also further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc.

[0049] In the present invention, when the strain is used as a feed additive, it may be administered to animals alone or in combination with other feed additives among edible carriers. Additionally, the feed additive may be easily administered to animals as a top dressing, by mixing them directly into animal feed, or as an oral formulation separate from the feed. When the feed additive is administered separately from animal feed, it may be prepared as an immediate-release or sustained-release tablet formulation by combining it with a pharmaceutically acceptable edible carrier, as is well known in the art. Such edible carriers may be solid or liquid, for example, corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, and propylene glycol. When a solid carrier is used, the feed additive may be a tablet, capsule, powder, lozenge, sugar-containing tablet, or a finely dispersed top dressing. When a liquid carrier is used, the feed additive may be a gelatin soft capsule, or in the form of a syrup, suspension, emulsion, or solution. The above feed may include any protein-containing organic grain meal commonly used to satisfy the dietary needs of animals. Such protein-containing grain meal typically consists of corn, soybean meal, or a corn / soybean meal mix. Additionally, the feed composition may contain, for example, preservatives, stabilizers, wetting agents or emulsifiers, solution accelerators, etc. Furthermore, the feed additive composition may be used by adding it to the animal feed by immersion, spraying, or mixing.

[0050] The subjects of feeding the feed or feed additive of the present invention are individuals requiring prevention, improvement, or treatment of nosema, and said individuals may include all animals excluding humans who have or may develop nosema, and said animals may include non-human primates, e.g., chimpanzees, other ape or monkey species; livestock animals, e.g., cattle, horses, sheep, goats, pigs; domesticated animals, e.g., rabbits, dogs, or cats; laboratory animals, e.g., rodents, e.g., rats, mice, or guinea pigs; non-mammalians, e.g., birds or fish, but are not limited thereto. Preferably, said animals may be carried out.

[0051]

[0052] In one aspect of the present invention, the present invention provides a method for preventing or treating nosema, comprising the step of administering the composition to a bee.

[0053] The pharmaceutical composition of the present invention can be administered orally or parenterally.

[0054] Suitable dosages of the pharmaceutical composition of the present invention vary depending on factors such as the formulation method, mode of administration, age, body weight, sex, pathological condition of the bee, food, time of administration, route of administration, excretion rate and response sensitivity, and according to a preferred embodiment of the present invention, the daily dosage of the composition of the present invention is 0.0001-100 mg / kg.

[0055] In one embodiment of the present invention, the bee is a larva or an adult bee.

[0056]

[0057] The features and advantages of the present invention are summarized as follows:

[0058] (a) The present invention provides a composition for inhibiting Nosema bacteria comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

[0059] (b) The present invention provides a pharmaceutical composition for the prevention or treatment of nosema comprising the above composition.

[0060] (c) The present invention provides a food composition for improving nosema comprising the above composition.

[0061] (d) The present invention provides a method for preventing or treating nosema in bees, comprising the step of administering the above composition to a bee.

[0062] (e) When using the composition of the present invention, nosema can be effectively prevented or treated.

[0063]

[0064] Figures 1a and 1b show the results of gut microbiome analysis in Western bee and native bee larvae.

[0065] Figures 2a and 2b show the results of gut microbiome analysis in Seongbong.

[0066] Figure 3 shows the results of gut microbiome analysis in bee larvae infected with Nosema bacteria.

[0067] Figure 4 shows the results of intestinal microbiome analysis in Nosema-infected bees.

[0068] Figure 5 shows the results of gut microbiome analysis in bee larvae infected with a combination of Nosema disease and sacbrood disease.

[0069] Figure 6 shows the results of gut microbiome analysis in adult bees infected with a combination of Nosema disease and sacbrood disease.

[0070] Figure 7 shows the results of gut microbiome analysis in bee larvae infected with a combination of four diseases: Nosema, sacbrood, American foulbrood, and European foulbrood.

[0071] Figure 8 shows the results of gut microbiome analysis in adult bees infected with a combination of four diseases: Nosema, sacbrood, American foulbrood, and European foulbrood.

[0072] Figure 9 shows the composition of the medium used for isolating and identifying the intestinal microbiome of domestic honeybees.

[0073] Figures 10a and 10b show the results of isolating and identifying the gut microbiome of domestic honeybees.

[0074] Figure 11 shows the results of verifying the self-aggregation ability of the candidate strain.

[0075] Figure 12 shows the results of measuring the cell surface hydrophobicity of the candidate strain.

[0076] Figure 13 shows the results of verifying the stability (toxicity to bees) of the candidate strain.

[0077] Figure 14 shows the results of phylogenetic tree analysis of selected strains using 16S rRNA base sequences.

[0078] Figure 15 shows the results of the analysis of the effect of the selected strain on the bee development ability.

[0079] Figure 16 shows the results of verifying the change in survival rate of honeybees infected with Nosema bacteria when treated with selected strains.

[0080] Figure 17 shows the results of comparing the infection amount of Nosema bacteria when treated with selected strains.

[0081] Figure 18 shows the results of verifying changes in honeybee growth factors when treated with selected strains.

[0082] Figures 19 and 20 show the results of verifying changes in honeybee immunity-related factors when treated with selected strains.

[0083]

[0084] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.

[0085]

[0086] Examples

[0087] Example 1: Analysis of Gut Microbiome Diversity in Domestic Honeybees

[0088] To analyze the microbiome of domestic honeybees, a total of 94 samples were obtained from 9 farms in 8 cities and provinces for Western honeybees and 9 farms in 4 cities and provinces for native honeybees.

[0089] Nucleic acids were extracted using MP Biomedicals' FastDNA Spin Kit for soil, which is primarily used to isolate the guts of adult and larval samples and extract metagenomic DNA. Subsequently, the adult and larval samples were placed in Lysing Matrix E tubes containing ceramic beads, 400 µl of PBS was added, and the mixture was homogenized using a Precellys 24 homogenizer. The homogenate was then used for DNA extraction, and the extracted nucleic acid samples were analyzed by pyrosequencing. The primers, mixes, and conditions used for PCR are shown in Tables 1, 2, 3, 4, 5, and 6 below.

[0090]

[0091] Primary PCR Primer Pair Forward1st_341F(Sequence No. 1)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG (50mer)Reverse1st_805R(Sequence No. 2)GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC (55mer)

[0092]

[0093] 1st PCR master mixReagentVolume10X buffer2.5 uldNTP2.5 ulForward Primer (10 pmole / ul)1 ulReverse Primer (10 pmole / ul)1 ulTaq polymerase (Dr.Mas DNA polymerase, 500U)0.25 ulDNA2 ulD.W.16.75 ulTotal25 ul

[0094]

[0095] 1st PCR conditionsStep℃MinCycleInitial denaturation953:00Denaturation950:3025 cyclesAnnealing550:30Extension720:30Final extension725:00Hold4∞

[0096]

[0097] Secondary PCR Primer Pair Index i5S502 (Sequence No. 3)AATGATACGGCGACCACCGAGATCTACAC-CTCTCTAT-TCGTCGGCAGCGTC (51mer) (Composition: Left-i5(XXXXXXXX)-Right) Index I7N701 (Sequence No. 4)CAAGCAGAAGACGGCATACGAGAT-TCGCCTT-GTCTCGTGGGCTCGG (47mer) (Composition: Left-i7(XXXXXXXX)-Right)

[0098]

[0099] 2nd PCR master mixReagentVolume10X buffer2.5 uldNTP2.5 ulForward Primer (10 pmole / ul)1 ulReverse Primer (10 pmole / ul)1 ulTaq polymerase (Dr.Mas DNA polymerase, 500U)0.25 ulDNA (1st PCR Product)2 ulD.W.16.75 ulTotal25 ul

[0100]

[0101] Second PCR conditionsStep℃MinCycleInitial denaturation953:00Denaturation950:308 cyclesAnnealing550:30Extension720:30Final extension725:00Hold4∞

[0102]

[0103] The results of the analysis of gut microbiome characteristics of Western bees and native bees are shown in Figures 1a and 1b and Figures 2a and 2b.

[0104] As shown in Figures 1a and 1b and 2a and 2b, when considering the characteristics of the gut microbiome of Western honeybees, it was found that Proteobactria, Firmicutes, and Actinobacteria were dominant in the order of both adults and larvae, and at the genus level, adults showed higher diversity than larvae. In addition, it was found that Lactobacillus and Bifidobacterium, known as lactic acid bacteria, were present in greater quantities in adults than in larvae.

[0105] As shown in Figures 1a and 1b and 2a and 2b, when considering the characteristics of the gut microbiome of native bees, it was found that both adults and larvae were dominated in the order of Proteobactria, Firmicutes, Bacteroidetes, and Actinobacteria, and that Actinobacteria were more dominant than in Western bees. At the genus level, it was found that adults had higher diversity than larvae, and that lactic acid bacteria such as Lactobacillus and Bifidobacterium were also present in greater quantities in adults than in larvae.

[0106]

[0107] The results of the comparative analysis of the gut microbiome of bees infected with Nosema and normal bees are shown in Figures 3 and 4.

[0108] As shown in Figure 3, when infected with nosema, it was confirmed that the Frischella perrara and Gilliamella apicola groups were reduced in bee larvae, and the Providencia alcalifacies group was lost.

[0109] As shown in Figure 4, it was confirmed that when infected with nosema, the Proteus hauseri group, Bifidobacterium asteroides group, Citrobacter_uc, Pseudomonas synxantha group, Pseudomonas flavescens group, Enterobacteriaceae group, Eneterobacter_uc, Lactobacillus kullabergensis, Lactobacillus kimbladii, Lactobacillus kunkeei group, Lactobacillus helsinborgensis, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus apis, etc. were lost or reduced in adult bees.

[0110]

[0111] The results of the comparative analysis of the gut microbiomes of bees infected with a combination of Nosema disease and sacbrood disease and normal bees are shown in Figures 5 and 6.

[0112] As shown in Figure 5, it was confirmed that when bee larvae were infected with two types of diseases—Nosemasis and Sacbrood—the Bonbella intestini group, Providencia alcalifaciens group, Rhodococcus erythropolis group, and Gilliamella apicola group were lost or reduced.

[0113] As shown in Figure 6, it was confirmed that adult bees infected with a combination of Nosema disease and sacbrood disease showed the disappearance or reduction of Bifidobacterium asteroides group, Citrobacter_uc, Pseudomonas synxantha group, Pseudomonas flavescens group, Enterobacteriaceae group, Enterobacter_uc, Frischella perrara, Lactobacillus mellifer, L. kullabergensis, L. kimbladii, L. kunkeei group, L. helsingborgensis, L. mellis, L. melliventris, L. apis, etc.

[0114]

[0115] The results of a comparative analysis of the gut microbiomes of bees infected with a combination of four diseases—Nosema, sacbrood, American foulbrood, and European foulbrood—and normal bees are shown in Figures 7 and 8.

[0116] As shown in Figure 7, when the bee larvae were infected with four types of diseases—Nosema, Sacbrood, American foulbrood, and European foulbrood—it was confirmed that Bonbella intestini group, Providencia alcalifaciens group, and Frischella perrara disappeared, and Gilliamella apicola group and Rhodococcus erythropolis group were reduced.

[0117] As shown in Figure 8, when adult bees were infected with four types of diseases—Nosema, Sacbrood, American foulbrood, and European foulbrood—it was confirmed that Bifidobacterium asteroides group, Lactobacillus kullabergensis, L. kimbladii, L. kunkeei group, L. helsingborgensis, L. mellis, L. melliventris, L. apis, etc. were reduced.

[0118] From the above results, it was confirmed that the composition of the bee's gut microbiome consists of various strains, and that significant changes in the microbiome composition occur when infected with specific diseases.

[0119]

[0120] Example 2: Isolation and Identification of Gut Microbiome from Domestic Honeybees and Selection of Candidate Strains

[0121] 2.1 Isolation and Identification of Gut Microbiome in Korean Honeybees

[0122] To select strains effective for the treatment of nosema, the gut microbiome of Korean honeybees was isolated and identified. The intestines were separated from adult honeybees using tweezers, and 500 µl of PBS was added to a tube containing beads and vortexed for 5 to 10 seconds. After treatment with a homogenizer, 100 µl of the stock or diluted sample was inoculated into the culture medium, spread with a spreader, and then anaerobic incubated in a jar or chamber. The culture temperature was maintained at 35±2℃. The composition of the culture medium, the primers used for microbiome identification, and the PCR conditions are shown in Figure 9, Table 8, and Table 9 below.

[0123]

[0124] PCR primers for the identification of enteric bacteria and Target size Primer Sequence (5' → 3') Fragment size (bp) 518F(Sequence No. 5)CCAGCAGCCGCGGTAATACG1500800R(Sequence No. 6)TACCAGGGTATCTAATCC

[0125]

[0126] PCR primers and Target size for the identification of enteric fungi and yeasts Primer Sequence (5' → 3') Fragment size (bp) ITS1 (Sequence No. 7) TCCGTAGGTGAACCTGCGG 700-900 bp ITS4 (Sequence No. 8) TCCTCCGCTTATTGATATGC

[0127]

[0128] PCR conditionsStep℃MinCycleInitial denaturation943Denaturation940.530 cyclesAnnealing550.5Extension720.5Final extension725Hold10∞

[0129]

[0130] The results of the isolation and identification of honeybee gut microorganisms are shown in Figures 10a and 10b.

[0131] As shown in Figures 10a and 10b, intestinal microorganisms were isolated and identified from honeybee samples collected in Korea, resulting in the identification of a total of 72 species of intestinal bacteria. Similar to the results of the microbiome analysis, bacteria of the genera Lactobacillus and Bifidobacterium, which are widely known as lactic acid bacteria, were mainly isolated.

[0132]

[0133] 2.2 Verification of Cell Adhesion Ability

[0134] Lactic acid bacteria used as probiotics require cell adhesion ability to attach to intestinal cells in order to function continuously within the body; in this experiment, we investigated auto-aggregation ability, which can indirectly confirm cell adhesion ability. Candidate strains were cultured at 37°C on MRS agar under anaerobic conditions. Subsequently, single colonies were inoculated into MRS broth and cultured under anaerobic conditions for 18 hours. The candidate strain cultures were centrifuged (8,000 rpm, 10 min), washed twice with PBS, and resuspended in PBS to adjust the OD580 to 0.5 (±0.05). Each culture was incubated at 37°C. At 0, 1, 5, 18, and 24 hours, 100 µl of the supernatant was transferred to a 96-well plate, and the absorbance was measured at 580 nm. Auto-aggregation ability was calculated using Equation 1 below.

[0135]

[0136] [Equation 1]

[0137] Self-reliance ability (%) = (A0-A) / A0 x 100

[0138]

[0139] The results are shown in Figure 11.

[0140] As shown in Figure 11, the results of measuring the self-aggregation activity of honeybee-derived probiotic candidate strains showed that the self-aggregation of the six strains gradually increased over time. When 24 hours were reached, self-aggregation activity was confirmed in the range of 82.27% (L. panisapium) to 90.83% (L. melliventris). In the case of the L. melliventris strain, it showed a self-aggregation ability of 87.59% after 5 hours, confirming a higher self-aggregation activity compared to other strains.

[0141]

[0142] 2.3 Measurement of Cell Surface Hydrophobicity of Candidate Strains

[0143] The ability of cells to adhere to the intestinal tract is significantly influenced by the composition and structure of the cell surface, and cell surface hydrophobicity is known to be a major factor. Cell surface hydrophobicity refers to the presence of proteins on the cell surface; as the amount of proteins increases, self-aggregation and cell adhesion capabilities improve. Therefore, in this study, the cellular hydrophobicity of candidate probiotic strains derived from honeybees was measured. The candidate strains were cultured at 37°C on MRS agar under anaerobic conditions. Subsequently, a single colony was inoculated into MRS broth and cultured under anaerobic conditions for 18 hours. The candidate strain cultures were centrifuged (8,000 rpm, 10 minutes) and washed twice with PBS. The absorbance of each culture was adjusted to an OD580 of 0.5 (±0.05), and xylene or toluene was added to each culture in a 1:1 ratio. The mixtures were vigorously mixed for 2 minutes and incubated at room temperature for 30 minutes. Among the separated layers, 100 µl of the culture layer was transferred to a 96-well plate, and the absorbance was measured at 580 nm. The degree of hydrophobicity of the cell surface was determined by comparing the initial absorbance with the absorbance of the culture layer. Cell surface hydrophobicity was calculated using Equation 2 below.

[0144]

[0145] [Equation 2]

[0146] Hydrophobicity (%) = (A0-A) / A0 x 100

[0147]

[0148] The results are shown in Figure 12.

[0149] As shown in Figure 12, the toluene and xylene adhesion ability, which indicates the hydrophobicity of the cells, was confirmed to be high for the L. kimbladii strain at 71.95% and for the L. panisapium strain at 70.15%. For toluene, hydrophobicity was observed in the range of 16.53% (L. mellis) to 71.95% (L. kimbladii), and for xylene, hydrophobicity was observed in the range of 11.09% (L. mellis) to 70.15% (L. panisapium). In addition, the four species L. apis, L. panisapium, L. melliventris, and L. kimbladii showed higher hydrophobicity compared to the two species L. kullabergensis and L. mellis.

[0150]

[0151] 2.4 Safety Assessment of Candidate Strains

[0152] It is known that the efficacy of probiotic strains varies depending on the strain, and it has been reported that some commercially available strains can exacerbate diseases. Therefore, the safety of the candidate strains selected in this study was observed on larvae when treated at a constant concentration. The candidate strains were cultured at 37°C on MRS agar under anaerobic conditions. Subsequently, a single colony was inoculated into MRS broth and cultured under anaerobic conditions for 18 hours. First and second-instar European honeybee larvae were transferred to a 6-well plate at a density of 10 larvae per well and cultured in a 35°C incubator for one day. The candidate strain cultures were centrifuged (13,000 rpm, 5 min), washed twice, and the absorbance of each culture was adjusted to an OD600 of 0.7 (±0.05). Each culture was mixed with royal jelly in a 1:1 ratio, and 200 µl was administered per well. The survival rate of the larvae was checked after 7 days of culture.

[0153] The results are shown in Figure 13.

[0154] As shown in Figure 13, the untreated group showed a survival rate of 94% after 3 days and 40% after 7 days. The groups treated with L. kullabergensis, L. mellis, L. panisapium, L. kimbladii, L. apis, and L. melliventris showed survival rates of 88%, 90%, 84%, 76%, 98%, and 80%, respectively, after 7 days, which were higher than the survival rate of the untreated control group.

[0155] Among 72 lactic acid bacteria isolates derived from honeybees, six final strains were selected based on a comprehensive evaluation of cell adhesion ability, safety, and species diversity, including L. kullabergensis OMG2-B25, L. apis HSY8-B25, L. panisapium PKH2-L3, L. mellis OMG2-B33, L. melliventris HSY3-B5, and L. kimbladii AHS3-B36. Information on the selected probiotic candidate strains is shown in Table 10.

[0156]

[0157] List of Probiotic Candidate Strains Serial No. | Isolator | Isolation Information | Variety | Region 1L. kullabergensis | OMG2-B25 | Western Bee (Adult) | Goesan-si, Chungcheongbuk-do 2L. apis | HSY8-B25 | Western Bee (Adult) | Wonju-si, Gangwon-do 3L. panisapium | PKH2-L3 | Western Bee (Larva) | Hwaseong-si, Gyeonggi-do 4L. mellis | OMG2-B33 | Western Bee (Adult) | Goesan-si, Chungcheongbuk-do 5L. melliventris | HSY3-B5 | Western Bee (Adult) | Wonju-si, Gangwon-do 6L. kimbladii | AHS3-B36 | Western Bee (Adult) | Ulju-gun, Ulsan

[0158]

[0159] Example 3: Characterization of Selected Strains

[0160] 3.1 Phylogenetic Analysis of Selected Strains

[0161] 16S rRNA sequencing analysis was performed on six selected probiotic candidate strains. The primers used for sequencing analysis are shown in Table 11.

[0162] Primer information used for 16S rRNA sequencing analysis Primer name Sequence(5' -> 3') Product size(bp) 27F (Sequence No. 9) AGAGTTTGATCMTGGCTCAG14001492R (Sequence No. 10) TACGGYTACCTTGTTACGACTT1400

[0163]

[0164] The results are shown in Fig. 14.

[0165] As shown in Figure 14, the 16S rRNA base sequence analysis results were analyzed as OMG2-B25 (L. kullavergensis), HSY8-B25 (L. apis), PKH2-L3 (L. panisapium), OMG2-B33 (L. mellis), and HSY3-B5 (L. melliventris).

[0166]

[0167] 3.2 Analysis of Variations in Selected Strains

[0168] Single nucleotide polymorphisms and small insertion / deletion polymorphisms are the most frequently occurring polymorphisms in the genome and contribute to genetic diversity and phenotypic variation, so we performed an analysis of six selected variants.

[0169] The results are shown in Table 12.

[0170] As shown in Table 12, it was confirmed that the variant was present in the selected 6 weeks.

[0171] Variant analysis from whole-genome information OMG2-B25HSY8-B25PKH2-L3OMG2-B33HSY3-B5InDelsHomo19893381469711881507Hetero31342812462Total20203415677812121569SNPsHomo458891037242923000939534Hetero28832743208423Total461771069250353021739947

[0172]

[0173] 3.3 Analysis of the Effects of Selected Strains on Bee Developmental Capacity

[0174] To analyze the effect of the selected strains on bee developmental ability, the final 6 strains, including L. kullabergensis OMG2-B25, L. apis HSY8-B25, L. panisapium PKH2-L3, L. mellis OMG2-B33, L. melliventris HSY3-B5, and L. kimbladii AHS3-B36, were each 10 7 A mixture containing more than CFU / ml was prepared, and its effects on growth capacity were analyzed after administration.

[0175] The results are shown in Fig. 15.

[0176] As shown in Figure 15, it was confirmed that the larvae developed healthily even after 6 weeks of mixed strain treatment. In particular, the survival rate increased when treated with the mixed strain compared to the untreated group, and it was observed that the degree of increase in the survival rate expanded as the concentration increased.

[0177]

[0178] Example 4: Analysis of the therapeutic effect of selected strains on nosema

[0179] To verify the therapeutic effect of the selected strains on Nosema, immune-related factors (abaecin, dorsal-1) and growth-related factors (vitellogenin) were measured 1, 3, 5, and 7 days after treating adult worms infected with Nosema bacteria with candidate probiotic strains.

[0180] The results are shown in Figs. 16, 17, 18, and 19.

[0181] As shown in Figure 16, when probiotics were administered to honeybees infected with Nosema bacteria, it was confirmed that the survival rate of adult bees in the lactic acid bacteria administration group (L.apisHSY8-B25 88.0%, L.panisapiumPKH2-L3 84.0%, L.mellisOMG2-B33 90.0%, L.melliventrisHSY3-B5 80.0%, L.apisHSY8-B25 98.0%, L.kimbladiiAHS3-B36 76.0%) was higher than that of the control group (40.0%).

[0182] As shown in Figure 17, when comparing the infection levels of Nosema bacteria using a microscope and real-time PCR, it was confirmed that the Nosema causative pathogen in the group treated with the mixture was reduced.

[0183] As shown in Figure 18, when comparing the honeybee growth factor (vitellogenin) on the 11th day after administering L. kullabergensis OMG2_B25, one of the strains in the mixture, to honeybees infected with Nosema, it was confirmed that it increased compared to the control group.

[0184] As shown in Figures 19 and 20, when the bee immune-related factors (abaecin, dorsal-1) were compared with those before administration on the 11th day after administering the mixture to adult bees infected with Nosema, it was confirmed that the immune-related factors of the administered group significantly increased compared to the control group.

[0185] Based on the above results, it was confirmed that the selected strain enhances the defense ability against Nosema bacteria when administered to honeybees.

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

Claims

1. A composition for inhibiting Nosema bacteria comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

2. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus kullabergensis is Lactobacillus kullabergensis OMG2-B25 with accession number KCTC 16079BP.

3. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus apis is Lactobacillus apis HSY8-B25 with accession number KCTC 16077BP.

4. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus panisapium is Lactobacillus panisapium PKH2-L3 with accession number KCTC 16082BP.

5. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus mellis is Lactobacillus mellis OMG2-B33 with accession number KCTC 16080BP.

6. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus melliventris is Lactobacillus melliventris HSY3-B5 with accession number KCTC 16081BP.

7. A composition for inhibiting Nosema bacteria according to claim 1, wherein the Lactobacillus kimbladii is Lactobacillus kimbladii AHS3-B36 with accession number KCTC 16078BP.

8. The composition according to claim 1, wherein the composition has the characteristics of increasing the expression of growth factors in honeybees, increasing the expression of immune factors in honeybees, or a combination thereof.

9. A composition according to claim 8, wherein the growth factor is vitellogenin.

10. A composition according to claim 8, wherein the immune factor is abaecin, dorsal-1, or a combination thereof.

11. A pharmaceutical composition for the prevention or treatment of nosema comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

12. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in claim 11, the Lactobacillus kullabergensis is Lactobacillus kullabergensis OMG2-B25 with accession number KCTC 16079BP.

13. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in paragraph 11, the Lactobacillus apis is Lactobacillus apis HSY8-B25 with accession number KCTC 16077BP.

14. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in claim 11, the Lactobacillus panisapium is Lactobacillus panisapium PKH2-L3 with accession number KCTC 16082BP.

15. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in claim 11, the Lactobacillus mellis is Lactobacillus mellis OMG2-B33 with accession number KCTC 16080BP.

16. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in claim 11, the Lactobacillus melliventris is Lactobacillus melliventris HSY3-B5 with accession number KCTC 16081BP.

17. A pharmaceutical composition for the prevention or treatment of nosema, wherein, in claim 1, the Lactobacillus kimbladii is Lactobacillus kimbladii AHS3-B36.

18. A food composition for improving nosema comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

19. A feed composition for improving nosema comprising a bacterium selected from the group consisting of Lactobacillus kullabergensis, Lactobacillus apis, Lactobacillus panisapium, Lactobacillus mellis, Lactobacillus melliventris, Lactobacillus kimbladii, and combinations thereof.

20. A method for preventing or treating nosema, comprising the step of administering the composition of claim 1 to a bee.

21. A method for preventing or treating Nosema in which, in paragraph 20, the bee is a larva or an adult bee.