Cellular reprogramming ii
Chemically modified mRNAs reprogram adult human fibroblasts into induced oligodendrocyte precursor cells, addressing safety concerns of stem cell therapies by producing effective myelinating cells for treating demyelinating diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SAMUEL AMY JANE
- Filing Date
- 2025-11-28
- Publication Date
- 2026-06-04
Smart Images

Figure IMGF000004_0001 
Figure IMGF000044_0001 
Figure IMGF000026_0001
Abstract
Description
[0001] CELLULAR REPROGRAMMING II
[0002] 1. FIELD OF THE INVENTION
[0003] The present invention relates generally to compositions for cellular reprogramming of human somatic cells into induced oligodendrocyte precursor cells, methods of making human induced oligodendrocyte precursor cells by cellular reprogramming and methods of using reprogramed human induced oligodendrocyte precursor cells for treating disease.
[0004] 2. BACKGROUND TO THE INVENTION
[0005] Oligodendrocytes are glial cells of the central nervous system which are known as the myelinating cells of the brain and spinal cord.
[0006] Oligodendrocytes are the last neural lineage cells to form during brain development. They are glial cells that produce a lipid-rich sheath called myelin. This sheath lines neuronal axons in the central nervous system, insulating them and promoting saltatory nerve signal conduction. The myelin sheath also protects the neuronal axons from damage or insults. Each oligodendrocyte is capable of myelinating up to 60 different axons.
[0007] Demyelination takes places when myelin is degraded, and oligodendrocytes are lost. This can be caused, for example, by genetic inheritance, acquired injury or autoimmune insults. Demyelination results in loss of neurological function and can often lead to severe disability and a reduction in life span. Demyelination is a prominent feature of many neurological conditions including Multiple sclerosis (MS), the most common myelin disorder, spinal cord injuries (SCI), cerebral palsy, leukodystrophies, and white matter strokes. There is also growing evidence that oligodendrocyte dysfunction and loss, resulting in a breakdown of oligodendrocyte and neuronal axon interaction, are linked to neurodegenerative diseases including Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis. This crucial role of oligodendrocytes in brain and spinal cord function and disease puts them as an important cell type for neurological disease modelling and as a potential therapeutic target. Cell transplantation therapy has been studied and tested for a variety of neurological conditions using a variety of different cell types with demyelinating disorders among the compelling targets for cellbased therapy. MS, white matter stroke, and SCI are the most obvious targets for cell-based remyelination therapy due to their severe and well described demyelination, the aim being to replace the oligodendrocytes lost to the disease process and restore myelination. Several drugs exist that can modulate demyelination; however, these have not proven to be effective in promoting or enhancing remyelination in the clinic, making cell-based transplantation strategies an attractive and necessary option.
[0008] Trials using human fetal tissue in the 1990s and early 2000s demonstrated the feasibility of cell transplantation therapy for demyelinating diseases (Gilerovich, Fedorova, & Otellin, 1991; Giovanini, Reier, Eskin, Wirth, & Anderson, 1997; Seiger, Holtz, & Akesson, 1998; Windrem et al., 2002, 2004; Wirth Hi et al., 2001). However, for cell transplantation therapy to be a viable therapeutic option for individuals with a demyelinating condition or disease, one of the main issues that needs to be addressed is the identification of an ethically and technically viable source of donor cells, other than human fetal striatal tissue.
[0009] In searching for an alternative donor cell source attention has fallen on the potential use of human-derived stem cells including human embryonic stem cells (hESCs) or human induced pluripotent stem cells (iPSC) (McCaughey-Chapman & Connor, 2023). hESC-derived oligodendrocyte precursor cells (OPCs) have been transplanted into the brain or spinal cord of shiverer mice and the survival and oligodendrocyte differentiation assessed as early as 4 weeks post-transplant and as late as 3 months after transplant (Hu, Du, & Zhang, 2009; Izrael et al., 2007; Nistor, Totoiu, Haque, Carpenter, & Keirstead, 2005). In all these studies, abundant MBP+ expression with multilayered compact myelin sheaths were detected in the transplanted brain or spinal cord. This work demonstrated that hESC-derived OPCs can survive and differentiate to mature MBP+ myelinating oligodendrocytes within the neonatal shiverer mouse model (Hu, Du, & Zhang, 2009; Izrael et al., 2007; Nistor, Totoiu, Haque, Carpenter, & Keirstead, 2005). Other groups extended this finding to other rodent models of demyelination including the rat contusion model of SCI (All et al., 2012; Keirstead et al., 2005; Kerr et al., 2010; Kim et al., 2017), the rat transection model of SCI (Erceg et al., 2010) and irradiated rats (Piao et al., 2015). Several studies have also demonstrated the potential use of iPSC-derived OPCs as a cellular source for transplantation therapy for conditions involving demyelination using shiverer mice (Douvaras et al., 2014; Ehrlich et al., 2017; Wang et al., 2013) and the contusion mouse model of SCI (Fuhrmann et al., 2016; Kawabata et al., 2016).
[0010] However, the use of hESC- or hiPSC-derived OPCs for cell transplantation comes with the potential risk of tumorigenesis and genetic mutagenesis due to the accumulation of chromosomal abnormalities associated with long-term passaging. Furthermore, hiPSCs carry the risk of developing genetic abnormalities and insertional mutagenic effects due to the oncogenic nature of reprogramming factors and the integrative methods of gene delivery used in the reprogramming process (Gonzalez, Boue, & Belmonte, 2011).
[0011] In view of the above, there is a need in the art for the development of alternative forms of cellular transplantation therapy that avoid the problems identified with the use of hESC- or hiPSC-derived OPCs, particularly the risks associated with tumorigenesis, genetic mutagenesis, development of genetic abnormalities and insertional mutagenic effects.
[0012] It is an object of the invention to provide compositions and methods that will support at least one such alternative form of cellular transplantation therapy while avoiding at least some of the defects identified in prior therapies, and / or that will at least provide the public with a useful choice. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.
[0013] 3. SUMMARY OF THE INVENTION
[0014] The compositions and methods disclosed herein employ chemically modified mRNAs to cellularly reprogram somatic cells into oligodendrocyte precursor cells. The present disclosure provides, for the first time, compositions and methods for cellularly reprogramming adult human somatic cells (aHSs), particularly adult human fibroblasts (aHFs), particularly adult human dermal fibroblasts (aHDFs) to human induced pre-oligodendrocyte precursor (hiPOPC) and human induced oligodendrocyte precursor cells (hiOPC).
[0015] Also disclosed for the first time is the inventors' determination that directly reprogrammed somatic cells produced using the compositions and methods described herein survive cellular transplantation onto demyelinated rat brain sagittal organotypic slices where they differentiate into mature myelinating oligodendrocytes. Following transplantation, these directly reprogrammed hiOPCs support remyelination of demyelinated brain ex-vivo after about four weeks, demonstrating that directly reprogrammed hiOPCs offer an effective and clinically viable cell source for cell replacement therapy to treat diseases and conditions related to demyelination including but not limited to Multiple sclerosis, spinal cord injury, leukodystrophies, cerebral palsy and white matter strokes.
[0016] In one aspect the invention relates to a reprogramming composition comprising a basal cell reprogramming medium and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement.
[0017] In another aspect the present invention relates to a differentiation composition comprising a basal cell differentiation medium and at least three active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1), neurotrophin-3 (NT-3), a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF) and N-2 supplement.
[0018] In another aspect the invention relates to a method of making a human induced oligodendrocyte precursor cell (hiOPC) comprising reprogramming a human fibroblast (HF) cell into a hiOPC comprising a. transfecting the HF with SC 2cmRNA, < ZJG2cmRNA and SC> 0cmRNA (SOS), b. culturing the transfected HF in a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement,
[0019] c. passaging the HF in b. into a second reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), a Sonic Hedgehog (SHH) activator and N-2 supplement, and
[0020] d. culturing the passaged HF.
[0021] In another aspect the invention relates to a kit comprising
[0022] i. at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting o
[0023]
[0024] f S0X2 cmRNA, OLIG2 cmRNA and cmRNA.
[0025] In another aspect the invention relates to a human induced oligodendrocyte precursor cell (hiOPC). In another aspect the invention relates to a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier.
[0026] In another aspect the invention relates to a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1) and neurotrophin-3 (NT-3).
[0027] In another aspect the invention relates to the use of a reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to induce the expression of at least one oligodendrocyte precursor marker in a reprogrammed HF.
[0028] In another aspect the invention relates to the use of a reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to promote induction of an oligodendrocyte precursor fate in a fibroblast, preferably a human fibroblast (HF).
[0029] In another aspect the invention relates to the use of a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement and a second reprogramming composition comprising a basal cell reprograming medium and at least three active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to induce the expression of at least one biomarker associated with oligodendrocyte differentiation in a reprogrammed human fibroblast (HF) pre-oligodendrocyte precursor cell.
[0030] In another aspect the invention relates to the use of a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1) and neurotrophin-3 (NT-3) to induce the expression of at least one biomarker associated with oligodendrocyte differentiation of a reprogrammed human fibroblast (HF) oligodendrocyte precursor.
[0031] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte (hiOPC) or a reprogramed human fibroblast (HF) that expresses at least one oligodendrocyte precursor factor and a carrier to make a human induced oligodendrocyte (hiOL). In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to treat a disease or condition associated with demyelination.
[0032] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to reduce the severity of a disease or condition associated with demyelination.
[0033] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to delay the onset of a disease or condition associated with demyelination.
[0034] In another aspect the invention relates to a method of treating a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject having or suspected of having the disease or condition.
[0035] In another aspect the invention relates to a method of delaying the onset of a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject suspected of having the disease or condition or having at least one symptom of the disease or condition.
[0036] In another aspect the invention relates to a method of reducing the severity of a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject suspected of having the disease or condition or having at least one symptom of the disease or condition.
[0037] In another aspect the invention relates to a human induced oligodendrocyte precursor cell (hiOPC) made by a method as described herein. In another aspect the invention relates to a human induced oligodendrocyte cell (hiOL) made by a method as described herein.
[0038] 4. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] The invention will now be described by way of example only and with reference to the drawings in which:
[0040] Figure 1 shows the direct reprogramming protocol of human induced oligodendrocyte precursor cells and differentiation protocol to oligodendrocytes from adult human dermal fibroblasts (aHDF) disclosed herein.
[0041] Figure 2 shows the reprogramming of aHDFs to oligodendrocyte precursor cells using various combinations of reprogramming transcription factors and differentiation to oligodendrocytes. (A), (B) and (C) show the positive effects of reprogramming HDFs from 3 different donors for 18 days instead of 32 or 46, with the combination of transcription factors SOX2 / OLIG2 / SOX10o \ the acquisition of the OPC fate as assessed by OLIG1+ hiOPC yield. (F) and (G) show the ability of SOX2 / OLIG2 / SOX10 hiOPCs to differentiate to hiOLs expressing the oligodendrocyte markers A / F / ’and PLP1, to a greater extent when the hiOPCs were only reprogrammed for 18 days (RPL3 DIFF), rather than 32 (RPL5 DIFF) or 46 days (RPL7 DIFF).
[0042] Figure 3 shows the expression of oligodendrocyte precursor biomarkers by reprogrammed hiOPCs. (A) shows a representative image of hiOPCs which express key biomarkers at the gene (B) and protein level (C).
[0043] Figure 4 shows the expression of oligodendrocyte lineage biomarkers by hiOPC-derived oligodendrocytes (hiOLs). (A) shows a representative image of hiOLs which express key biomarkers at the gene (B) and protein level (C).
[0044] Figure 5 shows the remyelination of the demyelinated rat corpus callosum ex vivo by SOS-reprogrammed hiOPCs. (A) shows the expression of myelin basic protein (MBP) in the corpus callosum of untreated, LPC-treated (demyelinated) and LPC-treated with hiOPCs (identified by STEM101) rat brain organotypic slice cultures. (B) shows the ability of transplanted hiOPCs to differentiate into MBP+ hiOLs ex vivo and remyelinate the demyelinated corpus callosum. * p < 0.05; ** p < 0.01. (C) shows the expression of myelin oligodendrocyte glycoprotein (MOG) in the corpus callosum of untreated, LPC-treated (demyelinated) and LPC-treated with hiOPCs (identified by STEM101) rat brain organotypic slice cultures. (D) shows the ability of transplanted hiOPCs to differentiate into MOG+ hiOLs ex vivo and remyelinate the demyelinated corpus callosum. * p < 0.05; ** p < 0.01. 5. DETAILED DESCRIPTION OF THE INVENTION
[0045] 5.1 Definitions and abbreviations
[0046] The term "cmRNA" as used herein is an abbreviation for chemically modified mRNA containing a combination of modified and unmodified nucleotides and refers to stabilized non-immunogenic mRNA (known and commercialized as SNIM RNA) as disclosed in WO 2011 / 012316, the entirety of which is hereby incorporated by reference. Chemical modification of cmRNA structural elements allows these molecules to avoid the innate immunity and instability of naturally occurring mRNA. cmRNA can be used repeatedly, i.e., in separate and / or sequential transfection events, providing a cell the ability to produce sustained levels of desired protein products. Known uses for cmRNA include the augmentation and / or replacement of absent or non-functional proteins and / or for the introduction of new proteins. The term " N-2 supplement" as used herein means Bottenstein's N-2 formulation (1) which is a chemically defined supplement composed of Human transferrin (holo), recombinant insulin full chain, progesterone, putrescine and selenite (Bottenstein, IE. (1985) Cell Culture in the Neurosciences, Bottenstein, IE. and Harvey, A. L., editors, p. 3, Plenum Press: New York and London).
[0047] The term "cyclic adenosine 3′,5′-monophosphate (cAMP) activator" or "cAMP activator" as used herein refers to a molecule that activates the cAMP pathway. In one embodiment the cAMP activator is dcAMP, forskolin (FSK), 8-Bromo-cAMP or cAMPS-Sp. Preferably the "cAMP" activator is dcAMP.
[0048] The term " Sonic Hedgehog activator" or " SHH activator" as used herein refers to a molecule that activates the Sonic Hedgehog (SHH) pathway. In one embodiment the SHH activator is smoothened agonist (SAG), Sonic Hedgehog (SHH), or SHH-C24II. Preferably the " SHH" activator is SAG.
[0049] The term "active agent" as used herein means that the agent is an essential component of a composition, kit, method or use as described herein for driving the cellular reprogramming of human fibroblasts, particularly adult human fibroblasts, particularly adult human dermal fibroblasts to human induced oligodendrocyte precursor cells (hiOPC).
[0050] The active agents contemplated herein for the reprograming of human fibroblasts to hiOPCs are selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the active agents are a SHH activator, PDGF-AA, T3, and N-2 supplement. In one embodiment the SHH activator is SAG or SHH-C24II.
[0051] In some embodiments, at least two active agents, preferably three active agents are used for culturing fibroblasts to be reprogrammed to hiOPCs according to the compositions, kits, methods and / or uses described herein. In one embodiment the at least two active agents are selected from the group consisting of a SHH activator, PDGF-AA, T3, and N-2 supplement. In one embodiment the three active agents are a SHH activator, PDGF-AA and T3. In one embodiment the SHH activator is SAG or SHH-C24II. In some embodiments, at least three active agents, preferably four active agents are used for passaging human dermal fibroblasts to be reprogrammed to hiOPCs according to the compositions, kits, methods and / or uses described herein. In one embodiment the three active agents are selected from the group consisting of a SHH activator, PDGF-AA, T3, and N-2 supplement. In one embodiment the four active agents are a SHH activator, PDGF-AA, T3, and N-2 supplement. In one embodiment the SHH activator is SAG or SHH-C24II.
[0052] As used herein "basal cell reprogramming medium" refers to a generalized medium that is suitable for in vitro culture of oligodendrocyte precursor cells. Preferably the basal cell reprogramming medium is Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12).
[0053] In one embodiment the basal cell reprogramming medium is DMEM / F-12 that is supplemented with at least one active agent, preferably at least two, three or all four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In some embodiments the basal cell reprogramming medium is supplemented with at least one, preferably at least two, three or all four of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the SHH activator is selected from the group consisting of SAG, SHH and SHH-C24II.
[0054] Compositions, kits, methods and / or uses as described herein may also comprise additional agents that are not the "active agents" but that contribute and / or allow cell culturing and passaging while the cells are being reprogrammed. Such additional agents may be selected and used as known to the skilled person for culturing and passaging human cells.
[0055] In some embodiments the additional agents are any combination of and / or all of the following constituents: penicillin-streptomycin, B27 with retinoic acid (B27+RA), epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2), heparin, and retinoic acid (RA).
[0056] The term " B27+RA" as used herein is used interchangeably with the term " B27-supplemment" and means the neuronal cell culture B27 supplement with retinoic acid. As known in the art B27 supplement is composed of biotin, DL alpha tocopherol acetate, DL alpha tocopherol, vitamin A, biotin, bovine serum albumin fatty acid free fraction V, catalase, human recombinant insulin, human transferrin, superoxide dismutase, corticosterone, D-galactose, ethanolamine HCL, glutathione (reduced), L-carnitine HCL, linoleic acid, linolenic acid, progesterone, putrescine 2HCL, sodium selenite and T3 (triodo-I-thyronine).
[0057] A person of skill in the art recognizes that an appropriate amount of retinoic acid should be used in the media described herein. This amount can be provided in the media as retinoic acid or as B-27+RA. The skilled person also recognizes that an appropriate amount of B-27 should be used in the media as described herein. This amount can be provided in the media as B-27 or as B-27+RA. All combinations of B-27, B-27+RA, and RA are specifically contemplated as embodiments of the aspects of the invention disclosed herein. The term " S0X2' as used herein means the SRY-box transcription factor 2 [Homo sapiens (human)] having Gene ID: 6657. The gene encoding S0X2 is an intronless gene encoding this a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system and regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called S0X2 overlapping transcript (S0X20T) (https: / / www.ncbi.nlm.nih.gov / gene / 6657).
[0058] The specific sequence of the SQY cmRNA used herein is provided as SEQ ID NO: 1.
[0059] GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCCAGTGTGGTGGTACGGG AAATCACAAGTTTGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACCATGTACAACATGATGGAGACGGA GCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCG GCAACCAGAAAAACAGCCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGC GGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGA AACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGG AGCACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCC CGGCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGG GCGTGAACCAGCGCATGGACAGTTACGCGCAATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGA CCAGCTGGGCTACCCGCAGCACCCGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTAC GACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCA TGTCCTACTCGCAGCAGGGCACCCCТGGCATGGCTCTTGGCTCCATGGGTTCGGTGGTCAAGTCCGAGGCCA GCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCGGGGACCTCCGGGACATG ATCAGCATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCACT ACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACATGTGAAAGGGTGGGC GCGCCGACCCAGCTTTCTTGTACAAAGTGGTGATATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGT CTGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGTAC TATTTAAACTCGAAATTCTGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[0060] The term "0LIG2' as used herein means oligodendrocyte transcription factor 2 [Homo sapiens (human)] having gene ID: 10215. The gene encoding OLIG2 \s a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(qll.2;q22) associated with T-cell acute lymphoblastic leukaemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome (https: / / www.ncbi.nlm.nih.gov / gene / 10215).
[0061] The specific sequence of the CY7G cmRNA used herein is provided as SEQ ID NO: 2. GGATGCTTATTATAGATCGACGCGACACCAGCGCCCGGTGCCAGGTTCTCCCCTGAGGCTTTTCGGAGCGAGC TCCTCAAATCGCATCCAGATTTTCGGGTCCGAGGGAAGGAGGACCCTGCGAAAGCTGCGACGACTATCTTCCC CTGGGGCCATGGACTCGGACGCCAGCCTGGTGTCCAGCCGCCCGTCGTCGCCAGAGCCCGATGACCmTTCT GCCGGCCCGGAGTAAGGGCAGCAGCGGCAGCGCCTTCACTGGGGGCACCGTGTCCTCGTCCACCCCGAGTGA CTGCCCGCCGGAGCTGAGCGCCGAGCTGCGCGGCGCTATGGGCTCTGCGGGCGCGCATCCTGGGGACAAGCT AGGAGGCAGTGGCTTCAAGTCATCCTCGTCCAGCACCTCGTCGTCTACGTCGTCGGCGGCTGCGTCGTCCACC AAGAAGGACAAGAAGCAAATGACAGAGCCGGAGCTGCAGCAGCTGCGTCTCAAGATCAACAGCCGCGAGCGC AAGCGCATGCACGACCTCAACATCGCCATGGATGGCCTCCGCGAGGTCATGCCGTACGCACACGGCCCTTCGG TGCGCAAGCTTTCCAAGATCGCCACGCTGCTGCTGGCGCGCAACTACATCCTCATGCTCACCAACTCGCTGGA GGAGATGAAGCGACTGGTGAGCGAGATCTACGGGGGCCACCACGCTGGCTTCCACCCGTCGGCCTGCGGCGG CCTGGCGCACTCCGCGCCCCTGCCCGCCGCCACCGCGCACCCGGCAGCAGCAGCGCACGCCGCACATCACCCC GCGGTGCACCACCCCATCCTGCCGCCCGCCGCCGCAGCGGCTGCTGCCGCCGCTGCAGCCGCGGCTGTGTCC AGCGCCTCTCTGCCCGGATCCGGGCTGCCGTCGGTCGGCTCCATCCGTCCACCGCACGGCCTACTCAAGTCTC CGTCTGCTGCCGCGGCCGCCCCGCTGGGGGGCGGGGGCGGCGGCAGTGGGGCGAGCGGGGGCTTCCAGCAC TGGGGCGGCATGCCCTGCCCCTGCAGCATGTGCCAGGTGCCGCCGCCGCACCACCACGTGTCGGCTATGGGC GCCGGCAGCCTGCCGCGCCTCACCTCCGACGCCAAGTGAGCCGACTGGCGCCGGCGCGTTCTGGCGACAGGG GAGCCAGGGGCCGCGGGGAAGCGAGGACTGGCCTGCGCTGGGCTCGGGAGCTCTGTCGCGAGGAGGGGCGC AGGACCATGGACTGGGGGTGGGGCATGGTGGGGATTCCAGCATCTGCGAACCCAAGCAATGGGGGCGCCCAC AGAGCAGTGGGGAGTGAGGGGATGTTCTCTCCGGGACCTGATCGAGCGCTGTCTGGCTTTAACCTGAGCTGG TCCAGTAGACATCGTTTTATGAAAAGGTACCGCTGTGTGCATTCCTCACTAGAACTCATCCGACCCCCGACCCC CACCTCCGGGAAAAGATTCTAAAAACTTCTTTCCCTGAGAGCGTGGCCTGACTTGCAGACTCGGCTTGGGCAG CACTTCGGGGGGGGAGGGGGTGTTATGGGAGGGGGACACATTGGGGCCTTGCTCCTCTTCCTCCTTTCTTGG CGGGTGGGAGACTCCGGGTAGCCGCACTGCAGAAGCAACAGCCCGACCGCGCCCTCCAGGGTCGTCCCTGGC CCAAGGCCAGGGGCCACAAGTTAGTTGGAAGCCGGCGTTCGGTATCAGAAGCGCTGATGGTCATATCCAATCT CAATATCTGGGTCAATCCACACCCTCTTAGAACTGTGGCCGTTCCTCCCTGTCTCTCGTTGATTTGGGAGAATA TGGTTTTCTAATAAATCTGTGGATGTTCCTTCTTCAACAGTATGAGCAAGTTTATAGACATTCAGAGTAGAACC ACTTGTGGATTGGAATAACCCAAAACTGCCGATTTCAGGGGCGGGTGCATTGTAGTTATTATTTTAAAATAGA AACTACCCCACCGACTCATCTTTCCTTCTCTAAGCACAAAGTGATTTGGTTATTTTGGTACCTGAGAACGTAAC AGAATTAAAAGGCAGTTGCTGTGGAAACAGTTTGGGTTATTTGGGGGTTCTGTTGGC I I I I IAAAAI I I I C l I TnTGGATGTGTAAATTTATCAATGATGAGGTAAGTGCGCAATGCTAAGCTGTTTGCTCACGTGACTGCCAGC CCCATCGGAGTCrAAGCCGGCTTTCCrCrATTTTGGTTTATTTTTGCCACGTTTAACACAAATGGTAAACTCCT CCACGTGCTTCCTGCGTTCCGTGCAAGCCGCCTCGGCGCTGCCTGCGTTGCAAACTGGGCTTTGTAGCGTCTG CCGTGTAACACCCTTCCTCTGATCGCACCGCCCCTCGCAGAGAGTGTATCATCTGTTTTATTTTTGTAAAAACA AAGTGCTAAATAATATTTATTACTTGTTTGGTTGCAAAAACGGAATAAATGACTGAGTGTTGAGATTTTAAATA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[0062] The term "50X10' as used herein means the SRY-box transcription factor 10 \Homo sapiens (human)] having Gene ID: 6663. The gene encoding SOXIO is a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease (https: / / www.ncbi.nlm.nih.gov / gene / 6663)
[0063] The specific sequence of the 5C> 0cmRNA used herein is provided as SEQ ID NO: 3.
[0064] AGTCGCTCAGTCAGTCTCGGGCTGTCCGGCCAGGGTGGTTGGTGGTAAGGATTCAGGCTCCGTCCTAACGAG GCCGTGGCCTGAGGCTCAGGGCCCCCCGCCCCTCCCTCCCAGCCCACCAGCGTCACCTCCCAGCCCCGAGCTG GACCGCACACCTTGGGACACGGTTTTCCACTTCCTAAGGACGAG CCCAGACTGGAGGAGAGGTCCGAGGAGGTGGGCGTTGGACTCTTTGCGAGGACCCCGGCGGCTGGCCCGGG GGAGGCGGCCGAGGCGGCGGCGGCGGCGGCCGGGGGCGACATGGCGGAGGAGCAGGACCTATCGGAGGTG GAGCTGAGCCCCGTGGGCTCGGAGGAGCCCCGCTGCCTGTCCCCGGGGAGCGCGCCCTCGCTAGGGCCCGAC GGCGGCGGCGGCGGATCGGGCCTGCGAGCCAGCCCGGGGCCAGGCGAGCTGGGCAAGTCAAGAAGGAGCAG CAGGACGGCGAGGCGGACGATGACAAGTTCCCCGTGTGCATCCGCGAGGCCGTCAGCCAGGTGCTCAGCGGC TACGACTGGACGCTGGTGCCCATGCCCGTGCGCGTCAACGGCGCCAGCAAAAGCAAGCCGCACGTCAAGCGG CCCATGAACGCCTTCATGGTGTGGGCTCAGGCAGCGCGCAGGAAGCTCGCGGACCAGTACCCGCACCTGCAC AACGCTGAGCTCAGCAAGACGCTGGGCAAGCTCTGGAGGCTGCTGAACGAAAGTGACAAGCGCCCCTTCATCG AGGAGGCTGAGCGGCTCCGTATGCAGCACAAGAAAGACCACCCGGACTACAAGTACCAGCCCAGGCGGCGGA AGAACGGGAAGGCCGCCCAGGGCGAGGCGGAGTGCCCCGGTGGGGAGGCCGAGCAAGGTGGGACCGCCGCC ATCCAGGCCCACTACAAGAGCGCCCACTTGGACCACCGGCACCCAGGAGAGGGCTCCCCCATGTCAGATGGGA ACCCCGAGCACCCCTCAGGCCAGAGCCATGGCCCACCCACCCCTCCAACCACCCCGAAGACAGAGCTGCAGTC GGGCAAGGCAGACCCGAAGCGGGACGGGCGCTCCATGGGGGAGGGCGGGAAGCCTCACATCGACTTCGGCA ACGTGGACATTGGTGAGATCAGCCACGAGGTAATGTCCAACATGGAGACCTTTGATGTGGCTGAGTTGGACCA GTACCTGCCGCCCAATGGGCACCCAGGCCATGTGAGCAGCTACTCAGCAGCCGGCTATGGGCTGGGCAGTGC CCTGGCCGTGGCCAGTGGACACTCCGCCTGGATCTCCAAGCCACCAGGCGTGGCTCTGCCCACGGTCTCACCA CCTGGTGTGGATGCCAAAGCCCAGGTGAAGACAGAGACCGCGGGGCCCCAGGGGCCCCCACACTACACCGAC CAGCCATCCACCTCACAGATCGCCTACACCTCCCTCAGCCTGCCCCACTATGGCTCAGCCTTCCCCTCCATCTC CCGCCCCCAGTTTGACTACTCTGACCATCAGCCCTCAGGACCCTATTATGGCCACTCGGGCCAGGCCTCTGGC CTCTACTCGGCCTTCTCCTATATGGGGCCCTCGCAGCGGCCCCTCTACACGGCCATCTCTGACCCCAGCCCCTC AGGGCCCCAGTCCCACAGCCCCACACACTGGGAGCAGCCAGTATATACGACACTGTCCCGGCCCTAAAGGGGG CCCTGTCGCCACCACCCCCCGCCCAGCCCCTGCCCCCAGCCTGTGTGCCCTGTTCCTTGCCCACCTCAGGCCT GGTGGTGGCAGTGGAGGAGGCTGAGGAGGCTGAAGAGGCTGACAGGTCGGGGGGCTTTCTGTCTGGCTCAC TGCCCTGATGACCCACCCGCCCCATCCAGGCTCCAGCAGCAAAGCCCCAGGAGAACAGGCTGGACAGAGGAGA AGGAGGTTGACTGTTGCACCCACACTGAAAGATGAGGGGCTGCACCTTCCCCCAGGAATGACCCTCTATCCCA GGACCTGAGAAGGGCCTGCTCACCCTCCTCGGGGAGGGGAAGCACCAGGGTTGGTGGCATCGGAGGCCTTAC CACTCCTATGACTCCTGTNTCTCTCTCACAGATAGTGAGGGTCTGACATGCCCATGCCACCTATGCCACAGTG CCTAAGGGCTAGGCCACCCAGAGACTGTGCCCGGAGCTGGCCGTGTCTCCCACTCAGGGGCTGAGAGTAGCT TTGAGGAGCCTCATTGGGGAGTGGGGGGTTCGAGGGACTTAGTGGAGTTCTCATCCCTTCAATGCCCCCTCCC TTTCTGAAGGCAGGAAGGAGTTGGCACAGAGGCCCCCTGATCCAATTCTGTGCCAATAACCTCATTCTTTGTC TGAGAAACAGCCCCCAGTCCTCCTCCACTACAACCTCCATGACCTTGAGACGCATCCCAGGAGGTGACGAGGC AGGGGCTCCAGGAAAGGAATCAGAGACAATTCACAGAGCCTCCCTCCCTGGGCTCCTTGCCAGCTCCCTCTTC CCTTACTAGGCTCTATGGCCCCTGCTCAGTCAGCCCCACTCCCTGGGCTTCCCAGAGAGTGACAGCTGCTCAG GCCCTAACCCTTGGCTCCAGGAGACACAGGGCCCAGCACCCAGGTTGCTGTCGGCAGGCTGAAGACACTAGAA TCCTGACCTGTACATTCTGCCCTTGCCTCTTACCCCTTGCCTCCCAGTGGTATTTGATAAAGTATGTAGCTATA TCTGCCCCTATTTTCCTGTTCTGCAGCCCCCCAAATCCACATGTAACTCATTACTGTCTCCTGTTATTTATCTCA GTAGTCCCCTCTCCTAGCCACTCTAGCCCCTATTAACTCTGCATTAAGCATTCCACATAATAAAATTAAAGGTT CCGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
[0065] The skilled person recognizes that the cmRNAs described herein each comprise a poly A tail and that the length of this tail may be varied as known and used in the art without altering the functionality of the primary cmRNA sequence to which it is appended. All appropriate lengths of poly A tail are specifically contemplated as embodiments herein.
[0066] The term "adult" as used herein with reference to somatic cells, particularly fibroblasts, refers to cells taken from an adult organism, preferably an adult human.
[0067] In one embodiment an adult human fibroblast is a fibroblast taken from a human at any stage other than embryonic or fetal.
[0068] The term "mature" as used herein with reference to somatic cells, particularly fibroblast, refers to a cell that has differentiated, which means it has acquired a specific rather than a generalized function. This is in contrast to an immature or stem cell that remains pluripotent and has the potential to differentiate into any cell type found in the body.
[0069] In a one embodiment, the term "mature human somatic cell" means a human somatic cell that has reached a final differentiation state. Such cells no longer have the potential to further differentiate. Such cells can be found at different stages of development including embryonal, postnatal or adult stages; however, they are typically obtained from human adults.
[0070] As used herein a "therapeutically effective amount" is a suitable dose as may be determined by a person of skill in the art based on a number of known factors. Such a dose can be administered as part of a dosage regimen that may be determined by an attending physician based on a number of known clinical factors. Such factors will include the size of a subject, their weight, age, body surface area, sex, time and route of administration, other drugs being administered to the subject at the time and the subject's general health (but not limited to). The therapeutically effective amount will be an amount that is sufficient to provide a treatment for the disease or condition to be treated. In some embodiments the disease or condition to be treated is a disease or condition associated with demyelination. The term "treatment" as used herein refers to obtaining, generally, a preferred or desired result, typically a preferred or desired pharmacological and / or physiological response or effect. In this context the term "treatment" refers to a beneficial therapeutic outcome in terms of partially or completely curing a disease and / or adverse effect and / or symptoms attributed to the disease.
[0071] By way of example, treating a subject having a disease or condition associated with demyelination can be treating any stage of the disease or condition, including acute stages of the disease. Treating in the context of the present disclosure also includes measures taken to reduce the severity and / or delay the onset of the disease, e.g., encompassing the partial or complete treatment of the disease (or a symptom thereof). As used herein the term "delaying the onset" (and grammatical variations thereof) in the context of treatment refers to reducing the time between an initial indication that a subject has or is suspected of having the disease or condition, and the onset of "acute" disorder. As considered herein, the disease or condition is "acute" in a subject that displays some and / or all of the symptoms of the disease or condition. Such a subject requires treatment following the onset of the disease, for example, to reduce some and / or all symptoms.
[0072] The term "delay the onset of including grammatical variations thereof means a delay in the occurrence of at least one clinical symptom of the disease or condition in a subject. These would be determined by assessing change from baseline in EDSS measure in the case of Multiple sclerosis. EDSS (Expanded Disability Status Scale) is a research tool known to those skilled in the art to provide a uniform assessment of the clinical features and course of Multiple sclerosis. Components of the full EDSS assess muscle weakness and the ability of the individual to move their arms and legs, balance, coordination and tremor, uncontrolled eye movements, speech, swallowing, unusual sensations or numbness, bowel and bladder function, eyesight, thinking and memory and other functions. Each of these is rated on a scale of 0 (normal motor function) to 10 (death due to MS), in half unit steps. The greater the level of disability, the higher the score. Individuals with scores over 6.5 haven't in the past been able to take part in clinical trials of disease modifying therapies.
[0073] As used herein the term "comprising" means "consisting at least in part of". When interpreting each statement in this specification that includes the term "comprising", features other than that or those prefaced by the term may also be present. Related terms such as "comprise" and "comprises" are to be interpreted in the same manner.
[0074] The term "about" as used herein means a reasonable amount of deviation of the modified term such that the end result is not significantly changed. For example, when applied to a value, the term should be construed as including a deviation of+ / - 5% of the value.
[0075] It is intended that reference to a range of numbers disclosed herein (for example, 1 to 10) also incorporates reference to all rational numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example, 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are hereby expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner.
[0076] Whenever a range is given in the specification, for example, a temperature range, a time range, or a composition range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. In the disclosure and the claims, "and / or" means additionally or alternatively. Moreover, any use of a term in the singular also encompasses plural forms.
[0077] 5.1 Detailed Description
[0078] Disclosed herein is the inventors' work demonstrating for the first time that human fibroblasts (HFs), particularly human dermal fibroblasts (HDFs) can be directly reprogrammed with S0X2, OLIG2 and SC> A (9cmRNAs to a human induced oligodendrocyte precursor cell (hiOPC) phenotype which, following transplantation onto demyelinated rat brain sagittal organotypic slices, differentiate into mature myelinating oligodendrocytes. This work is exemplified in adult human dermal fibroblasts but is not so limited. Based on the present disclosure, the inventors believe that the compositions and methods of cellular reprogramming as described herein can be successfully applied for reprogramming different types of human fibroblasts with a reasonable expectation of success.
[0079] In one example, the compositions and methods described herein leverage the use of cmRNA to generate hiOPCs for transplantation. Regarding both safety and efficiency, cmRNA provides an ideal non-viral, non-integrating delivery system for cell reprogramming. The cmRNA system described herein allows for mRNA transfection without immune response inhibition through the replacement of uridine and cytidine residues with chemically modified uridine and cytidine analogues, respectively, reducing the activation of an innate immune response and increasing mRNA stability. As such, the use of cmRNA to generate reprogrammed donor cells for cell replacement therapy is highly attractive as it provides an efficient and stable system of gene delivery without the risk of genomic integration and insertional mutation inherent to all DNA-based methodologies, as well as, allowing cell reprogramming without residual tracers of transgenes. These features make cmRNA an excellent option for the clinical translation of reprogramming-based cell replacement therapies.
[0080] Also disclosed herein is the inventors' demonstration that HFs, particularly HDFs, can be directly reprogrammed to an oligodendrocyte precursor fate. In this regard, the compositions and methods of cellular reprogramming described herein are not limited to the reprogramming of lineage-specific oligodendrocyte precursor cells for transplantation. Rather, as described herein, cellular reprogramming of various types of HFs, particularly HDFs, is provided in a manner that ensures complete differentiation to an oligodendrocyte phenotype. In some embodiments, the HFs, particularly the HDFs are lineage specific. By culturing HFs, particularly HDFs, in a SHH activator, PDGF-AA, T3 and N-2 following transfection with SOX2 / OLIG2 / SOX10 cmRNA as described herein, the inventors demonstrate that direct reprogramming results in oligodendrocyte precursor cells expressing the oligodendrocyte precursor markers A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. Based on this profile, and in particular the greater OLIG1+ precursor yield, the inventors have determined that using the cocktail of transcription factors SOX2, OLIG2 and SOX10 (SOS), combined with a SHH activator, PDGF-AA, T3 and N-2, they can induce a oligodendrocyte precursor cell (OPC) fate (i.e., they can produce hiOPCs) which is further promoted when the cells are only passaged three times (Day 18) as opposed to five (Day 32) or seven times (Day 46). As described herein, the generation of hiOPCs by direct reprogramming is further confirmed by the generation of oligodendrocytes expressing OLIG1, 04, MBP, PLP1, 01 and MOG following in vitro differentiation of hiOPCs in DMEM / F-12-based oligodendrocyte differentiation media supplemented with PDGF-AA, T3, IGF-1, dcAMP, NT3 and BDNF.
[0081] Moreover, also described herein is the ability for hiOPCs as described to survive transplantation onto rat brain sagittal organotypic slices, to differentiate to oligodendrocytes and to mediate the remyelination of demyelinated brain tissue. Importantly, the inventors' work as disclosed herein demonstrates that transplantation of directly reprogrammed hiOPCs to demyelinated brain tissue can mediate remyelination, providing a route by which diseases and conditions associated with demyelination can be treated.
[0082] In one aspect the invention relates to a reprogramming composition comprising a basal cell reprogramming medium and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N2- supplement.
[0083] In one embodiment the composition comprises a basal cell reprogramming medium and at least three active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N2- supplement. In one embodiment the composition comprises a basal cell reprogramming medium, a SHH activator, PDGF-AA, T3 and N2- supplement.
[0084] In one embodiment the composition is a culture medium.
[0085] In one embodiment the basal cell reprogramming medium is Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12).
[0086] In one embodiment the SHH activator is selected from the group consisting of SAG, SHH, SHH-C24II, purmorphamine and 20(S)-hydroxycholesterol (20(S)-OHC). In one embodiment the SHH activator is SAG. In one embodiment the SHH activator is SHH-C24II.
[0087] In one embodiment the concentration of the SHH activator is O.lnM to about lOpM, preferably about InM to about 5pM, about lOnM to about 2.5pM, about lOOnM to about 1.25pM, preferably about lpM. In one embodiment the concentration of PDGF-AA is about lpg / mL to about lOOng / mL, preferably about lOpg / mL to about 50ng / mL, about 100 pg / mL to about 25ng / mL, about Ing / mL to about 12.5ng / mL, preferably about lOng / mL
[0088] In one embodiment the concentration of T3 is about 4pg / mL to about 400ng / mL, preferably about 40pg / mL to about 300ng / mL, about 400pg / mL to about 200ng / mL, about 4ng / mL to about lOOng / mL, about 20ng / mL to about 60ng / mL, preferably about 40ng / mL
[0089] In one embodiment the " N-2 supplement" is Bottenstein's N-2 formulation (1).
[0090] In one embodiment the concentration of the N-2 supplement is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%. In one embodiment the basal cell reprogramming medium further comprises penicillin-streptomycin. In one embodiment the concentration of penicillin-streptomycin is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%. In one embodiment the composition is used for reprogramming a fibroblast, preferably an HF to an hiOPC.
[0091] In one embodiment the composition is for use to reprogram a fibroblast, preferably an HF to a hiOPC. In one embodiment the composition when used, is used to reprogram a fibroblast, preferably an HF to a hiOPC.
[0092] In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell. In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). In another aspect the invention relates to a differentiation composition comprising a basal cell differentiation medium and at least three active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1), neurotrophin-3 (NT-3), a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF) and N-2 supplement.
[0093] In one embodiment the composition comprises a basal cell differentiation medium and at least four active agents, preferably at least five, preferably at least six, preferably all seven active agents that are PDGF-AA, T3, IGF-1, NT-3, a cAMP activator, BDNF and N-2 supplement.
[0094] In one embodiment the composition comprises a basal cell differentiation medium and at least four active agents, preferably at least five, preferably six active agents that are PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
[0095] In one embodiment the composition comprises a basal cell differentiation medium and five active agents that are T3, IGF-1, NT-3, a cAMP activator and N-2 supplement. In one embodiment the composition comprises a basal cell differentiation medium and six active agents that are T3, IGF-1, NT-3, a cAMP activator, BDNF and N-2 supplement.
[0096] In one embodiment the concentration of PDGF-AA is about lpg / mL to about lOOng / mL, preferably about lOpg / mL to about 50ng / mL, about 100 pg / mL to about 25ng / mL, about Ing / mL to about 12.5ng / mL, preferably about lOng / mL.
[0097] In one embodiment the concentration of T3 is about 4pg / mL to about 400ng / mL, preferably about 40pg / mL to about 300ng / mL, about 400pg / mL to about 200ng / mL, about 4ng / mL to about lOOng / mL, about 20ng / mL to about 60ng / mL, preferably about 40ng / mL.
[0098] In one embodiment the concentration of IGF-1 is about lpg / mL to about lOOng / mL, preferably about lOpg / mL to about 50ng / mL, about 100 pg / mL to about 25ng / mL, about Ing / mL to about 12.5ng / mL, preferably about lOng / mL.
[0099] In one embodiment the concentration of NT-3 is about lpg / mL to about lOOng / mL, preferably about lOpg / mL to about 50ng / mL, lOOpg / mL to about 25ng / mL, Ing / mL to about 12.5ng / mL, preferably about lOng / mL.
[0100] In one embodiment the cAMP activator is dcAMP or forskolin (FSK).
[0101] In one embodiment the concentration of dcAMP is about 0.1nM to about 10µM, preferably about 1nM to about 7.5µM, 100nM to about 5µM, 500nM to about 2.5µM, preferably about 1µM.
[0102] In one embodiment the concentration of dcAMP is about 0.1nM to about 100µM, preferably about 1nM to about 75µM, 100nM to about 50µM, 500nM to about 25µM, about 1µM to about 10 µM.
[0103] In one embodiment the concentration of dcAMP is about 100µM.
[0104] In one embodiment the concentration of BDNF is about 1pg / mL to about 100ng / mL, preferably about 10pg / mL to about 50ng / mL, 100pg / mL to about 25ng / mL, 1ng / mL to about 12.5ng / mL, preferably about 10ng / mL.
[0105] In one embodiment the concentration of the N-2 supplement is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%. In one embodiment the composition further comprises penicillin-streptomycin. In one embodiment the concentration of penicillin-streptomycin is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%.
[0106] In one embodiment the composition is a differentiating composition, wherein hiOPCs placed into the composition are induced to form human induced oligodendrocytes (hiOLs).
[0107] In one embodiment the composition comprises hiOPCs. In one embodiment the hiOPCs are differentiated into hiOLs in the composition after culturing for about 14 to about 22 days, preferably for about 15 to 21 days, about 16 to about 20 days, preferably for about 17 to about 19 days, preferably for about 18 days.
[0108] In one embodiment the hiOLs are made according to a method as described herein.
[0109] In another aspect the invention relates to a method of making a human induced oligodendrocyte precursor cell (hiOPC) comprising reprogramming a human fibroblast (HF) into a hiOPC comprising a. transfecting the HF with SC 2cmRNA, < ZJG2cmRNA and SC> 0cmRNA (SOS), b. culturing the transfected HF in a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement,
[0110] c. passaging the HF in b. into a second reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), a Sonic Hedgehog (SHH) activator and N-2 supplement, and
[0111] d. culturing the passaged HF.
[0112] In one embodiment transfection in a. comprises transfecting with 0.5 to 5 pg, preferably 1.5 to 4 pg, preferably 2-3 pg, preferably 2.5 pg of each of SC cmRNA, C ZG2cmRNA and 5C> 0cmRNA. In one embodiment transfection in a. comprises at least one, preferably at least two, at least three, preferably four, separate transfection events.
[0113] In one embodiment at least two separate transfection events are conducted over two to six consecutive days, preferably over three to five consecutive days, preferably over four consecutive days.
[0114] In one embodiment transfection events are about 10 min in duration, preferably about 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 400, 420, 480, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, preferably about 1400, 1420, 1460, 1480, preferably about 1440 min in duration.
[0115] In one embodiment transfection events are about 100 to about 500 min in duration, preferably about 150 to about 450, 200 to 400, 250 to 350, preferably about 300 min in duration.
[0116] In one embodiment transfection in a. comprises a single transfection of about 1440 min in duration. In one embodiment the SOX2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1). In one embodiment the OLIG2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:2). In one embodiment the SOX10 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3). In one embodiment the composition in b. comprises at least two, preferably at least three, four, five, preferably all six agents selected from the group consisting of B-27 supplement, FGF2, EGF heparin, RA and N-2 supplement.
[0117] In one embodiment the basal cell reprogramming medium in b. is Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12).
[0118] In one embodiment the concentration of B-27 supplement in b. is about 0.2% to about 20%, preferably about 0.5% to about 15%, about 0.7% to about 10%, about 0.9% to about 5%, about 1% to about 3%, preferably about 2%.
[0119] In one embodiment the concentration of the FGF2 in b. is about 2pg / mLto 200ng / mL, preferably about 20pg / mL to about 150ng / mL, about 200pg / mL to about lOOng / mL, about 2pg / mL to about 50pg / mL, about lOpg / mL to about 30pg / mL, preferably about 20ng / mL.
[0120] In one embodiment the concentration of EGF in b. is about 2pg / mL to about 200ng / mL, preferably about 20pg / mL to about 150ng / mL, about 200pg / mL to about lOOng / mL, about 2pg / mL to about 50pg / mL, about lOpg / mL to about 30pg / mL, preferably about 20ng / mL.
[0121] In one embodiment the concentration of heparin in b. is about 0.2ng / mL to about 20pg / mL, preferably about 2ng / mL to about lOpg / mL, about 200ng / mL to about 5pg / mL, about lpg / mL to about 3pg / mL, preferably about 2pg / mL.
[0122] In one embodiment the concentration of RA in b. is about InM to about 100µM, preferably about lOnM to about 50pM, about lOOnM to about 25pM, about lpM to about 12.5pM, preferably about lOpM. In one embodiment the concentration of N-2 supplement in b. is about 0.1% to about 10%, preferably about 0.3% to about 8%, about 0.5% to about 5%, about 0.7% to about 3%, about 0.9% to about 2%, preferably about 1%.
[0123] In one embodiment the composition in b. further comprises penicillin-streptomycin.
[0124] In one embodiment the concentration of penicillin-streptomycin in b. is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%.
[0125] In one embodiment the composition in c. comprises at least three active agents, preferably all four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the basal cell reprogramming medium in c. is Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12).
[0126] In one embodiment the SHH activator in c. is selected from the group consisting of SAG, SHH, SHH-C24II, purmorphamine, 20(S)-hydroxycholesterol (20(S)-OHC). In one embodiment the SHH activator in c. is SAG. In one embodiment the SHH activator in b. is SHH-C24II. In one embodiment the concentration of SAG in c. is about O.lnM to about lOpM, InM to about 7.5|jM, lOOnM to about 5|jM, 500nM to about 2.5|jM preferably about lpM.
[0127] In one embodiment the concentration of PDGF -AA in c. is about lpg / mL to about lOOng / mL, preferably about lOpg / mL to about 50ng / mL, lOOpg / mL to about 25ng / mL, Ing / mL to about 12.5ng / mL preferably about lOng / mL.
[0128] In one embodiment the concentration of T3 in c. is about 4pg / mL to about 400ng / mL, preferably about 40pg / mL to about 300ng / mL, about 400pg / mL to about 200ng / mL, about 4ng / mL to about lOOng / mL, about 20ng / mL to about 60ng / mL, preferably about 40ng / mL.
[0129] In one embodiment the concentration of N-2 supplement in c. is about 0.1% to about 10%, preferably about 0.3% to about 8%, about 0.5% to about 5%, about 0.7% to about 3%, about 0.9% to about 2%, preferably about 1%.
[0130] In one embodiment the composition in c. further comprises penicillin-streptomycin.
[0131] In one embodiment the concentration of penicillin-streptomycin in c. is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%.
[0132] In one embodiment culturing in b. is for about one to seven days, preferably for about two to about six days, preferably for about three to about five days, preferably for about four days. In one embodiment culturing in b. is for about four days.
[0133] In one embodiment passaging in c. is at about one to about seven days, preferably at about two to about six days, preferably at about three to about five days, preferably at about four days. In one embodiment passaging in c. is at about four days.
[0134] In one embodiment culturing in d. is for about 10 to 18 days, preferably for about 11 to 17 days, about 12 to 16 days, about 13 to 15 days, preferably for about 14 days. In one embodiment culturing in d. is for about 14 days.
[0135] In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell.
[0136] In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). In one embodiment culturing in e. produces the hiOPC from the reprogrammed HF.
[0137] In one embodiment the hiOPC expresses at least one oligodendrocyte precursor marker. The skilled person recognizes that these markers can be detected by detecting either nucleic acid or protein expression. Accordingly, all references to oligodendrocyte precursor markers and biomarkers encompass nucleic acid and / or protein markers / biomarkers. In one embodiment the at least one oligodendrocyte precursor marker is selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
[0138] In one embodiment the hiOPC expresses at least two, preferably at least three, at least four, preferably at least five oligodendrocyte precursor markers selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
[0139] In one embodiment the hiOPC expresses A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
[0140] In one embodiment the method further comprises differentiating the hiOPC reprogrammed from an HF in a. - d. into a human induced oligodendrocyte cell (hiOL) by:
[0141] e. passaging the hiOPC cultured in d. into a composition comprising a basal cell differentiation medium and at least three active agents selected from the group consisting of PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement, and f. culturing the passaged hiOPC.
[0142] In one embodiment the composition in e. comprises at least four active agents, preferably at least five, preferably all six active agents selected from the group consisting of PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
[0143] In one embodiment the composition in e. comprises five active agents that are T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
[0144] In one embodiment the basal cell differentiation medium in e. is Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12).
[0145] In one embodiment the concentration of PDGF-AA in e. is about 1pg / mL to about 100ng / mL, preferably about 10pg / mL to about 50ng / mL, about 100 pg / mL to about 25ng / mL, about 1ng / mL to about 12.5ng / mL, preferably about 10ng / mL.
[0146] In one embodiment the concentration of T3 in e. is about 4pg / mL to about 400ng / mL, preferably about 40pg / mL to about 300ng / mL, about 400pg / mL to about 200ng / mL, about 4ng / mL to about 100ng / mL, about 20ng / mL to about 60ng / mL, preferably about 40ng / mL.
[0147] In one embodiment the concentration of IGF-1 in e. is about 1pg / mL to about 100ng / mL, preferably about 10pg / mL to about 50ng / mL, about 100 pg / mL to about 25ng / mL, about 1ng / mL to about 12.5ng / mL, preferably about 10ng / mL.
[0148] In one embodiment the cAMP activator in e. is dcAMP or forskolin (FSK).
[0149] In one embodiment the concentration of dcAMP in e. is about 0.1nM to about 10µM, preferably about 1nM to about 7.5µM, 100nM to about 5µM, 500nM to about 2.5µM, preferably about 1µM.
[0150] In one embodiment the concentration of dcAMP is about 0.1nM to about 100µM, preferably about 1nM to about 75µM, 100nM to about 50µM, 500nM to about 25µM, about 1µM to about 10 µM. In one embodiment the concentration of dcAMP is about 100µM.
[0151] In one embodiment the concentration of NT-3 in e. is about 1pg / mL to about 100ng / mL, preferably about 10pg / mL to about 50ng / mL, 100pg / mL to about 25ng / mL, 1ng / mL to about 12.5ng / mL, preferably about 10ng / mL.
[0152] In one embodiment the concentration of the N-2 supplement in e. is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%.
[0153] In one embodiment e. is supplemented with an additional active agent after about six to about eight days, preferably after about seven days. In one embodiment the additional active agent is BDNF. In one embodiment the concentration of BDNF in e. is about 1pg / mL to about 100ng / mL, preferably about 10pg / mL to about 50ng / mL, 100pg / mL to about 25ng / mL, 1ng / mL to about 12.5ng / mL, preferably about 10ng / mL
[0154] In one embodiment the composition in e. further comprises penicillin-streptomycin.
[0155] In one embodiment the concentration of penicillin-streptomycin in e. is about 0.1% to about 10%, preferably about 0.25 to about 7.5%, about 0.5 to about 5%, about 0.75 to about 2.5%, preferably about 1%.
[0156] In one embodiment passaging into e. is at about 14 to 22 days, preferably at about 15 to 21 days, about 16 to about 17 days, preferably at about 18 days. In one embodiment passaging into e. is at about 18 days.
[0157] In one embodiment the hiOPC in f. are cultured in the composition defined in e. for about 7 to about 35 days, preferably for about 10 to 28 days, about 12 to about 21 days, preferably for about 13 to about 18 days, preferably for about 14 days.
[0158] In one embodiment differentiating comprises differentiating the hiOPC into a cell that expresses at least one biomarker associated with oligodendrocyte differentiation. In one embodiment differentiating comprises differentiating the hiOPC into a human induced oligodendrocyte (hiOL).
[0159] In one embodiment the hiOL expresses at least one protein or nucleic acid oligodendrocyte biomarker selected from the group consisting of OLIG1, 04, MBP, PLP1, 01 and MOG after culturing in f.
[0160] In one embodiment the hiOL expresses at least two, preferably at least three, preferably at least four, preferably at least five oligodendrocyte biomarkers selected from the group consisting of 04, MBP, PLP1, 01 and MOG. In one embodiment the hiOL expresses OLIG1, 04, MBP, PLP1, 01 and MOG. In another aspect the invention relates to a kit comprising
[0161] i. at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting of S0X2 cmRNA, OLIG2 cmRNA and SOX10 cmRNA. In one embodiment i. comprises S0X2, OLIG2 and SOXIO cmRNAs. In one embodiment the SOX2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1). In one embodiment the OLIG2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:2). In one embodiment the SOX10 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3).
[0162] In one embodiment a cmRNA provided in i. is comprised in a composition comprising a carrier. In one embodiment the composition is a dried, substantially dried, lyophilized, liquid or frozen composition. In one embodiment the kit further comprises:
[0163] ii. a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement. In one embodiment the composition in ii. comprises at least three agents, preferably at least four, five, preferably all six agents selected from the group consisting of B-27 supplement, FGF2, EGF, heparin, RA and N-2 supplement.
[0164] In one embodiment the composition in ii. further comprises penicillin-streptomycin.
[0165] In one embodiment the composition in ii. is a dry, substantially dry, lyophilized, liquid or frozen composition.
[0166] In one embodiment i. and ii. are packaged separately in the kit in a manner that requires the sequential use of i. before ii.
[0167] In one embodiment the composition in ii. further comprises penicillin-streptomycin.
[0168] Specifically contemplated as embodiments of the composition in ii. are all of the embodiments related to the basal cell reprogramming medium, B-27 supplement, FGF2, EGF, heparin, RA, N-2 supplement, and penicillin-streptomycin as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations).
[0169] In one embodiment the kit further comprises:
[0170] iii. a composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'- Triiodo-L-thyronine (T3), a Sonic Hedgehog (SHH) activator and N-2 supplement.
[0171] In one embodiment the composition in iii. comprises at least three active agents, preferably all four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the composition in iii. further comprises penicillin-streptomycin.
[0172] In one embodiment the composition in iii. is a dry, substantially dry, lyophilized, liquid or frozen composition. Specifically contemplated as embodiments of the composition provided in iii. are all of the embodiments related to the basal cell reprogramming medium, SHH activator, PDGF-AA, T3, N-2 supplement and penicillin-streptomycin as set forth in the previous composition and method aspects of the invention (including compounds, concentrations and ranges of concentrations).
[0173] In one embodiment, when iii. is present in the kit, i., ii., iii. are packaged separately in the kit in a manner that requires the sequential use of i. followed by ii., followed by iii.
[0174] In one embodiment the kit i-iii is used for reprogramming a fibroblast, preferably an HF to a human induced oligodendrocyte precursor cell (hiOPC).
[0175] In one embodiment the kit i-iii is for use to reprogram a fibroblast, preferably an HF to a hiOPC. In one embodiment the kit i-iii when used, is used to reprogram a fibroblast, preferably an HF to a hiOPC.
[0176] In one embodiment the kit further comprises iv., a differentiation composition comprising a basal cell differentiation medium and at least three, preferably at least four, at least five, preferably all six active agents selected from the group consisting of PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
[0177] In one embodiment the composition in iv. comprises five active agents that are T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
[0178] In one embodiment the composition in iv. further comprises penicillin-streptomycin.
[0179] In one embodiment the kit further comprises v., a composition comprising brain-derived neurotrophic factor (BDNF) and a carrier.
[0180] In one embodiment the composition in vi. or v. or both is a dry, substantially dry, lyophilized, liquid or frozen composition.
[0181] Specifically contemplated as embodiments of the compositions provided in iv. and v. are all of the embodiments related to the basal cell differentiation medium, PDGF-AA, T3, IGF-1, NT-3, a cAMP activator, BDNF, N-2 supplement and penicillin-streptomycin as set forth in the previous composition and method aspects of the invention (including compounds, concentrations and ranges of concentrations).
[0182] In one embodiment, when iv. is present in the kit, i., ii., iii., and iv. are packaged separately in the kit in a manner that requires the sequential use of i. followed by ii., followed by iii, followed by iv.
[0183] In one embodiment, when v. is present in the kit, i., ii., iii., iv. and v. are packaged separately in the kit in a manner that requires the sequential use of i. followed by ii., followed by iii, followed by iv, followed by v. In one embodiment the kit i-v. is used for reprogramming a fibroblast, preferably an HF into a human induced oligodendrocyte precursor cell (hiOPC) and an hiOPC into a human induced oligodendrocyte cell (hiOL).
[0184] In one embodiment the kit i-v. when used, is used to reprogram a fibroblast, preferably an HF into an hiOPC and an hiOPC into a hiOL.
[0185] In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell. In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). In another aspect the invention relates to a human induced oligodendrocyte precursor cell (hiOPC). In one embodiment the hiOPC does not express IRX3, nor HOXB9.
[0186] In one embodiment the hiOPC is made according to a method as described herein.
[0187] In another aspect the invention relates to a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier.
[0188] In one embodiment the hiOPC does not express IRX3, nor HOXB9.
[0189] In one embodiment the carrier is a buffer, a culture medium or a pharmaceutically acceptable carrier. In one embodiment the carrier is a pharmaceutically acceptable carrier.
[0190] In one embodiment the composition is a pharmaceutical composition.
[0191] In one embodiment the composition comprises at least about 25,000 viable hiOPCs, preferably at least about 50,000, 75,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, preferably at least about 5,000,000 viable hiOPCs.
[0192] In one embodiment the at least one hiOPC is made according to a method as described herein.
[0193] In another aspect the invention relates to the use of a reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to induce the expression of at least one oligodendrocyte precursor marker in a reprogrammed HF.
[0194] In one embodiment the composition comprises at least three active agents, preferably all four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the composition further comprises penicillin-streptomycin.
[0195] In one embodiment the reprogrammed HF is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the reprogrammed HF has been transfected with at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting of SOX2 cmRNA, OLIG2 cmRNA and SOX10 cmRNA.
[0196] In one embodiment the SOX2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1). In one embodiment the OLIG2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:2). In one embodiment the SOX10 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3). In one embodiment the at least one oligodendrocyte precursor marker is a nucleic acid or protein marker selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 or OLIG2. In one embodiment at least two, at least three, at least four, preferably at least five of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 or OLIG2 are induced. In one embodiment A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2 are induced.
[0197] In one embodiment the use provides an hiOPC that has been made from the reprogrammed HF. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments related to the basal cell reprogramming medium, a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), N-2 supplement, penicillin-streptomycin, B27+RA, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), retinoic acid (RA), heparin and oligodendrocyte precursor markers and biomarkers as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations).
[0198] In another aspect the invention relates to the use of a reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to promote induction of an oligodendrocyte precursor fate in a fibroblast, preferably a human fibroblast (HF).
[0199] In one embodiment the composition comprises at least three active agents, preferably all four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement. In one embodiment the composition further comprises penicillin-streptomycin.
[0200] In one embodiment the HF is an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast.
[0201] In one embodiment the use provides for the reprograming of the HF to an hiOPC. In one embodiment the use is according to the method of making an hiOPC as described herein.
[0202] In one embodiment reprogramming comprises transfection with at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting of SOX2 cmRNA, OLIG2 cmRNA and SOX10 cmRNA. In one embodiment the SOX2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1). In one embodiment the < 7762 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:2). In one embodiment the S6> A76cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3). In one embodiment transfection is carried out in a reprogramming composition comprising a basal cell reprograming medium, B27+RA, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), retinoic acid (RA), heparin and N-2 supplement.
[0203] In one embodiment induction of an oligodendrocyte precursor fate is determined using an hiOPC marker or biomarker as described herein.
[0204] Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments related to basal cell reprogramming medium, a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), N-2 supplement, penicillin-streptomycin, B27+RA, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), retinoic acid (RA), heparin and oligodendrocyte precursor markers and biomarkers as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations).
[0205] In another aspect the invention relates to the use of a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement and a second reprogramming composition comprising a basal cell reprograming medium and at least three active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement to induce the expression of at least one biomarker associated with oligodendrocyte differentiation in a reprogrammed human fibroblast (HF) pre-oligodendrocyte precursor cell.
[0206] In one embodiment the first reprogramming composition comprises a basal cell reprogramming medium, and at least three agents, preferably at least four, five, preferably all six agents selected from the group consisting of B-27 supplement, FGF2, EGF, heparin, RA and N-2 supplement.
[0207] In one embodiment the second reprogramming composition comprises a basal cell reprograming medium and at least three active agents, preferably four active agents selected from the group consisting of a SHH activator, PDGF-AA, T3 and N-2 supplement.
[0208] In one embodiment the first or second or both reprogramming compositions comprise penicillinstreptomycin.
[0209] In one embodiment the reprogrammed HF pre-oligodendrocyte precursor has been reprogrammed from an adult human fibroblast, human dermal fibroblast, or adult human dermal fibroblast. In one embodiment the adult human fibroblast, human dermal fibroblast, or adult human dermal fibroblast has been reprogrammed in the first reprograming composition.
[0210] In one embodiment reprogramming the adult human fibroblast, human dermal fibroblast, or adult human dermal fibroblast comprises transfecting the adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast with at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting of S0X2 cmRNA, OLIG2 cmRNA and SOXIO cmRNA. In one embodiment the 50X2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1). In one embodiment the OLIG2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO:2). In one embodiment the SOXIO cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3). In one embodiment the use comprises use of the first composition for about one to about seven days, preferably for about two to about six, about three to about five, preferably for about four days. In one embodiment the use comprises use of the first composition for about four days.
[0211] In one embodiment the use comprises use of the second composition for about 10 to 18 days, preferably about 11 to 17, 12 to 16, 13 to 15, preferably for about 14 days.
[0212] In one embodiment the at least one biomarker is selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 or OLIG2. In one embodiment at least two, at least three, at least four, preferably at least five biomarkers selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 or OLIG2 are induced. In one embodiment A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2 are induced. In one embodiment the use provides an hiOPC as described herein.
[0213] Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments related to basal cell reprogramming medium, a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), N-2 supplement, penicillin-streptomycin, B27+RA, basic fibroblast growth factor 2 (FGF2), epidermal growth factor (EGF), retinoic acid (RA), heparin and oligodendrocyte precursor markers and biomarkers as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations).
[0214] In another aspect the invention relates to the use of a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1) and neurotrophin-3 (NT-3) to induce the expression of at least one biomarker associated with oligodendrocyte differentiation of a reprogrammed HF oligodendrocyte precursor cell (hiOPC).
[0215] In another aspect the invention relates to the use of a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF- 1) and neurotrophin-3 (NT-3) to induce the expression of at least one biomarker associated with oligodendrocyte differentiation of a reprogrammed HF oligodendrocyte precursor cell (hiOPC).
[0216] In another aspect the invention relates to the use of a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1) and neurotrophin-3 (NT-3) to induce the expression of at least one biomarker associated with oligodendrocyte differentiation of a reprogrammed HF oligodendrocyte precursor cell (hiOPC).
[0217] In another aspect the invention relates to the use of a differentiation composition comprising a basal cell differentiation medium, N-2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, brain-derived neurotrophic factor (BDNF), 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1 (IGF-1) and neurotrophin-3 (NT-3) to induce the expression of at least one biomarker associated with oligodendrocyte differentiation of a reprogrammed HF oligodendrocyte precursor cell (hiOPC).
[0218] In one embodiment the reprogrammed hiOPC is a reprogrammed aHF, a HDF, or an aHDF.
[0219] In one embodiment the use is as a cell culture media.
[0220] In one embodiment the use is for about 7 to about 35 days, preferably for about 14 to about 28 days. In one embodiment at least one biomarker is selected from the group consisting of OLIG1, 04, MBP, PLP1, 01 and MOG. In one embodiment at least two, preferably at least three, biomarkers selected from the group consisting of 0LIG1, 04, MBP, PLP1, 01 and MOG are induced. In one embodiment expression of 04, MBP, PLP1, 01 and MOG are induced.
[0221] Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments related to basal cell differentiation medium, N-2 supplement, a cAMP activator, PDGF-AA, T3, IGF-1, NT-3, BDNF and oligodendrocyte markers and biomarkers as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations).
[0222] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor (hiOPC) or a reprogramed HF that expresses at least one oligodendrocyte precursor factor and a carrier to make a human induced oligodendrocyte (hiOL).
[0223] In one embodiment the carrier is a buffer, a culture medium or a pharmaceutically acceptable carrier. In one embodiment the carrier is a pharmaceutically acceptable carrier.
[0224] In one embodiment the hiOPC is a reprogrammed aHF, a HDF, or an aHDF. In one embodiment the hiOPC is made according to a method as described herein.
[0225] In one embodiment at least one oligodendrocyte precursor factor is selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, 0LIG1 and 0LIG2. In one embodiment the reprogramed HF expresses at least two, preferably at least three, as least four, preferably at least five oligodendrocyte precursor factors selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. In one embodiment the reprogrammed HF expresses A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
[0226] In one embodiment the hiOL is made in vitro or in vivo.
[0227] In one embodiment the hiOL is made in vitro by culturing the hiOPC in a differentiation composition comprising a basal cell differentiation medium comprising N-2 supplement, a cAMP activator, BDNF, PDGF-AA, T3, IGF-1, and NT-3 as described herein.
[0228] In one embodiment the hiOL is made in vitro by culturing the hiOPC in a differentiation composition comprising a basal cell differentiation medium comprising N-2 supplement, a cAMP activator, BDNF, T3, IGF-1, and NT-3 as described herein.
[0229] In one embodiment the differentiation composition further comprises penicillin-streptomycin.
[0230] In one embodiment the hiOL is made in vivo by transplanting the hiOPC into a subject, preferably a human subject.
[0231] In one embodiment transplanting comprises inserting the hiOPC or into the subject. In one embodiment inserting is by injection.
[0232] In one embodiment the hiOL is identified by at least one biomarker selected from the group consisting of OLIG1, 04, MBP, PLP1, 01 and MOG. In one embodiment the hiOL is identified by at least two, preferably at least three, biomarkers selected from the group consisting of 0LIG1, 04, MBP, PLP1, 01 and MOG. In one embodiment the hiOL is identified by expression 0LIG1, 04, MBP, PLP1, 01 and MOG.
[0233] Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments related to the basal cell differentiation medium, N-2 supplement, a cAMP activator, PDGF-AA, T3, IGF-1, NT-3, penicillin-streptomycin and BDNF as set forth in the previous composition and method aspects of the in invention (including specific compounds, concentrations and ranges of concentrations). In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to treat a disease or condition associated with demyelination.
[0234] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to reduce the severity of a disease or condition associated with demyelination.
[0235] In another aspect the invention relates to the use of a composition comprising a human induced oligodendrocyte precursor cell (hiOPC) and a carrier to delay the onset of a disease or condition associated with demyelination. In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) in the manufacture of a medicament to treat a disease or condition associated with demyelination.
[0236] In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) in the manufacture of a medicament to reduce the severity of a disease or condition associated with demyelination.
[0237] In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) in the manufacture of a medicament to delay the onset of a disease or condition associated with demyelination.
[0238] In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) to treat a disease or condition associated with demyelination.
[0239] In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) to reduce the severity of a disease or condition associated with demyelination.
[0240] In another aspect the invention relates to the use of a human induced oligodendrocyte precursor cell (hiOPC) to delay the onset of a disease or condition associated with demyelination.
[0241] The following embodiments are specifically contemplated as embodiments of any and / or all of the use of a composition comprising a hiOPC, the use of a hiOPC in the manufacture of a medicament and / or the use of a hiOPC aspects described herein.
[0242] In one embodiment the carrier is a pharmaceutically acceptable carrier. In one embodiment the composition is a pharmaceutical composition.
[0243] In one embodiment the medicament comprises a pharmaceutically acceptable carrier.
[0244] In one embodiment the hiOPC expresses at least one oligodendrocyte precursor factor selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. In one embodiment the hiOPC expresses at least at least two, preferably at least three, at least four, preferably at least five one oligodendrocyte precursor factors selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. In one embodiment hiOPC expresses A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. As used herein the term oligodendrocyte precursor factor is considered synonymous with oligodendrocyte precursor marker or oligodendrocyte precursor biomarker. All of these terms are used interchangeably.
[0245] In one embodiment the hiOPC is a lineage specific cell. In one embodiment the hiOPC is non-lineage specific cell.
[0246] In one embodiment the hiOPC is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the hiOPC is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast made according to a method as described herein.
[0247] In one embodiment the use comprises inserting the composition, medicament and / or hiOPC into the brain, spinal cord or optic nerve of a human subject. In one embodiment inserting is by injection. In one embodiment injecting is injecting into the brain, spinal cord or optic nerve of a human subject suspected of having a disease or condition associated with demyelination or having at least one symptom of a disease or condition associated with demyelination.
[0248] In one embodiment injecting comprises injecting a therapeutically effective amount the composition, medicament and / or hiOPCs.
[0249] In one embodiment a therapeutically effective amount of the composition or medicament comprises at least about 25,000 viable hiOPCs, preferably at least about 50,000, 75,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, preferably at least about 5,000,000 viable hiOPCs.
[0250] In one embodiment a therapeutically effective amount of the hiOPCs is at least about 25,000 viable hiOPCs per injection, preferably at least about 50,000, 75,000, 100,000 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, preferably at least about 5,000,000 viable hiOPCs per injection.
[0251] In one embodiment the disease or condition associated with demyelination is multiple sclerosis (MS), spinal cord injuries (SCI), cerebral palsy, leukodystrophies, white matter strokes, Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple systems atrophy or amyotrophic lateral sclerosis. In another aspect the invention relates to a method of treating a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject having or suspected of having the disease or condition.
[0252] In another aspect the invention relates to a method of ameliorating a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject suspected of having a disease or condition associated with demyelination or having at least one symptom a disease or condition associated with demyelination.
[0253] In another aspect the invention relates to a method of delaying the onset of a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject suspected of having the disease or condition or having at least one symptom of the disease or condition. In another aspect the invention relates to a method of reducing the severity of a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) into the brain, spinal cord or optic nerve of a subject suspected of having the disease or condition or having at least one symptom of the disease or condition.
[0254] The following embodiments are specifically contemplated as embodiments of any and / or all of the method aspects of the invention as set out above.
[0255] In one embodiment transplanting comprises transplanting a therapeutically effective amount of hiOPCs. In one embodiment a therapeutically effective amount of the hiOPCs comprises at least about 1,000,000 viable hiOPCs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least about 5,000,000 viable hiOPCs.
[0256] In one embodiment transplanting comprises inserting the hiOPCs into the brain, spinal cord or optic nerve of the subject. In one embodiment inserting is by injection.
[0257] In one embodiment the hiOPC expresses at least one oligodendrocyte precursor factor selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. In one embodiment the hiOPC expresses at least at least two, preferably at least three, at least four, preferably at least five one oligodendrocyte precursor factors selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2. In one embodiment hiOPC expresses A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
[0258] In one embodiment the hiOPC is a lineage specific cell. In one embodiment the hiOPC is a non-lineage specific cell.
[0259] In one embodiment the hiOPC has been reprogrammed from an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast.
[0260] In one embodiment the hiOPC has been reprogrammed from an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast as described herein.
[0261] In one embodiment the hiOPC is comprised in a pharmaceutical composition comprising a physiologically acceptable carrier.
[0262] In one embodiment transplanting comprises inserting the pharmaceutical composition into the brain, spinal cord or optic nerve of a human subject. In one embodiment inserting is by injection. In one embodiment injection is injection of a therapeutically effective amount.
[0263] In one embodiment the pharmaceutical composition comprises a therapeutically effective amount of hiOPCs.
[0264] In one embodiment a therapeutically effective amount of the hiOPCs is at least about 25,000 viable hiOPCs per injection, preferably at least about 50,000, 75,000, 100,000 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, preferably at least about 5,000,000 viable hiOPCs.
[0265] In one embodiment ameliorating a disease or condition associated with demyelination comprises improving at least one symptom of the disease or condition. In one embodiment delaying the onset of a disease or condition associated with demyelination comprises increasing the time of appearance of at least one symptom of the disease or condition that has not been observed in a subject. In one embodiment reducing the severity of a disease or condition associated with demyelination comprises reducing the severity of at least one symptom of the disease or condition.
[0266] In one embodiment the disease or condition associated with demyelination is multiple sclerosis (MS), spinal cord injuries (SCI), cerebral palsy, leukodystrophies, white matter strokes, Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple systems atrophy and amyotrophic lateral sclerosis. In one embodiment the at least one symptom is selected from the group consisting of numbness, tingling, Lhermitte sign, lack of coordination, trouble walking, balance problems, weakness, partial or complete loss of vision, double vision, blurry vision, dizziness, vertigo, bladder dysfunction, bowel dysfunction, sexual dysfunction, fatigue, slurred speech, mood changes, memory problems, thinking and understanding problems, loss of movement, abnormal movements, loss or change in sensation of temperature and / or touch, difficulty eating, difficulty hearing, abnormal muscle tone, decline in physical and mental development, difficulty performing two or more activities at once.
[0267] In another aspect the invention relates to a human induced oligodendrocyte precursor cell (hiOPC) made by a method as described herein.
[0268] In another aspect the invention relates to a human induced oligodendrocyte cell (hiOL) made by a method as described herein.
[0269] Additionally, specifically contemplated as embodiments of the compositions of, provided by or used in any of the aspects of the invention disclosed herein, are embodiments there the composition consists essentially of, or consists of, the agents and / or active agents as recited (including any and all combinations of agents and / or active agents).
[0270] Disclosed herein are compositions and methods that provide for the cellular reprogramming of human fibroblasts (HFs) to oligodendrocyte precursor cells (hiOPCs). In a particular embodiment disclosed are compositions and methods that provide for the cellular reprogramming of HFs to human induced oligodendrocyte precursor cells. As described herein cellular reprogramming using SOX2, OLIG2 n SC> 0cmRNA provides HFs with the ability to form cellular progeny having at least one new cellular phenotype as compared to the cellular progeny of the same HF cell type that have not been reprogramed. This new cellular phenotype can be observed in reprogrammed cells either in culture or in vivo. The cellular reprogramming described herein provides multipotent potential to a HF transfected with cmRNA as described herein. In this context, "multipotent potential" refers to a measurable proportion of the progeny of the reprogrammed cell having the potential to differentiate into cells displaying phenotypic characteristics of a new cell type, as compared to a cell that was not reprogramed and does not have that potential. In some embodiments, the proportion of progeny displaying phenotypic characteristics of a new cell type will be measurably more than before reprogramming. In some embodiments, the proportion of progeny displaying phenotypic characteristics of a new cell type will be at least 0.05%, 0.1%, 0.5%>, 1%, 5%, 10%, 15%, 25%, 30%, 40%, 50% or greater than observed in an appropriate control as understood by a person of skill in the art.
[0271] In some embodiments, the reprogramed cell is a cell displaying phenotypic characteristics of a cell from the nervous system and / or a lineage specific glial cell. The term "lineage specific" is a genealogic pedigree of cells from a tissue type that are related products of cellular mitosis.
[0272] As described herein, an oligodendrocyte precursor cell, particularly a human induced oligodendrocyte precursor cell (hiOPC) is a cell which is capable of differentiating into the cell and / or tissue types of the oligodendrocyte cell lineage. In this regard, lineage specific oligodendrocyte precursor cells, particularly the lineage specific induced human oligodendrocyte precursor cells described herein are artificially created, multipotent precursor cells derived from a non-pluripotent and non-multipotent source. This source is exemplified herein using human dermal fibroblasts (HDFs) reprogrammed to express specific genes characteristic of lineage specific neural cells.
[0273] In some embodiments, reprogramming of HFs with cmRNA(s) as described herein comprises the transfection of cmRNAs encoding SOX2, OLIG2 and SOXIO cmRNAs as described herein, into HDFs. Transfection comprises the introduction or delivery of the cmRNA encoding SOX2, OLIG2 and SOX10 into a HDF and is carried out using standard techniques of transfection as known and used by a person of skill in the art. Transfection protocols are provided in the examples included in the present specification and can be carried out as described. Standard transfection techniques are also known to the person of skill in the art, such as those described in W02011 / 012316 which discloses methods for transfecting lung cells with mRNA using Lipofectamine 2000 (Invitrogen). Additional transfection protocols are also described by Kim and Eberwine (Anal Bioanal Chem. 397(8):3173-8 (2010)) who review biological, chemical and physical transfection methods that are employed in the art to deliver nucleic acids into cells.
[0274] Transfection of HDFs as described herein comprises transfection with cmRNA. In some embodiments transfection comprises transfection with separate cmRNAs that encode SOX2, OLIG2 or SOX10. In some embodiments about 5 to 50% of the cytidine nucleotides and 5 to 50% of the uridine nucleotides of a cmRNA are modified. In some embodiments, about 10% to 35% of the cytidine and uridine nucleotides are modified. In some embodiments the cmRNA may comprise about 7.5 to 25% modified cytidine nucleotides and about 7.5 to 25% modified uridine nucleotides. In a preferred embodiment about 25% of the cytidine nucleotides and about 25% of the uridine nucleotides are modified. In some embodiments the modified uridine nucleotides are 2-thiouridin. In some embodiments the modified cytidine nucleotides are 5-methylcytidin residues. In some embodiments the adenosine- and guanosine-containing nucleotides are unmodified or partially modified.
[0275] The cmRNA(s) encoding SOX2, OLIG2 and SOX10 as described herein can be made using recombinant methods in an in vivo or an in vitro system or can be made synthetically (e.g., conventional chemical synthesis on an automated nucleotide sequence synthesizer using a solid-phase support and standard techniques). A person of skill in the art can produce cmRNA recombinantly in an in vivo or an in vitro system or synthetically using known methods. Once produced by any method, cmRNAs can be purified and recovered using methods known to the skilled worker.
[0276] In some embodiments an HF is an adult human fibroblast (aHF), a human dermal fibroblast (HDF) or an adult human dermal fibroblast (aHDF). Preferably the HF is an adult HDF. Fibroblasts are found generally in connective tissues where they are associated with collagen fibre formation and the production of connective tissue ground substance. Contemplated for cellular reprogramming as described herein are mammalian fibroblasts from any source tissue including, but not limited to fibroblasts from kidney, cardiac tissue, lung tissue, stroma and dermal tissue. In some embodiments the fibroblasts reprogrammed using the compositions and methods described herein are adult mammalian dermal fibroblasts, preferably adult human dermal fibroblasts (aHDFs). aHDFs are obtainable from commercial sources or may be isolated from various tissues as known in the art using known methodologies, laboratory equipment and techniques.
[0277] Following transfection with cmRNA, fibroblasts are cultured to allow expression of the transfected RNAs and subsequent reprogramming. As described herein, HDFs are cultured under permissive conditions in a basal cell reprogramming culture media that is capable of supporting the growth of oligodendrocyte precursor cells. Preferred basal cell reprogramming media is DMEM / F-12 media but is not necessarily limited thereto.
[0278] In some embodiments the medium is supplemented with various constituents that contribute to the remodelling process. As described herein some constituents are essential particularly preferred for reprogramming HFs (including HDFs) to oligodendrocyte precursor cells, particularly hiOPCs. These constituents are termed "active agents" herein.
[0279] The basal cell reprogramming medium may also contain various combinations of some and / or all of the following constituents: amino acids (including non-essential amino acids), fatty acids lipids, growth factors, vitamin(s), antioxidant substances, cytokines, inorganic salts, pyruvic acid (pyruvate) and reducing agents such as 2-mercaptoethanol. In some embodiments the listed constituents are chosen for use at and supplied in the media at an appropriate concentration for culturing neural cells as based on what is known and used in the art.
[0280] In some embodiments permissive conditions for the culture of oligodendrocyte cells are the conditions described in the examples provided in the present disclosure but are not limited there to. Cell cultures can also be performed under conditions permissive to the culture of oligodendrocyte cells as known and used in the art. Cultures can be grown in vessels including culture bags, tubes, flasks, bottles, dishes (including petri dishes and culture dishes), well plates (micro and multi), trays, and slide chambers, but not limited thereto. A skilled worker can choose an appropriate vessel for cell culture. HFs, particularly HDFs, being reprogramed as disclosed herein may be cultured in any appropriate volume of culture media. For example, volumes of from about 0.2 ml to about 2000 ml may be chosen as appropriate for culturing with the equipment and protocols available to the skilled person and depending on the permissive conditions required. In some embodiments bioreactors may be employed as known and used in the art.
[0281] Culture vessels may be selected based on purpose and can be cellular adhesive or non-adhesive as known in the art. Cellular adhesive culture vessels may comprise a coating that promotes and / or improves cell adhesion to the vessel. A vessel comprising an interior surface coated to promote and / or improve cell adhesin may be coated with various constituents as known in the art including, but not limited to fibronectin, gelatin, laminin, collagen, vitronectin, poly-L or poly-D lysine, or mixtures thereof. A skilled worker can define further culturing conditions based on the present disclosure combined with what is known and used in the art. Such conditions include choice of temperature, oxygen tension and concentration of CO₂. By way of non-limiting example, culture temperature can be in a range of about 30 to 40°C, including all temperature points in between, but not necessarily limited thereto, oxygen tension can be in a range of about 1 to 20%, including all percentages in between but not necessarily limited thereto, and CO₂ concentration can be about 1 to 10%, again including any percentage between, but not necessarily limited thereto.
[0282] Components of the media / compositions
[0283] In addition to the general considerations regarding cell culture provided, the inventors have determined that certain culture conditions are required for the effective reprogramming of HFs to hiOPCs. These required conditions are set out as embodiments herein.
[0284] In one example, reprogramming HFs, particularly HDFs, particularly aHDFs as described herein comprises transfecting the cells with cmRNA encoding the transcription factors, SOX2, OLIG2 and SOXIO followed by culturing the transfected cells with 2% B-27+RA, 20ng / mL FGF2, 20ng / mL EGF, 2pg / ml heparin, 1% N-2 supplement and lOpM retinoic acid in a basal cell reprogramming medium. A preferred basal cell reprogramming medium is DMEM / F-12. Cells are cultured for about 1 to 7 days, preferably about 4 days, after which the culture is passaged, and cultured in a second basal cell reprogramming medium comprising 1% N-2 supplement, lOng / mL PDGF-AA, 40ng / mLT3 and a Sonic Hedgehog activator. A preferred Sonic Hedgehog activator is lpM SAG. A preferred basal cell reprogramming medium is DMEM / F-12. Cells are cultured for about 6 to 8 days, preferably about 7 days, after which the cells are passaged again. The passaged cells are cultured for a further about 6 to 8 days, preferably about 7 days, for a total of about 15 to about 21 days in culture. A preferred number of total days in culture is about 18 days. Reprogramed cells were assayed to identify that reprogramming had acquired an oligodendrocyte precursor fate using molecular and cytological techniques as known in the art and as described in the appended Example.
[0285] A subset of reprogrammed cells having an OPC fate were further differentiated as described in the appended Example into functional oligodendrocytes in vitro.
[0286] Pharmaceutical compositions as described herein are compositions that are suitable for administration to a subject, preferably a human subject.
[0287] A pharmaceutical composition comprising hiOPCS as described herein may be formulated as appropriate for methods of cell transplantation therapy. In some embodiments such pharmaceutical compositions are used in to treat a disease or condition associated with demyelination or to at least reduce the severity and / or to delay the onset of, the disease or condition.
[0288] In addition to comprising hiOPCs as described herein, the pharmaceutical compositions described herein comprise pharmaceutically acceptable carriers, diluents and / or excipients. As used herein a pharmaceutically acceptable carrier is a physiologically acceptable carrier.
[0289] Pharmaceutically acceptable carriers, diluents and / or excipients include inactive substances included in formulations of hiOPCs as described herein. Such substances serve various purposes in the formulations. In one example, such substances are used for bulking up formulations to allow greater convenience and / or accuracy when producing dosage forms. Such substances may be referred to as diluents, fillers or bulking agents. Pharmaceutically acceptable carriers, diluents and / or excipients can also provide therapeutic-enhancing properties to a formulation, including but not limited to facilitating solubility or absorption of an active agent. Various excipients are also used to reduce difficulties in handling active agents during manufacturing, e.g., by providing flowability or non-stick properties. Additionally, various carriers, diluents and / or excipients may provide stabilizing properties, including preventing oxidation, crystallization or denaturation, to increase formulation shelf life. The choice of the appropriate pharmaceutically acceptable carriers, diluents and / or excipients for any given formulation is believed to be within the skill of those in the art. Consideration will be given to various factors when designing such formulations including dosage form, the nature of the active ingredient, route of administration and others.
[0290] A number of well-known pharmaceutically acceptable carriers, excipients and / or diluents suitable in many formulations include water, saline, phosphate buffered saline (PBS), wetting agents, and emulsifiers. Pharmaceutical compositions comprising various pharmaceutically acceptable carriers can be formulated by well-known conventional methods.
[0291] Pharmaceutical compositions comprising hiOPCs as described herein are formulated to comprise an effective amount of the hiOPCs together with an appropriate pharmaceutically acceptable carrier, diluent and / or excipient. Such formulations can readily be determined by the skilled person based on the disclosure provided herein and methods known in the art. As will be appreciated, a "therapeutically effective amount" is an amount sufficient to induce a detectable therapeutic response in the subject to which the pharmaceutical composition is administered.
[0292] In some embodiments the therapeutically effective amount is at least about 25,000 viable hiOPCs per injection / dose, preferably at least about 50,000, 75,000, 100,000200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, preferably at least about 5,000,000 viable hiOPCs per injection / dose.
[0293] Administration of a therapeutically effective amount of hiOPCs as described herein comprises administration of the hiOPCs or a pharmaceutical composition comprising hiOPCs as described herein and can be carried out using various cell transplantation techniques appropriately chosen for cell therapy as known to the person of skill in the art. It is believed that methods to transplant cells for transplantation therapy are well known to the person skilled in the art. By way of non-limiting example, cells to be transplanted may be administered by intracerebral injection, stereotaxic injection, localized injection, or by direct injection into the vertebral channel.
[0294] The pharmaceutical composition described herein may also comprise appropriate amount of a carrier comprising a pharmaceutically acceptable salt or other pharmaceutically acceptable substances. The presence of the pharmaceutically acceptable salt and / or other substances is to render the pharmaceutical composition isotonic. By way of non-limiting example, the carrier may include saline, Ringer's solution and dextrose solution. Pharmaceutically acceptable carriers, diluents and / or carriers (including stabilizers) are non-toxic at the dosages and concentrations employed. Suitable carriers and their formulations are described in greater detail in Remington's Pharmaceutical Sciences, 17th ed., 1985, Mack Publishing Co. Progress.
[0295] Pharmaceutically acceptable carriers, diluents and / or excipients may include, but are not limited to, buffers including citrate, phosphate, and other organic acid buffers; proteins including serum albumin, or gelatine and / or low molecular weight (> 10 amino acid residues) polypeptides; chelating agents including EDTA; non-ionic surfactants such as Tween, Pluronics or polyethylene glycol; salt- forming counter-ions including sodium and potassium; hydrophilic polymers such as polyvinylpyrrolidone (PVP); amino acids including histidine, glutamine, lysine, asparagine, arginine, or glycine; antioxidants including methionine, ascorbic acid and tocopherol; carbohydrates such as glucose, mannose, dextrose or dextrins; various mono- and di-saccharides; various sugars including sucrose, mannitol, trehalose or sorbitol; and / or a number of different preservatives, e.g. octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens, e.g. methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). 6. EXAMPLES
[0296] Materials and Methods
[0297] Adult Human Fibroblast Direct-to-induced Oligodendrocyte Precursor Cell Reprogramming and Differentiation.
[0298] Human induced oligodendrocyte precursor (hiOPC) cells were generated from adult human dermal fibroblast (aHDF) cell lines (2116: Female Caucasian, 35 years old, abdominal tissue; Cell Applications Inc; 759506: Female Caucasian, 37 years old, abdominal tissue; Invitrogen; 771080: Female Caucasian, 38 years old, breast and abdominal tissue; Invitrogen). aHDF cells were cultured in Dulbecco's modified eagle medium (DMEM; Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific).
[0299] aHDFs were induced to a pre-oligodendrocyte precursor cell (pre-OPC) fate by transient over-expression of the pro-neural gene SOX? and the oligodendrocyte precursor cell (OPC) lineage genes OLIG2 n SOXIO using chemically modified mRNA (cmRNA; Ethris GmbH, Munich, Germany). The aHDFs were transfected with either 2.5pg of each SOX2, OLG2 and SOX10 cmRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific) transfection reagent, for five-hour transfections over four consecutive days, or with a combined single twenty-four-hour transfection of 2.5pg SOX2-OLIG2-SOX10\\t>\ nanoparticle (LNP). Optimisation experiments investigating different transcription factor combinations involved transfections of 2.5pg of cmRNA including: SOXIO alone, OLIG2, alone, SOXIO and OLIG2 SOX10 / OLIG2), SOXIO, OLIG2< \6 NKX6.2{SOX10 / OLIG2 / NKX6.2), SOX2zx\ OLIG2 S0X2 / 0LIG2) or SOX2, OLIG2 and SOX10 (SOX2 / OLIG2 / SOX10). The cells were reprogrammed under normoxia in a first Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12-based neural reprogramming medium (DMEM / F-12); Thermo Fisher Scientific) containing 1% penicillin-streptomycin (Thermo Fisher Scientific), 2% B-27 with retinoic acid (Thermo Fisher Scientific), 20ng / ml epidermal growth factor (EGF; Prospec Bio), 20ng / ml fibroblast growth factor 2 (FGF2; Prospec Bio), 2pg / ml heparin (Sigma-Aldrich), 1% N-2 supplement (Thermo Fisher Scientific), and lOpM retinoic acid (Sigma-Aldrich). The cells were passaged at Day 4 of reprogramming and further cultured in a DMEM / F-12-based OPC reprogramming medium from Day 4 to Day 18 of reprogramming with a second passage at Day 11 (Figure 1). During optimisation experiments, the cells were either reprogrammed until Day 18, 32 or 46 with a third replate at Day 18 (RPL3), fourth at Day 25, fifth at Day 32 (RPL5), sixth at Day 39 and seventh at Day 46 (RPL7). The OPC reprogramming medium comprised 1% penicillin-streptomycin, 1% N-2 supplement, lpM Smoothened agonist (SAG; Sapphire Bioscience Pty Ltd), lOng / mL platelet-derived growth factor-AA (PDGF-AA; Prospec Bio) and 40ng / mL 3,3',5-Triiodo-L-thyronine (T3; Sigma-Aldrich).
[0300] After 18 days of reprogramming the hiOPCs were collected either for RT-qPCR, fixed for immunocytochemistry (ICC), seeded for oligodendrocyte differentiation in vitro, or collected for transplantation onto a rat brain sagittal organotypic ex vivo slice culture model of demyelination. For optimisation experiments, the cells were either fixed for ICC and seeded for oligodendrocyte differentiation at Day 18 (RPL3), 32 (RPL5) or 46 (RPL7).
[0301] Oligodendrocyte differentiation in vitro was undertaken by seeding 30,000 hiOPCs / well onto glass bottom, black 24-well plates (Porvair) coated with 0.01% poly-L-ornithine - 10µg / mL laminin. Cells were cultured for a minimum of 14 days in oligodendrocyte (OL) differentiation medium consisting of DMEM / F-12 with 1% penicillin-streptomycin, 1% N-2 supplement, 10ng / mL PDGF-AA, 40ng / mL T3, 10ng / mL insulin growth factor-1 (IGF-1; Prospec Bio), 10ng / mL neurotrophin-3 (NT-3; Prospec Bio) and 1µM dibutyryl cAMP (dbcAMP; Sigma-Aldrich). After 7 days of differentiation, 10ng / mL brain-derived neurotrophic factor (BDNF; Prospec Bio) was added to the medium. After 14 days of differentiation 20 wells' worth of cells were pulled and collected for RT-qPCR and cells were fixed for ICC. Quantitative RT-PCR
[0302] Total RNA was isolated from hiOPCs, derived OLs and the originating aHDF cell line using the Nucleospin RNA kit (Macherey Nagel). cDNA was synthesised from total RNA using Superscript IV reverse transcriptase (Thermo Fisher Scientific). Duplex qPCR reactions were performed using the TaqMan® system (Applied Biosystems) with ribosomal 18S rRNA as the internal standard and an equivalent of 4-10ng RNA per reaction, in triplicate. Gene expression was normalised to ribosomal 18S rRNA as the internal standard. Gene expression was presented as fold change relative to aHDFs using the AACt method. The FAM gene of interest TaqMan® assays used were A2B5 (ST8SIA1; Hs00268157_m1), CSPG4 (NG2; Hs00361541_g1), NKX6.2 (Hs00752986_sl), OLIG2 (Hs00300164_sl), MBP (Hs00921945_m1), PLP1 (Hs00166914_ml) and 01 (Hs00164660_ml).
[0303] Immunocytochemistry
[0304] Cells were fixed in 4% cold paraformaldehyde for 10 minutes at room temperature and stored in PBS at 4°C until processed for ICC. The cells were first permeabilised in phosphate-buffered saline with 0.5% Triton X-100 for 5 minutes. The following human-specific primary antibodies were used: OLIG1 (AB5991; 1:250), A2B5 (MAB312; 1:400), PDGFRa (sc-398206; 1:100), NG2 (abl39406; 1:100), NKX6.2 (ABN1455; 1:250), 04 (MAB1326; 1:250), 01 (MAB1327; 1:250), MOG (AB233549; 1:100) and MBP (AB7349; 1:50). The species-appropriate Alexa Fluor™ secondary conjugated antibodies (1:500; Invitrogen) were used for visualisation of the primary antibody. DAPI was added as a tertiary stain 1:5,000 in 0.1M PB to confirm individual cell nuclei. Images were captured using an inverted Nikon TE2000E fluorescence microscope equipped with a DS-Ri2 camera. Quantification of the number of OLIG1+ hiOPCs was undertaken manually in ImageJ using the in-built Cell Counter plugin as a proportion of DAPI+ cells from a minimum of 500 DAPI+ cells.
[0305] Animals
[0306] Postnatal 9- to 11-day old male Sprague-Dawley rat pups (University of Auckland Vernon Jansen Unit) were used in this study. All animals were housed in a 12-hour light-dark cycle with access to food and water ad libitum. Animal euthanasia was designed in accordance with the New Zealand Animal Welfare Act 1999 and had approval from the University of Auckland Animal Ethics Committee. All efforts were made to minimise the number of animals used.
[0307] Sagittal Brain Organotypic Slice Culture Generation and Culturing
[0308] Sagittal brain organotypic slice cultures were generated and cultured as previously described (McCaughey-Chapman & Connor, 2017, 2022). Briefly, animals were euthanised by decapitation and the brains divided into two hemispheres for sectioning. 300µm-thick sagittal brain slices were cut using a vibratome (Leica Biosystems) in ice-cold medium consisting of Advanced DMEM / F-12 with 1% penicillin-streptomycin (Thermo Fisher Scientific, #12634010 and #15140148). Individual slices were mounted onto sterile membrane inserts in 6-well plates (Corning, #COR3450) and cultured at the airmembrane interface at 35°C with 5% CO2. Slices were cultured in MEM with Hanks balanced salts (Thermo Fisher Scientific, #11575032), 1% penicillin-streptomycin and 25% horse serum (Thermo Fisher Scientific, #16050130) for 3 days (ImL of medium added below the membrane insert). To limit glial scar formation, a cocktail of three mitotic inhibitors was added to the medium for the first three days of culturing: uridine, 5-fluorodeoxyuridine and cytosine-B-arabinofuranoside (4.4mM each, Sigma, #U3003, #F0503 and #C1768). The slices were then transitioned into a serum-free medium consisting of Advanced DMEM / F-12 with 2% B-27 supplement (Thermo Fisher Scientific, #17504044) and 1% N-2 supplement (Thermo Fisher Scientific, #17502048) and cultured for up to 5 weeks.
[0309] Lysolecithin (LPC) Treatment of Sagittal Brain Organotypic Slice Cultures and hiOPC transplantation
[0310] On Day 7 of culturing, slices were randomly allocated to one of three groups: untreated, lysolecithin (LPC)-treated or LPC-treated + hiOPCs. LPC-treated slices were incubated in 0.5mg / mL LPC (Sigma, #62962) for 17 hours (Hawker, Dhakal, Connor, & McCaughey-Chapman, 2024) to induce demyelination of the slices. Media was changed to serum-free medium. 3 days post-LPC removal, slices in the LPC-treated + hiOPC group received hiOPCs. Briefly, all slices were switched into OL differentiation medium. hiOPCs from 3 different aHDF lines were reprogrammed as described above, collected with Accutase (Thermo Fisher Scientific), resuspended in OL differentiation medium and counted using a haemocytometer. 50,000 hiOPCs were transplanted in 2pL of OL differentiation medium into the corpus callosum of LPC-treated slices using a Hamilton syringe. Slices were further cultured in OL differentiation medium for 4 weeks.
[0311] Immunohistochemical Analysis
[0312] Slices were fixed in 4% paraformaldehyde for 24 hours at 4°C. Whole mount slices were stained using a shortened version of the optical clearing technique iDISCO (Renier et al., 2014), as previously described (McCaughey-Chapman & Connor, 2022). Briefly, after 24 hours of permeabilization, the slices were blocked and then incubated in primary antibody for 48 hours. The extent of demyelination and remyelination was assessed by quantification of the expression of MBP (MAB386; 1:250) and MOG (ab233549; 1:250) (n=3 slices per group for each MBP and MOG). Identification of transplanted hiOPCs was undertaken by labelling with the human nuclei marker STEM101 (TKY40400; 1:500) and hiOPC-derived hiOL remyelination assessed by co-expression of STEM101 / MBP and STEM101 / MOG. Alexa Fluor conjugated secondary antibodies were used to fluorescently label the antigens of interest and following dehydration in a series of increasing concentrations of methanol and clearing in dibenzyl ether, the membrane-bound slices were placed onto a glass microscope slide and imaged using a Zeiss LSM 800 inverted confocal microscope. Demyelination and remyelination were quantified by densitometric analysis of MBP and MOG fluorescence intensity by measurement of the integrated density in ImageJ after consistent background subtraction and threshold adjustment across all images.
[0313] Statistical Analysis
[0314] Statistical analyses were performed using IBM SPSS Statistics v28 (IBM Corporation). Levene's test for equality of variances was performed on all data. A two-way repeated measures ANOVA and one-way repeated measures ANOVA were used for comparison of time and / or transcription factor combinations. A one-way ANOVA was used to compare MBP and MOG fluorescent intensity ex vivo. Post-hoc analyses were performed with the Bonferroni test. All data are presented as mean ± SEM. Results were considered significant if p < 0.05.
[0315] Results
[0316] Adult human derma! fibroblasts can be directly reprogrammed to an oligodendrocyte precursor phenotype and differentiated to mature oligodendrocytes
[0317] Figure 1 depicts the direct reprogramming and differentiation protocols disclosed herein, that promote the generation of oligodendrocyte precursor cells with a hiOPC phenotype and enhance differentiation to human induced oligodendrocytes (hiOLs).
[0318] In the examples provided herein, the inventors have investigated the effect of six different cmRNA transcription factor combinations on the resulting OLIG1+ hiOPC yield at different time points through reprogramming, Day 18, 32 and 46 (Figure 2A). A two-way repeated measures ANOVA revealed a significant effect of time on OLIG1+ hiOPC yield, irrespective of transcription factor combination, with Day 18 of reprogramming resulting in the greatest OLIG1+ hiOPC yield (Figure 2A). Focusing on Day 18-reprogrammed hiOPCs, the inventors observed that OLIG1+ hiOPC yield was significantly greater, 51.97% ± 17.96%, when aHDFs were reprogrammed using the SOX2 / OLIG2 / SOX10 combination as opposed to SOXIO alone or SOX10 / OLIG2 (Figure 2B). The inventors observed large variations in OLIG1+ hiOPC yield in between donor cell lines, and hence investigated the OLIG1+ / DAPI+ expression across transcription factor combinations within each line (Figure 2C-E). For two of the cell lines, 759506 and 771080, aHDFs reprogrammed with SOX2 / OLIG2 / SOX10 resulted in the greatest OLIG1+ hiOPC yield when compared to all other transcription factor combinations (759506: 95.97% ± 1.36%; 771080: 29.83% ± 4.06%; Figures 2C & D). For line 2116 aHDFs reprogrammed with SOX2 / OLIG2 / SOX10 \so resulted in the greatest OLIG1+ hiOPC yield (30.11% ± 5.21%) when compared to all other transcription factor combinations, but SOX2 / OLIG2 (Figure 2E). Overall, the inventors concluded that on average to achieve the greatest OLIG1+ hiOPC yield, aHDFs needed to be reprogrammed using SOX2 / OLIG2 / SOX10 cmRNA in combination with a defined OPC reprogramming medium for 18 days only.
[0319] To confirm that, SOX2 / OLIG2 / SOX10 cmRNA-hiOPCs give rise to hiOLs expressing myelin genes and that 18 days of reprogramming only was sufficient to achieve this, the inventors investigated the expression of A / F / ’and PLP1 in SQY / C! L 7 / SQW^-hiOPC differentiated to hiOLs after 18 days (RPL3 DIFF), 32 days (RPL5 DIFF) or 46 days (RPL7 DIFF) of reprogramming (Figures 2F & G). A / FZ’and PLP1 were up-regulated in all SQY / C! LZt7 / SQY7Z7-hiOPC-derived hiOLs, with a large up-regulation in hiOLs derived from hiOPCs that were only reprogrammed for 18 days (RPL3 DIFF). Combined, these results indicate that aHDFs reprogrammed with S0X2 / 0UG2 / S0X1 Of or 18 days and differentiated for 14 days produces the greatest yield of OLIG1+ hiOPCs that differentiate to mature oligodendrocytes expressing A / FZ’and PLP1.
[0320] The inventors next aimed to confirm the authenticity of the SOX2 / OLIG2 / SOX10 hiOPCs and derived hiOLs by analysis of gene and protein expression profile. Figure 3A provides a representative image of SOX2 / OLIG2 / SOX10 hiOPCs. SOX2 / OLIG2 / SOX10 hiOPCs express the OPC lineage genes A2B5, CSPG4, N
[0321]
[0322] KX6.2 and OLIG2 (Figure 3B) and the OPC lineage markers A2B5, PDGFra, NG2, NKX6.2 and OLIG1 (Figure 3C). Figure 4A provides a representative image of SOX2 / OLIG2 / SOX10 hiOPC-derived hiOLs. SQY^C’£Zt7^SC’A Z7hiOPC-derived hiOLs express the oligodendrocyte and myelin genes 01, MBPa PLP1 (Figure 4B) and the oligodendrocyte and myelin proteins OLIG1, 04, 01, MBP and MOG (Figure 4C).
[0323] Without wishing to be bound by theory, the inventors believe that the above findings support the proposition that aHDFs reprogrammed with SOX2 / OLIG2 / SOX10 cmRNA for 18 days in a defined OPC reprogramming medium consisting of PDGF-AA, SAG, T3 and N-2 promotes the induction of an OPC fate, and subsequent OL differentiation for 14 days produces mature oligodendrocytes expressing myelin genes and proteins in vitro.
[0324] Human induced oligodendrocyte precursors survive transplantation into the demyelinated corpus callosum and differentiate to myelinating oligodendrocytes ex vivo.
[0325] To provide proof-of-concept that SOX2 / OLIG2 / SOX10 hiOPCs can survive and differentiate to myelinating hiOLs following transplantation into a demyelinated region, the inventors investigated the OL differentiation and myelination capacity of S0X2 / 0LIG2 / S0X1Q hiOPCs after transplantation into the demyelinated corpus callosum ex vivo. Myelination of the corpus callosum of rat brain sagittal organotypic slice cultures was shown by abundant expression of MBP and MOG after 5 weeks in culture (Figure 5A and C, untreated). Treatment of the slices with the demyelinating compound LPC induced demyelination observed by a significant decrease in %MBP and %M0G fluorescence intensity 4 weeks post-LPC when compared to untreated slices (Figure 5B & D). When S0X2 / 0LIG2 / S0X1Q hiOPCs were transplanted into the corpus callosum of LPC-treated slices they gave rise to hiOLs co-expressing STEM101 / MBP and STEMIOI / MOG 4 weeks post-transplant (Figure 5A & C, LPC-treated + hiOPC). Quantification of the MBP and MOG fluorescence intensity revealed a significant increase in MBP and MOG intensity in LPC-treated slices transplanted with hiOPCs, when compared to LPC-treated demyelinated slices (Figure 5B & D).
[0326] These results indicate that SOX2 / OLIG2 / SOX10 cmRNA direct reprogramming generates hiOPCs which survive transplantation and differentiate into MBP+ and MOG+ myelinating oligodendrocytes in the demyelinated rat corpus callosum ex vivo.
[0327] Discussion - Conclusion
[0328] The results provided by this study demonstrate that aHDFs can be directly reprogrammed to hiOPCs following transient cmRNA-mediated over-expression of SOX2, OLIG2 and SOX10 and exposure to PDGF-AA, SAG, T3 and N-2 in a DMEM / F-12-based reprogramming medium in only 18 days. hiOPCs were shown to be authentic through expression of a characteristic panel of OPC markers. hiOPCs can be further differentiated in vitro to high yields of hiOLs expressing the mature OL markers 04, 0LIG1 / 01, MBP and MOG. Also demonstrated for the first time is that the transplantation of directly reprogrammed hiOPCs into the corpus callosum of LPC-demyelinated brain organotypic slices cultures, an art accepted ex vivo model of demyelination, results in the survival and differentiation of hiOPCs into hiOLs ex vivo. Derived hiOLs are capable of remyelinating the demyelinated slice cultures. This demonstrated the ability of hiOPC-derived hiOLs to functionally integrate into a demyelinated brain environment and produce myelin. Without wishing to be bound by theory, the inventors believe that based on these findings, the use of cmRNA directly reprogrammed hiOPCs offers an effective and clinically viable strategy for cell replacement therapy to treat conditions and diseases related to demyelination.
[0329] 7. INDUSTRIAL APPLICATION
[0330] The present invention is useful for cellular reprogramming of aHDFs to oligodendrocyte precursor cells, having applications in both research and medicine. Those persons skilled in the art will understand that the above description is provided by way of illustration only and that the invention is not limited thereto. 8. REFERENCES
[0331] All, A. H., Bazley, F. A., Gupta, S., Pashai, N., Hu, C., Pourmorteza, A., & Kerr, C. (2012). Human embryonic stem cell-derived oligodendrocyte progenitors aid in functional recovery of sensory pathways following contusive spinal cord injury.
[0332] Douvaras, P., Wang, J., Zimmer, M., Hanchuk, S., O'Bara, M. A., Sadiq, S., Fossati, V. (2014). Efficient generation of myelinating oligodendrocytes from primary progressive multiple sclerosis patients by induced pluripotent stem cells. Stem Cell Reports, 3(2), 250-259.
[0333] Ehrlich, M., Mozafari, S., Glatza, M., Starost, L., Velychko, S., Hallmann, A., Bachelin, C. (2017). Rapid and efficient generation of oligodendrocytes from human induced pluripotent stem cells using transcription factors. Proceedings of the National Academy of Sciences, 114(11), E2243-E2252.
[0334] Erceg, S., Ronaghi, M., Oria, M., Garcia Rosello, M., Arago, M. A. P., Lopez, M. G., Shanker Bhattacharya, S. (2010). Transplanted oligodendrocytes and motoneuron progenitors generated from human embryonic stem cells promote locomotor recovery after spinal cord transection. Stem Cells, 28(9), 1541-1549.
[0335] Fuhrmann, T., Tam, R. Y., Ballarin, B., Coles, B., Donaghue, I. E., Van Der Kooy, D., Shoichet, M. S. (2016). Injectable hydrogel promotes early survival of induced pluripotent stem cell-derived oligodendrocytes and attenuates longterm teratoma formation in a spinal cord injury model. Biomaterials, 83, 23-36.
[0336] Gilerovich, E. G., Fedorova, E. A., & Otellin, V. A. (1991). Transplantation of human embryonal nervous tissue into the spinal cord of adult rats. Neuroscience and Behavioral Physiology, 21(3), 193-198. Giovanini, M. A., Reier, P. J., Eskin, T. A., Wirth, E., & Anderson, D. K. (1997). Characteristics of human fetal spinal cord grafts in the adult rat spinal cord: Influences of lesion and grafting conditions. Experimental Neurology, 148(2), 523-543.
[0337] Gonzalez, F., Boue, S., & Belmonte, J. C. I. (2011). Methods for making induced pluripotent stem cells: Reprogramming a la carte. Nature Reviews Genetics, 12(4), 231-242.
[0338] Hawker, B., Dhakal, M., Connor, B., & McCaughey-Chapman, A. (2024). Modeling demyelination and endogenous remyelination in spinal cord ex vivo rat organotypic slice cultures. Frontiers in Cellular Neuroscience, 18, 1345042.
[0339] Hu, B., Du, Z., & Zhang, S. (2009). Differentiation of human oligodendrocytes from pluripotent stem cells. Nature Protocols, 4(11), 1614-1622.
[0340] Izrael, M., Zhang, P., Kaufman, R., Shinder, V., Ella, R., Amit, M., Revel, M. (2007). Human oligodendrocytes derived from embryonic stem cells: Effect of noggin on phenotypic differentiation in vitro and on myelination in vivo. Molecular and Cellular Neuroscience, 34(3), 310-323.
[0341] Kawabata, S., Takano, M., Numasawa-Kuroiwa, Y., Itakura, G., Kobayashi, Y., Nishiyama, Y., Isoda, M. (2016). Grafted human iPS cell-derived oligodendrocyte precursor cells contribute to robust remyelination of demyelinated axons after spinal cord injury. Stem Cell Reports, 6(1), 1-8.
[0342] Keirstead, H. S., Nistor, G., Bernal, G., Totoiu, M., Cloutier, F., Sharp, K., & Steward, O. (2005). Human embryonic stem cell-derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury. Journal of Neuroscience, 25(19), 4694-4705.
[0343] Kerr, C. L., Letzen, B. S., Hill, C. M., Agrawal, G., Thakor, N. V., Sterneckert, J. L., All, A. H. (2010). Efficient differentiation of human embryonic stem cells into oligodendrocyte progenitors for application in a rat contusion model of spinal cord injury. International Journal of Neuroscience, 120(4), 305-313. Kim, D., Jung, S. J., Lee, J. S., Lim, B. Y., Kim, H. A., Yoo, J., Leem, J. W. (2017). Rapid generation of OPC-like cells from human pluripotent stem cells for treating spinal cord injury. Experimental & Molecular Medicine, 49(7), e361.
[0344] McCaughey-Chapman, A., & Connor, B. (2023). Cell reprogramming for oligodendrocytes: A review of protocols and their applications to disease modeling and cell-based remyelination therapies. Journal of Neuroscience Research,
[0345] McCaughey-Chapman, A., & Connor, B. (2017). Rat brain sagittal organotypic slice cultures as an ex vivo dopamine cell loss system. Journal of Neuroscience Methods, 277, 83-87.
[0346] McCaughey-Chapman, A., & Connor, B. (2022). Rat cortico-striatal sagittal organotypic slice cultures as ex vivo excitotoxic striatal lesion models. Heliyon, 8(9)
[0347] Nistor, G. I., Totoiu, M. 0., Haque, N., Carpenter, M. K., & Keirstead, H. S. (2005). Human embryonic stem cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation. Glia, 49(3), 385-396.
[0348] Piao, J., Major, T., Auyeung, G., Policarpio, E., Menon, J., Drams, L., Soulet, D. (2015). Human embryonic stem cell-derived oligodendrocyte progenitors remyelinate the brain and rescue behavioral deficits following radiation. Cell Stem Cell, 16(2), 198-210.
[0349] Renier, N., Wu, Z., Simon, D. J., Yang, J., Ariel, P., & Tessier-Lavigne, M. (2014). iDISCO: A simple, rapid method to immunolabel large tissue samples for volume imaging. Cell, 159(4), 896-910.
[0350] Seiger, A., Holtz, A., & Akesson, E. (1998). Fetal spinal cord grafting in man. J Neurol Rehab, 12, 198-199.
[0351] Wang, S., Bates, J., Li, X., Schanz, S., Chandler-Militello, D., Levine, C., Windrem, M. (2013). Human iPSC -derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell, 12(2), 252-264.
[0352] Windrem, M. S., Nunes, M. C., Rashbaum, W. K., Schwartz, T. H., Goodman, R. A., McKhann, G., Goldman, S. A. (2004). Fetal and adult human oligodendrocyte progenitor cell isolates myelinate the congenitally dysmyelinated brain. Nature Medicine, 10(1), 93-97.
[0353] Windrem, M. S., Roy, N. S., Wang, J., Nunes, M., Benraiss, A., Goodman, R., Goldman, S. A. (2002). Progenitor cells derived from the adult human subcortical white matter disperse and differentiate as oligodendrocytes within demyelinated lesions of the rat brain. Journal of Neuroscience Research, 69(6), 966-975.
[0354] Wirth lii, E. D., Reier, P. J., Fessler, R. G., Thompson, F. J., Uthman, B., Behrman, A., Anderson, D. K. (2001). Feasibility and safety of neural tissue transplantation in patients with syringomyelia. Journal of Neurotrauma, 18(9), 911-929.
Claims
1. WHAT WE CLAIM:
1. A method of making a human induced oligodendrocyte precursor cell (hiOPC) comprising reprogramming a human fibroblast (HF) into a hiOPC comprising3.a. transfecting the HF with SOX2 cmRNA, OLIG2 cmRNA and SOX10 cmRNA (SOS), b. culturing the transfected HF in a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement,4.c. passaging the HF in b. into a second reprogramming composition comprising a basal cell reprogramming medium, and at least two active agents selected from the group consisting of platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3), a Sonic Hedgehog (SHH) activator and N-2 supplement, and5.d. culturing the passaged HF.
2. The method of claim 1 wherein the SC cmRNA comprises, consists essentially of or consists of (SEQ ID NO:1), the OLIG2 cmRNA comprises, consists essentially of or consists of (SEQ ID NO: 2) and the 5C> 0cmRNA comprises, consists essentially of or consists of (SEQ ID NO:3).
3. The method of claim 1 or claim 2 wherein the composition in b. comprises a basal cell reprogramming medium, and at least three agents, preferably at least three, four, at least five, preferably six active agents selected from the group consisting of B-27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement.
4. The method of any one of claims 1 to 3 wherein culturing in b. is for about one to seven days, preferably for about two to about six days, preferably for about three to about five days, preferably for about four days.
5. The method of any one of claims 1 to 4 wherein the composition in c. comprises a basal cell reprogramming medium and at least three active agents, preferably all four active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2- supplement.
6. The method in any one of claims 2 to 5 wherein the SHH activator in c. is selected from the group consisting of SAG, SHH, SHH-C24II, purmorphamine, 20(S)-hydroxycholesterol (20(S)- OHC), preferably wherein the SHH activator is SAG or SHH-C24II.
7. The method of any one of claims 2 to 6 wherein culturing in d. is for about 10 to 18 days, preferably for about 11 to 17 days, about 12 to 16 days, about 13 to 15 days, preferably for about 14 days.
8. The method of any one of claims 2 to 7 wherein the HF is a human dermal fibroblast (HDF), preferably an adult human fibroblast (aHF), preferably an adult human dermal fibroblast (aHDF).
9. The method of any one of claims 2 to 8 wherein the hiOPC expresses at least one nucleic acid or protein oligodendrocyte precursor marker, preferably at least two, three, four, at least five,preferably all six protein or nucleic acid oligodendrocyte precursor markers selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 and OLIG2.
10. The method of any one of claims 2 to 9 further comprising differentiating the hiOPC reprogrammed from an HF in a. - d. into a human induced oligodendrocyte cell (hiOL) by: e. passaging the hiOPC cultured in d. into a composition comprising at least three active agents, preferably at least four, at least five, preferably six active agents selected from the group consisting of PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement, and15.f. culturing the passaged hiOPC.
11. The method of claim 10 wherein the composition in e. comprises 5 active agents that are T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
12. The method of claim 10 wherein the composition in e. is supplemented with BDNF after about six to about eight days, preferably after about seven days.
13. The method of any one of claims 10 to 12 wherein passaging into the composition in e. is at about 14 to 22 days, preferably at about 15 to 21 days, about 16 to 20 days, about 17 to 19 days, preferably at about 18 days.
14. The method of any one of claims 10 to 13 wherein culturing in f. is for about 7 to about 35 days, preferably for about 14 to 28 days, preferably for about 14 days.
15. The method of any one of claims 10 to 14 wherein differentiating comprises differentiating the hiOPC into a cell that expresses at least one protein or nucleic acid biomarker associated with oligodendrocyte differentiation, preferably into a human induced oligodendrocyte (hiOL).
16. The method of claim 15 wherein the at least one biomarker, preferably at least two, three, four, at least five, preferably al six biomarkers is selected from the group consisting of OLIG1, 04, MBP, PLP1, 01 and MOG.
17. A human induced oligodendrocyte precursor cell (hiOPC) made according to the method of any one of claims 1 to 9.
18. A pharmaceutical composition comprising at least one hiOPC of claim 17.
19. Use of a human induced oligodendrocyte precursor cell (hiOPC) of claim 17 to treat a disease or condition associated with demyelination.
20. The use of claim 19 wherein the disease or condition associated with demyelination is multiple sclerosis (MS), spinal cord injuries (SCI), cerebral palsy, leukodystrophies, white matter strokes, Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple systems atrophy or amyotrophic lateral sclerosis.
21. A method of treating a disease or condition associated with demyelination, the method comprising transplanting a human induced oligodendrocyte precursor cell (hiOPC) of claim 17 into the brain, spinal cord or optic nerve of a subject having or suspected of having the disease or condition.
22. A composition comprising a basal cell reprogramming medium and at least two active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N2- supplement.
23. The composition of claim 22 comprising a basal cell reprogramming medium and at least three active agents, preferably all four active agents, selected from the group consisting of a SHH activator, PDGF-AA, T3 and N2- supplement.
24. The composition of claim 22 or claim 23 wherein the SHH activator is selected from the group consisting of SAG, SHH, SHH-C24II, purmorphamine and 20(S)-hydroxycholesterol (20(S)- OHC), preferably wherein the SHH activator is SAG or SHH-C24II.
25. Use of a composition as defined in any one of claims 22 to 24 to induce the expression of at least one oligodendrocyte precursor marker in a reprogrammed human fibroblast, a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast.
26. The use of claim 25 wherein the at least one protein or nucleic acid oligodendrocyte precursor marker, preferably at least two, three, four, at least five, preferably all six protein or nucleic acid oligodendrocyte precursor markers are a selected from the group consisting of A2B5, PDGFRa, NG2, NKX6.2, OLIG1 or OLIG2.
27. A kit comprising i., at least one cmRNA, preferably at least two, preferably all three cmRNAs selected from the group consisting of S0X2 cmRNA, OLIG2 cmRNA and SOXIO cmRNA preferably wherein the SOX2, OLIG2 and SOX10 cmRNAs are as defined in claim 2.
28. The kit of claim 27 further comprising ii., a first reprogramming composition comprising a basal cell reprogramming medium, and at least two agents selected from the group consisting of B- 27 supplement, basic fibroblast growth factor (FGF2), epidermal growth factor (EGF), heparin, retinoic acid (RA) and N-2 supplement.
29. The kit of claim 27 or 28 further comprising Hi., a second reprogramming composition comprising a basal cell reprogramming medium, and at least two, preferably at least three, preferably all four active agents selected from the group consisting of a Sonic Hedgehog (SHH) activator, platelet-derived growth factor AA (PDGF-AA), 3,3',5'-Triiodo-L-thyronine (T3) and N-2 supplement.
30. The kit of claim 21 wherein the SHH activator is as defined in claim 24.
31. The kit of any one of claims 27 to 30 further comprising iv., a differentiation composition comprising a basal cell differentiation medium and at least three, preferably at least four, at least five, preferably all six active agents selected from the group consisting of PDGF-AA, T3, IGF-1, NT-3, a cAMP activator and N-2 supplement.
32. The kit of any one of claims 27 to 30 comprising iv., a differentiation composition comprising a basal cell differentiation medium and at least three, preferably at least five active agents selected from the group consisting of 3,3',5'-Triiodo-L-thyronine (T3), insulin growth factor 1(IGF-1), neurotrophin-3 (NT-3), a cyclic adenosine 3′,5′-monophosphate (cAMP) activator and N-2 supplement.
33. The kit of claim 31 or 32 further comprising v., a composition comprising brain-derived neurotrophic factor (BDNF) and a carrier.
34. The kit of any one of claims 27 to 33 wherein i., ii., iii., iv. and v. are packaged separately and in a manner that requires sequential use of i. followed by ii. followed by iii. followed by iv. followed by v.