Universal UTR sequences for mRNA assembly, composition thereof, and use thereof

Abstract

Disclosed are universal UTR sequences for mRNA assembly, a composition thereof, and use thereof, belonging to the fields of molecular biology and biotechnology. The sequences are obtained by modifying a 5'UTR sequence and / or a 3'UTR sequence, for example, adding GCCACC at position -1 or adding GCCACC at position -4 of a consensus sequence of the 5'UTR, removing a uORF from the 5'UTR, and adding three sets of stop codons at the 5' end. The provided universal modified 5'UTR and 3'UTR sequences can effectively promote the stability and protein expression level of mRNAs, and are particularly suitable for the fields of gene therapy and therapeutic protein production.

Description

Universal UTR sequences for assembling mRNA, their compositions and applications Technical Field

[0001] This invention relates to the fields of molecular biology and biotechnology, and in particular to universal UTR sequences for assembling mRNA, their compositions, and their applications. Background Technology

[0002] Messenger RNA (mRNA), as a novel drug entity, has attracted widespread attention in recent years due to its characteristics such as independence from nuclear transcription and low susceptibility to insertional mutations. However, current traditional mRNA expression technologies still suffer from problems such as insufficient protein expression levels, strong immunogenicity, and limited stability. These shortcomings limit its widespread clinical application, for example, by restricting dosage and dosing intervals. Therefore, optimizing the 5'UTR and 3'UTR to enhance mRNA translation efficiency and stability has become a research focus in this field.

[0003] mRNA molecules typically contain three main structural regions: the 5' untranslated region (5'UTR), the coding region (CDS), and the 3' untranslated region (3'UTR), as shown in Figure 1. The 5'UTR usually contains functional elements that regulate translation, the coding region consists of codons responsible for specifying the amino acid sequence of the protein, and the 3'UTR may contain important signals affecting mRNA stability and translation efficiency. In eukaryotic cells, mRNA also includes a 5' cap and a polyA tail, which are used to protect mRNA from degradation and to promote the completion of the translation process, respectively. From a functional perspective, mRNA is the direct template for protein translation, determining the amino acid sequence in the synthesized protein, thereby further influencing the protein's structure and function. In addition, mRNA plays an important regulatory role, ensuring the precision and efficiency of protein synthesis by participating in gene expression regulation and interacting with various intracellular mechanisms.

[0004] The 5'UTR and 3'UTR sequences are crucial for mRNA stability and translation efficiency. In mRNA vaccine design, the 5'UTR and 3'UTR sequences are typically derived from the UTRs of highly expressed genes within the target species to promote efficient translation. For example, the UTR sequence of the α-globin gene is frequently used. Furthermore, the 5'UTR sequence can also be optimized using the phylogenetic exponential enrichment (SELEX) method. The BioNTech / Pfizer vaccine BNT162b2 and the Moderna vaccine mRNA-1273, which have been successfully marketed, employ different UTR optimization strategies. The 5'UTR of BNT162b2 is directly selected from the human α-globin gene and optimized for the Kozak sequence (using GCCACCAUG instead of ACCAUG). Its 3'UTR consists of two fragments from the human mitochondrial 12S rRNA (mtRNR1) and the AES / TLE5 gene. On the other hand, Moderna designed the 5'UTR of mRNA-1273 using the SELEX method, which included the optimal Kozak sequence GCCACCAUG and adopted the 3'UTR of human α-globin. Different 5'UTR sequences can be customized and optimized for specific coding sequences, species, and target cells.

[0005] In prokaryotes, the ribosome binding site is located 3–10 bases upstream of the start codon ATG. This purine-rich nucleotide sequence, consisting of 3–9 bases, is called the Shine-Dalgarno sequence, or SD sequence for short. This sequence is complementary to the pyrimidine-rich sequence at the 3' end of 16S rRNA, initiating translation. The ribosome, guided by the SD sequence, recognizes the AUG start codon. The structure of the SD sequence and its distance from the AUG start codon determine the binding strength of the RBS, thus significantly affecting translation efficiency.

[0006] Numerous reports have documented synthetic 5' sequences for enhancing expression, such as those disclosed in patent US20100293625, which enhance transgenic expression, particularly in therapeutic mRNA applications. These synthetic UTRs optimize translation processes in different host cells, thereby increasing protein expression levels and are suitable for medical uses such as gene therapy. Another patent, US20190071682, discloses specific 3' UTR sequences that help stabilize RNA transcripts, thereby increasing the lifespan and function of mRNA within cells. These stabilized mRNAs are particularly useful for therapeutic applications because they prolong protein expression time in target tissues. Heterologous UTR sequences for enhancing expression: Patent US11389546 covers the use of heterologous UTRs (UTRs derived from highly expressed genes) to improve mRNA stability and protein expression levels. These sequences are of significant value for gene therapies targeting diseases such as liver disease because they can promote sustained expression in specific tissues, such as hepatocytes.

[0007] Nevertheless, the BNT162b2, mRNA-1273, US20100293625, and US20190071682 mentioned above still have room for improvement in terms of high expression and stability, and their expression levels and durations need to be enhanced. Technical solutions

[0008] One of the objectives of this invention is to provide a universal UTR sequence for assembling mRNA in order to solve the above-mentioned problems.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: a universal UTR sequence for assembling mRNA, wherein the sequence is a modified 5'UTR sequence, specifically by modifying the Kozak consensus sequence near the 5'UTR start codon, specifically by adding GCCACC at position -1 or at position -4.

[0010] This invention first optimizes the Kozak sequence of the 5' UTR. Taking human α-globin (HBA) as an example, the sequence before the start codon in the HBA1-5' UTR is CCCACC. According to the Kozak consensus, there is room for improvement. This invention enhances ribosome binding by modifying the Kozak consensus sequence near the start codon, by adding GCCACC at position -1 or -4. Experiments have shown that these modifications can significantly improve translation initiation and translation efficiency. Through UTR improvements, this invention significantly increases mRNA expression levels and expression duration.

[0011] As a preferred technical solution, the uORF is removed from the 5' UTR, and three sets of stop codons are added to the 5' end. The aim is to prevent possible translation of any of the three strands in the mRNA mutant molecule.

[0012] As a further preferred technical solution, it has a base sequence as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0013] In one implementation, the 5'UTR sequence is 5'UTR-a: GGGAAUAACUAGUUGAA UCUUCUGGUCCCCACAGACUCAGAGAGAACCCACCGCCACC (SEQ ID NO.2);

[0014] Compared with the human α-globin 5'UTR sequence (SEQ ID NO.1), SEQ ID NO.2 adds six nucleotides GCCACC at the -1 site to form an enhanced Kozak sequence, which further improves protein synthesis efficiency; and adds three stop codons at the 5' end to terminate premature translation on three possible translation strands.

[0015] In another embodiment, the 5'UTR sequence is 5'UTR-b: GGGAAUAACUAGUUGAAUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACCACC (SEQ ID NO.3);

[0016] Compared to SEQ ID NO.1, SEQ ID NO.3 has six added nucleotides at the -4 position to form an enhanced Kozak sequence, further improving protein synthesis efficiency; and three stop codons are added at the 5' end to terminate premature translation on three possible translation strands.

[0017] As a preferred technical solution, the length, base composition, and distance from AUG of the 5'UTR sequence are adjusted. Preferably, the distance is increased by more than 3 bases.

[0018] In prokaryotes, the SD sequence is located 3–10 bases upstream of the start codon, consisting of 3–9 purine nucleotides. Its structure and distance from the start codon directly affect ribosome binding strength, thus significantly impacting translation efficiency. This invention, by directly inserting 6 nucleotides, adjusts the length, base composition, and distance from AUG in the UTR sequence preceding AUG, altering the position of the inherent ribosome binding site on the HBA1 5'UTR to further optimize translation efficiency. It should be noted that, as those skilled in the art will understand, inserting GCCACC also alters the position of the inherent ribosome binding site on the HBA1 5'UTR.

[0019] Furthermore, the present invention preserves, for example, a stable hairpin structure in the human α-globin 5'UTR, enhancing ribosome scanning.

[0020] The second objective of this invention is to provide another universal UTR sequence for assembling mRNA, wherein the sequence is a modification of the 3'UTR, specifically by replacing GGGGG in the 3'UTR with GGG.

[0021] As a preferred technical solution, a 30-120nt polyA tail is added to the end of the 3'UTR.

[0022] Taking human β-globin 3'UTR as an example, based on the analysis of miRNA content distribution in relevant tissues, key miRNA targets were removed and optimized to prevent miRNA-mediated inhibition, thereby increasing mRNA stability. To maximize the high efficiency and stability of human β-globin 3'UTR, the degree of sequence alteration was limited to a maximum extent, with only 2 bases changed, and the conserved sequence content exceeding 98%.

[0023] In one implementation, the optimized sequence is 3'UTR-a:

[0024] cUcgaggcUcgcUUUcUUgcUgUccaaUUUcUaUUaaaggUUccUUUgUUcccUaagUccaacUacUaaacUgggaUaUUaUgaagggccUUgagcaUcUggaUUcUgccUaaUaaaaaacaUUUaUUUUcaUUgc (SEQ ID NO.4);

[0025] Compared with the human β-globulin 3'UTR sequence (SEQ ID NO.5, a known sequence: GenBank Access: NM_000518.5), SEQ ID NO.4 shows that GGGGG in the human β-globulin 3'UTR is replaced by GGG, which reduces miRNA binding sites and promotes mRNA stability.

[0026] As a further preferred technical solution, it has a base sequence as shown in SEQ ID NO.4.

[0027] A third objective of this invention is to provide a composition comprising the aforementioned modified 5'UTR sequence and modified 3' sequence.

[0028] The fourth objective of this invention is to provide an application of the above-mentioned universal UTR sequence for assembling mRNA in the preparation of mRNA drugs or vaccines.

[0029] It should be noted that the main innovation of this invention is the optimized UTR sequence. Its versatility is that after this set of UTRs or UTR combinations are assembled with different mRNA sequences, they all exhibit high expression and high stability. Beneficial effects

[0030] Compared with the prior art, the advantages of the present invention are as follows: the universal modified 5'UTR and 3'UTR sequences provided in the present invention can effectively promote the stability of mRNA and the protein expression level, and significantly improve the expression level and expression duration of mRNA; it is particularly suitable for gene therapy and therapeutic protein production; the present invention provides an important tool for the development of mRNA vaccines and treatment regimens, and is expected to promote the rapid development of related fields. Attached Figure Description

[0031] Figure 1 shows the constituent units of mRNA;

[0032] Figure 2 shows the universal 5'UTR design and its sequence comparison with the 5'UTR of the human natural α-globin (HBA1);

[0033] Figure 3 shows the secondary structure analysis of the 5'UTR – 5'UTR+FLuc CDS;

[0034] Figure 4 shows the secondary structure analysis of 5'UTR – 5'UTR+eGFP optimized CDS;

[0035] Figure 5 shows the sequence design of the universal 3'UTR, compared with the sequence of human natural β-globin (HBB);

[0036] Figure 6 shows how the universal 5'UTR sequence enhances Fluc mRNA expression levels.

[0037] Figure 7 shows the effect of the universal 5'UTR sequence on eGFP mRNA expression levels;

[0038] Figure 8 shows the effect of the universal 3'UTR sequence on eGFP mRNA expression levels;

[0039] Figure 9 shows the effects of optimizing the 5'UTR and 3'UTR on expression levels and duration in a mouse model.

[0040] Figure 10 shows the optimized Fluc / control Fluc mRNA expression levels in a mouse model;

[0041] Figure 11 shows the optimized Fluc / control Fluc expression level ratio in the mouse model. Embodiments of the present invention

[0042] Embodiments of the present invention will now be described in more detail, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the invention, and should not be construed as limiting the invention.

[0043] Example 1: Constructing an optimized 5'UTR universal sequence

[0044] The design of the 5'UTR in this invention utilizes the 5'UTR sequence of the human α-globin gene, which consists of 38 bases preceding the promoter AUG. This sequence contains a neck loop structure and a typical Kozak sequence, as shown in Figure 2. The selection of this sequence is based on optimizing the length of the 5'UTR sequence of the human α-globin gene without disrupting the core neck loop structure (3-23 nt) of the 5'UTR. Shortening the excessively long 5'UTR can reduce the ribosome scanning distance and enhance translation efficiency.

[0045] Then, GCCACC was added outside the Kozak consensus sequence (at position -1). The sequence used in the specific embodiment is shown in Figure 2 to improve translation initiation and efficiency. The 5'UTR of HBA1 is composed of CCCACC AUGG, which is not the optimal Kozak sequence; in addition, considering that the ribosome binding site is located 3-10 bp upstream of the start codon ATG and is rich in purine nucleotides, this sequence overlaps with the Kozak sequence. It has been shown in prokaryotes that changing the base sequence in this region has a significant impact on translation initiation efficiency; therefore, the inventors added a longer GCCACC sequence before the start codon AUG to enhance the translation initiation efficiency of the Kozak region.

[0046] The design of this invention involves adding a 17-base sequence containing three sets of stop codons to the 5' end of the 5' UTR, removing abnormal transcriptions generated by potential uORFs from any strand as templates, and ensuring that protein translation starts from the correct start site.

[0047] In this invention, RNA fold analysis was used to analyze the RNA secondary structure of the optimized 5'UTR sequence, excluding sequences that disrupt the 5'UTR HBA1 neck loop structure of the α-globin gene. Figure 3 shows the potential secondary structures obtained by RNA fold analysis of the sequences after the 5'UTR binds to the CDS of the luciferin gene at different 60 nt intervals. The results show that the luciferin gene sequence attached to the 5'UTR of the human α-globin gene still maintains the integrity of the core neck loop structure (HBA1 neck loop structure) as shown in Figure 2. The optimized sequences SEQ ID NO.2 and SEQ ID NO.3 attached to the luciferin gene sequence did not affect the integrity of the HBA1 neck loop structure. The inventors performed the same calculations using the fusion protein genes of eGFP, SARS-cov-2 spike, and RSV A, respectively, to confirm the integrity of the core neck loop structure. The first 60 bases of the commercially available eGFP-encoded protein are rich in GC bases (CAI=0.76), and the sequences after binding to the 5'UTR sequence are shown in Figure 4 ("2D-1" and "2D-3" in Figure 4). RNAfold analysis revealed potential variant neck loop structures in these sequences. Optimization of the eGFP base sequence (“2D-2”, “2D-4” in Figure 4) (CAI=0.97) restored the HBA1 neck loop structure.

[0048] The 5'UTR of the present invention can be used as a universal sequence to pair with protein-coding sequences or their optimized sequences to maintain the same primary and secondary structure of the mRNA 5'UTR.

[0049] The inventors used miRDB to search for binding targets in these optimized 5'UTR sequences. Five miRNA targets were detected in the 5'UTR sequence of the human α-globin gene, listed in Table 1. Inserting GCCACC at position -1 had no effect on the number of miRNA binding targets.

[0050] Further statistical analysis of the distribution and content (RPM) of miRNAs in different tissues showed that these five miRNAs were expressed at low levels in immune-related tissues, muscle tissues, hepatocytes, brain cells, skeletal muscle cells, fibroblasts, epithelial cells, dermal fibroblasts, endothelial cells, and myoblasts. It is not expected that they will have a significant impact on mRNA stability. See Tables 2.1 and 2.2.

[0051] It should be noted that miRDB is an online database for miRNA target prediction and functional annotation. This tool was developed by analyzing thousands of miRNA-target interactions from high-throughput sequencing experiments. Common features associated with miRNA binding and target downregulation were identified and used using machine learning methods to predict miRNA targets. miRDB contains predicted miRNA targets for five species: human, mouse, rat, dog, and chicken. The inventors performed custom target predictions on these three sets of sequences (i.e., SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3). The results confirmed that the miRNA targets of these three sets of sequences are the same, and the additional base sequence did not increase the number of human and mouse miRNA targets in the 5' UTR.

[0052] Table 1: Optimization of miRNA binding sites in the 5'UTR

[0053]

[0054] Table 2.1: Distribution and content of miRNAs targeting the optimized 5'UTR (SEQ ID No. 2) sequence in relevant tissues

[0055]

[0056] Table 2.2 Distribution and content of miRNAs targeting the optimized 5'UTR (SEQ ID No. 2) sequence in relevant tissues

[0057]

[0058] Example 2: Constructing an optimized 3'UTR universal sequence

[0059] The 3'UTR is the main region where miRNAs cleave mRNA, primarily affecting mRNA stability. The highly efficient translation of human β-globin confirms the protective effect of its 3'UTR on mRNA stability. This invention analyzed the types and distribution of miRNA targets in the 3'UTR of the human β-globin gene. Table 3.1 lists 21 miRNAs located on the HBB 3'UTR and their target binding strength (target score). For example, miR-361-3p has a target score of 93, indicating a very strong binding ability to the HBB 3'UTR sequence. We also analyzed the content of these miRNAs in relevant tissues and found that miR-361-3p was highly abundant in peripheral blood mononuclear cells, thymocytes, various lymphocytes, macrophages, and hepatocytes, and is a key factor affecting the stability and expression level of mRNA in these cells.

[0060] Table 3.1: miRNA binding sites in the 3'UTR of human natural β-globin (HBB)

[0061]

[0062] Table 3.2: miRNA binding sites in the optimized 3'UTR (SEQ ID No. 4)

[0063]

[0064] Table 4.1: Distribution and RPM of miRNAs targeting the 3'UTR (SEQ ID No. 5) sequence of human natural β-globin in relevant tissues

[0065]

[0066] Table 4.2: Distribution and RPM of miRNAs targeting the 3'UTR (SEQ ID No. 5) sequence of human natural β-globin in relevant tissues

[0067]

[0068] Figure 5 shows the optimized HBB 3'UTR sequence and the binding site of miR-361-3p (Sequence 2 in Figure 5). Sequence 1 in Figure 5 is the sequence of Sequence 2 with the "GG" 561-562 removed. miRDB analysis shows that the number of miRNA binding sites in the optimized 3'UTR is reduced to 20 (see Table 3.2). By removing two Gs, the removal of the miR-361-3p binding target is optimized, preventing miRNA-mediated inhibition and thus increasing mRNA stability (see Table 4 above). The sequence alteration in this invention is very minor; the optimized 3'UTR sequence retains more than 98.4% of the HBB sequence, fully utilizing the high efficiency and stability of the human β-globin 3'UTR sequence for mRNA.

[0069] In one implementation, the optimized 3'UTR sequence is:

[0070] cUcgaggcUcgcUUUcUUgcUgUccaaUUUcUaUUaaaggUUccUUUgUUcccUaagUccaacUacUaaacUgggaUaUUaUgaagggccUUgagcaUcUggaUUcUgccUaaUaaaaaacaUUUaUUUUcaUUgc (SEQ ID NO.4).

[0071] This invention provides a method for constructing 5'UTR sequences with improved expression efficiency. First, the inventors designed several 5'UTR sequences using the method described in this invention. Further screening experiments yielded a 5'UTR sequence with significantly improved target gene expression efficiency: SEQ ID NO.2. Compared to the α-globulin 5'UTR sequence obtained through traditional motif modification methods, the mRNA constructed from the 5'UTR sequence obtained in this embodiment exhibits significantly improved target gene expression efficiency.

[0072] Example 3: mRNA liposome preparation and characterization

[0073] 3.1 mRNA preparation

[0074] The mRNA consists of a 5' UTR region, a target gene sequence (CDS), a 3' UTR region, and a PolyA tail region, as shown in Figure 1. In this embodiment of the invention, the target gene sequence used is an optimized firefly luciferase (Fluc) gene sequence (SEQ ID NO. 6) or a green fluorescent protein (eGFP) gene sequence (a known sequence, GenBank Access: XM_013393261.1). Fluc and eGFP mRNAs are commonly used reporter genes to investigate the effects of different mRNA elements on mRNA expression levels.

[0075] Based on the experimental objectives, mRNA sequences were designed by combining different mRNA elements according to the mRNA structure. DNA fragments containing the same sequence were synthesized by GenScript and cloned into plasmids containing the T7 RNA polymerase promoter. The plasmid DNA was purified using a Qiagen DNA purification column. Based on the structural characteristics of the plasmid vector, the restriction endonuclease BsaXI was selected for linearization (enzyme digestion) of the plasmid. The digestion results were identified by gel electrophoresis, and finally, the linearized plasmid was purified by ethanol precipitation to obtain the template plasmid for in vitro transcription of mRNA. Plasmid vectors expressing Fluc or eGFP were prepared, with all sequences identical except for the 5'UTR or 3'UTR, including the 5'UTR region, the target gene region (open reading frame), the 3'UTR region, and the PolyA tail region.

[0076] mRNA production was performed using Novoprotein's in vitro transcription (IVT) reaction system, which used n1-methylpseudouridine (Hongene) as a UTP substitute. The reaction was incubated at 37°C for 6 hours and treated with DNase I (Merck), followed by purification using the Monarch® RNA Cleanup Kit (NEB). The RNA was then capped for one hour using vaccinia capping enzyme (Novoprotein) under the supplier-recommended reaction buffer and conditions. The capped mRNA was further purified by oligodT chromatography (Sartorius) and then dissolved in 10 mM citrate buffer at pH 4.0. The quality of the mRNA was analyzed by agarose gel electrophoresis and Qubit HS RNA analysis. The final product was stored at -70°C.

[0077] 3.2 Preparation and characterization of LNP and LPX

[0078] mRNA was encapsulated by lipids, forming lipid nanoparticles (LNPs). The lipid composition of LNPs and LNP74 consisted of ALC-0315, DSPC, cholesterol, DMG-PEG, and Dotap, with molar ratios of 46.29:9.4:42.67:1.64:0 and 30.68:9.35:42.42:2.20:15.35, respectively. The ionizable lipid ALC-0315 was purchased from Xiamen Biotechnology Co., Ltd. Cholesterol, Dotap, DSPC, and DMA-PEG2000 were purchased from AVT (Shanghai) Pharmaceutical Technology Co., Ltd. Lecithin was purchased from Sigma-Aldrich. LNPs were prepared by mixing the lipid mixture in ethanol with three volumes of mRNA in 10 mM citrate buffer (pH 4.0) using a microfluidic apparatus at a total flow rate of 5.2 mL / min. The resulting mixture was dialyzed against 1xPBS at pH 7.4 and 4°C for 16 hours to remove ethanol, and then concentrated using a 100 kDa Amicon filter. Particle size and uniformity were analyzed using a particle size analyzer (Winner 802, micro / nano). The encapsulation efficiency of LNPs ranged from 93.45% to 99.53%. The size range of LNPs was 67.11 nm to 92.34 nm. LNPs could be stored at 4°C for up to 4 weeks.

[0079] Example 4: Effect of 5'UTR on mRNA expression levels in cultured cells in vitro

[0080] This embodiment investigated the effect of different 5'UTR sequences on the expression level of mRNA in cultured cells in vitro. The sequences included: the BioNTech / Pfizer vaccine BNT162b2 sequence with a -4 insertion at GCC (Kozak optimized), GenBank Access: PF145214.1 (as "control 5'UTR"), the sequence "5'UTR-a" as shown in SEQ ID NO.2, and the sequence "5'UTR-b" as shown in SEQ ID NO.3.

[0081] The specific method is as follows: Control 5'UTR, 5'UTR-a, and 5'UTR-b were respectively conjugated with marker gene sequences (such as Fluc or eGFP), 3'UTR, and polyA to construct different mRNAs, which were then encapsulated using the LNPs described in 3.2 of Example 3 to prepare the corresponding mRNA-LNP complexes. The cell lines used in the experiment included human lung adenocarcinoma cell lines H322 and HEK293, as well as the mouse dendritic cell line DC2.4.

[0082] Cell culture was performed using medium containing 10 vol.% fetal bovine serum (FBS). Cells in the logarithmic growth phase were collected, counted, and then cultured at 2 × 10⁶ cells per well. 5 Cells were seeded in 24-well plates and cultured overnight. The following day, the medium was changed and transfected with culture medium containing 1 µg mRNA-LNP. Three replicates were set up for each mRNA experiment. Twenty-four hours post-transfection, the transfection efficiency of eGFP mRNA-LNP was assessed using fluorescence microscopy and flow cytometry. Simultaneously, for the luciferase mRNA-LNP transfection experiment, potassium luciferin was added 24 hours after transfection, and the fluorescence intensity was measured by flow cytometry.

[0083] The experimental results showed that the expression levels of three Fluc mRNAs transfected into cells were detected. The three mRNAs had the same sequence and structure, differing only in the 5'UTR used: the Kozak-optimized α-globulin 5'UTR sequence (with GCC inserted at positions 1-4 of SEQ ID NO: 1 as the control 5'UTR), 5'UTR-a (sequence as shown in SEQ ID NO. 2), and 5'UTR-b (sequence as shown in SEQ ID NO. 3). Twenty-four hours after transfection, the fluorescence intensity of the 5'UTR-a and 5'UTR-b groups was significantly higher than that of the control group in all three cell lines, while there was no significant difference in the average fluorescence intensity between the 5'UTR-a and 5'UTR-b groups (as shown in Figure 6).

[0084] Furthermore, in the detection after cell transfection with three eGFP mRNAs, the results were consistent with those of Fluc mRNA: the fluorescence intensity of the 5'UTR-a and 5'UTR-b groups was significantly higher than that of the control 5'UTR, while there was no significant difference in the mean fluorescence intensity between the 5'UTR-a and 5'UTR-b groups (as shown in Figure 7).

[0085] In conclusion, the results of this embodiment show that the expression efficiency of mRNAs designed using 5'UTR-a and 5'UTR-b in different cultured cells is significantly higher than that of the traditionally optimized α-globulin 5'UTR sequence (control group). In the control group, GCC was inserted at position -4 of the 5'UTR, while in the experimental groups, GCCACC was inserted at positions -1 or -4, respectively.

[0086] Example 5: Effects of HBB-3'UTR and 3'UTR-a on mRNA expression levels in cultured cells in vitro

[0087] This study investigated the effects of HBB-3'UTR (sequence shown in SEQ ID NO.5, serving as the control group) and 3'UTR-a (sequence shown in SEQ ID NO.4) on the expression level of transfected mRNA in cultured cells.

[0088] The specific method is as follows: Different mRNAs were constructed from HBB-3'UTR, 3'UTR-a, 5'UTR, eGFP gene sequences, and polyA. The resulting mRNAs were encapsulated with LNPs to prepare mRNA-LNP complexes. The cell lines used in the experiment included H322, HEK293, and DC2.4.

[0089] Cell culture was performed using medium containing 10 vol.% FBS. Logarithmic growth phase cells were collected, counted, and seeded at 2 × 10⁵ cells per well in 24-well plates, and cultured overnight. The following day, the medium was changed with medium containing 1 µg mRNA-LNP and transfected. Three replicates were performed for each mRNA assay. Twenty-four hours post-transfection, the transfection efficiency of eGFP mRNA-LNP was assessed using fluorescence microscopy and flow cytometry.

[0090] The experimental results showed that two eGFP mRNAs were used to transfect cells. These mRNAs had the same sequence and structure, differing only in their 3'UTR regions (HBB-3'UTR and 3'UTR-a, respectively). Twenty-four hours after transfection, the fluorescence intensity of the two 3'UTR transfection groups was not significantly different in H322 and HEK293 cells. However, in DC2.4 cells, the average fluorescence intensity of the 3'UTR-a group was significantly higher than that of the HBB-3'UTR control group (as shown in Figure 8).

[0091] In conclusion, the experimental results show that the expression efficiency of mRNA constructed using 3'UTR-a is cell type-dependent: it did not significantly increase the expression level of mRNA in H322 and HEK293 cells, but significantly increased the expression efficiency of eGFP mRNA in DC2.4 cells.

[0092] Example 6: Effects of optimized 5'UTR and 3'UTR on mRNA expression levels in BalB / c mouse model

[0093] This embodiment evaluated the effects of the HBA1-5'UTR / HBB-3'UTR combination (i.e., the combination of sequences as SEQ ID NO.1 and SEQ ID NO.5, as the control group) and the 5'UTR-a / 3'UTR-a combination (i.e., the combination of sequences as SEQ ID NO.2 and SEQ ID NO.4, as the experimental group) on the expression level of Fluc mRNA in the BalB / c mouse model after its construction.

[0094] Experimental Methods: HBA1-5'UTR / HBB-3'UTR (control group) and 5'UTR-a / 3'UTR-a were respectively bound to the Fluc gene sequence and polyA to construct different mRNAs, which were then encapsulated with LNP74 to prepare mRNA-LNP complexes. Seven-week-old BalB / c mice were used in the experiment, and 5 µg of Fluc mRNA-LNP (injection volume 50 µl) was injected intramuscularly into the hind leg. In vivo luciferin detection was performed on days 0.25, 1, 2, 3, and 4 post-injection, as detailed below:

[0095] 1. Before each test, mice were injected intraperitoneally with 3 mg of D-fluorescein (purchased from Beyotime);

[0096] 2. Ten minutes after the injection of fluorescein, mice were anesthetized with isoflurane and the anesthesia was maintained through a nasal cannula;

[0097] 3. Thirteen to 15 minutes after fluorescein injection, the bioluminescence signal of mice was detected using the Xenogen IVIS-200 imaging system, with fluorescence intensity measured in photons per second (p / s).

[0098] Experimental Results: After intramuscular injection, the fluorescence intensity of Fluc in the experimental group mice was significantly higher than that in the control group mice at all detection time points (see Figures 9, 10, and 11). Specific results are as follows:

[0099] 1. Within one day after drug administration, the fluorescence expression level in the experimental group was more than 3.4 times that in the control group;

[0100] 2. During the period from 2 to 4 days, the fluorescence intensity of the experimental group increased from 25 times to 52 times compared with the control group (see Figure 11).

[0101] 3. In the thymus, lymph nodes and liver tissues of mice, the expression level and duration of Fluc in the experimental group were significantly higher than those in the control group (see Figure 9).

[0102] Experimental Conclusion: This study demonstrates that the mRNA modified with the 5'UTR-a / 3'UTR-a combination exhibits significantly higher expression efficiency in BalB / c mice than the control mRNA modified with HBA1-5'UTR / HBB-3'UTR, with a maximum fold increase of 52-fold. Furthermore, the experimental group showed significant expression advantages in lymph nodes, thymus, and muscle tissue. These results indicate that the optimized 5'UTR and 3'UTR significantly improve mRNA expression efficiency, effectively enhancing the application potential of mRNA-LNP in vaccine development.

[0103] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A universal UTR sequence for assembling mRNA, characterized in that, The sequence is a modified 5'UTR sequence, specifically a modification of the Kozak consensus sequence near the 5'UTR start codon, specifically by adding GCCACC at position -1 or at position -4.

2. The universal UTR sequence for assembling mRNA according to claim 1, characterized in that, Remove uORF from 5'UTR and add 3 sets of stop passwords to 5' end.

3. The universal UTR sequence for assembling mRNA according to claim 2, characterized in that, It has a base sequence as shown in SEQ ID NO.2 or SEQ ID NO.

3.

4. The universal UTR sequence for assembling mRNA according to claim 1, characterized in that, Adjust the distance between the potential ribosome binding site in the 5'UTR and AUG.

5. The universal UTR sequence for assembling mRNA according to claim 4, characterized in that, Increase the distance by more than 3 bases.

6. A universal UTR sequence for assembling mRNA, characterized in that, The sequence is a portion of the modified human β-globin 3'UTR sequence, specifically, GGGGG in the 3'UTR is replaced by GGG, characterized in that the number of bases replaced or substituted is 1.6% or less of the sequence listed in SEQ ID NO.

5.

7. The universal UTR sequence for assembling mRNA according to claim 6, characterized in that, The 3'UTR also has a 30-120nt polyA tail at the end.

8. The modified UTR sequence for mRNA according to claim 7, characterized in that, It has a base sequence as shown in SEQ ID NO.

4.

9. A composition, characterized in that, The composition comprises the modified 5'UTR sequence of claim 1 and the modified 3'UTR sequence of claim 6.

10. The use of the modified UTR sequence according to any one of claims 1 to 9 in the preparation of mRNA drugs or vaccines.

Images