Compositions immunogenic against respiratory syncytial virus and methods of use thereof
Live attenuated chimeric influenza viruses expressing RSV and SARS-CoV-2 antigens administered intranasally address the limitations of current RSV vaccines by inducing effective immune responses and mucosal immunity, protecting against RSV and SARS-CoV-2 infections.
Patent Information
- Application Number
- PCT/CN2025/135349
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-22
- Filing Date
- 2025-11-17
- Publication Date
- 2026-05-28
AI Technical Summary
Current RSV vaccines do not provide full protection against infection in the upper respiratory tract and cannot prevent virus transmission in the community, and there is a need for vaccines that induce mucosal immunity.
Development of live attenuated chimeric influenza viruses, such as DelNS1-RSV and DelNS1-RSV-SARS-CoV-2, which express RSV and SARS-CoV-2 antigens, administered intranasally to induce immune responses, including neutralizing antibodies and mucosal IgA, to combat RSV and SARS-CoV-2 infections.
The chimeric vaccines effectively induce immune responses, including neutralizing antibodies and mucosal immunity, providing protective immunity against RSV and SARS-CoV-2, and reducing virus replication in the lungs.
Smart Images

Figure PCTCN2025135349-FTAPPB-I100001 
Figure PCTCN2025135349-FTAPPB-I100002 
Figure PCTCN2025135349-FTAPPB-I100003
Abstract
Description
COMPOSITIONS IMMUNOGENIC AGAINST RESPIRATORY SYNCYTIAL VIRUS AND METHODS OF USE THEREOF
[0001] CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims benefit of and priority to U.S. Provisional Application No. 63 / 723,993, filed November 22, 2024, the contents of which is specifically incorporated by reference herein in its entirety.
[0003] REFERENCE TO THE SEQUENCE LISTING
[0004] The Sequence Listing XML submitted as a file named “UHK_01529_PCT_ST26. xml, ” created on October 28, 2025, and having a size of 68, 698 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.834 (c) (1) .FIELD OF THE INVENTION
[0005] The present invention generally pertains to live attenuated chimeric influenza viruses and, more specifically, to compositions and methods for inducing immune responses to RSV, either alone or in combination with Sars-CoV-2.BACKGROUND OF THE INVENTION
[0006] Respiratory syncytial virus (RSV) is the leading cause of severe respiratory illness in infants and young children and is the major cause of infantile bronchiolitis (Welliver (2003) J Pediatr 143 : S 112) . An estimated 64 million cases of respiratory illness and 160,000 deaths worldwide are attributed to RSV induced disease. In the United States alone, tens of thousands of infant hospitalizations are due to infections by paramyxoviruses, such as RSV and parainfluenza virus (PIV) (Shay et al. (1999) JAMA 282: 1440-1446) . Severe RSV infection occurs most often in children and infants, especially in premature infants. Underlying health problems such as chronic lung disease or congenital heart disease can significantly increase the risk of serious illness. RSV infections also can cause serious illness in the elderly, individuals with chronic pulmonary disease and immunocompromised adults, such as bone marrow transplant recipients.
[0007] Currently, there are only two vaccines approved for use in adults, which are given through muscle injection and shown to prevent severe diseases caused by RSV (2-5) . However, these vaccines do not provide full protection against RSV infection in the upper respiratory tract and cannot prevent virus transmission in the community. To address these issues, it is important to develop vaccines which can induce mucosal immunity in the upper respiratory airway.
[0008] It is an object of the present invention to provide a safe and effective live attenuated vaccines for RSV.
[0009] It is also an object of the present invention to provide methods of generating live attenuated RSV vaccine.
[0010] It is also an object of the present invention to provide methods of eliciting an immune response against RSV in a mammal.
[0011] It is also an object of the present invention to provide compositions immunogenic against RSV, SARS-2-CoV-2 and the influenza virus.
[0012] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.
[0013] Throughout this specification the word “comprise, ” or variations such as “comprises” or “comprising, ” will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0014] BRIEF SUMMARY OF THE INVENTION
[0015] Compositions co-immunogenic against respiratory syncytial virus (RSV) , and SARS-CoV-2, and in some forms, the influenza virus, methods of making and using thereof, are disclosed.
[0016] The immunogenic compositions include chimeric viruses made from a genetically modified influenza virus expressing antigens for the RSV and / or antigens for SARS-CoV-2. The genetically modified influenza virus is a live attenuated influenza virus (LAIV) , and it is attenuated in view of the modification to delete viral virulence element, the NS1 (non-structural protein 1) (herein, DeLNS1 LAIV) . The disclosed RSV chimeric viruses are built on the backbone of DeLNS1 LAIV. The chimeric virus strain resulting from DelNS1 LAIV, and expressing an RSV antigen is referred to generally herein as DelNS1-RSV.
[0017] In some forms, DelNS1-RSV, expresses an RSV antigen derived from glycoprotein G encompassing amino acids residues 63aa-298aa, and is referred to generally herein as DelNS1-RSV (G) .
[0018] In some forms, the DelNS1-RSV, expresses an RSV antigen derived from glycoprotein G encompassing amino acids residues 130aa-230aa (G2Na) , and is referred to generally herein as DelNS1-RSV (G2Na) .
[0019] In some forms DelNS1-RSV, expresses an RSV G2Na antigens from two different RSV strains, preferably RSV-B1 and RSV-A2 (referred to herein as DelNS1-RSV (G2Nab) .
[0020] In some forms, DelNS1-RSV, expresses an RSV antigen derived from the head of pre-F protein (Foldon-Fhead) , and is referred to generally herein as DelNS1-RSV (F) (SEQ ID NO: 5) .
[0021] In some forms, DelNS1-RSV, additionally co-expresses antigens from Sars-CoV-2, and is referred to generally herein as DelNS1-RSV-Sars-CoV-2. In some forms, the Sars-CoV-2 antigen is the receptor binding domain (RBD) of the Sars-CoV-2.
[0022] In some forms, DelNS1-RSV-SARS-CoV-2 expresses an RSV antigen derived from glycoprotein G encompassing amino acids residues 130aa-230aa (G2Na) , and a RBD, and is referred to generally herein as DelNS1-RSV (G2Na) -Sars-CoV-2 (RBD) . In some forms, DelNS1-RSV-SARS-CoV-2 expresses expresses a RSV antigen derived from glycoprotein G encompassing amino acids residues 63aa-298aa, and RBD, and is referred to generally herein as DelNS1-RSV (G) -Sars-CoV-2 (RBD) .
[0023] Also disclosed are methods for making chimeric viruses expressing one or more antigens of the RSV and / or Sars-CoV-2. The chimeric virus strains include a LAIV which includes a deletion of the viral virulence element, the NS1 protein and adaptive mutations that allows growth of the mutated strain in vaccine producing systems. Exemplary RSV antigens include glycoprotein (G) encompassing amino acids residues (63aa-298aa or 130aa-230aa) , pre-F protein or a combination thereof. Exemplary coronavirus antigen domains include receptor binding domain (RBD) . The vaccine is generated by inserting the RSV-G protein or RSV pre-F protein or Sars-CoV-2 RBD into a live attenuated influenza virus with deleted NS1 gene (DelNS1 LAIV) . The antigens are cloned to the site of NS1 which is deleted from influenza viral genome.
[0024] Pharmaceutical compositions are also provided. The pharmaceutical compositions include the disclosed immunogenic chimeric DelNS1-RSV, DelNS1-RSV (G) (which includes SEQ ID NO: 1) , DelNS1-RSV (G2Na) (which includes SEQ ID NO: 2) , DelNS1-RSV (G2Nab) (which includes SEQ ID NO: 3) , DelNS1-RSV (F) (which includes SEQ ID NO: 6) or DelNS1-G2Na-SARS-CoV-2 (RBD) (which includes SEQ ID NO: 4) produced according to the disclosed methods in combination with LAIV. The pharmaceutical compositions typically include an effective amount of a virus to induce an immune response in subject in need thereof, when administered to the subject. The pharmaceutical compositions can include additional agents, for example adjuvants to enhance the immune response. In some embodiments, the pharmaceutical compositions do not include an adjuvant.
[0025] Methods of treating a subject in need thereof by administering the pharmaceutical composition to the subject are also provided. The methods can be vaccine protocols. Thus, in some embodiments, the subject is administered the composition to provide prophylactic or therapeutic protection against RSV and / or Sars-CoV-2 or in combination with the influenza virus.
[0026] In preferred embodiments, the disclosed chimeric compositions generated according to the methods disclosed herein, are administered to a subject in need thereof intranasally. In other embodiments, the disclosed chimeric compositions generated according to the methods disclosed herein, are administered to a subject in need thereof by subcutaneous (s. c. ) , intradermal (i. d. ) , intramuscular (i. m. ) , intravenous (i. v. ) , oral, or intranasal administration; or by injection or by inhalation. The disclosed compositions are administered to a subject in need of protective immunity against a RSV and / or SARS-CoV-2-infection.
[0027] In some forms, the immunogenic compositions administered intranasally induce neutralizing antibodies in the subject against the expressed antigens. In some forms, the immunogenic compositions induce mucosal IgA against the antigens in bronchoalveolar lavage (BAL) fluid of the subject. In some forms, the immunogenic compositions induce IgG against the antigens in serum of the subject. In some forms, the immunogenic compositions induce CD4+ and / or CD8+ cells in the lungs of the subject. In some forms, the immunogenic compositions induce neutralizing antibodies against one or more RSV strains and / or SARS-CoV-2 strains.
[0028] Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or can be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIGs. 1A-1D are schematic that show selection and design of RSV-G protein antigens for construction of DelNS1-RSV live attenuated vaccines. Segments as shown represent antigen derived from G gene of RSV (SEQ ID NO: 1 (FIG. 1A (DelNS1-G) ) ; SEQ ID NO: 2 (FIG. 1B (DelNS1-G2Na) ) ; and SEQ ID NO: 3 (FIG. 1C (DelNS1-G2Nab) ) and cloned into the DelNS1 live attenuated influenza viral vector. DelNS1-G2Na-RBD represent a chimeric antigen compose of RSV-A2-G2Na and RBD from Sars-CoV-2 (SEQ ID NO: 4 (FIG. 1D (DelNs1-G2Na-RBD) ) (Omicron BA. 5) .
[0030] FIGs. 2A-2C show illustration of construction of DelNS1-RSV-G-DAF vaccine. The vaccine was generated by inserting the G2Na (130aa-230aa) gene or G (63aa-298aa) of the RSV-G protein into a live attenuated influenza virus with deleted NS1 gene (DelNS1 LAIV) . RSV antigen was cloned to the site of NS1 which was deleted from influenza viral genome.
[0031] FIGs. 3A-3D show that DelNS1-RSV-G-DAF vaccine induce neutralizing antibodies in mice. Mice were prime-boost immunized intranasally with 2 × 106 pfu of either R1 (n =4) or R2 (n=4) DelNS1-RSV live attenuated influenza virus. At week 4 and week 6, blood was collected from mice and tested for anti-RSV-G specific IgG titers to R1 or R2 (FIG. 3B-3C) antigen and live neutralization activity against the RSV-A2 strain. At week 8, the BAL of immunized mice was collected and tested for anti-RSV-G specific IgA titers (FIG. 3D) .
[0032] FIGs. 4A-4C show that DelNS1-RSV-G-DAF R1 and R2 vaccines induce tissue resident memory (TRM) immune cells responses in lungs of BALB / c mice. At week 9 after prime-boost immunization, lung cells from immunized mice were obtained and stimulated with RSV-G peptide or incubated without peptides overnight in the presence of BFA. Surface markers (CD4-A or CD8-B) were stained, and cells were fixed and permeabilized. Intracellular cytokines were then stained with IFN-γ antibodies. Sample data were acquired using a BD FACSAria III cell sorter. R1 and R2 induce IFN-γ CD4+ and CD8+ T cell responses in lung of BALB / C mice.
[0033] FIGs. 5A-5G demonstrate DelNS1-G2Na-RBD vaccine protect against RSV and Sars-CoV-2 virus challenge in mice. (Fig. 5A) Mice were intranasally prime-boost vaccinated with G2Na-RBD (2 × 106 pfu) or PBS and then challenged with RSV-MA or Sars-COV-2 mouse-adapted strain omicron-MA virus 4 weeks after boost immunization. (FIG. 5B-5C) Antibodies to RSV-G and Sars-CoV-2 (BS. 5 RBD) were estimated. Body-weight changes (Fig. 5D) were followed after virus challenge (FIG. 5E) . RSV virus titer in the lungs were measured at 4 dpi post virus challenge. (FIG. 5F-5G) Body weight and Sars-CoV-2 (Omicron BA. 1) virus titers from lung of mice were estimated.
[0034] FIGs. 6A-6E show comparison of GSK commercial RSV vaccine with DelNS1-RSV -R1, -R2 and -G2Na-RBD in mice challenged with RSV. For the R1, R2 and G2Na-RBD group, mice were intranasally prime-boost vaccinated with 2 × 106 pfu vaccines or PBS and then challenged with RSV-MA virus 4 weeks after boost immunization. For the GSK-preF vaccine group, mice were intramuscular with 0.5ug GSK-PreF vaccine for three times and then challenged with RSV-MA virus 4 weeks after 3rd immunization (FIGs. 6A-6B) . (FIG. 6C) Body-weight changes were followed for four days till mice were scarified. (FIG. 6D) Sera antibodies to R1, R2 or to pre-F protein (GSK-Arexvy) were determined. (FIG. 6E) Virus titer in the lung tissues from mice were estimated at 4 dpi.
[0035] FIGs. 7A-7D show that DelNS1-RSV-F chimeric virus induce neutralizing antibodies in mice. Antigen derived from the head of pre-F protein of RSV A1 strain (SEQ ID NO: 5 (FIG. 7A) was selected and cloned into DelNS1 vector. Mice (n=4) were prime-boost immunized with DelNS1-RSV-F 9FIG. 7B) . (FIG. 7C) Sera were collected and antibodies to RSV pre-F IgG were estimated at week 6. (FIG. 7D) Mice were challenged with RSV moused adapted strain and RSV-N gene relative expression in the lung were measured at 4 dpi. Immunization with DelNS1-RSV-F significantly reduced virus replication in the lung of mice.
[0036] FIG. 8A and 8B show identification of G95E mutation in the NEP gene of DelNS1 vector. G95E mutation enhances the stability of the DelNS1 live attenuated influenza vaccine (LAIV) . (FIG. 8A) NEP-95G DelNS1-antigen LAIV displayed truncation in the antigen to be expressed after passage four times. (FIG. 8B) G95E stabilizes DelNS1-antigen LAIV even after passage for 12 times in cells.
[0037] FIG. 9 shows modification of five residues (K145T, K195N, P215N in B1-G2Na, and T198N, Q218N in A2-G2Na) for N-glycosylation. R22 is a fused antigen of G2Na (B1) and G2Na (A2) (SEQ ID NO: 6) which is designed for inducing immunity against both RSV B1 and A2 strains. Introduction of K145T, K195N and P214N in G2Na (B1) and T198N and Q218N substitutions in the G2Na (A2) respectively for adding N-glycosylation on these sites to enhance immunogenicity of DelNS1-RSV LAIV G protein vaccine.
[0038] FIG. 10A-10E shows addition of N-glycosylation versions (R32) elicit higher levels of antibodies and offer more efficient protection. FIG. 10A. Mice were intranasally immunized with DelNS1 vector (Vec) or DelNS1-G2Nab (R22) or DelNS1-G2Nab-Ngly (R32) LAIVs. FIG. 10B and FIG. 10C show total antibodies to RSV-A2-G and RSV-B1-G. FIG. 10D. Neutralizing activity measured using surrogate ELISA and RSV-A2 virus neutralization, respectively. FIG. 10E. Lungs of challenged mice were collected at day 4 post infection, for detect the relative expression of RSV-A2-N gene by quantitative PCR.DETAILED DESCRIPTION OF THE INVENTION
[0039] The disclosed method and compositions can be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description.
[0040] It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0041] A. Definitions
[0042] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed method and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Further, each of the materials, compositions, components, etc. contemplated and disclosed as above can also be specifically and independently included or excluded from any group, subgroup, list, set, etc. of such materials. These concepts apply to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.
[0043] As used herein, the term "adjuvant" refers to a compound or mixture that enhances an immune response.
[0044] As used herein, “attenuated” refers to refers to procedures that weaken an agent of disease (a pathogen) . An attenuated virus is a weakened, less vigorous virus. A vaccine against a viral disease can be made from an attenuated, less virulent strain of the virus, a virus capable of stimulating an immune response and creating immunity but not causing illness or less severe illness. Attenuation can be achieved by chemical treatment of the pathogen, through radiation, or by genetic modification, using methods known to those skilled in the art. Attenuation may result in decreased proliferation, attachment to host cells, or decreased production or strength of toxins.
[0045] As used herein, "elderly" , refers to a subject older than 65 years of age.
[0046] As used herein, the term “effective amount” or “therapeutically effective amount” means a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of a disease state being treated or to otherwise provide a desired pharmacologic effect. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc. ) , the disease, and the age of the subject.
[0047] As used herein, the term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that including coding sequences necessary for the production of a polypeptide, RNA (e.g., including but not limited to, mRNA, tRNA and rRNA) or precursor. The polypeptide, RNA, or precursor can be encoded by a full length coding sequence or by any portion thereof. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5'a nd 3'ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The term “gene” encompasses both cDNA and genomic forms of a gene, which may be made of DNA, or RNA. A genomic form or clone of a gene may contain the coding region interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences. ” Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA) ; introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
[0048] As used herein “immunogenic composition” means that the composition can induce an immune response and is therefore antigenic. By “immune response” means any reaction by the immune system. These reactions include the alteration in the activity of an organism's immune system in response to an antigen and can involve, for example, antibody production, induction of cell-mediated immunity, complement activation, or development of immunological tolerance.
[0049] As used herein, “nasal administration” refers to any form of administration whereby an active ingredient is propelled or otherwise introduced into the nasal passages of a subject so that it contacts the respiratory epithelium of the nasal cavity, from which it is absorbed into the systemic circulation. Nasal administration can also involve contacting the olfactory epithelium, which is located at the top of the nasal cavity between the central nasal septum and the lateral wall of each main nasal passage. The region of the nasal cavity immediately surrounding the olfactory epithelium is free of airflow. Thus, specialized methods must typically be employed to achieve significant absorption across the olfactory epithelium.
[0050] As used herein, “oral” , “enteral” , “enterally” , “orally” , “non-parenteral” , “non-parenterally” , and the like, refer to administration of a compound or composition to an individual by a route or mode along the alimentary canal. Examples of “oral” routes of administration of a composition include, without limitation, swallowing liquid or solid forms of a vaccine composition from the mouth, administration of a vaccine composition through a nasojejunal or gastrostomy tube, intraduodenal administration of a vaccine composition, and rectal administration, e.g., using suppositories that release a live bacterial vaccine strain described herein.
[0051] As used herein, “mammal” includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
[0052] As used herein, “topical administration” refers to the application of a pharmaceutical agent to the external surface of the skin or the mucous membranes (including the surface membranes of the nose, lungs and mouth) , such that the agent crosses the external surface of the skin or mucous membrane and enters the underlying tissues. Topical administration can result in a limited distribution of the agent to the skin and surrounding tissues or, when the agent is removed from the treatment area by the bloodstream, systemic distribution of the agent. In a preferred form, the agent is delivered by transdermal delivery, e.g., using a transdermal patch. Transdermal delivery refers to the diffusion of an agent across the skin (stratum corneum and epidermis) , which acts as a barrier few agents are able to penetrate. In contrast, the dermis is permeable to absorption of many solutes and drugs, and topical administration therefor occurs more readily through skin which is abraded or otherwise stripped of the epidermis to expose the dermis. Absorption through intact skin can be enhanced by combining the active agent with an oily vehicle (e.g., creams, emollients, penetration enhancers, and the like, as described, e.g., in Remington's Pharmaceutical Sciences, current edition, Gennaro et al., eds. ) prior to application to the skin (aprocess known as inunction) .
[0053] As used herein, the term “peptide” refers to a class of compounds composed of amino acids chemically bound together. In general, the amino acids are chemically bound together via amide linkages (CONH) ; however, the amino acids may be bound together by other chemical bonds known in the art. For example, the amino acids may be bound by amine linkages. Peptide as used herein includes oligomers of amino acids and small and large peptides, including polypeptides.
[0054] As used herein “chimeric virus” refers to a virus stain including viral RNA from more than one type of viral strain.
[0055] As used herein, a “variant, ” “mutant, ” or “mutated” polynucleotide or polypeptide contains at least one polynucleotide or polypeptide sequence alteration as compared to the polynucleotide or polypeptide sequence of the corresponding wild-type or parent polynucleotide or polypeptide. Mutations may be natural, deliberate, or accidental. Mutations include substitutions, deletions, and insertions.
[0056] B. Compositions
[0057] Immunogenic compositions including live attenuated chimeric virus are provided, based on DelNS1 live attenuated influenza virus (LAIV) containing a deleted NS1 segment (DelNS1) , engineered to express one or more antigens from the respiratory syncytial virus (RSV) alone or in combination with the antigens from coronavirus (herein, CoV2Ag) . The chimeric virus can be included in a formulation for administration, in a carrier, and in some embodiments, in combination with an adjuvant. The adjuvant can serve as the carrier. In some embodiments, immunogenic compositions containing the disclosed chimeric virus strains do not include an adjuvant.
[0058] The disclosed chimeric virus strains are based on a DelNS1 live attenuated influenza virus (LAIV) platform which is able to express foreign antigen from the NS1 position of NS segment of the DelNS1 LAIV genome. The compositions are immunogenic in that they can be used to elicit an immune response against the one or more RSV antigens and / or CoV2Ag encoded by the LAIV. The LAIV has improved safety due to deletion of the coding region of the NS1 segment (DelNS1) and adaptive mutations (AM) which improve its growth in vaccine producing systems.
[0059] 1. Live Attenuated Chimeric Virus
[0060] The disclosed chimeric viruses can contain various LAIV backbones containing a deleted NS1 segment (DelNS1) , engineered to express one or more antigens from the RSV alone or in combination with coronavirus (herein, CoV2Ag) . The resulting chimeric virus resulting from DelNS1 live attenuated influenza virus (LAIV) and expressing a RSV antigen is referred to generally herein, as DelNS1-RSV, DelNS1-RSV (G) , DelNS1-RSV (G2Na) , DelNS1-RSV (G2Nab) , DelNS1-RSV (F) .
[0061] Sequence used in DelNS1-RSV (G) (Fig. 1A)
[0062] Sequence used in DelNS1-G2Na (FIG. 1B)
[0063] Sequence used in DelNS1-G2Nab (FIG. 1C)
[0064] The resulting chimeric virus resulting from DelNS1 live attenuated influenza virus (LAIV) and co-expressing a RSV antigen and CoV2Ag is referred to generally herein as DelNS1-G2Na-RBD or DelNS1-G-RBD, wherein the antigen, RBD, is a receptor-binding domain of the SARS-CoV-2.
[0065] Sequence used in DelNS1-G2Na-RBD (Fig. 1D)
[0066] i. LAIV Backbones
[0067] The backbone virus used to make the disclosed chimeric virus are preferably live attenuated influenza A virus strains or live attenuated influenza A virus strains, with a partial, or preferably, a complete deletion of the NS1 gene, herein (DelNS1 LAIV) .
[0068] Influenza viruses are characterized by segmented, negative-strand RNA genomes requiring an RNA-dependent RNA polymerase of viral origin for replication. The particular structure of the influenza virus genome and function of its viral proteins enable antigenic drift and antigenic shift. These processes result in viruses able to evade the long-term adaptive immune responses in many hosts.
[0069] The influenza A, B, and C viruses, representing three of the five genera of the family Orthomyxoviridae, are characterized by segmented, negative-strand RNA genomes. Sequencing has confirmed that these viruses share a common genetic ancestry; however, they have genetically diverged, such that reassortment -the exchange of viral RNA segments between viruses -has been reported to occur within each genus, or type, but not across types.
[0070] Influenza A viruses are further characterized by the subtype of their surface glycoproteins, the hemagglutinin (HA) and the neuraminidase (NA) . Influenza viruses have a standard nomenclature that includes virus type; species from which it was isolated (if non-human) ; location at which it was isolated; isolate number; isolate year; and, for influenza A viruses only, HA and NA subtype. Thus, A / Panama / 2007 / 1999 (H3N2) was isolate number 2007 of a human influenza A virus taken in the country of Panama in 1999, and it has an HA subtype 3 and an NA subtype 2. While many genetically distinct subtypes -16 for HA and 9 for NA -have been found in circulating influenza A viruses, only three HA (H1, H2, and H3) and two NA (N1 and N2) subtypes have caused human epidemics, as defined by sustained, widespread, person-to-person transmission.
[0071] By electron microscopy, influenza A and B viruses are virtually indistinguishable. They are spherical or filamentous in shape, with the spherical forms on the order of 100 nm in diameter and the filamentous forms often in excess of 300 nm in length. The influenza A virion is studded with glycoprotein spikes of HA and NA, in a ratio of approximately four to one, projecting from a host cell-derived lipid membrane [1] . A smaller number of matrix (M2) ion channels traverse the lipid envelope, with an M2: HA ratio on the order of one M2 channel per 101-102 HA molecules [2] . The envelope and its three integral membrane proteins HA, NA, and M2 overlay a matrix of M1 protein, which encloses the virion core. Internal to the M1 matrix are found the nuclear export protein (NEP; also called nonstructural protein 2, NS2) and the ribonucleoprotein (RNP) complex, which consists of the viral RNA segments coated with nucleoprotein (NP) and the heterotrimeric RNA-dependent RNA polymerase, composed of two “polymerase basic” and one “polymerase acidic” subunits (PB1, PB2, and PA) . The organization of the influenza B virion is similar, with four envelope proteins: HA, NA, and, instead of M2, NB and BM2. Influenza C virions are structurally distinct from those of the A and B viruses; on infected cell surfaces, they can form long cordlike structures on the order of 500 μm. However, influenza C virions are compositionally similar, with a glycoprotein-studded lipid envelope overlying a protein matrix and the RNP complex. The influenza C viruses have only one major surface glycoprotein, the hemagglutinin-esterase-fusion (HEF) protein, which corresponds functionally to the HA and NA of influenza A and B viruses, and one minor envelope protein, CM2.
[0072] The disclosed chimeric DelNS1-RSV are based at least on an unexpected discovery of a genetic modification of DelNS1 LAIV, which provided improved stability of the DelNS1-RSV or DelNS1-RSV-SARS-CoV-2. In some forms, DelNS1 LAIV is further modified to introduce a G95E substitution in NEP (nuclear export) protein of the DelNS1. G95E substitution is in the NEP of CA4-DelNS1.
[0073] Exemplary starting strains include CA04, and A / WSN / 33 and A / PR / 8 / 34, with mutations introduced as exemplified herein for CA04-DelNS1.
[0074] (a) CA04-DelNS1
[0075] A LAIV backbone is a mutated influenza virus disclosed in U.S. Patent No. 11123421, incorporated herein by reference. Briefly, cold adapted influenza virus CA04-DelNS1 is based on the 2009 H1N1 influenza stain, a California (CA / 04 / 09) , strain and includes a deletion of a virulence factor activity, a first set of one or more mutation (s) that confers replication at 37 oC in the absence of the virulence factor activity, and a second or third set of one or more mutation (s) that confers replication at a temperature below 35℃. The deletion of virulence factor activity can include a deletion of at least part of a virulence factor gene. Such a deletion can be a deletion of at least part of an NS1 gene extending beyond nucleotides 57 to 528 of an NS1 segment of the mutated virus, i.e., DelNS1.
[0076] DELNS1 can include additional sets of point mutations. The first set of one or more point mutation (s) confer replicative competence, and can lie outside of an NP region of the mutated H1N1 influenza virus (for example, a G346A (D101N in protein sequence) mutation in the H1N1 influenza virus genome) . G346A mutation is in NP, leading to D101N protein mutation in the NP protein.
[0077] The second set of one or more mutation (s) can include one or more point mutation (s) , such as a T261G (L79V in protein sequence) and / or an A310G (E95G in the protein sequence) mutation in the H1N1 influenza virus genome segment encoding NEP, positions that have been found to support cold adapted DelNS1 virus replication. The mutated influenza virus can show reduced replicative ability, relative to a temperature of 35 ℃ or lower, at a temperature of 37 ℃ or higher.
[0078] (b) A / WSN / 33-DelNS1 and A / PR / 8 / 34-DELNS1
[0079] The LAIV backbone can be also derived from the A / WSN / 33 and A / PR / 8 / 34 strains described in Zheng, et al., J. Virol., 89: 10273-10285 (2015) . These viral strains include a deletion of the NS1 gene, and an adaptive substitution, A14U (obtained after a few passages of DelNS1 virus) , in the 3' noncoding region (NCR) of the M segment of viral RNA (vRNA) significantly enhances the replication of DelNS1 viruses. The M-A14U substitution supports PR8 DelNS1 virus replication in Vero and MDCK cells, while PR8 DelNS1 virus without this substitution cannot be propagated.
[0080] ii. RSV Antigens
[0081] Disclosed herein are live attenuated chimeric viruses that encode RSV antigens, in some forms antigens from more than one strain of RSV.
[0082] The RSV genome is 15.2 kb and contains 10 genes encoding 11 proteins. The RSV virion contains a lipid bilayer displaying the fusion (F) , attachment (G) and small hydrophobic (SH) proteins. RSV genome encodes two major surface glycoproteins, glycoprotein G and glycoprotein F. Glycoprotein G, or the attachment protein, mediates virus binding to the cell receptor while glycoprotein F, or the fusion protein, promotes fusion of the viral and cell membranes, allowing penetration of the viral ribonucleoprotein into the cell cytoplasm (Lopez et al. (1998) J. Virology 72: 6922-6928) . Glycoprotein F also promotes fusion of the membranes of infected cells with those of adjacent cells leading to the formation of syncytia. The F protein contains two disulfide-linked 15 subunits, Fi and F2, which are produced by proteolytic cleavage of an inactive, Nglycosylated precursor. The G protein is a 80-90 kDa type II transmembrane glycoprotein, containing N-and O-linked oligosaccharides attached to a 32 kDa precursor protein. The F and G proteins are in greater abundance than the SH protein, which is a pentameric ion channel thought to be involved in delaying apoptosis in infected cells. The viral envelope is supported by a layer of matrix (M) and M2-1 proteins. The M protein is a non-glycosylated structural protein lining the inner leaflet of the viral envelope, and it associates with the cytoplasmic domain of the F protein. The M2 gene has two overlapping ORFs, generating both M2-1 (a transcription processivity factor) and M2-2 (a protein that governs the switch from transcription to genome replication) 23. The first two transcribed genes are the nonstructural proteins NS1 and NS2, which together inhibit apoptosis24 and interferon responses. M2-1 mediates the association between M and the enclosed ribonucleoprotein complexes (RNPs) comprising viral genomic RNA tightly associated with nucleoprotein (N) . Also associated with the RNP is the RNA-dependent RNA polymerase complex (RdRp) composed of the large polymerase subunit (L) , a phosphoprotein polymerase cofactor (P) and N. (Reviewed in Battles, et al., Nature Reviews Microbiology volume 17, pages233-245 (2019) ) ,
[0083] In some forms, the live attenuated chimeric viruses disclosed herein encode at least one antigenic peptide or protein derived from the fusion protein F, the glycoprotein G, or a fragment, variant or derivative thereof. In other forms, the live attenuated chimeric viruses can encode the short hydrophobic protein SH, the matrix protein M, the nucleoprotein N, the large polymerase L, the M2-1 protein, the M2-2 protein, the phosphoprotein P, the non-structural protein NS1 or the non-structural protein NS2 of Respiratory syncytial virus (RSV) or a fragment, variant or derivative thereof.
[0084] In some preferred forms, the RSV antigen is G2Na, the central conserved region of RSV-A attachment glycoprotein G (aa130-230) .
[0085] In some forms, the RSV antigen is glycoprotein G or glycoprotein G amino acids residues 63aa-298aa.
[0086] The improved chimeric RSV viruses, herein DelNS1-RSV are also based at least on the discovery of genetic modifications which confer enhanced immunity, compared to components of the DelNS1-RSV from the parent strain.
[0087] iii. CoV2Ag
[0088] Despite similarities between SARS-CoV and SARS-CoV-2, there is genetic variation between the two and it is not obvious if epitopes that elicit an immune response against SARS-CoV will be effective against SARS-CoV-2.
[0089] A preferred CoV2Ag is the receptor binding domain (RBD) of Sars-CoV-2 in combination with RSV antigens, resulting in the chimeric virus denoted herein as DelNS1-G2Na-RBD or DelNS1-G-RBD. The LAIV platform involves distinguishing features in which the key virulent element, NS1, is knocked out, but can still replicate in vaccine production systems (eggs or MDCK cells) . When the RSV antigens and the receptor-binding domain (RBD) of Sar-CoV-2 are inserted into the NS1 site of viral genome, the antigens are stably expressed from cells infected with DelNS1-G2Na-RBD or DelNS1-G-RBD.
[0090] Use of RBD as antigen minimizes potential antibody-dependent enhancement pathology caused by using full-length spike protein or whole virus as shown in SARS coronavirus. Thus, in preferred embodiments, the antigen is not full length spike protein of Sars-CoV-2. The RBD can be further optimized to cover more than one strain of coronavirus to prevent future emerging coronavirus. DelNS1-G2Na-RBD or DelNS1-G-RBD chimeric viruses can induce both neutralizing antibodies and T cell immunities. Various vaccine seeds with different combination of HA and NA of influenza surface proteins can be generated. DelNS1-G2Na-RBD or DelNS1-G-RBD chimeric viruses can be produced by engineering an influenza virus with a deleted NS1 segment to express RSV G proteins and / or RBD.
[0091] 2. Adjuvants
[0092] The disclosed LAIV can be administered in conjunction with other immunoregulatory agents, including adjuvants. Useful adjuvants but are not limited to, one or more set forth below:
[0093] Mineral Containing Adjuvant Compositions include mineral salts, such as aluminum salts and calcium salts. Exemplary mineral salts include hydroxides (e.g., oxyhydroxides) , phosphates (e.g., hydroxyphosphates, orthophosphates) , sulfates, and the like or mixtures of different mineral compounds (e.g., a mixture of a phosphate and a hydroxide adjuvant, optionally with an excess of the phosphate) , with the compounds taking any suitable form (e.g., gel, crystalline, amorphous, and the like) , and with adsorption to the salt (s) being preferred. The mineral containing compositions can also be formulated as a particle of metal salt (WO / 0023105) . Aluminum salts can be included in compositions of the invention such that the dose of Al3+ is between 0.2 and 1.0 mg per dose.
[0094] Oil-Emulsion Adjuvants suitable for use as adjuvants in the invention can include squalene-water emulsions, such as MF59 (5%Squalene, 0.5%Tween 80, and 0.5%Span 85, formulated into submicron particles using a microfluidizer) . See, e.g., WO90 / 14837, Podda, Vaccine 19: 2673-2680, 2001. Additional adjuvants for use in the compositions are submicron oil-in-water emulsions. Examples of submicron oil-in-water emulsions for use herein include squalene / water emulsions optionally containing varying amounts of MTP-PE, such as a submicron oil-in-water emulsion containing 4-5%w / v squalene, 0.25-1.0%w / v Tween 80 (polyoxyelthylenesorbitan monooleate) , and / or 0.25-1.0%Span 85 (sorbitan trioleate) , and, optionally, N-acetylmuramyl-L-alanyl-D-isogluatminyl-L-alanine-2- (1'-2'-dipalmitoyl-s--n-glycero-3-huydroxyphosphophoryloxy) -ethylamine (MTP-PE) , for example, the submicron oil-in-water emulsion known as "MF59" (International Publication No. WO90 / 14837; U.S. Pat. Nos. 6,299,884 and 6,451,325, incorporated herein by reference in their entirety. MF59 can contain 4-5%w / v Squalene (e.g., 4.3%) , 0.25-0.5%w / v Tween 80, and 0.5%w / v Span 85 and optionally contains various amounts of MTP-PE, formulated into submicron particles using a microfluidizer such as Model 110Y microfluidizer (Microfluidics, Newton, Mass. ) . For example, MTP-PE can be present in an amount of about 0-500 μg / dose, or 0-250 μg / dose, or 0-100 μg / dose. Submicron oil-in-water emulsions, methods of making the same and immunostimulating agents, such as muramyl peptides, for use in the compositions, are described in detail in International Publication No. WO90 / 14837 and U.S. Pat. Nos. 6,299,884 and 6,451,325.
[0095] Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) can also be used as adjuvants in the invention.
[0096] Saponin Adjuvant Formulations can also be used as adjuvants in the invention. Saponins are a heterologous group of sterol glycosides and triterpenoid glycosides that are found in the bark, leaves, stems, roots and even flowers of a wide range of plant species. Saponin from the bark of the Quillaia saponaria Molina tree have been widely studied as adjuvants. Saponin can also be commercially obtained from Smilax ornata (sarsaprilla) , Gypsophilla paniculata (brides veil) , and Saponaria officianalis (soap root) . Saponin adjuvant formulations can include purified formulations, such as QS21, as well as lipid formulations, such as Immunostimulating Complexes (ISCOMs; see below) . Saponin compositions have been purified using High Performance Thin Layer Chromatography (HPLC) and Reversed Phase High Performance Liquid Chromatography (RP-HPLC) . Specific purified fractions using these techniques have been identified, including QS7, QS17, QS18, QS21, QH-A, QH-B and QH-C. A method of production of QS21 is disclosed in U.S. Pat. No. 5,057,540. Saponin formulations can also comprise a sterol, such as cholesterol (see WO96 / 33739) . Combinations of saponins and cholesterols can be used to form unique particles called ISCOMs. ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs. For example, an ISCOM can include one or more of Quil A, QHA and QHC. ISCOMs are described in EP0109942, WO96 / 11711, and WO96 / 33739. Optionally, the ISCOMS can be devoid of additional detergent. See WO00 / 07621. A description of the development of saponin based adjuvants can be found at Barr, et al., "ISCOMs and other saponin based adjuvants" , Advanced Drug Delivery Reviews 32: 247-27, 1998. See also Sjolander, et al., "Uptake and adjuvant activity of orally delivered saponin and ISCOM vaccines" , Advanced Drug Delivery Reviews 32: 321-338, 1998.
[0097] Virosomes and Virus-Like Particles (VLPs) can also be used as adjuvants. These structures generally contain one or more proteins from a virus optionally combined or formulated with a phospholipid. They are generally non-pathogenic, non-replicating and generally do not contain any of the native viral genome. The viral proteins can be recombinantly produced or isolated from whole viruses. These viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA) , Hepatitis B virus (such as core or capsid proteins) , Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus, HIV, RNA-phages, QB-phage (such as coat proteins) , GA-phage, fr-phage, AP205 phage, and Ty (such as retrotransposon Ty protein pl) .
[0098] Bacterial or Microbial Derivatives useful as adjuvants include: (i) Non-Toxic Derivatives of Enterobacterial Lipopolysaccharide (LPS) ; (ii) lipid derivatives, (iii) immunostimulatory oligonucleotides and ADP-Ribosylating Toxins and Detoxified Derivatives Thereof, (iv) ADP-Ribosylating Toxins and Detoxified Derivatives Thereof. Examples of Non-Toxic Derivatives of LPS Monophosphoryl lipid A (MPL) and 3-O-deacylated MPL (3 dMPL) . 3 dMPL is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains. An example of a "small particle" form of 3 De-O-acylated monophosphoryl lipid A is disclosed in EP 0 689 454. Such "small particles" of 3 dMPL are small enough to be sterile filtered through a 0.22 micron membrane (see EP 0 689 454) . Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosaminide phosphate derivatives e.g., RC-529 (Johnson et al., Bioorg Med Chem Lett, 9: 2273-2278, 1999) . Examples of lipid A derivatives can include derivatives of lipid A from Escherichia coli such as OM-174. OM-174 is described for example in Meraldi et al., Vaccine 21: 2485-2491, 2003; and Pajak, et al., Vaccine 21: 836-842, 2003. Examples of immunostimulatory oligonucleotides nucleotide sequences containing a CpG motif (a sequence containing an unmethylated cytosine followed by guanosine and linked by a phosphate bond) . Bacterial double stranded RNA or oligonucleotides containing palindromic or poly (dG) sequences have also been shown to be immunostimulatory.
[0099] The CpG's can include nucleotide modifications / analogs such as phosphorothioate modifications and can be double-stranded or single-stranded. Optionally, the guanosine can be replaced with an analog such as 2'-deoxy-7-deazaguanosine. See Kandimalla, et al., "Divergent synthetic nucleotide motif recognition pattern: design and development of potent immunomodulatory oligodeoxyribonucleotide agents with distinct cytokine induction profiles" , Nucleic Acids Research 31: 2393-2400, 2003; WO02 / 26757 and WO99 / 62923 for examples of analog substitutions. The adjuvant effect of CpG oligonucleotides is further discussed in Krieg, Nature Medicine (2003) 9 (7) : 831-835; McCluskie, et al., FEMS Immunology and Medical Microbiology (2002) 32: 179-185; WO98 / 40100; U.S. Pat. No. 6,207,646; U.S. Pat. No. 6,239,116 and U.S. Pat. No. 6,429,199. The CpG sequence can be directed to Toll-like receptor (TLR9) , such as the motif GTCGTT or TTCGTT. See Kandimalla, et al., "Toll-like receptor 9: modulation of recognition and cytokine induction by novel synthetic CpG DNAs" , Biochemical Society Transactions (2003) 31 (part 3) : 654-658. The CpG sequence can be specific for inducing a Th1 immune response, such as a CpG-A ODN, or it can be more specific for inducing a B cell response, such a CpG-B ODN. CpG-A and CpG-B ODNs are discussed in Blackwell, et al., J. Immunol. 170: 4061-4068, 2003; Krieg, TRENDS in Immunology 23: 64-65, 2002, and WO01 / 95935. In some aspects, the CpG oligonucleotide can be constructed so that the 5'end is accessible for receptor recognition. Optionally, two CpG oligonucleotide sequences can be attached at their 3'ends to form "immunomers" . See, for example, Kandimalla, et al., BBRC 306: 948-95, 2003; Kandimalla, et al., Biochemical Society Transactions 31: 664-658, 2003; Bhagat et al., "BBRC 300: 853-861, 2003, and WO03 / 035836. Bacterial ADP-ribosylating toxins and detoxified derivatives thereof can be used as adjuvants in the invention. For example, the toxin can be derived from E. coli (i.e., E. coli heat labile enterotoxin (LT) ) , cholera (CT) , or pertussis (PTX) . The use of detoxified ADP-ribosylating toxins as mucosal adjuvants is described in WO95 / 17211 and as parenteral adjuvants in WO98 / 42375. In some aspects, the adjuvant can be a detoxified LT mutant such as LT-K63, LT-R72, and LTR192G. The use of ADP-ribosylating toxins and detoxified derivatives thereof, particularly LT-K63 and LT-R72, as adjuvants can be found in the following references, each of which is specifically incorporated by reference herein in their entirety: Beignon, et al., Infection and Immunity 70: 3012-3019, 2002; Pizza, et al., Vaccine 19: 2534-2541, 2001; Pizza, et al., Int. J. Med. Microbiol 290: 455-461, 2003; Scharton-Kersten et al., , Infection and Immunity 68: 5306-5313, 2000; Ryan et al., Infection and Immunity 67: 6270-6280, 2003; Partidos et al., Immunol. Lett. 67: 09-216, 1999; Peppoloni et al., Vaccines 2: 285-293, 2003; and Pine et al., J. Control Release 85: 263-270, 2002.
[0100] Bioadhesives and mucoadhesives can also be used as adjuvants in the invention. Suitable bioadhesives can include esterified hyaluronic acid microspheres (Singh et al., J. Cont. Rel. 70: 267-276, 2001) or mucoadhesives such as cross-linked derivatives of poly (acrylic acid) , polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose. Chitosan and derivatives thereof can also be used as adjuvants in the invention disclosed for example in WO99 / 27960.
[0101] Adjuvant Microparticles: Microparticles can also be used as adjuvants. Microparticles (i.e., a particle of about 100 nm to about 150 μm in diameter, or 200 nm to about 30 μm in diameter, or about 500 nm to about 10 μm in diameter) formed from materials that are biodegradable and / or non-toxic (e.g., a poly (alpha-hydroxy acid) , a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone, and the like) , with poly (lactide-co-glycolide) are envisioned, optionally treated to have a negatively-charged surface (e.g., with SDS) or a positively-charged surface (e.g., with a cationic detergent, such as CTAB) .
[0102] Examples of liposome formulations suitable for use as adjuvants are described in U.S. Pat. No. 6,090,406, U.S. Pat. No. 5,916,588, and EP 0 626 169.
[0103] Additional adjuvants include polyoxyethylene ethers and polyoxyethylene esters. WO99 / 52549. Such formulations can further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol (WO 01 / 21207) as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol (WO 01 / 21152) . In some aspects, polyoxyethylene ethers can include: polyoxyethylene-9-lauryl ether (laureth 9) , polyoxyethylene-9-steoryl ether, polyoxytheylene-8-steoryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35-lauryl ether, or polyoxyethylene-23-lauryl ether.
[0104] PCPP formulations for use as adjuvants are described, for example, in Andrianov et al., Biomaterials 19: 109-115, 1998.1998. Examples of muramyl peptides suitable for use as adjuvants in the invention can include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP) , N-acetyl-normuramyl-1-alanyl-d-isoglutamine (nor-MDP) , and N-acetylmuramyl-1-alanyl-d-isoglutaminyl-1-alanine-2- (1'-2'-dipalmitoyl-s--n-glycero-3-hydroxyphosphoryloxy) -ethylamine MTP-PE) . Examples of imidazoquinolone compounds suitable for use as adjuvants in the invention can include Imiquimod and its homologues, described further in Stanley, "Imiquimod and the imidazoquinolones: mechanism of action and therapeutic potential" Clin Exp Dermatol 27: 571-577, 2002 and Jones, "Resiquimod 3M" , Curr Opin Investig Drugs 4: 214-218, 2003. Human immunomodulators suitable for use as adjuvants in the invention can include cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, and the like) , interferons (e.g., interferon-gamma) , macrophage colony stimulating factor, and tumor necrosis factor.
[0105] Adjuvant Combinations: The adjuvants are used in come preferred embodiments as combinations. For example, adjuvant compositions can include: a saponin and an oil-in-water emulsion (WO99 / 11241) ; a saponin (e.g., QS21) +a non-toxic LPS derivative (e.g., 3 dMPL) (see WO94 / 00153) ; a saponin (e.g., QS21) +a non-toxic LPS derivative (e.g., 3 dMPL) +a cholesterol; a saponin (e.g., QS21) +3 dMPL+IL-12 (optionally+a sterol) (WO98 / 57659) ; combinations of 3 dMPL with, for example, QS21 and / or oil-in-water emulsions (See European patent applications 0835318, 0735898 and 0761231) ; SAF, containing 10%Squalane, 0.4%Tween 80, 5%pluronic-block polymer L121, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion. Ribi adjuvant system (RAS) , (Ribi Immunochem) containing 2%Squalene, 0.2%Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL) , trehalose dimycolate (TDM) , and cell wall skeleton (CWS) , preferably MPL+CWS (Detox) ; and one or more mineral salts (such as an aluminum salt) +a non-toxic derivative of LPS (such as 3 dPML) .
[0106] Aluminum salts and MF59 are examples of adjuvants for use with injectable influenza vaccines. Bacterial toxins and bioadhesives are examples of adjuvants for use with mucosally-delivered vaccines, such as nasal vaccines. All adjuvants noted above and others as generally known in the art to one of ordinary skill can be formulated for intranasal administration using techniques well known in the art.
[0107] 3. Formulations and carriers
[0108] The composition of the invention can be formulated in pharmaceutical compositions. These compositions can comprise, in addition to one or more of the live attenuated chimeric virus disclosed herein, a pharmaceutically acceptable excipient, carrier, buffer, stabilizer, or other materials well known to those skilled in the art. Such materials should typically be non-toxic and should not typically interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material can depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal routes.
[0109] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. A tablet can include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Physiological saline solution, dextrose, or other saccharide solution or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol can be included. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition (e.g., immunogenic or vaccine formulation) is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, ethanol and the like. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin. The formulation should be selected according to the mode of administration.
[0110] For intravenous, cutaneous, or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity, and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, or Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants, and / or other additives can be included, as required.
[0111] Administration is preferably in a “therapeutically effective amount” or “prophylactically effective amount” (as the case can be, although prophylaxis can be considered therapy) , this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of disease being treated. Prescription of treatment, e.g., decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in the latest edition of Remington's Pharmaceutical Science, Mack Publishing Company, Easton, Pa. ( “Remington's ” ) .
[0112] Active agent (s) and compositions thereof can be formulated for pulmonary or mucosal administration. The administration can include delivery of the composition to the lungs, nasal, oral (sublingual, buccal) , vaginal, or rectal mucosa. In a particular form, the composition is formulated for and delivered to the subject sublingually.
[0113] In one form, the compounds are formulated for pulmonary delivery, such as intranasal administration or oral inhalation. The respiratory tract is the structure involved in the exchange of gases between the atmosphere and the blood stream. The lungs are branching structures ultimately ending with the alveoli where the exchange of gases occurs. The alveolar surface area is the largest in the respiratory system and is where drug absorption occurs. The alveoli are covered by a thin epithelium without cilia or a mucus blanket and secrete surfactant phospholipids. The respiratory tract encompasses the upper airways, including the oropharynx and larynx, followed by the lower airways, which include the trachea followed by bifurcations into the bronchi and bronchioli. The upper and lower airways are called the conducting airways. The terminal bronchioli then divide into respiratory bronchiole, which then lead to the ultimate respiratory zone, the alveoli, or deep lung. The deep lung, or alveoli, is the primary target of inhaled therapeutic aerosols for systemic drug delivery.
[0114] Pulmonary administration of therapeutic compositions composed of low molecular weight drugs has been observed, for example, beta-androgenic antagonists to treat asthma. Other therapeutic agents that are active in the lungs have been administered systemically and targeted via pulmonary absorption. Nasal delivery is considered to be a promising technique for administration of therapeutics for the following reasons: the nose has a large surface area available for drug absorption due to the coverage of the epithelial surface by numerous microvilli, the subepithelial layer is highly vascularized, the venous blood from the nose passes directly into the systemic circulation and therefore avoids the loss of drug by first-pass metabolism in the liver, it offers lower doses, more rapid attainment of therapeutic blood levels, quicker onset of pharmacological activity, fewer side effects, high total blood flow per cm3, porous endothelial basement membrane, and it is easily accessible.
[0115] The term aerosol as used herein refers to any preparation of a fine mist of particles, which can be in solution or a suspension, whether or not it is produced using a propellant. Aerosols can be produced using standard techniques, such as ultrasonication or high-pressure treatment.
[0116] Carriers for pulmonary formulations can be divided into those for dry powder formulations and for administration as solutions. Aerosols for the delivery of therapeutic agents to the respiratory tract are known in the art. For administration via the upper respiratory tract, the formulation can be formulated into a solution, e.g., water or isotonic saline, buffered or un-buffered, or as a suspension, for intranasal administration as drops or as a spray. Preferably, such solutions or suspensions are isotonic relative to nasal secretions and of about the same pH, ranging e.g., from about pH 4.0 to about pH 7.4 or, from pH 6.0 to pH 7.0. Buffers should be physiologically compatible and include, simply by way of example, phosphate buffers. For example, a representative nasal decongestant is described as being buffered to a pH of about 6.2. One skilled in the art can readily determine a suitable saline content and pH for an innocuous aqueous solution for nasal and / or upper respiratory administration.
[0117] Preferably, the aqueous solution is water, physiologically acceptable aqueous solutions containing salts and / or buffers, such as phosphate buffered saline (PBS) , or any other aqueous solution acceptable for administration to an animal or human. Such solutions are well known to a person skilled in the art and include, but are not limited to, distilled water, de-ionized water, pure or ultrapure water, saline, phosphate-buffered saline (PBS) . Other suitable aqueous vehicles include, but are not limited to, Ringer's solution and isotonic sodium chloride. Aqueous suspensions may include suspending agents such as cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting agent such as lecithin. Suitable preservatives for aqueous suspensions include ethyl and n-propyl p-hydroxybenzoate.
[0118] In another form, solvents that are low toxicity organic (i.e. nonaqueous) class 3 residual solvents, such as ethanol, acetone, ethyl acetate, tetrahydrofuran, ethyl ether, and propanol may be used for the formulations. The solvent is selected based on its ability to readily aerosolize the formulation. The solvent should not detrimentally react with the compounds. An appropriate solvent should be used that dissolves the compounds or forms a suspension of the compounds. The solvent should be sufficiently volatile to enable formation of an aerosol of the solution or suspension. Additional solvents or aerosolizing agents, such as freons, can be added as desired to increase the volatility of the solution or suspension.
[0119] In one form, compositions may contain minor amounts of polymers, surfactants, or other excipients well known to those of the art. In this context, “minor amounts” means no excipients are present that might affect or mediate uptake of the compounds in the lungs and that the excipients that are present are present in amount that do not adversely affect uptake of compounds in the lungs.
[0120] Dry lipid powders can be directly dispersed in ethanol because of their hydrophobic character. For lipids stored in organic solvents such as chloroform, the desired quantity of solution is placed in a vial, and the chloroform is evaporated under a stream of nitrogen to form a dry thin film on the surface of a glass vial. The film swells easily when reconstituted with ethanol. To fully disperse the lipid molecules in the organic solvent, the suspension is sonicated. Nonaqueous suspensions of lipids can also be prepared in absolute ethanol using a reusable PARI LC Jet+ nebulizer (PARI Respiratory Equipment, Monterey, CA) .
[0121] Dry powder formulations ( “DPFs” ) with large particle size have improved flowability characteristics, such as less aggregation, easier aerosolization, and potentially less phagocytosis. Dry powder aerosols for inhalation therapy are generally produced with mean diameters primarily in the range of less than 5 microns, although a preferred range is between one and ten microns in aerodynamic diameter. Large “carrier” particles (containing no drug) have been co-delivered with therapeutic aerosols to aid in achieving efficient aerosolization among other possible benefits.
[0122] Polymeric particles may be prepared using single and double emulsion solvent evaporation, spray drying, solvent extraction, solvent evaporation, phase separation, simple and complex coacervation, interfacial polymerization, and other methods well known to those of ordinary skill in the art. Particles may be made using methods for making microspheres or microcapsules known in the art. The preferred methods of manufacture are by spray drying and freeze drying, which entails using a solution containing the surfactant, spraying to form droplets of the desired size, and removing the solvent.
[0123] The particles may be fabricated with the appropriate material, surface roughness, diameter and tap density for localized delivery to selected regions of the respiratory tract such as the deep lung or upper airways. For example, higher density or larger particles may be used for upper airway delivery. Similarly, a mixture of different sized particles, provided with the same or different active agents may be administered to target different regions of the lung in one administration.
[0124] C. Methods of Making
[0125] A protocol to engineer the live attenuated chimeric virus is provided for in the examples section of Published Application No. 20190125858, incorporated herein by reference. The protocol includes (a) generating an influenza virus for example the California (CA) / 04 / 09 strain with the coding region of the NS1 gene removed from its genome. The coding region of the NS1 gene can be removed using methods known in the art. Methods to introduce targeted mutations into a genome or, in the context of virology, into a virus are subsumed under the term reverse genetics (RG) and are disclosed for example, in Hoffmann et al., Proc Natl Acad Sci U S A, 97 (11) : 6108-13 Zheng et al., J. Virol. 89 (20) : 10273-85 and Dauber, et al., J. Virol., 78 (4) : 1865-1872 (2004) , the materials and method of which are incorporated herein by reference. The method of generating influenza virus with the NS1 coding region deleted, as disclosed in Published Application No. 20190125858 is generalized and summarized herein.
[0126] 1. Generating live attenuated influenza virus (LAIV) with the coding region of the NS1 gene removed
[0127] The LAIV can be constructed with the methods disclosed in the published Application No. 20190125858 and / or US20220016232 A1. Briefly, an NS1 deletion Plasmid is constructed. Construction of NS1 Deletion Plasmid: A suitable viral strain, for example, 2009 H1N1 A / California / 04 / 09 (CA04) can be used as backbone to construct the DelNS1 vaccines strain. Plasmid without NS1 expression can be constructed by inverse PCR with primers as follows: CA04-DelNS1-529F: GACATACTTATGAGGATGTC (SEQ ID NO: 21) ; CA04-DelNS1-56F: CTGAAAGCTTGACATGGTGTTG (SEQ ID NO: 22) . These primers can be used to construct CA4-DelNS1 virus from a California (CA) / 04 / 09 strain through reverse genetic procedures that deleted an intron at 56-529.
[0128] Primers 5'-GACATACTGTGAGGATGTCAAAAATG-3 (SEQ ID NO: 23) = (NS-529F) and 5=-CTGAAAGCTTGACACAGTGTTTGG-3' (SEQ ID NO: 24) (NS-56R) can be used to construct A / WSN / 33-DelNS1 and A / PR / 8 / 34-DELNS1.
[0129] The NS1 deletion plasmid can be constructed according to the protocol described in a previous report (Garcia-Sastre, J. Virology 252: 324-330, 1998) ; Zheng, et al., J Virol 89: 10273-10285 (2015) . In brief, inverse PCR is carried out to delete the intron of the NS gene inserted into the pHW2000 vector and the plasmid phosphorylated and self-ligated. For point mutations, commercially available kits can be used, for example, the QuikChange II site-directed mutagenesis kit (Stratagene) .
[0130] An exemplary method is described in the Examples.
[0131] For example, CA4-DelNS1 can be used as the backbone viral vector, derived from A / California / 4 / 2009 (H1N1) , from which the NS1 has been deleted. HK68-DelNS1 can be made from made from the CA4-DelNS1 backbone but with HA and NA being derived from A / Hong Kong / 1 / 1968 (H3N2) . In the NS segment, the NS1 gene is deleted and replaced with G (63aa-298aa) or G2Na (130aa-230aa) gene of the RSV-G protein. The signal peptide sequence of tissue plasminogen activator (tPA) was added to the N terminal of insertion and the sequence for the transmembrane domain of decay accelerating factor (DAF) was added to the C terminal. The DAF peptide (37 amino acids) includes the transmembrane domain and cytoplasmic tail of the DAF protein. The addition of the signal peptide and the DAF transmembrane sequences to the RBD ensure its proper processing and expression on the cell surface.
[0132] Eight pHW2000 plasmids containing the DelNS1 with insertion segment and the other 7 influenza virus genomic segments, together with an NS1 expression plasmid (9th plasmid) , are transfected into a 293T / MDCK cell mixture and incubated overnight. The DNA mixture was removed, and MEM supplemented with 1 μg / ml N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) -treated trypsin (Sigma) added. Virus supernatant was collected 72 h later and designated passage 0 (P0) virus and are subsequently passaged in MDCK cells or embryonated chicken eggs.
[0133] i. Rescue of CA-04-DELNS1 Virus
[0134] Nine plasmids: pHW2000-CA04-PB2, pHW2000-CA04-PB1, pHW2000-CA04-PA, pHW2000-CA04-NP, pHW2000-CA04-HA, pHW2000-CA04-NA, pHW2000-CA04-M, pHW2000-CA04-DelNS1 and pCX-CA04-NS1 are mixed together in one tube. Each one is present at 1 μg. Transfection with the mixed plasmids was conducted in 80%confluent 293T cells plated in a 6-well plate. During transfection the old medium was replaced with 1 ml Opti-MEM without penicillin and streptomycin. Sixteen hours later the supernatant was discarded and 2 ml of MEM containing 1 μg / ml trypsin was added. Seventy hours after transfection, the supernatant was collected after the cell debris was removed.
[0135] CA4-PB2
[0136] CA4-PB1
[0137] CA4-PA
[0138] CA4-NP (D101N)
[0139] CA4-M
[0140] CA4-NA
[0141] CA-HA
[0142] CA4-NEP (delNS1) (L79V, E95G) and
[0143] CA4-NS1
[0144] ii. Passage of DelNS1 Virus
[0145] Two hundred microliter rescued DelNS1 virus can be injected into a 9 to 10-day-old fertilized egg and incubated in the 37 ℃ incubator for 48 hours. Egg allantoic fluid was collected and HA titer was measured. Blood cells and other debris were removed by centrifugation at 1500g for 10 minutes. Supernatant was transferred into a Millipore 100K ultra filter and centrifuged at the speed of 3000 g for 10 minutes. PBS was added to the filter to give a volume of 10 ml to wash the concentrated virus, and the suspension was again centrifuged at 3000 g for 10 minutes. Two hundred microliter of the resulting virus preparation is used to inoculate 9 to 10-day-old fertilized eggs and the procedure was repeated until the virus HA titer increased dramatically.
[0146] Rescued chimeric virus can be cultured in any virus-producing cell until virus titer is stabilized, evidenced for example, when the virus titer remains unchanged for at least three consecutive passages in MDCK cells and eggs. Supernatant from the transfected cells after 72 hours is collected and passaged in MDCK cells.
[0147] A preferred cell for passaging is MDCK (Madin-Darby canine kidney) cells. However, the cells used for the cultivation of viruses using a cultivation medium can be cells that can grow in vitro in synthetic media and can be used for the propagation of viruses. These can be for example BSC-1 cells, LLC-MK cells, CV-1 cells, CHO cells, COS cells, murine cells, human cells, HeLa cells, 293 cells, VERO cells, MDBK cells, , MDOK cells, CRFK cells, RAF cells, TCMK cells, LLC-PK cells, PK15 cells, WI-38 cells, MRC-5 cells, T-FLY cells, BHK cells, SP2 / 0 cells, NS0, PerC6 (human retina cells) , chicken embryo cells or derivatives, embryonated egg cells, embryonated chicken eggs or derivatives thereof.
[0148] The cultivation medium used for the production of viruses can be any medium known from prior art that is applicable for virus cultivation. Preferably the medium is a synthetic medium. This can be for example basal media as Modified Eagle's media MEM, minimum essential media MEM, Dulbecco's modified Eagle's media D-MEM, D-MEM-F12 media, William's E media, RPMI media and analogues and derivative thereof. These can also be specialty cell cultivation and virus growth media as VP-SFM, OptiProTM SFM, AIM media, HyQ SFM4 MegaVirTM, EX-CELLTM Vero SFM, EPISERF, ProVero, any 293 or CHO media and analogues and derivatives thereof. These media can be supplemented by any additive known from prior art that is applicable for cell and virus cultivation as for example animal sera and fractions or analogues thereof, amino acids, growth factors, hormones, buffers, trace elements, trypsin, sodium pyruvate, vitamins, L-glutamine and biological buffers. Preferable medium is OptiPROTM SFM supplemented with L-glutamine and trypsin.
[0149] Thus, disclosed method includes culturing the virus in for an effective amount of time to obtain a stable viral titer. In preferred embodiment, the rescued virus is passaged in a virus-producing cell, for example, MDCK cells for a period of time until viral titre remains unchanged for 3 consecutive passaged. This culture period can range from 10-50 passages, preferably, for over 20 passages at 33 ℃. The time and conditions of culture result in adaptive mutations, which allows replication of the LAIVB in vaccine producing systems such as eggs or MDCK.
[0150] D. METHODS OF USE
[0151] The disclosed live attenuated influenza chimeric virus, DelNS1-RSV, DelNS1-RSV- (G) , DelNS1-RSV (G2Na) , DelNS1-RSV (G2Nab) , DelNS1-RSV (F) , DelNS1-RSV (G2Na) -SARS-CoV-2 (RBD) or DelNS1-RSV (G) -SARS-Cov-2 (RBD) , can be used to effectively increase viral titer or elicit an immune response in a subject in need thereof. In some aspects, subjects can include the elderly (e.g., >65 years old) , young children (e.g., <5 years old) . Methods for improving immune response in children using adjuvanted formulations are disclosed for example in U.S. Publication 2017 / 0202955.
[0152] The live attenuated chimeric virus strains disclosed herein can generally be administered directly to a mammal in need thereof to increase viral titer in the mammal and elicit an immune response. In some embodiments the subject is a young child, less than 5 years of age. In other embodiments, the subject is a young child, less than two years of age. In the embodiments, the composition is administered intranasally. In other embodiments the subject is elderly, and the subject can be between the ages of 5 and 65.
[0153] Viruses are typically administered to a patient in need thereof in a pharmaceutical composition. Pharmaceutical compositions containing virus may be for systemic or local administration. Dosage forms for administration by parenteral (intramuscular (IM) , intraperitoneal (IP) , intravenous (IV) or subcutaneous injection (SC) ) , or transmucosal (nasal, vaginal, pulmonary, or rectal) routes of administration can be formulated. In the most preferred embodiments, the immunizing virus is delivered peripherally by intranasally or by intramuscular injection, and the therapeutic virus is delivered by local injection.
[0154] Direct delivery can be accomplished by parenteral injection (e.g., subcutaneously, intraperitoneally, intradermal, intravenously, intramuscularly, or to the interstitial space of a tissue) , or mucosally, such as by rectal, oral (e.g., tablet, spray) , vaginal, topical, transdermal (See e.g., WO99 / 27961) or transcutaneous (See e.g., WO02 / 074244 and WO02 / 064162) , inhalation, intranasal (See e.g., WO03 / 028760) , ocular, aural, pulmonary or other mucosal administration. Compositions can also be administered topically by direct transfer to the surface of the skin. Topical administration can be accomplished without utilizing any devices, or by contacting naked skin with the composition utilizing a bandage or a bandage-like device (see, e.g., U.S. Pat. No. 6,348,450) . In some aspects, the mode of administration is parenteral, mucosal, or a combination of mucosal and parenteral immunizations. In other aspects, the mode of administration is parenteral, mucosal, or a combination of mucosal and parenteral immunizations in a total of 1-2 vaccinations 1-3 weeks apart. In related aspects, the route of administration includes but is not limited to intranasal delivery.
[0155] 1. Effective amounts
[0156] Typically the composition is administered in an effective amount to induce an immune response against RSV antigens alone or in combination with one or more Sars-CoV-2 antigens encoded by the chimeric virus. For example, an effective amount of virus generally results in production of antibody and / or activated T cells that kill or limit proliferation of or infection by the RSV and / or Sars-CoV-2.
[0157] The composition can typically be used to elicit systemic and / or mucosal immunity, for example to elicit an enhanced systemic and / or mucosal immunity. For example, the immune response can be characterized by the induction of a serum IgG and / or intestinal IgA immune response. Typically, the level of protection against influenza infection can be more than 50%, e.g., 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. In one aspect, the level of protection can be 100%.
[0158] The immune response induced by the invention can be one or both of a TH1 immune response and a TH2 response. The immune response can be an improved or an enhanced or an altered immune response. The immune response can be one or both of a systemic and a mucosal immune response. For example, the immune response can be an enhanced systemic and / or mucosal response. An enhanced systemic and / or mucosal immunity is reflected in an enhanced TH1 and / or TH2 immune response. For example, the enhanced immune response can include an increase in the production of IgG1 and / or IgG2a and / or IgA. In another aspect the mucosal immune response can be a TH2 immune response. For example, the mucosal immune response can include an increase in the production of IgA.
[0159] Typically, activated TH2 cells enhance antibody production and are therefore of value in responding to extracellular infections. Activated TH2 cells can typically secrete one or more of IL-4, IL-5, IL-6, and IL-10. A TH2 immune response can also result in the production of IgG1, IgE, IgA, and / or memory B cells for future protection. In general, a TH2 immune response can include one or more of an increase in one or more of the cytokines associated with a TH2 immune response (such as IL-4, IL-5, IL-6 and IL-10) , or an increase in the production of IgG1, IgE, IgA and memory B cells. For example, an enhanced TH2 immune response can include an increase in IgG1 production. A TH1 immune response can include one or more of an increase in CTLs, an increase in one or more of the cytokines associated with a TH1 immune response (such as IL-2, IFN-gamma, and TNF-alpha) , an increase in activated macrophages, an increase in NK activity, or an increase in the production of IgG2a. For example, the enhanced TH1 immune response can include an increase in IgG2a production.
[0160] The disclosed DelNS1-RSV, DelNS1-RSV (G) , DelNS1-RSV (G2Na) , DelNS1-RSV(G2Nab) , DelNS1-RSV (F) , DelNS1-RSV (G2Na) -RBD or DelNS1-G-RBD chimeric virus strains can be used either alone or in combination with other agents optionally with an immunoregulatory agent capable of eliciting a Th1 and / or Th2 response.
[0161] 2. Dosages
[0162] The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc. ) , and age of the subject being treated. Appropriate dosages can be determined by a person skilled in the art, considering the therapeutic context, age, and general health of the recipient. The selected dosage depends upon the desired therapeutic effect, on the route of administration, and on the duration of the treatment desired. In determining the effective amount of the virus to be administered for the prophylaxis, the physician may evaluate circulating plasma levels of virus, and / or the production of existing antibodies against the antigen (s) . Active virus can also be measured in terms of plaque-forming units (PFU) . A plaque-forming unit can be defined as areas of cell lysis (CPE) in monolayer cell culture, under overlay conditions, initiated by infection with a single virus particle. Generally, dosage levels of virus between 102 and 1012 pfu are administered to humans. In different embodiments, the dosage range is from 104 to 1010 pfu, 105 to 109 pfu, 106 to 108 pfu, or any dose within these stated ranges. When more than one vaccine is to be administered (i.e., in combination vaccines) , the amount of each vaccine agent can be within their described ranges.
[0163] Virus is typically administered in a liquid suspension, in a volume ranging between 10 μl and 100 μl depending on the route of administration. Vaccine volumes commonly practiced range from 0.1 mL to 0.5 mL. Generally, dosage and volume will be lower for local injection as compared to systemic administration or infusion.
[0164] The vaccine composition can be administered in a single dose or a multi-dose format. Vaccines can be prepared with adjuvant hours or days prior to administrations, subject to identification of stabilizing buffer (s) and suitable adjuvant composition. Typically, the dose will be 100 μl administered locally in multiple doses, while systemic or regional administration via subcutaneous, intramuscular, intra-organ, intravenous or intranasal administration can be from for example, 10 to 100 μl.
[0165] E. Kits
[0166] A kit including the disclosed DelNS1-RSV, DelNS1-RSV (G) , DelNS1-RSV (G2Na) , DelNS1-RSV (G2Nab) , DelNS1-RSV (F) , DelNS1-RSV (G2Na) -SARS-CoV-2 (RBD) or DelNS1-RSV (G) -SARS-CoV-2 (RBD) chimeric virus strains are also provided. The kit can include a separate container containing a suitable carrier, diluent or excipient. Additionally, the kit can include instructions for mixing or combining ingredients and / or administration.
[0167] Compositions can be in liquid form or can be lyophilized. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. A container can have a sterile access port (for example, the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) .
[0168] The kit can further include a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery device (s) . The kit can further include a third component comprising an adjuvant.
[0169] The kit can also include a package insert containing written instructions for methods of inducing immunity, preventing infections, or for treating infections. The package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.
[0170] The invention also provides a delivery device pre-filled with the compositions of the invention.
[0171] The compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
[0172] The materials described above as well as other materials can be packaged together in any suitable combination as a kit useful for performing, or aiding in the performance of, the disclosed method. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed method.
[0173] The disclosed compositions can be further understood by the following paragraphs and Examples.
[0174] 1. A live attenuated chimeric influenza virus comprising a live attenuated influenza virus (LAIV) comprising a deletion of a gene associated with virulence, and one or more genes encoding respiratory syncytial virus (RSV) antigens, optionally, in combination with one or more genes encoding Sars-CoV-2 antigens.
[0175] 2. The live attenuated chimeric influenza virus of paragraph 1, wherein the LAIV is obtained from: (a) an influenza virus A subtype H1N1 or H3N2, or (b) an influenza B virus.
[0176] 3. The live attenuated chimeric influenza virus of paragraph 1, wherein the chimeric influenza virus comprises a deletion of a gene encoding Non-Structural Protein 1 (NS1) (DelNS1) .
[0177] 4. The live attenuated chimeric influenza virus of paragraph 3, wherein the deletion comprises the removal of an entire gene or a portion of a gene encoding Non-Structural Protein 1 (NS1) .
[0178] 5. The live attenuated chimeric influenza virus of any one of paragraphs 1-4, wherein the one or more RSV and optional Sars-CoV-2 antigens are inserted into the live attenuated chimeric influenza virus at a location of the deleted NS1 gene.
[0179] 6. The live attenuated chimeric influenza virus of paragraph 1, comprising one or more RSV antigens from any one of RSV-A strain, RSV-B strain, or both.
[0180] 7. The live attenuated chimeric influenza virus of paragraph 6, wherein the one or more RSV antigen is an attachment glycoprotein (glycoprotein G) , a fusion glycoprotein (glycoprotein F) , or a combination thereof.
[0181] 8. The live attenuated chimeric influenza virus of paragraph 6 or 7, wherein the glycoprotein G antigen comprises amino acids residues 63 to 298 (G) or amino acids residues 130-230 (G2Na) of the glycoprotein G.
[0182] 9. The live attenuated chimeric influenza virus of paragraph 6 or 7, wherein the glycoprotein F encompasses amino acids residues 51 to 306.
[0183] 10. The live attenuated chimeric influenza virus of any one of paragraphs 1-9, wherein the Sars-CoV-2 antigen is the Sars-CoV-2 receptor binding domain (RBD) .
[0184] 11. The live attenuated chimeric influenza virus of any one of paragraphs 1-10, comprising CA4-DelNS1 or HK68-DelNS1, and optionally, a sequence for the transmembrane domain of decay accelerating factor (DAF) at the C-terminus of the chimeric influenza virus.
[0185] 12. The live attenuated chimeric influenza virus of paragraph 11, expressing the combination of RSV G protein fragments of G2Na (A2) and G2Na (B1) , optionally, wherein the fragments of G2Na (A2) and G2Na (B1) are glycosylated.
[0186] 13, The lived attenuated chimeric influenza virus of any one of paragraphs 1-12, comprising a G95E mutation. The original DelNS1 backbone has 95G sequence in the NEP gene. The G95E mutation (change from G to E) in the NEP gene will greatly enhance the genome stability of the antigen sequence inserted in the NS segment.
[0187] 14. The live attenuated chimeric influenza virus of paragraph 12, wherein the G2Na (A2) fragment comprises T198N and Q218N substitutions and the G2Na (B1) comprises K145T, K195N, and P214N substitutions relative to the WT G2Na (B1) and G2Na (A2) fragments.
[0188] 15. A pharmaceutical composition comprising an effective amount of the live attenuated chimeric influenza virus of any one of paragraphs 1-14.
[0189] 16. The composition of paragraph 15, comprising any one of SEQ ID NOs: 1-7.
[0190] 17. The live attenuated virus of any one of paragraphs 1-14 or the composition of paragraph 15 or 16, further comprising an adjuvant.
[0191] 18. The composition of any one of paragraphs 15-17 in a form suitable for nasal administration.
[0192] 19. A method for increasing an immune response to RSV in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of claims 1-14 or the composition of any one of paragraphs 15-17, to the subject.
[0193] 20. A method for increasing an immune response to any one or both of RSV or Sars-CoV-2 in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of paragraphs 1-14, or the composition of any one of paragraphs 15-17, to the subject.
[0194] 21. A method for increasing an immune response to any one of RSV, Sars-CoV-2, influenza or a combination thereof in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of paragraphs 1-14, or the composition of any one of paragraphs 15-17, to the subject.
[0195] 22. The method of any one of paragraphs 19-21, wherein the chimeric virus is administered intranasally or intramuscularly.
[0196] 23. The method of paragraph 22, wherein the chimeric virus is administered intranasally.
[0197] 24. The method of any one of paragraphs 19-23, wherein the subject administered with the chimeric virus has elevated levels of IgA and / or IgG in mucosa and / or bronchoalveolar lavage (BAL) fluid, and / or serum against the expressed antigens.
[0198] 25. The method of any one of paragraphs 19-24, wherein the subject administered with the chimeric virus has elevated levels of CD4+ and / or CD8+ cells against the expressed antigens.
[0199] Examples
[0200] Materials and Methods
[0201] Generation and passage of DelNS1-RSV (G) vaccines
[0202] CA4-DelNS1 is the backbone viral vector, derived from A / California / 4 / 2009 (H1N1) , from which the NS1 has been deleted.
[0203] HK68-DelNS1 was made from the CA4-DelNS1 backbone but with HA and NA being derived from A / Hong Kong / 1 / 1968 (H3N2) . In the NS segment, the NS1 gene was deleted and replaced with G (63aa-298aa) or G2Na (130aa-230aa) gene of the RSV-G protein. The signal peptide sequence of tissue plasminogen activator (tPA) (gatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtttcggcc (SEQ ID NO: 19) ) was added to the N terminal of insertion and the sequence for the transmembrane domain of decay accelerating factor (DAF) (ccaaataaaggaagtggaaccacttcaggtactacccgtcttctatctgggcacacgtgtttcacgttgacaggtttgcttgggacgcta gtaaccatgggcttgctgact (SEQ ID NO: 20) ) was added to the C terminal. The DAF peptide (37 amino acids) includes the transmembrane domain and cytoplasmic tail of the DAF protein. The addition of the signal peptide and the DAF transmembrane sequences to the RBD ensure its proper processing and expression on the cell surface.
[0204] Eight pHW2000 plasmids containing the DelNS1 with insertion segment and the other 7 influenza virus genomic segments, together with an NS1 expression plasmid, were transfected into a 293T / MDCK cell mixture and incubated overnight. The DNA mixture was removed, and MEM supplemented with 1 μg / ml N-tosyl-l-phenylalanine chloromethyl ketone (TPCK) -treated trypsin (Sigma) added. Virus supernatant was collected 72 h later and designated passage 0 (P0) virus and was subsequently passaged in MDCK cells or embryonated chicken eggs.
[0205] Mice immunization and virus challenge.
[0206] Mice were prime-boost immunized intranasally with 1 × 106 pfu of DelNS1 vector (n=8) DelNS1-G (contains RSV G antigen (63aa-298aa) in the NS segment shown in Fig 1A) (n=5) , DelNS1-G2Na ( (contains RSV G antigen (130aa-230aa) in the NS segment shown in Fig 1B ) (n=5) , DelNS1-G2Nab (contains both G protein fragments form both RSV-A2 and RSV-B1 in the NS segment so that it can induce immune response against both RSV strains. The construct shown in Fig 1C) (n=3) , or DelNS1-G2Na-RBD (contains both RSV-G2Na antigen and Sars-CoV-2 RBD antigen in the NS segment so that it can induce immune response against both RSV and Sars-CoV-2. This construct is shown in Fig 1D) (n=4) . At week 6, blood was collected from mice and tested for anti-RSV-G specific IgG titers and neutralization antibody titer against the RSV-A2 strain. At week 8, the BAL of immunized mice was collected and tested for anti-RSV-G specific IgA titers. For comparison in one experiment, GSK RSV-preF subunit vaccine Arexvy was used to immunize mice intramuscularly at 0.5 μg per mouse, for three times and two weeks apart (GSK*3, n=5) . Serum was collected at week 6 for ELISA and neutralization assays. At week 8, the mice were challenged intranasally with mouse adapted RSV A2 strain (RSV-MA: 2 × 106 pfu) or Sars-CoV-2 strains (Omicron-MA: 1 × 105 pfu) . Body weight and disease symptoms were monitored daily. At day 4, lungs were collected for virus titration and detect the RSV-N gene relative expression.
[0207] Vaccine-induced memory T cell responses in lungs of BALB / c mice.
[0208] Mice were prime-boost immunized intranasally with 1 × 106 pfu of DelNS1 vector (n=4) DelNS1-G (n=4) , DelNS1-G2Na (n=4) . At week 9 after first immunization, lung cells were obtained and stimulated with RSV-G peptide or incubated without peptides overnight in the presence of BFA. Surface markers were stained, and cells fixed and permeabilized. Intracellular cytokines were then stained with antibodies. Sample data were acquired using a BD FACSAria III cell sorter. DelNS1-G and DelNS1-G2Na induce IFN-γ CD4+ T cell responses in lung of BALB / C mice.
[0209] Example 1. Selection and design of RSV (G) protein antigens for construction of DelNS1-RSV live attenuated viruses.
[0210] Current available RSV vaccines (two subunits and one mRNA) are based on application of antigen derived from pre-F of RSV. The studies herein tested another RSV surface protein, glycoprotein, which is a potential attachment protein for RSV.
[0211] Example 2. Illustration of construction of DelNS1-RSV (G) and DelNS1-RSV (G2Na) chimeric attenuated virus.
[0212] The vaccine was generated by inserting the G2Na (130aa-230aa) gene or G (63aa-298aa) of the RSV-G protein into a live attenuated influenza virus with deleted NS1 gene (DelNS1 LAIV) . RSV antigen was cloned to the site of NS1 which was deleted from influenza viral genome.
[0213] Example 3. DelNS1-RSV (G) -DAF chimeric attenuated virus induce neutralizing antibodies in mice.
[0214] This experiment showed both R1 and R2 of RSV G antigens induce high level of antibodies in mice (Fig. 3B) . R1 is DelNS1-RSV-G2Na (Figure 1B; SEQ ID NO: 2) ) , R2 is DelNS-RSV-G (Figure 1A; SEQ ID NO: 1) ) . Using RSV-A2 strain, this experiment showed antibodies induced by both R1 and R2 antigen inhibit RSV infection in cells in a neutralization assay (Fig. 3C) . In addition to the induction of antibodies in the sera, this experiment also showed immunization with DelNS1-R1 (DelNS1-RSV (G2Na) (Figure 1B) ) or DelNS1-R2 (DelNS-RSV (G) ) antigen induced mucosal IgA in bronchoalveolar lavage (BAL) fluid (Fig. 3D) .
[0215] Example 4. DelNS1-RSV (G) DAF R1 and R2 chimeric attenuated viruses induce tissue resident memory (TRM) immune cells responses in lungs of BALB / c mice.
[0216] Induction of tissue resident memory T cells is important for vaccine protection. This experiment showed immunization with both DeLNS1-R1 or DeLNS1-R2 induced CD4+ (Fig. 4B) and CD8+ (Fig. 4C) T cells in mice.
[0217] Example 5. DelNS1-RSR (G2Na) -SARS-CoV-2 (RBD) chimeric attenuated virus protect against RSV and Sars-CoV-2 virus challenge in mice.
[0218] Immunization with DelNS1-R1, DelNS1-R2 or DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) induced antibodies cross reactive antibodies to both RSV A2 and RSV-B1 strains (Figs. 5B-5C) . Upon challenge with RSV mouse adapted strain, mice immunized with DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) are protected as shown by not detectable virus titer in the lungs (Figs. 5D-5E) . Similarly, mice immunized with DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) also protected from challenged of Sars-CoV-2 (Omicron BA. 1) (Figs. 5F-5G) .
[0219] Example 6. DelNS1-G2Na-RBD chimeric attenuated virus protects against RSV and Sars-CoV-2 virus challenge in mice.
[0220] This experiment showed that vaccination with DelNS1-R1, DelNS1-R2 or DelNS1-DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) induced cross reactive antibodies to both RSV A-2 and B1 strains (Figs. 6A-6B) . Mice immunized with DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) also induced antibodies against Omicron BA. 5 strain (Fig. 6C) . To compare DelNS1-R1, DelNS1-R2 and DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) with commercial available vaccine (GSK-pre-F-Arexvy) , mice were immunized with DelNS1 LAIV through intranasal route (two times) or with GSK-pre-F-Arexvy (three times) through muscle injection and antibodies were collected as the scheduled in the (Fig. 6B) . This experiment showed that DelNS1-R1, DelNS1-R2 or DelNS1-RSV (G2Na) -SARS-CoV2 (RBD) induce comparable antibodies. When immunized mice were challenged with mouse adapted RSV strain, this experiment showed that all lung tissues collected from vaccinated mice contain not live RSV virus four days post virus challenge. This result showed all vaccinated mice were protected from RSV and proved two doses of intranasal immunization DelNS1-R1, DelNS1-R2 and DelNS1-G2Na-RBD provide same protection as three doses of muscle injection of GSK-pre-F-Arexvy.
[0221] Example 7. DelNS1-RSV (F) chimeric attenuated virus induce neutralizing antibodies in mice
[0222] DelNS1 LAIV can also be used to express RSV F antigen. This experiment used an antigen derived from the head of pre-F protein (Fig. 7A) .
[0223] Sequence used in DelNS1-foldon-Fhead (Fig. 7A) , i.e., DelNS1-RSV (F)
[0224] DelNS1-RSV (F) (SEQ ID NO: 5) was made and used to immunize mice. This experiment showed immunization with DelNS1-RSV (F) induced high level of antibodies to pre-F protein (Figs. 7B-7C) . Mice immunized with DelNS1-RSV (F) through intranasal route were protected from RSV challenge as shown by quantitative RT-PCR of N gene of RSV in the lungs of challenged mice. Mice received two doses of intranasal vaccination of DelNS1-RSV(F) vaccine has 1000-fold lower titers of viral RNA (Fig. 7D) .
[0225] The sequence for RSV-F (WT) is shown below.
[0226] EXAMPLE 8.
[0227] Description of experiment: For mouse immunization: 6-8-week-old female BALB / c mice were anesthetized with ketamine and xylazine and then immunized intranasally with 2 ×106 pfu of either CA4-R22, CA4-R32 or empty vector (CA4-DelNS1) . After 4 weeks, mice were then boosted with HK68-R22 HK68-R3, 2 or empty vector (HK68-DelNS1) . A prime boost regimen was used to increase immune response and used empty vector (DelNS1 virus) only as a control. Serum was collected at week 6 for ELISA and neutralization assays. Four weeks after boost immunization, the mice were challenged intranasally with mouse adapted RSV-A2 strains (2.5 × 106 TCID50 / ml) , lungs were collected at day 4 post infection for detect the relative expression of RSV-A2-N gene.
[0228] CA4-R22 is the H1N1 (CA4) DelNS1 chimeric virus expressing the combination of RSV G protein fragments of G2Na (A2) and G2Na (B1) as shown in figure 9.
[0229] Sequence for Fig. 9 R22 (G2Nab)
[0230] CA3-R32 is the H1N1 (CA4) DelNS1 chimeric virus expressing the combination of glycosylated form of RSV G protein fragments of G2Na (A2) and G2Na (B1) as shown in Figure 9. It is used for 1st immunization (prime) .
[0231] Sequence for Fig. 9 R32 (G2Nab-Ngly)
[0232] HK68-32 is the H3N2 (HK68) DelNS1 chimeric virus expressing the glycosylated form of RSV G protein fragments of G2Na (A2) and G2Nb (B1) as shown in Figure 9. It is used for 2nd immunization (boost) .
[0233] Further studies identified a G95E substitution in the DelNS1 vector, necessary for maintaining the stability of the DelNS1-antigen (in this case, RSV) . Without this substitution, the DelNS1-antigen is unstable during passage in vaccine-producing cells and the inserted gene is truncated (become smaller in size) after 4 passages (Figure 8A) . Upon incorporating the G95E substitution, DelNS1-RSV remains stable, as demonstrated after 12 passages (see Figure 8B) .
[0234] In order to enhance the immunogenicity of RSV G proteins (G2Na-B1 and G2N1-A2) , K145T, K195N, and P214N substitutions were introduced in G2Na (B1) , and the T198N and Q218N substitutions in the G2Na (A2) . These substitutions induced N-glycosylation on these sites, thereby enhancing the immunogenicity of the DelNS1-RSV LAIV G protein vaccine (Figure 9) .
[0235] The studies herein confirmed that the inclusion of the K145T, K195N, and P214N substitutions in G2Na (B1) , and the T198N and Q218N substitutions in the G2Na (A2) (R32) , resulted in higher levels of serum antibodies against RSV A2 (see Figure 9A) and B1 (see Figure 9B) compared to the original G protein (R22) . Studies validated that R32 induced higher levels of neutralizing antibodies against the RSV A2 strain (see Figure 10C) . In animal challenge experiments, we demonstrated that R32 is more effective in protecting mice from RSV infection, as lower levels of viral genome RNA were detected in the lungs of the R32-immunized group compared to the R22 group after RSV challenge.
[0236] G2Na (B1) is the G protein fragment of RSV B1 strain. The three mutations introduce 3 glycosylation sites to the G protein to improve its immunogenicity. Combining RSV subtype A and B G protein fragments, which can induce immune response against both RSV subtypes.
[0237] R32 should be G2Nab-Ngly. It’s the glycosylated form of R22. Some glycosylation sites were added to the G protein fragment to improve its immunogenicity (Figure 9) .
[0238] Fig. 9A and 9B show identification of G95E mutation in the NEP gene of DelNS1 vector. G95E mutation enhances the stability of the DelNS1 live attenuated influenza vaccine (LAIV) . (FIG. 9A) NEP-95G DelNS1-antigen LAIV displayed truncation in the antigen to be expressed after passage four times. (FIG. 9B) G95E stabilizes DelNS1-antigen LAIV even after passage for 12 times in cells.
[0239] FIG. 10A-E show modification of five residues (K145T, K195N, P215N in B1-G2Na, and T198N, Q218N in A2-G2Na) for N-glycosylation. R22 is a fused antigen of G2Na (B1) and G2Na (A2) which is designed for inducing immunity against both RSV B1 and A2 strains. Introduction of K145T, K195N and P214N in G2Na (B1) and T198N and Q218N substitutions in the G2Na (A2) respectively for adding N-glycosylation on these sites to enhance immunogenicity of DelNS1-RSV LAIV G protein vaccine.
[0240] References
[0241] 1. Li et al., Lancet. 2022; 399 (10340) : 2047-64.
[0242] 2. Allely et al. N Engl J Med. 2023; 389 (11) : 1052-3.
[0243] 3. Boytchev, et al. BMJ. 2023; 381: 1187.
[0244] 4. Harris E. CDC: RSV Vaccine Recommended for Older People. JAMA. 2023; 330 (5) : 401.
[0245] 5. Harris E. FDA Approves Maternal RSV Vaccine. JAMA. 2023; 330 (11) : 1029.
[0246] 6. Wang P, Zheng M, Lau SY, Chen P, Mok BWY, Liu SW, et al. Generation of DelNS1 Influenza Viruses: a Strategy for Optimizing Live Attenuated Influenza Vaccines. Mbio. 2019; 10 (5) .
[0247] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
[0248] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
1.A live attenuated chimeric influenza virus comprising a live attenuated influenza virus (LAIV) comprising a deletion of a gene associated with virulence, and one or more genes encoding respiratory syncytial virus (RSV) antigens, optionally, in combination with one or more genes encoding Sars-CoV-2 antigens.2.The live attenuated chimeric influenza virus of claim 1, wherein the LAIV is obtained from: (a) an influenza virus A subtype H1N1 or H3N2, or (b) an influenza B virus.3.The live attenuated chimeric influenza virus of claim 1, wherein the chimeric influenza virus comprises a deletion of a gene encoding Non-Structural Protein 1 (NS1) (DelNS1) .4.The live attenuated chimeric influenza virus of claim 3, wherein the deletion comprises the removal of an entire gene or a portion of a gene encoding Non-Structural Protein 1 (NS1) .5.The live attenuated chimeric influenza virus of any one of claims 1-4, wherein the one or more RSV and optional Sars-CoV-2 antigens are inserted into the live attenuated chimeric influenza virus at a location of the deleted NS1 gene.6.The live attenuated chimeric influenza virus of claim 1, comprising one or more RSV antigens from any one of RSV-Astrain, RSV-B strain, or both.7.The live attenuated chimeric influenza virus of claim 6, wherein the one or more RSV antigen is an attachment glycoprotein (glycoprotein G) , a fusion glycoprotein (glycoprotein F) , or a combination thereof.8.The live attenuated chimeric influenza virus of claim 6 or 7, wherein the glycoprotein G antigen comprises amino acids residues 63 to 298 (G) or amino acids residues 130-230 (G2Na) of the glycoprotein G.9.The live attenuated chimeric influenza virus of claim 6 or 7, wherein the glycoprotein F encompasses amino acids residues 51 to 306.10.The live attenuated chimeric influenza virus of claim 1, wherein the Sars-CoV-2 antigen is the Sars-CoV-2 receptor binding domain (RBD) .11.The live attenuated chimeric influenza virus of any one of claims 1-10, comprising CA4-DelNS1 or HK68-DelNS1, and optionally, a sequence for the transmembrane domain of decay accelerating factor (DAF) at the C-terminus of the chimeric influenza virus.12.The live attenuated chimeric influenza virus of claim 11, expressing the combination of RSV G protein fragments of G2Na (A2) and G2Na (B1) , optionally, wherein the fragments of G2Na (A2) and G2Na (B1) are glycosylated.13.The lived attenuated chimeric influenza virus of any one of claims 1-12, comprising a G95E mutation relative to the DelNS1 backbone from which is it derived.14.The live attenuated chimeric influenza virus of claim 12, wherein the G2Na (A2) fragment comprises T198N and Q218N substitutions and the G2Na (B1) comprises K145T, K195N, and P214N substitutions relative to the WT G2Na (B1) and G2Na (A2) fragments.15.A pharmaceutical composition comprising an effective amount of the live attenuated chimeric influenza virus of any one of claims 1-14.16.The composition of claim 15, comprising any one of SEQ ID NOs: 1-7.17.The live attenuated virus of any one of claims 1-14 or the composition of claim 15 or 16, further comprising an adjuvant.18.The composition of any one of claims 15-17 in a form suitable for nasal administration.19.A method for increasing an immune response to RSV in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of claims 1-14 or the composition of any one of claims 15-17, to the subject.20.A method for increasing an immune response to any one or both of RSV or Sars-CoV-2 in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of claims 1-14, or the composition of any one of claims 15-17, to the subject.21.A method for increasing an immune response to any one of RSV, Sars-CoV-2, influenza or a combination thereof in a subject in need thereof, comprising administering the live attenuated chimeric influenza virus of any one of claims 1-14, or the composition of any one of claims 15-17, to the subject.22.The method of any one of claims 19-21, wherein the chimeric virus is administered intranasally or intramuscularly.23.The method of claim 22, wherein the chimeric virus is administered intranasally.24.The method of any one of claims 19-23, wherein the subject administered with the chimeric virus has elevated levels of IgA and / or IgG in mucosa and / or bronchoalveolar lavage (BAL) fluid, and / or serum against the expressed antigens.25.The method of any one of claims 19-24, wherein the subject administered with the chimeric virus has elevated levels of CD4+ and / or CD8+ cells against the expressed antigens.