Method for producing heart organoid from pluripotent stem cells through elongation and looping, heart organoid produced thereby, and use thereof

By culturing pluripotent stem cells with CHIR99201 and bFGF and forming embryoid bodies, cardiac organoids with elongated structures are produced, addressing the limitations of conventional methods and improving their applicability in regenerative medicine and drug development.

WO2026116838A1PCT designated stage Publication Date: 2026-06-04ANIMUSCURE INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/018535
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-27
Filing Date
2025-11-11
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Conventional methods for producing cardiac organoids do not include the elongation and looping processes that occur during human heart development, limiting their functionality and applicability in regenerative medicine and drug development.

Method used

A method involving culturing pluripotent stem cells in a medium with CHIR99201 and bFGF, forming embryoid bodies, and then culturing them in a cardiac organoid differentiation medium to induce elongation and looping, resulting in cardiac organoids with an elongated structure and functional capabilities.

Benefits of technology

The method produces cardiac organoids that mimic the elongation and looping processes of human heart development, enhancing their functionality for regenerative medicine and drug development applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025018535_04062026_PF_FP_ABST
    Figure KR2025018535_04062026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are: a method for producing a heart organoid from pluripotent stem cells through a cardiac development process of elongation and looping; a method for studying cardiac differentiation; an elongated heart organoid produced thereby; and a use thereof. The method for producing a heart organoid according to the present invention is characterized by the undergoing of a heart tube elongation and looping process, and thus the undergoing of the same process as human cardiac differentiation.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing cardiac organoids through elongation and bending from pluripotent stem cells, cardiac organoids produced thereby, and uses thereof

[0001] This relates to a method for producing cardiac organoids through elongation and bending from pluripotent stem cells, the cardiac organoids produced thereby, and their uses.

[0002] The heart is an important organ responsible for blood circulation through rhythmic contractions and sustains the life of animals. This organ is composed of various types of cells, such as endothelial cells, myocardial cells, and smooth muscle cells, and enables rhythmic contractions; therefore, these groups of cells with different functions and forms are arranged in an intricate and fine manner within the heart during the developmental process.

[0003] Heart organoids are three-dimensional (3D), self-organizing structures that spontaneously possess the form and function of heart tissue and contain major cardiac cell types, including cardiomyocytes, cardiac fibroblasts, and / or endothelial cells. Many recent studies have revealed how heart organoids can model human heart development and have made significant progress.

[0004] Cardiac organoids can be useful in various application fields, such as regenerative medicine, new drug development research, and safety testing. For example, in regenerative medicine, lost function can be restored by transplanting the cardiac organoid itself. Furthermore, in new drug development research, the analysis and screening of cardiac organoids differentiated under disease-specific conditions can contribute to the development of new drugs for those diseases. Additionally, safety testing is generally performed on animal cells. Since the body's response to drugs occurs due to the interaction of various cells, there is a possibility of analyzing drug safety with higher accuracy by using cardiac organoids rather than evaluating cells alone.

[0005] Korean Patent Publication No. 10-2022-0153170 discloses a method for manufacturing a cardiac organoid derived from human pluripotent stem cells. Additionally, Lewis-Israeli et al. (Nat. Commun, (2021) 12: 5142) disclose a method for generating a human cardiac organoid by self-assembly using human pluripotent stem cells.

[0006] However, the conventionally known method for manufacturing cardiac organoids produces spherical cardiac organoids, and discloses a method for manufacturing cardiac organoids that does not include the elongation and looping processes that occur during actual human heart development.

[0007] Therefore, there is a demand for a method for manufacturing a cardiac organoid with cardiac functionality that undergoes extension and bending processes even by conventional technology, and for the cardiac organoid.

[0008] One aspect provides a method for producing a cardiac organoid from PSCs, comprising the steps of: culturing pluripotent stem cells (PSCs) in a medium containing differentiation inducing factors to obtain pretreated PSCs, wherein the differentiation inducing factors include CHIR99201 and bFGF; culturing the pretreated PSCs in an embryoid body (EB) forming medium to form embryoids; and culturing the formed embryoids in a cardiac organoid differentiation medium to form cardiac organoids.

[0009] Another aspect provides a cardiac organoid obtained by the above method.

[0010] Another aspect is a cardiac organoid, providing a cardiac organoid with an elongated structure.

[0011] Another aspect provides a method for studying cardiac differentiation that includes the step of culturing cardiac organoids in candidate conditions or in a medium containing candidate substances.

[0012] Another aspect provides a composition or kit containing a cardiac organoid.

[0013] One aspect provides a method for producing a cardiac organoid from PSCs, comprising the steps of: culturing pluripotent stem cells (PSCs) in a medium containing differentiation inducing factors to obtain pretreated PSCs, wherein the differentiation inducing factors include a GSK-3α / β inhibitor including CHIR99201 and bFGF; culturing the pretreated PSCs in an embryoid body (EB) formation medium to form embryoids; and culturing the formed embryoids in a cardiac organoid differentiation medium to form cardiac organoids.

[0014] In this specification, the term “organoid” refers to a miniature organ created by culturing or recombining isolated cells. This term should be broadly interpreted to include three-dimensional (3D) multicellular in vitro tissue structures that substantially mimic the corresponding in vivo tissue or organ. This term is contrasted with two-dimensional (2D) cultures, which generally contain fewer cell types and do not mimic the physiological conditions and / or structures observed in in vivo tissues or organs. Such organoids may be used to study aspects of the tissue or organ in a tissue culture dish. The term “in vitro” refers to a process or reaction occurring in an artificial environment or outside of a living organism. An in vitro environment may include test tubes, cell cultures, well plates, bioreactors, etc.

[0015] In this specification, the term “pluripotent stem cell (PSC)” refers to a cell having the ability to self-renew by division and to develop into the three primary germ cell layers (endoderm, mesoderm, and ectoderm) of an early embryo and, accordingly, into all cells of an adult. The pluripotent stem cell may be a human-derived cell.

[0016] In some embodiments, the pluripotent stem cells include embryonic stem cells or induced pluripotent stem cells.

[0017] In this specification, the term “embryonic stem cell (ESC)” refers to stem cells derived from the internal cell mass of a pre-implantation embryo during the process of in vitro fertilization, as well as embryonic stem cells produced by somatic cell nuclear transfer and embryonic stem cells from unfertilized eggs. The stem cells may be derived from sources including, but not limited to, embryonic or fetal tissues, post-fetal tissues, adult tissues, and differentiated tissues. ES cells also have the potential for self-renewal and differentiation into mature cells including, but not limited to, nerve cells, muscle cells, adipocytes, hepatocytes, organ cells, blood cells, bone cells, etc.

[0018] In this specification, the term "induced pluripotent stem cell (iPSC)" refers to a stem cell derived from somatic cells, e.g., differentiated somatic cells, which has a higher potential than the somatic cells themselves. Like ESCs, iPSCs are capable of self-renewal and differentiation into mature cells. The iPSCs of the present invention can be obtained by the methods described at the current level of the art. For example, they can be obtained through somatic cell reprogramming following the exogenous expression of specific transcription factors Oct-3 / 4, KLF4, SOX2, and c-Myc (commonly known as the Yamanaka factor). In the context of the present invention, the term "somatic cell" refers to virtually all cells of the body, excluding gonads. Gonads are cells of the reproductive organs that produce sperm and eggs. Examples of somatic cells include cells of internal organs, skin, bone, blood (e.g., peripheral blood mononuclear cells (PBMCs)), or connective tissue cells such as fibroblasts. Fibroblasts and PBMCs are most commonly used to produce human iPSCs.

[0019] The above method comprises the step of obtaining pretreated PSCs by culturing pluripotent stem cells (PSCs) in a medium containing differentiation-inducing factors, wherein the differentiation-inducing factors include CHIR99201 and bFGF (basic fibroblast growth factor). CHIR99201 is called Laduviglusib. CHIR99201 is a potent, selective, and orally active GSK-3α / β inhibitor. CHIR99201 is also a potent Wnt / β-catenin signaling pathway activator. CHIR99201 also promotes self-renewal of mouse and human embryonic stem cells. bFGF can play a role in inducing differentiation of stem cells into the mesoderm when acting in conjunction with the Wnt / β-catenin signaling pathway activator.

[0020] In the above method, the pluripotent stem cells (PSCs) may be embryonic stem cells or induced pluripotent stem cells (iPSCs). Induced pluripotent stem cells may be manufactured according to known methods or commercially purchased.

[0021] In the above method, the pluripotent stem cells may be isolated or maintained after being prepared. The method may further include the step of culturing the pluripotent stem cells in a cell culture substrate. The substrate may be an extracellular matrix, for example, a solubilized basement membrane. The substrate may be Marigel. The culture may be performed in a pluripotent stem cell maintenance medium. The maintenance medium may be known. The maintenance medium may be, for example, mTeSR TM Plus Basic Badge (STEMCELL) TM It could be Technologies Inc. mTeSR TM Plus, the basic medium may be a cGMP, stabilized feeder-free maintenance medium for human embryonic stem cells (ES) and iPS cells.

[0022] In the above method, the concentration of CHIR99201 may be 2.0 μM to 4.0 μM, 2.5 μM to 3.5 μM, 2.8 μM to 3.2 μM, or about 3.0 μM. The concentration of bFGF may be 30 ng / ml to 50 ng / ml, 35 ng / ml to 45 ng / ml, 38 ng / ml to 42 ng / ml, or about 40 ng / ml. The concentrations of CHIR99201 and bFGF may be 2.0 μM to 4.0 μM and 30 ng / ml to 50 ng / ml, respectively.

[0023] The above differentiation-inducing factor-containing medium includes DMEM / F12, Neurobasal in addition to the above differentiation-inducing factor. TM medium, N-2 TM supplement, B-27 TM supplement, Glutamax TM The medium may contain one or more of a supplement, beta-mercaptoethanol, and an antibiotic or a mixture thereof, for example, a mixture of penicillin and streptomycin antibiotics.

[0024] Neurobasal TM The medium does not require an astrocyte feeder layer and is a basic medium for the long-term maintenance and maturation of pure prenatal and embryonic neuronal populations.

[0025] N-2 TM The supplement is a chemically defined serum-free supplement based on Bottenstein's N-1 formulation and contains human transferrin, insulin recombinant full chain, and progesterone.

[0026] B-27 TM The supplement is an optimized serum-free supplement used to support low- or high-density growth and short- or long-term survival of neurons in the hippocampus and other central nervous system in embryos, postnatal, and adults. B-27 TM Supplements may contain components essential for cell survival, such as various vitamins, lipids, hormones, and minerals.

[0027] A mixture of penicillin and streptomycin antibiotics is an example of an antibiotic mixture widely used to prevent bacterial contamination in mammalian cell cultures. The penicillin may be penicillin G. The penicillin and streptomycin may be contained at a concentration of 500 to 1,000 units / mL in the medium. Glutamax TM The supplement is an L-glutamine substitute that improves stability and cell health. Glutamax TM The supplement may contain L-alanyl-L-glutamine dipeptide. The concentration of L-alanyl-L-glutamine dipeptide may be 50 to 1000 mM, for example, 100 to 1000 mM, 100 to 800 mM, 100 to 600 mM, 100 to 400 mM, 100 to 300 mM, 150 to 300 mM, 150 to 250 mM, or about 200 mM. One embodiment may contain 200 mM L-alanyl-L-glutamine dipeptide in 0.85% NaCl.

[0028] The above differentiation-inducing factor-containing medium includes DMEM / F12, Neurobasal medium, N-2, B-27, and Glutamax in addition to the above differentiation-inducing factor. TM It may be a medium containing a mixture of supplement, beta-mercaptoethanol, and antibiotics penicillin and streptomycin.

[0029] The above differentiation-inducing factor-containing medium may not contain one or more of BMP4 and Activin A.

[0030] In the above method, in the step of obtaining the pretreated PSC, the culture may be a monolayer of cells. The culture may be a two-dimensional culture. The culture may be an adherent culture. The culture may be performed in a container containing microcompartments, for example, a microwell plate. The microwell plate may be 6 wells or more, for example, a 96-well plate. The culture may be performed under stirring.

[0031] In the above method, the pretreated PSCs are cultured in two dimensions, and the differentiation of the stem cells may occur in a form that detaches from the edges of the cell colony. The pretreated PSCs may not have a three-dimensional structure. During the pretreatment process, differentiation may proceed slowly. Cells in the EB formation stage may be cells in the process of differentiation. EBs in the early stage before elongation begins may be the same as conventional EBs.

[0032] In the step of obtaining the above-mentioned pretreated PSC, the culture may be performed for 24 to 48 hours, 28 to 44 hours, 32 to 40 hours, 34 to 38 hours, or about 36 hours. In addition to the conditions mentioned above, the culture may be performed under conditions such as temperature and oxygen concentration known in pluripotent stem cell culture.

[0033] The above method includes the step of forming an embryoid body by culturing the pretreated PSC in an embryoid body (EB) forming medium.

[0034] In this specification, the term “embryoid body (EB)” refers to an aggregate of pluripotent stem cells capable of differentiating into cells of the endoderm, mesoderm, and ectoderm layers. This spherical structure is formed when pluripotent stem cells aggregate and enables non-adherent culture of the EB in a suspension state.

[0035] In the step of forming the embryo, the EB forming medium may not contain one or more of CHIR99021, BMP4, Activin A, and Wnt-C59 / Wnt inhibitors.

[0036] In the step of forming the embryonic body, the pretreated PSCs at the start of the culture may have a density of 1,000 to 20,000 cells, 1,000 to 15,000 cells, 1,000 to 10,000 cells, 1,000 to 9,000 cells, 1,000 to 8,000 cells, 1,000 to 7,000 cells, 1,000 to 6,000 cells, 1,000 to 5,000 cells, 1,000 to 4,000 cells, 1,000 to 3,000 cells, 1,400 to 2,600 cells, 1,800 to 2,200 cells, or about 2,000 cells per culture compartment. The culture compartment may be a well of a microwell plate. For example, the culture compartment may be a well of a 96-well plate. According to the method of the present invention, an elongated cardiac organoid structure and a cardiac organoid therefrom can be induced even at low cell density.

[0037] In the step of forming the embryo, the culture may be performed in a container containing microcompartments, for example, in a microwell plate containing microwells. The culture may be performed under stirring. The culture may be a three-dimensional culture.

[0038] In the step of forming the embryo body, the EB forming medium may be a medium containing one or more of DMEM / F12, Neurobasal medium, N-2, B-27, Glutamax, beta-mercaptoethanol, antibiotics or mixtures thereof, for example, a mixture of penicillin and streptomycin antibiotics, Y-27632 / ROCK inhibitor, bFGF, IGF-1, and HGF. The EB forming medium may be a medium containing DMEM / F12, Neurobasal medium, N-2, B-27, Glutamax, beta-mercaptoethanol, a mixture of penicillin and streptomycin antibiotics, Y-27632 / ROCK inhibitor, bFGF, IGF-1, and HGF.

[0039] The concentration of the above Y-27632 / ROCK inhibitor may be 40.0 μM to 60.0 μM, 44.0 μM to 56.0 μM, 48.0 μM to 52.0 μM, or about 50.0 μM. The above Y-27632 / ROCK inhibitor may be, for example, Thiazovivin, Blebbistatin, or Fasudil (HA-1077).

[0040] The concentration of the above bFGF may be 5 ng / ml to 15 ng / ml, 7 ng / ml to 13 ng / ml, 8 ng / ml to 12 ng / ml, or about 10 ng / ml.

[0041] The concentration of the above IGF-1 may be 1.0 ng / ml to 3.0 ng / ml, 1.5 ng / ml to 2.5 ng / ml, 1.8 ng / ml to 2.2 ng / ml, or about 2.0 ng / ml.

[0042] The concentration of the above HGF may be 1.0 ng / ml to 3.0 ng / ml, 1.5 ng / ml to 2.5 ng / ml, 1.8 ng / ml to 2.2 ng / ml, or about 2.0 ng / ml.

[0043] The concentrations of the above Y-27632 / ROCK inhibitor, bFGF, IGF-1, and HGF may be 40.0 μM to 60.0 μM, 5 ng / ml to 15 ng / ml, 1.0 ng / ml to 3.0 ng / ml, and 1.0 ng / ml to 3.0 ng / ml, respectively.

[0044] The concentration of the above beta-mercaptoethanol may be 0.01 to 1.0 mM, 0.02 to 0.8 mM, 0.04 to 0.6 mM, 0.06 to 0.4 mM, 0.08 to 0.2 mM, or about 0.1 mM.

[0045] In the above method, in the step of forming the embryo, the culture may be performed for 1 to 3 days, 1.5 to 2.5 days, 1.8 to 2.2 days, or about 2 days.

[0046] In addition to the conditions mentioned above, the culture may be performed under conditions such as temperature and oxygen concentration known in the culture of embryoid formation of pluripotent stem cells.

[0047] The above method includes the step of forming a cardiac organoid by culturing the formed embryo in a cardiac organoid differentiation medium.

[0048] In the step of forming the cardiac organoid, the cardiac organoid differentiation medium may be a medium containing N-2 and B-27. The medium containing N-2 and B-27 may contain N-2 and B-27 in a ratio of about 1:1. The cardiac organoid differentiation medium may not contain cardiac-specific differentiation-inducing factors other than N-2 and B-27.

[0049] The above cardiac organoid differentiation medium may not contain one or more of CHIR99021, BMP4, Activin A, and Wnt-C59 / Wnt inhibitors. The Wnt-C59 / Wnt inhibitor may be, for example, IWP-2, IWP-4, XAV939, DKK1, IWR-2, or LGK974.

[0050] In the step of forming the cardiac organoid, the culture is 5 to 35 days, 5 to 30 days, 5 to 25 days, 5 to 20 days, 5 to 17 days, 6 to 35 days, 6 to 30 days, 6 to 25 days, 6 to 20 days, 6 to 17 days, 7 to 35 days, 7 to 30 days, 7 to 25 days, 7 to 20 days, 7 to 17 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, It may be cultured for 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 days.

[0051] The formed cardiac organoid may be a cardiac organoid formed through the elongation and looping process. Additionally, the formed cardiac organoid may be a cardiac organoid that has been formed through the elongation and looping process and still retains an elongated form, or a further differentiated form thereof, for example, a spherical cardiac organoid. For the elongated form of the cardiac organoid, for example, the distance between the end of the arterial pole and the end of the venous pole (hereinafter referred to as the 'total length') may be 300 μm to 1,500 μm, 400 μm to 1,500 μm, 500 μm to 1,500 μm, 800 μm to 1,500 μm, 1,000 μm to 1,500 μm, 1,000 μm to 1,400 μm, 1,000 μm to 1,300 μm, or 1,000 μm to 1,200 μm. The distance directly connecting the end of the arterial pole and the end of the venous pole (hereinafter referred to as the 'straight-line distance') may be 300 μm to It may be 700 μm, 400 μm to 700 μm, or 400 μm to 600 μm. The ends of the arterial pole and the venous pole may be those measured in a fluorescence microscope image.

[0052] The above cardiac organoid may have an elongated structure. The above cardiac organoid may have a width-to-total length ratio of 1.5 or greater, for example, 1.5 to 4, and a sphericity of 0.5 or less, for example, 0.1 to 0.5. The above organoid may be based on the 5th day of culture. The above ratio indicates the degree to which the elongated cardiac organoid is elongated. The larger the above ratio, the greater the degree of elongation.

[0053] The heart organoid may be elongated compared to a conventionally known heart organoid. The heart organoid may be larger than a conventionally known heart organoid, e.g. disclosed in Lewis-Israeli et al., Nat. Commun, 2021, and / or the heart organoid may have a ratio of straight-line distance to total distance, and / or a ratio of width to total distance.

[0054] The above cardiac organoid may be a culture 1 to 35, 2 to 35, 3 to 35, 4 to 35, 5 to 35, for example, 5 to 35, 6 to 35, 7 to 35, 8 to 35, 9 to 35, 10 to 35, 11 to 35, 12 to 35, 13 to 35, 14 to 35, 2 to 25, 2 to 20, 2 to 15, 3 to 35, 3 to 25, 3 to 20, 3 to 15, 4 to 35, 4 to 25, 4 to 20, 4 to 15, 5 to 35, 5 to 25, 5 to 20, 5 to 15, or 15 tomorrow 35 day cardiac organoid.

[0055] The heart organoid formed above may have (i) an elongated shape and (ii) two or more chambers, including one atrium and one ventricle.

[0056] The heart organoid formed above may be capable of beating.

[0057] In the above method, the cell culture conditions not otherwise mentioned may be known conditions for culturing hESC, PSC, iPSC, and EB cells. The above conditions may be, for example, culturing in a 5% CO2 and 37°C incubator.

[0058] According to the above method, the production efficiency of the cardiac organoid is superior compared to the control group, for example, the cardiac organoid described in Lewis-Israeli et al., Nat. Commun, 2021.

[0059] Another aspect provides a cardiac organoid obtained by the method described above, and the obtained cardiac organoid is as described above.

[0060] Another aspect is a cardiac organoid, providing a cardiac organoid with an elongated structure. The cardiac organoid with an elongated structure may have a width-to-total length ratio of, for example, 1.5 or greater, for example, 1.5 to 4, or a sphericity of 0.5 or less, for example, 0.1 to 0.5. The organoid may be based on a culture of 5 to 30 days.

[0061] The heart organoid may have (i) an elongated shape and (ii) two or more chambers, including one atrium and one ventricle.

[0062] The above cardiac organoid may be capable of beating.

[0063] Another aspect provides a method for studying cardiac differentiation comprising the step of culturing the above-mentioned cardiac organoid in candidate conditions or a medium containing candidate substances.

[0064] The above candidate conditions may be high concentrations of nutrients, for example, high concentrations of glucose or oxygen concentration. The above candidate substances may be proteins, sugars, small molecules, etc. The above small molecules may be known drug compounds or novel compounds.

[0065] The above method may further include a step of comparing with a control group.

[0066] The above method may be a method for use in searching for disease treatment conditions or drugs. The above method may include a step of selecting candidate conditions or candidate substances when they show a significant difference compared to a control group. The above control group may have undergone the same process except that a medium not containing candidate conditions or candidate substances was used. The above cardiac organoid may be derived from pluripotent stem cells derived from abnormal cells, and the control cardiac organoid may be derived from pluripotent stem cells derived from normal cells. The above abnormal cells may be cells derived from diseased tissue. The above diseased tissue may be a heart disease. The above heart disease may be a congenital heart disease. The above congenital heart diseases are, for example, one of the following: ventricular septal defect (VSD), an abnormal hole between the left and right ventricles; atrial septal defect (ASD), an abnormal hole between the left and right atria; patent ductus arteriosus (PDA), a condition in which the vessel connecting the aorta and pulmonary artery does not close after birth; tetralogy of Fallot (TOF); pulmonary artery stenosis; ventricular septal defect; aortic overriding; right ventricular hypertrophy; transposition of great arteries (TGA), a condition in which the aorta and pulmonary artery are reversed; pulmonary artery stenosis (PS), narrowing of the pulmonary valve; coarctation of aorta (CoA), narrowing of a portion of the aorta; tricuspid atresia; and a non-formation of the tricuspid valve. It could be more than that.

[0067] Another aspect provides a method for studying cardiac differentiation comprising: a step of obtaining pretreated PSCs by culturing pluripotent stem cells (PSCs) in a medium containing differentiation inducing factors, wherein the differentiation inducing factors include CHIR99201 and bFGF; a step of forming embryoids by culturing the pretreated PSCs in an embryoid body (EB) formation medium; a step of forming cardiac organoids by culturing the formed embryoids in a cardiac organoid differentiation medium; and a step of comparing the degree of regeneration of the formed experimental cardiac organoids with that of a control cardiac organoid.

[0068] In the above method, the step of comparing the degree of elongation of the formed experimental group heart organoid with the control group heart organoid may include a step of determining that it causes cardiac abnormalities if the degree of elongation of the experimental group heart organoid is significantly reduced compared to the control group heart organoid.

[0069] The step of comparing the degree of elongation may involve comparing the ratio of width to the total distance between two poles or the sphericity. The control cardiac organoid may have a ratio of width to the total distance between two poles of 1.5 or more, for example, 1.5 to 4, or a sphericity of 0.5 or less, for example, 0.1 to 0.5.

[0070] The above heart abnormality may be a congenital heart disease. The above congenital heart diseases are, for example, one of the following: ventricular septal defect (VSD), an abnormal hole between the left and right ventricles; atrial septal defect (ASD), an abnormal hole between the left and right atria; patent ductus arteriosus (PDA), a condition in which the vessel connecting the aorta and pulmonary artery does not close after birth; tetralogy of Fallot (TOF); pulmonary artery stenosis; ventricular septal defect; aortic overriding; right ventricular hypertrophy; transposition of great arteries (TGA), a condition in which the aorta and pulmonary artery are reversed; pulmonary artery stenosis (PS), narrowing of the pulmonary valve; coarctation of aorta (CoA), narrowing of a portion of the aorta; tricuspid atresia; and a non-formation of the tricuspid valve. It may be abnormal. In the above method, the control group cardiac organoid may be derived from normal cell-derived pluripotent stem cells, and the experimental group cardiac organoid may be derived from abnormal cell-derived pluripotent stem cells.

[0071] In the above method, the step of forming an embryo by culturing the pretreated PSC in an embryoid body (EB) forming medium may include the step of forming an embryo by culturing the pretreated PSC in an embryoid body (EB) forming medium containing candidate conditions and / or candidate substances.

[0072] The above method may further include a step of comparing with a control group.

[0073] The above method may be a method for use in searching for disease treatment conditions or drugs. The above method may include a step of selecting candidate conditions or candidate substances when they show a significant difference compared to a control group. The above control group may have undergone the same process except that a medium not containing candidate conditions or candidate substances was used. The above cardiac organoid may be derived from pluripotent stem cells derived from abnormal cells, and the control cardiac organoid may be derived from pluripotent stem cells derived from normal cells. The above abnormal cells may be cells derived from diseased tissue. The above diseased tissue may be a heart disease. The above heart disease may be a congenital heart disease.

[0074] The above method may include a step of determining the effect on cardiac differentiation through the morphology, structure, and function of the cardiac organoid obtained after culture.

[0075] The above method may be used to screen drugs for the treatment or prevention of diseases.

[0076] The above method may include the step of differentiating cardiac organoids using pluripotent stem cells derived from normal cells and pluripotent stem cells derived from disease tissue cells. The cardiac organoid derived from the disease tissue cell-derived pluripotent stem cells may have modifications compared to the cardiac organoid derived from normal cell-derived pluripotent stem cells. The modifications may have different shapes, structures, and / or functions compared to the cardiac organoid derived from normal cell-derived pluripotent stem cells.

[0077] The above method comprises the steps of: inducing cardiac organoids by culturing normal cell-derived pluripotent stem cells and disease tissue cell-derived pluripotent stem cells in a candidate condition and a substance-containing medium; and inducing cardiac organoids derived from disease tissue cell-derived pluripotent stem cells into cardiac organoids derived from normal cell-derived pluripotent stem cells and / or

[0078] If the kidney organoid obtained by the culture step has a different structure or function, the method may include the step of selecting the above conditions and substances as drug candidates for the treatment or prevention of disease.

[0079] Another aspect provides a composition or kit comprising the above-mentioned cardiac organoid.

[0080] The above composition may further include one substance necessary for cardiac organoid growth, for example, a culture medium, a growth factor, an induction factor, etc.

[0081] The above kit may further include one substance required for cardiac organoid growth, e.g., culture medium, growth factors, induction factors, etc., and / or reagents or equipment required for differentiation studies and / or drug studies, and instructions for use.

[0082] The above composition or kit may be used to screen drugs for the treatment or prevention of diseases or to study differentiation.

[0083] According to the cardiac organoid production method based on a single pattern, cardiac organoids can be produced efficiently.

[0084] Cardiac organoids produced according to the pattern of work have an elongated shape and are easy to produce, so they can be used for developmental studies and drug discovery.

[0085] According to the method of studying cardiac differentiation based on the pattern of work, cardiac differentiation can be studied efficiently.

[0086] A composition or kit containing a cardiac organoid according to a specific aspect can be used to screen for drugs for treating or preventing diseases or to study cardiac differentiation.

[0087] Figure 1 is a diagram showing the process of forming a cardiac organoid from induced pluripotent stem cells according to the present invention.

[0088] Figure 2 is a diagram showing cardiac organoids according to the pretreatment time described in Figure 1.

[0089] Figure 3 is a diagram showing the results of confirming the tissue composition of the organoid according to the pretreatment time described in Figure 1 through qRT-PCR on the 5th day of formation.

[0090] Figure 4 shows the immunostaining for FHF (NKX2-5) and SHF (ISL1) marker expression in eHo on days 2 and 6 of culture.

[0091] Figure 5 is a diagram showing the change in shape over time of a heart organoid formed according to the heart organoid production method of the present invention.

[0092] Figure 6 shows the results of immunostaining for atrial (MYL7) and ventricular (MYL2) myocardial cells in eHO (elongated cardiac organoid).

[0093] Figure 7 is a schematic diagram showing the morphogenesis and spatial configuration of eHO.

[0094] Figure 8a is a diagram showing real-time calcium imaging of eHO.

[0095] Figure 8b shows the tracking of changes in ΔF / F0 over time in four regions of interest (ROI) (left) within the heart tube as a graph (right).

[0096] Figure 8c is a diagram showing the quantification of the peak ΔF / F0 in Figure 8b.

[0097] Figure 9a shows the results of immunostaining for the sinoatrial node (SA node) (SHOX2) located at the boundary between the cardiac duct (MYL7) and the non-cardiac region.

[0098] Figure 9b is a diagram showing extensive connective tissue in the sinoatrial node using eHO's Masone tricolor staining.

[0099] Figure 9c is a diagram showing the results of immunohistochemistry for the vascular marker PECAM-1.

[0100] Figure 10a is a diagram showing the formation of the proepicardium in eHO.

[0101] Figure 10b is a diagram showing the results of immunostaining for the epicardial marker WT1.

[0102] Figure 10c is a diagram showing a schematic representation of the venous sinus and epicardial development summarized in eHO.

[0103] Figure 11a is a diagram showing discontinuous kinetic monitoring of eHO over time.

[0104] Figure 11b is a diagram showing the measurements of the total length (red double dash arrow) and straight-line distance (blue double dash arrow) between the two poles as indicators of cardiac extension and flexion, respectively.

[0105] Figure 11c is a diagram showing the degree of looping classified by average curvature measurement in eHO on the 17th (left) and the proportion of eHO showing looping from three independent experiments (n=48) (right).

[0106] Figure 11d is a 3D-represented immunohistochemical image of eHO showing atrial (MYL7) and ventricular (MYL2) cardiomyocytes.

[0107] Figure 12a is a diagram showing the six major clusters resulting from the Uniform Manifold Approximation and Projection (UMAP) clustering analysis of eHO on days 5 and 13.

[0108] Figure 12b is a dot plot showing the upexpressed genes of each major cluster identified through UMAP analysis.

[0109] Figure 12c is a diagram showing the marker gene expression of major clusters indicated in UMAP.

[0110] Figure 12d is a diagram showing a UMAP analysis focused on a myocardial cell population.

[0111] Figure 12e is a pairwise correlation analysis of the myocardial cell subclusters of Figure 12c, showing that three distinct series are identified.

[0112] Figure 12f is a heatmap showing the expression of cardiac progenitor cell markers in three cardiomyocyte lineages identified through the pairwise correlation analysis of Figure 12e.

[0113] Figure 12g is a dot plot showing the upexpressed genes of each major cluster identified through UMAP analysis.

[0114] Figures 12h, 12i, 12j, 12k, 12l, and 12m are violin plots showing the expression of previously known cardiomyocyte lineage markers used to annotate cardiomyocyte subclusters.

[0115] Figure 12n is a diagram showing the UMAP projection of the cardiomyocytes of eHO (left) and the cardiac organoids of previous studies (center), and the proportion of cardiomyocyte sub-clusters formed in each cardiac organoid (right).

[0116] Figure 13a is a diagram showing the morphology of eHO treated with a control group (left) and high concentration glucose (right).

[0117] Figure 13b is a diagram showing the results of measuring the size of the control group and the 17th day eHO (n=8) treated with high concentration glucose.

[0118] Figure 13c is a diagram showing the results of measuring the total length over time in the form of the control group and high-concentration glucose-treated eHO (n=8).

[0119] Figure 13d is a diagram showing the results of examining the degree of heart tube bending based on the length between two poles over time.

[0120] Figure 13e is a diagram showing the results of examining the degree of heart tube bending by the final average curvature on day 17.

[0121] Figure 13f is a diagram showing the results of immunostaining on myocardial cells for eHO on day 5.

[0122] Figure 13g shows the results of immunohistochemistry on cardiac progenitor cells for eHO on day 5.

[0123] Figure 13h shows the qPCR analysis of cardiac marker expression for eHO (n=3) on day 5.

[0124] Figure 14 is a diagram showing a typical 96-well plate of eHO on day 10.

[0125] Figure 15a is a diagram showing the 5-day eHO generated from three different hiPSC lines derived from three independent experiments.

[0126] Figure 15b is a diagram showing the efficiency of cardiac organoid formation, defined as the percentage of organoids showing regular cardiac contractions.

[0127] Figure 15c is a diagram showing the results of the cardiac lead being examined by the circularity of the eHO on day 5.

[0128] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0129] Example 1: Differentiation of cardiac organoids from human induced pluripotent stem cells

[0130] FIG. 1 is a diagram illustrating the process of forming a cardiac organoid from induced pluripotent stem cells according to the present invention. In this embodiment, a cardiac organoid was formed from human induced pluripotent stem cells according to the process described in FIG. 1.

[0131] 1. Cell Culture and Maintenance

[0132] The three human induced pluripotent stem cell (hiPSC) lines (WC035i-SOD1-D90D; UWWC1-DS2U; UWWC1-DS4) used in this study were provided by WiCell and cultured according to the provider's instructions. These are all cell lines derived from fibroblasts.

[0133] Briefly, cells were maintained in a 5% CO2, 37°C incubator on a Matrigel growth factor-reducing basement membrane matrix (Corning) in mTeSR1 Plus medium (Stem Cell Technologies). For each 6-well cell culture plate (Corning), 0.5 mg of Matrigel dissolved in DMEM / F12 was coated onto the wells for at least 2 hours prior to use. Cells were seeded every 3–4 days using Versene solution (Gibco). On the first day after seeding, 10 μM Y-27632 (Caymen Chemical) was added to the medium. For cryopreservation, cells were resuspended in mFreSR (Stem Cell Technologies) and stored in a liquid nitrogen tank. All cell lines were regularly tested for Mycoplasma contamination. The use of the hiPSC line in this study was approved by the SKKU Institutional Review Board.

[0134] 2. generation of hiPSC-derived eHO

[0135] (1) Preprocessing

[0136] Human iPSCs underwent at least two passages for organoid formation. When the cells were about 30% fused, the maintenance medium was replaced with a pretreatment medium. The pretreatment medium was N2B27 medium supplemented with 3 μM CHIR99021 (Caymen Chemical) and 40 ng / mL bFGF (Gibco). N2B27 medium was prepared by adding Neurobasal medium (Gibco), B27 supplement (Gibco), Glutamax (Gibco), 0.1 mM β-mercaptoethanol (Sigma), and Pen-Strep antibiotic (Welgene) to a 1:1 mixture of DMEM / F12 (Gibco) and N2 supplement (Gibco).

[0137] CHIR99021 is a potent and selective GSK-3α / β inhibitor that promotes the self-renewal of human embryonic stem cells or iPSCs. The iPSCs were pretreated by culturing for 24, 36, and 48 hours, respectively. Cells were cultured in a 5% CO2, 37°C incubator, and the medium was removed and replaced daily.

[0138] (2) EB formation

[0139] After pretreatment, cells were gently lysed to unicellular lysis using Accutase at 37°C for 2 minutes, counted using a Countess 3 automated cell counter (Invitrogen), and resuspended at a density of 20,000 cells / mL in N2B27 medium by adding 50 μM Y-27632, 10 ng / mL bFGF, 2 ng / mL IGF-1 (R&D Systems), and 2 ng / mL HGF (R&D Systems). 100 μL (2,000 cells / well) of this solution was inoculated into Ultra-Low Attachment 96-well plates (Corning). The plates were centrifuged at 350 xg for 2 minutes and then incubated in 5% CO2 at 37°C.

[0140] The above EB medium does not contain differentiation-inducing factors BMP4, Activin A, CHIR99021, or Wnt-C59 / Wnt inhibitors. Wnt-C59 / Wnt inhibitors may be, for example, IWP-2, IWP-4, XAV939, DKK1, IWR-2, or LGK974. The pretreated iPSCs were cultured for 2 days. Cells were cultured in a 5% CO2, 37°C incubator, and the medium was removed and replaced daily. As a result of culture, EB formation was confirmed.

[0141] (3) Formation of cardiac organoids by culturing the formed EB in a cardiac organoid differentiation medium

[0142] On the second day, 50 μL of medium was replaced and fresh N2B27 medium was added without additional growth factors. Thereafter, the N2B27 medium was replaced daily. Through systematic changes in the pretreatment period (36-48 hours), optimal eHO formation conditions were found by considering differences in differentiation response rates according to cell line and batch.

[0143] Specifically, in the wells of a 96-well plate containing EB formed on the second day of culture, the medium was replaced with N-2 and B-27-containing medium and cultured in a 5% CO2, 37°C incubator for a specified period, and the medium was removed and replaced daily.

[0144] 3. Brightfield microscopy and real-time imaging

[0145] Bright-field images and videos of cardiac organoids were acquired using a Nikon Eclipse Ti2 backlight microscope. Real-time imaging and organoid morphology tracking were performed using the CYTATION-C10 (Agilent) and Gen5 Image Prime 3.14 software (Agilent). Real-time organoids were imaged directly from the wells of an Ultra-Low Attachment 96-well plate, under imaging conditions of 5% CO2 and 37°C.

[0146] 3. Freeze cutting

[0147] Organoids were fixed in a 4% paraformaldehyde (PFA) solution at 4°C overnight. After fixation, the organoids were washed and incubated at room temperature for 30 minutes in a solution of PBS and Tissue-Tek OCT Compound (Sakura) mixed in a 1:1 ratio. The samples were embedded in a new OCT, placed in a cryomold, and frozen in isopentane cooled with liquid nitrogen. Cryosections were prepared using a cryostat to a thickness of 10 μm, mounted on frosted microscope slides, and stored at -80°C.

[0148] 4. Immunofluorescence staining

[0149] For whole staining, organoids were fixed in 4% PFA at 4°C overnight, permeated with 0.5% Triton X-100 for 5 minutes, and then blocked in a PBS solution containing 3% BSA and 0.1% Tween-20 at room temperature for 3 hours. Organoids were incubated with the primary antibody at 4°C overnight, washed with PBT (PBS containing 0.1% Tween-20), and then incubated with the secondary antibody at room temperature for 1 hour. After washing, organoids were mounted in PBS containing 80% glycerol, and confocal images were taken using CYTATION-C10. For cryopreservations, slides were fixed in 4% PFA for 15 minutes after washing, and immunostaining was performed using the same method as for whole staining. Samples were mounted in Mowiol mounting solution and imaged using CYTATION-C10.

[0150] The primary antibody was used at the following concentrations:

[0151] - anti-GATA6 (R&D systems AF1700-SP, 1:200)

[0152] -anti-FOXA2 (DSHB 4C7-c, 1:200)

[0153] -anti-SOX2 (Abcam ab97959, 1:200)

[0154] -anti-HOXB1 (ABclonal A6619, 1:200)

[0155] -anti-TNNT2 (Abcam ab10214, 1:100)

[0156] - anti-NKX2-5 (Cell Signaling Technology 8792S, 1:200)

[0157] -anti-ISL1 / 2 (DSHB 39.4D5-s, 1:200)

[0158] -anti-MYL7 (Synaptic Systems 311011, 1:200)

[0159] -anti-MYL2 (Abcam ab79935, 1:100)

[0160] -anti-SHOX2 (Biorbyt orb40303, 1:200)

[0161] -anti-PECAM-1 (Cell Signaling Technology 3528S, 1:200)

[0162]

[0163] -anti-WT1 (Abcam ab89901, 1:100)

[0164] -anti-α-ACTININ (Sigma-Aldrich A7732, 1:200)

[0165] -anti-N-CADHERIN (Abcam ab18203, 1:200)

[0166] -anti-Cx43 (Cell Signaling Technology 3512S, 1:200)

[0167] 5. Masson tricolor dyeing

[0168] Frozen organoids were stained according to standard protocols using the Masson tricolor staining kit (Abcam). The samples were rehydrated with PBS, fixed with 4% PFA, and incubated in Bouin solution at 60°C for 1 hour. After cooling for 10 minutes, the samples were stained sequentially with Weigert iron hematoxylin for 5 minutes, Biebrich Scarlet / Acid Fuchsin for 15 minutes, Phosphomolybdic / Phosphotungstic Acid for 15 minutes, and Aniline Blue for 5 minutes. The slides were immersed in 1% acetic acid for 3 minutes, dehydrated with ethanol of different concentrations, cleared with xylene, and mounted using Cytoseal™ 60 (ThermoFisher).

[0169] 6. Calcium Imaging

[0170] Organoids were incubated in 5 μM Fluo-8, AM (AAT Bioquest) and 0.04% Pluronic F-127 (Sigma) in a 5% CO2, 37°C incubator for 30 minutes. After washing the organoids twice with N2B27 medium, calcium transient changes were recorded at 12.5 frames per second using CYTATION-C10. Data analysis was performed using the Time Series Analyzer plugin from Fiji. Relative fluorescence intensity (ΔF / F0) was calculated using the following formula:

[0171] ΔF / F0 = (F - F0) / F0

[0172] 7. Tissue clearing and 3D reconstruction

[0173] Organoids were cleared using the Binaree Tissue Clearing Kit according to the manufacturer's protocol. Briefly, organoids immobilized in 4% PFA were incubated overnight in a 35% sucrose solution at 4°C until they settled to the bottom. Subsequently, the organoids were incubated in preheated Tissue Clearing Solution B at 37°C for 4–6 hours to allow the samples to clear. The samples were washed with distilled water and then stained. After staining was complete, the samples were mounted in the Binaree mounting solution and prepared for imaging. For 3D reconstruction, Z-stack images covering the entire organoid were captured using a CYTATION-C10 via confocal imaging at 5μm intervals. 3D reconstruction was performed using Gen5 Image Prime 3.14 software.

[0174] 8. Real-time quantitative reverse transcription PCR

[0175] Total RNA was isolated using the RNeasy Mini kit (Qiagen) according to the manufacturer's protocol. cDNA synthesis was performed using PrimeScript RT reagents (TaKaRa) according to the manufacturer's instructions. Real-time qRT-PCR was conducted using TB Green Premix Ex Taq II (TaKaRa) with the Thermal Cycler Dice Real Time System III (TaKaRa). Gene expression levels were normalized to GAPDH. The primer pairs used are shown in Table 1.

[0176] Gene Primer Sequence Number Sequence Number SOX1 Forward GTCATGTCCGAGGCCGAGAA1 Reverse GAGCAGCGTCTTGGTCTTGC2FOXA2 Forward GGAACACCACTACGCCTTCAAC3 Reverse AGTGCATCACCTGTTCGTAGGC4TBXT Forward TGCTTCCCTGAGACCCAGTT5 Reverse GATCACTTCTTTCCTTTGCATCA6TBX6 Forward TCATCTCCGTGACAGCCTACCA7 Reverse CCGCAGTTTCCTCTTCACACGG8TNNT2 Forward AAGAAGCAGACTGAGCGGGAAA9 Reverse AGATGCTCTGCCACAGCTCCTT10NKX2-5 Forward AAGTGTGCGTCTGCCTTTCCCG11 Reverse TTGTCCGCCTCTGTCTTCTCCA12

[0177] 9. At each stage of single-cell isolation and scRNA-seq development, eHOs collected from the entire 96-well plate were gathered into 15 mL conical tubes. After washing the organoids with PBS, they were incubated in preheated 10x TrypLE Select enzyme solution (Gibco) at 37°C for 20 minutes, and gently pipetted every minute. Pipette tips were cut to reduce physical stress on the cells. The dissolved cells were transferred to 5 mL of preheated N2B27 medium, centrifuged at 200 xg for 5 minutes, gently resuspended in cold PBS, and placed on ice to prepare for further processing.

[0178] 10. scRNA-seq Data Processing and Analysis

[0179] All scRNA-seq data analyses were performed using Seurat v4.3.140 in R 4.2.2. Cells in which mitochondrial gene expression accounted for more than 5% of the total reads were filtered out to exclude low-quality cells. Cells expressing between 1,000 and 6,000 traits were retained, and only genes expressed in at least three cells were included for further analysis. Doublets were removed using the scDblFinder v1.13.2 pipeline, and only cells with a score of 0.049 or lower were selected. Data normalization and scaling were performed using SCTransform, excluding unique molecular identifiers (UMIs). To integrate the 5-day and 13-day samples, 2,000 high-variance genes were selected from all samples and combined into a single Seurat object using the Merge function. Principal Component Analysis (PCA) was performed based on 30 principal components, followed by UMAP embedding using 24 principal components at a clustering resolution of 1.2. Cell clusters were annotated based on differential gene expression within each cluster using the FindAllMarkers function, and subsequently curated manually. Pathway analysis was performed based on the core gene set of GSEA using singleseqgset v0.1.2.9. Figures, including dot plots, violin plots, and heatmaps, were generated using AnnData in Scanpy v1.9.743 and Python 3.10.0. For comparative analysis of cardiomyocyte lineages, previously published scRNA-seq data (GEO: GSE150202 and GSE201343) were mapped and compared with the scRNA-seq results of eHOs.

[0180] 11. Hyperglucose eHO Disease Modeling

[0181] The glucose concentration of the N2B27 medium was calculated to be 21.25 mM. To create a hyperglycemic environment, the high-glucose N2B27 medium was prepared by supplementing D-(+)-glucose to a final concentration of 42.50 mM. The high-glucose N2B27 medium was used from the pretreatment step and replaced the standard N2B27 medium during the eHO culture period.

[0182] 12. Quantification and Statistical Analysis

[0183] Organoid size was measured by generating binary images from brightfield images, applying thresholding to define boundaries, and calculating the area within each boundary using Fiji. The total length of the eHO was determined by drawing a longitudinal midline using the segment line tool in Fiji, and the distance between the two extremes was measured by drawing a straight line connecting the two ends of the eHO. Average curvature was calculated using the Kappa - Curvature Analysis plugin in Fiji, and the average curvature value was measured by drawing an open B-spline curve along the eHO's longitudinal axis. The sphericity of the eHO was calculated using the cell analysis function of Gen5 Image Prime 3.14 software.

[0184] Statistical significance was evaluated using a two-sample asymmetric t-test, and a P-value less than 0.05 was considered a significant difference. To compare the two independent variables, data were analyzed using two-way ANOVA, and multiple comparisons were performed using Sidak's test with Geisser-Greenhouse correction applied (Prism 9.1.0, GraphPad). Error bars represent the standard deviation (SD) or standard error (SEM) as per the figure description.

[0185] 13. Results

[0186] Figure 1 is a diagram illustrating the process of forming a cardiac organoid from induced pluripotent stem cells according to the present invention. As shown in Figure 1, the morphology of the formed cardiac organoid varies depending on the pretreatment time. When cultured for 24, 36, and 48 hours, a gastruloid, an elongated heart organoid (eHO), and a spherical heart organoid (sHO) were formed, respectively. In Figure 1, the cardiac lineage represents the cardiac cell lineage, and the non-cardiac lineage represents the non-cardiac cell lineage. According to Figure 1, the pretreatment period using CHIR99021 and bFGF determines the balance between the cardiac lineage and the non-cardiac lineage.

[0187] Figure 2 is a diagram showing cardiac organoids according to the pretreatment time described in Figure 1. Figure 2 shows a bright-field microscope image (left) of a cardiac organoid obtained by culturing pretreated iPSCs obtained at different pretreatment times in EB-forming medium for 5 days, and a photograph of a cardiac organoid fluorescently stained with marker set 1 (GATA6, FOXA2, and SOX2) and marker set 2 (HOXB1, TNNT2, and HOECHST). Among the markers, GATA6 and TNNT2 are cardiomyocyte markers, FOXA2, SOX2, and HOXB1 are non-cardiomyocyte markers, and HOECHST represents the cell nucleus.

[0188] As shown in Figure 2, it was confirmed that gastroloids were formed after 24 hours of pretreatment, and elongating heart organoids (eHO) were formed after 36 hours of pretreatment. Additionally, spherical heart organoids (sHO), similar to conventionally known heart organoids, were formed after 48 hours of pretreatment. Furthermore, it can be observed that the formation ratio of cardiomyocytes (GATA6 and TNNT2) and non-cardiomyocytes (FOXA2, SOX2, and HOXB1) is adjusted according to the pretreatment time (n=3).

[0189] Figure 3 is a diagram showing the results of confirming the tissue composition of the organoid according to the pretreatment time described in Figure 1 through qRT-PCR on the 5th day of formation.

[0190] In Figure 3, mRNA from the 5th-day cardiac organoid was isolated, and qRT-PCR was performed on the isolated mRNA using the primer set of Table 1 for genes specific to each tissue.

[0191] In Figure 3, the genes specific to the ectodermal, endodermal, axial mesoderm, paraxial mesoderm, and lateral plate mesoderm (cardiac) are SOX1, FOXA2, TBXT, TBX6, TNNT2, and NRX2.5, respectively. In Figure 3, the horizontal axis represents the pretreatment time, and the vertical axis represents the normalized expression (au.), i.e., the relative expression amount to the expression amount of GAPDH (expression of gene of interest / GAPDH expression).

[0192] As shown in Figure 3, overall, as the pretreatment time increased, differentiation of lateral plate mesoderm-derived cardiomyocytes was induced, and differentiation into other types of cells, including endoderm, was inhibited.

[0193] Figure 4 shows the immunostaining for FHF (NKX2-5) and SHF (ISL1) marker expression in eHo on days 2 and 6 of culture.

[0194] Figure 5 is a diagram showing the morphological changes over time of a cardiac organoid formed according to the cardiac organoid production method of the present invention. Cardiac protrusions (arrows) appear on the opposite side of the non-cardiac cell region (arrowheads) on day 4, and extensive elongation occurs. The elongating cardiac tubes form looping to form the final structure. As shown in Figure 5, contractile cardiac tissue was observed to form on one side on day 4 of embryoid body formation, and subsequently, rapid elongation of the cardiac tissue was observed (see days 4 and 7). In addition, as the cardiac tissue elongated, it bent to one side, finally forming a spherical shape as seen on day 17 of formation (see days 10, 13, and 17). Accordingly, the cardiac organoid undergoes the processes of EB formation (Day 1), cardiac duct formation (Day 4), cardiac duct elongation (Day 7), cardiac duct looping (Days 10 and 13), and cardiac organoid formation (Day 17).

[0195] Figure 6 shows the results of immunostaining for atrial (MYL7) and ventricular (MYL2) cardiomyocytes in eHO (elongated cardiac organoids). As shown in Figure 6, the non-cardiomyocyte region (arrowhead) shows a non-specific signal. Figure 6 is a diagram showing that the atria and ventricles were formed in cardiac organoids formed on days 8, 13, and 25 of culture in EB-forming medium, through staining of the atrial marker MYL7 and the ventricular marker MYL2. As shown in Figure 6, it was confirmed that the atria and ventricles are formed spatially separated along the longitudinal axis of the cardiac tube, and that the atria and ventricles are spatially coupled due to looping.

[0196] Figure 7 is a schematic diagram showing the morphogenesis and spatial configuration of eHO. In Figure 7, based on the non-heart region (gray), the atrium (red) is formed closer to the heart and the ventricle (green) is formed further distal to the heart, confirming that the atrial side is the venous pole and the ventricular side is the arterial pole. A, Atrium; PA, Primitive Atrium; PV, Primitive Ventricle; V, Ventricle.

[0197] In FIGS. 2 to 7, the data are presented as mean ± standard deviation. The scale bar is 200 micrometers.

[0198] Regarding the formation of elongating human cardiac organoids, the inventors first established conditions for the strong formation of cardiac organoids with 48 hours of pretreatment using only CHIR99021 and bFGF as initial signaling stimulators (Figs. 1 and 2). To minimize external stimuli and promote cardiac development through intrinsic self-organization, the pretreatment duration was systematically varied to identify the minimum requirements for cardiac development. Organoids pretreated for 24 hours did not develop into cardiac organoids but instead took on a gastroloid form containing derivatives of all three germ layers, as previously reported (Figs. 1, 2, and 3). 36 hours of pretreatment was sufficient to induce cardiac muscle cell differentiation, and cardiac cells exhibited a form protruding from the main body (Figs. 1, 2, and 3). Unlike 48 hours of pretreatment, 36 hours of pretreatment produced organoids with a cardiac protrusion and a non-cardiac cell region opposite it. This region expressed the endodermal markers FOXA2, SOX2, and HOXB1 and represented a non-cardiac system. The proportion of the non-cardiac region increased as the pretreatment time decreased, suggesting that the balance between the cardiac and non-cardiac systems may be regulated by the duration of WNT / bFGF signaling.

[0199] To investigate how cell fate is affected by the duration of pretreatment, the inventors performed quantitative real-time PCR (qRT-PCR) on the cells after pretreatment. As pretreatment lengthened, the expression of cardiac mesoderm (MESP1) and cardiac progenitor cell (NKX2-5) markers gradually increased. In vivo, the cardiac system develops in the most posterior and proximal regions where WNT and FGF signaling are most active. The inventors hypothesized that long-term exposure to CHIR / bFGF induces cells to a more posterior and proximal position, while short exposure differentiates them into anterior and distal cell types. Consistent with this, longer pretreatment increased SOX17 expression and decreased FOXA2 expression, which forms a spatial pattern along the proximal-distal axis during the initial gastrulation process. These results defined the conditions for generating hiPSC-derived cardiac organoids with minimal external signals.

[0200] Next, cardiac organoids pretreated for 36 hours were further investigated. Prior to the formation of the cardiac protuberance, the expression of NKX2-5, an FHF progenitor cell marker, was concentrated on one side of the germ layer (Fig. 4). ISL1, an SHF marker, was located adjacent to NKX2-5 with some overlap. As cardiac development progressed, the entire cardiac protuberance expressed NKX2-5, and ISL1 was located at the boundary between the cardiac and non-cardiac regions. This arrangement mimics a structure where FHF cells forming the initial cardiac duct constitute the initial part of the heart, while SHF cells are located posteriorly and later combine. Surprisingly, the cardiac protuberance began to elongate rapidly, forming an elongated cardiac duct by day 7 (Fig. 5). This elongation was accompanied by looping of the cardiac duct, gradually bringing the opposite poles of the organoid closer together. Eventually, the spiral cardiac duct completed its bending and formed a heart shape.

[0201] The primitive heart tube forms a pattern along the arterial and venous poles, with the atria located at the venous pole and the ventricles near the arterial pole. In the elongated heart organoid (eHO), the atrial (MYL7) and ventricular (MYL2) markers were spatially separated along the longitudinal axis of the heart tube, with the atrial region consistently located near the non-cardiac region and the ventricular region located at the opposite pole (Fig. 6). This suggests that the eHO forms a spatial pattern of atrial and ventricular cardiomyocytes, with the venous pole on the side of the non-cardiac region and the arterial pole on the opposite side (Fig. 7). Collectively, the inventors present a protocol for generating self-organizing heart organoids that reproduce early morphological events of a developing fetal heart through extensive elongation and looping.

[0202] FIGS. 8a to 8c, FIGS. 9a to 9c, and FIGS. 10a to 10c are drawings showing directional contractile propagation, sinus venosus formation, and epicardial development of eHO.

[0203] Figure 8a is a diagram showing real-time calcium imaging of eHO. The calcium wave originates at the venous pole (arrowhead) and propagates toward the arterial pole. In Figure 8a, the contraction of the cardiac organoid was visualized via the fluo-8 calcium flux assay.

[0204] Figure 8b shows the tracking of changes in ΔF / F0 over time in four regions of interest (ROI) (left) within the heart tube as a graph (right).

[0205] Figure 8c is a diagram showing the quantification of the peak ΔF / F0 in Figure 8b. ROI1 and ROI2 were combined into the atrial (A) region, and ROI3 and ROI4 were summed into the ventricular (V) region (n = 12, peak amplitude). Since the ΔF / Fo value of the ventricle (V) is higher than the value measured in the atrial (A), it can be seen that the relatively strong contractile response of the ventricle is reproduced.

[0206] Data are presented as mean ± standard deviation. ****P < 0.0001, Student's t-test.

[0207] eHO exhibited contractions that started in the atrium and propagated toward the ventricle. To better visualize this directional contraction wave, the inventors performed in vivo calcium imaging. The calcium wave started at the venous pole and propagated toward the arterial pole (Fig. 8a). By plotting the relative fluorescence intensity (ΔF / F0) over time in four regions of interest along the venous-arterial axis, the inventors confirmed that this directional calcium wave occurred across multiple batches without a single exception (Fig. 8b). Furthermore, the maximum amplitude of ΔF / F0 was higher at the arterial pole, where ventricular cardiomyocytes are located, compared to the venous pole, which corresponds to atrial cardiomyocytes (Fig. 8c). This supports the concept of distinct atrial and ventricular regions in eHO and their physiological integration.

[0208] Figure 9a shows the results of immunostaining for the sinoatrial node (SA node) (SHOX2) located at the boundary between the cardiac duct (MYL7) and the non-cardiac region.

[0209] Figure 9b is a diagram showing extensive connective tissue in the sinoatrial node using eHO's Masone tricolor staining.

[0210] Figure 9c is a diagram showing the results of immunohistochemistry for the vascular marker PECAM-1.

[0211] Considering that the calcium wave originates at the posterior end of the coronary tube, the inventors hypothesized that this region corresponds to the sinus venosus, an essential structure responsible for cardiac pacing activity during early cardiac development. Immunostaining for SHOX2, a major marker of the sinoatrial node, showed expression at the junction between the atrium and non-cardiac regions, indicating the formation of the sinoatrial node at the site where contractile propagation begins (Fig. 9a). Since the sinoatrial node is embedded in the connective tissue matrix, the inventors performed Mason tricolor staining to visualize this feature. As expected, the inventors observed abundant connective tissue at the junction where the sinoatrial node is located, which is consistent with its known anatomical structure (Fig. 9b). Furthermore, PECAM-1 staining confirmed the presence of a vascular system formed near the posterior end of the coronary tube, suggesting that eHO reproduces the formation of the sinus venosus (Fig. 9c).

[0212] Figure 10a is a diagram showing the formation of the proepicardium in eHO. Protruding cell clusters (arrowheads) appear around day 10.

[0213] Figure 10b shows the results of immunohistochemistry for the epicardial marker WT1. The high-magnification image (right) confirms the presence of proepicardium identity and the epicardial layer (white arrow). Epicardial cells are also scattered within the ventricular region (left).

[0214] Fig. 10c is a diagram showing a schematic representation of the sinus venous and epicardial development summarized in eHO. Scale bars, 200 μm (Figs. 8a, 9a, 10a, and 10b) and 50 μm (Figs. 9b and 9c).

[0215] The sinus venosus also serves as the origin site for the pre-epidermis, a population of progenitor cells crucial for the formation of the epicardium, the outermost layer of the heart. The inventors observed protruding cell clusters near the venous poles of the eHO by day 10 (Fig. 10a). WT1 staining, a marker of the epicardial system, confirmed that this protrusion represents the pre-epidermis (Fig. 10b). WT1 staining also revealed a layer of cells appearing to migrate from the pre-epidermis, which is necessary for epicardial cell dispersal. The inventors detected WT1-positive cells scattered across the ventricular region, indicating successful migration of pre-epidermis-derived cells as observed in a developing fetal heart in vivo. Taken together, these results demonstrate that the eHO replicates key aspects of early cardiac development, including the formation of the epicardium through the sinus venosus, sinoatrial node, and pre-epidermis cell migration (Fig. 10c).

[0216]

[0217] FIGS. 11a to 11d are drawings showing eHO exhibiting extensive elongation and looping.

[0218] Figure 11a is a diagram showing discontinuous kinetic monitoring of eHO over time.

[0219] Figure 11b is a diagram showing the measurements of the total length (red double dash arrow) and straight-line distance (blue double dash arrow) between the two poles as indicators of cardiac extension and flexion, respectively.

[0220] The left panel shows examples of these measurements, and the right panel shows actual measurements of eHO over time (n=9). Extensive elongation was observed from day 4 to day 7 (gray box). Data are expressed as mean ± SD. Tables 2 and 3 show the total length of the heart tube and the distance between the two poles over time for each cardiac organoid shown in Fig. 11b, respectively.

[0221] Total length of heart tube (μm) Step(day)HO_1HO_2HO_3HO_4HO_5HO_6HO_7HO_8HO_92499.5474.3460.3472.4474.1487.8467.2474.9489.23398.7397.1384.0397.0387.6377.9415.1390.6369.44455.6446.6419.9481.3478.4412.6520.5487.6385.55572.1531.6624.1784. 1813.0775.6751.9680.5443.86992.1828.2762.61167.41151.71083.21262.3893.1532.171158.21006.9939.91291.11326.61175.81552.51173.4558.981219.91048.1966.21373.51321.61386.91586.11136.4668.091175.01118.31067.612 31.51345.61343.71471.31154.3792.1101236.11099.31015.11221.91302.71088.61382.31048.9853.5111122.71090.11194.71189.51286.61017.11537.51168.3838.4121125.81080.91075.41138.31301.3990.41498.21038.9825.1131114 .81070.81005.21035.91261.9976.11565.11030.0864.5141067.91057.4970.11030.61241.5980.91356.3993.4873.9151065.01050.9913.41034.01156.4971.01389.4939.9855.4161048.51052.7904.71030.41156.2928.21378.1931.5886.3

[0222] Distance between 2 poles (μm) Step(day)HO_1HO_2HO_3HO_4HO_5HO_6HO_7HO_8HO_92499.5474.3460.3472.4474.1487.8467.2474.9489.23398.7397.1384.0397.0387.6377.9415.1390.6369.44455.6446.6419.9481.3478.4412.6520.5487.6385.5557 2.1531.6610.8378.0553.1325.0751.9604.8418.16725.7628.9741.6409.6276.5101.01224.6581.0496.87719.3779.5788.5154.3346.7175.71347.5561.9483.48367.6950.8799.2211.8646.1498.81276.2512.3525.2925 8.91032.6987.5257.1915.7517.81151.7441.4690.010176.9994.41018.1258.2829.8526.7993.7374.9784.61199.1957.2937.9334.8864.1631.2929.1411.0773.812105.0960.6922.8364.8915.3626.9919.8520.0704.2 13134.3836.1715.2433.2891.4617.4791.8472.7519.814122.7589.0558.8403.0952.2566.2719.2424.7390.715106.8575.3412.4297.7934.2547.1648.9357.3298.21664.2138.2339.0332.9958.6550.5564.0371.8389.8

[0223] Figure 11c shows the degree of looping classified by average curvature measurements in eHOs on the 17th (left) and the proportion of eHOs exhibiting looping from three independent experiments (n=48) (right). In the left panel, the three groups (no loop, partial loop, and full loop) are defined by specific ranges of average curvature values, and representative eHOs from each group are shown below. Specifically, the average curvature values ​​(x, mm) for no loop, partial loop, and full loop -1 The specific ranges of ) are 0 ≤ x < 1.5, 1.5 ≤ x < 4.0, and 4.0 ≤ x, respectively. Average curvature values ​​(x, mm) of representative eHO derived from the no-loop, partial-loop, and full-loop groups -1 ) are 0.645, 3.254, and 5.810, respectively. Here, the average curvature value (x, mm -1 ) is calculated by the following formula.

[0224]

[0225] Here, ki is the curvature value at point i, and N is the total number of points where curvature was measured.

[0226] Fig. 11d is a 3D immunohistochemical image of eHO showing atrial (MYL7) and ventricular (MYL2) cardiomyocytes. The top view in the center and the side view on the right show how the cardiac duct bends three-dimensionally to form a helical structure. In Figs. 11a through 11d, the scale bar is 200 μm.

[0227] To visualize the morphogenesis of the heart tube over time in eHO, the morphology of individual organoids was tracked daily until heart tube annulation was complete. Cardiac protrusion, indicating the onset of elongation, appeared on day 4 (Fig. 11a). Elongation was accompanied by the gradual curling of the heart tube over approximately two weeks, mimicking the transition from a linear tube to a more complex structure. Annulation eventually caused the atrial region to merge into the central part of the elongated heart tissue, reminiscent of early fetal heart development forming the heart shape (Fig. 11b). Elongation and annulation in eHO were quantified by measuring the total length of the organoid and the straight-line distance between the two poles of the heart tube as an alternative measure of annulation (Fig. 11c). The total length of the eHO increased significantly between days 4 and 7 and subsequently reached a stable phase, defining the elongation timeline. Despite the significant increase in total length between days 4 and 7, the straight-line distance remained relatively constant, reflecting the simultaneous inward curvature of the heart tube. To classify eHOs, the inventors measured the average curvature of the longitudinal midline along the heart tube (Fig. 11d). Based on the average curvature values, the eHOs at day 17 were classified into three groups: no ring formation, partial ring formation, and complete ring formation. In three independent experiments, 37.5% of the eHOs showed complete ring formation, 50% showed partial ring formation, and the remaining 12.5% ​​did not ring (Fig. 11e). The degree of variability is consistent with the inherent heterogeneity of the organoid model. Taken together, these results suggest that eHOs effectively reproduce key aspects of early heart tube morphogenesis and provide a valuable platform for studying human heart development and morphogenesis.

[0228] Figures 12a to 12i are diagrams showing various cardiomyocyte lineages revealed through single-cell RNA sequencing (scRNA-seq).

[0229] Figure 12a shows the results of Uniform Manifold Approximation and Projection (UMAP) clustering analysis of eHO on days 5 and 13, showing six major clusters. The six major clusters include cardiomyocytes (CM), progenitor cells, mesenchymal cells, endoderm cells, surface ectoderm cells, and endothelial cells, each annotated based on established lineage markers (see Figures 12a and 12b).

[0230] Figure 12b is a dot plot showing the top-expressed genes of each major cluster identified through UMAP analysis. The color represents the average gene expression level, and the size of the dot represents the percentage of cells expressing each gene.

[0231] Figure 12c is a diagram showing the marker gene expression of major clusters indicated in UMAP.

[0232] Cardiomyocytes formed a major cluster expressing mature cardiomyocyte markers such as MYH6 and MYOZ2, followed by progenitor cells (PDGFRA, NR2F1) and mesenchymal cells (SULF1, COL1A1). A separate cluster showed AFP and RBP4, suggesting hepatic development in the foregut, along with endodermal markers expressing FOXA2 and HHEX, indicating foregut formation. Smaller clusters included superficial ectoderm (KRT19, WNT6) and endothelial cells (PECAM-1, CDH5). Despite the faint TUBB3 expression detected by immunohistochemistry (data not shown), no neural or neural crest cells were identified.

[0233] Figure 12d is a diagram showing a UMAP analysis focused on a myocardial cell population.

[0234] Figure 12e is a pairwise correlation analysis of the myocardial cell subclusters of Figure 12c, showing that three distinct series are identified.

[0235] To more accurately identify the identity of the cardiomyocytes, cluster analysis focused solely on this group was performed. UMAP analysis revealed eight cardiomyocyte sub-clusters, which could be classified into three distinct lineages based on pairwise correlation analysis (Figs. 12d and 12e).

[0236] The first lineage showed relatively high expression of NKX2-5 and HAND1, but low expression of ISL1 and MEF2C, indicating it is an FHF lineage (Fig. 12f). The second lineage was characterized by the expression of ISL1 and MEF2C, indicating an SHF origin. The third cardiomyocyte lineage did not match well with known cardiac lineages and showed no signs of stress or damage. Differential expression analysis revealed multiple non-coding RNAs (e.g., AC008591.1, AP001021.3, TTN-AS), suggesting that these cells may exhibit a transitional or specialized functional state accompanied by significant transcriptome regulation (Reg. CM_1,2) (Figs. 12h, 12i, 12j, 12k, 12l, and 12m). Subgroups within FHF-derived cardiomyocytes showed gene expression profiles corresponding to atrial cardiomyocytes (aCM_1), ventricular cardiomyocytes (vCM), and proliferative cardiomyocytes (prolif. CMs) (Figs. 12h, 12i, 12j, 12k, 12l, and 12m). Within the SHF lineage, subgroups exhibited markers associated with the sinus venosus (SV), atrial cardiomyocytes (aCM_2), and outflow tract (OFT), confirming their SHF origin.

[0237] Figure 12f is a heatmap showing the expression of cardiac progenitor cell markers in three cardiomyocyte lineages identified through the pairwise correlation analysis of Figure 12e.

[0238] Figure 12g is a dot plot showing the top-expressed genes of each major cluster identified through UMAP analysis. The color represents the average gene expression level, and the size of the dot represents the percentage of cells expressing each gene.

[0239] Figures 12h, 12i, 12j, 12k, 12l, and 12m are violin plots showing the expression of previously known cardiomyocyte lineage markers used to annotate cardiomyocyte subclusters.

[0240] Figure 12n is a diagram showing UMAP projections of cardiomyocytes from eHO (left) and cardiac organoids from previous studies (center) (HO1_day 13 (Draklis, L. et al., Nature Biotechnology 39, 737-746(2001)); HO2_day 15 (Kostina, A et al., Stem Cell Reports 19, 317-330 (2024)) and the proportion of cardiomyocyte sub-clusters formed in each cardiac organoid (right).

[0241] Because eHO exhibited dramatic morphological differences compared to existing cardiac organoid models, the inventors compared the transcriptome profile of eHO with previous studies. The inventors analyzed single-cell RNA sequencing data from the day 13 cardiac forming organoid developed by Drakhlis et al. and the day 15 human cardiac organoid developed by Kostina et al. To avoid confusion, these will be referred to as HO1_d13 and HO2_d15, respectively. Both HO1 and HO2 were found to contain various cardiac cell types but exhibited a spherical shape without elongation. When the cardiomyocytes of HO1_d13 and HO2_d15 were mapped to the cardiomyocytes of eHO_d13, the inventors observed distinct differences in the SHF-derived cardiomyocytes (Fig. 12n). In HO1_d13, the SHF-derived lineage consisted entirely of OFT cells, and there were no SHF-derived atrial cardiomyocytes or venous sinus cells. This observation is consistent with previous transcriptome analysis of HO1, which showed the absence of posterior SHF (pSHF)-derived cells generating the sinus venous and atria. On the other hand, the SHF-derived cardiomyocytes of HO2_d15 were primarily pSHF-derived sinus venous and atrial cardiomyocytes, but there were no anterior SHF (aSHF)-derived OFT cells. In eHO, both pSHF-derived (sinus venous and aCM_2) and aSHF-derived (OFT) lineages were present. Furthermore, the proportion of regulatory cardiomyocytes in eHO was significantly higher than in HO1_day13 (7%) and HO2_d15 (11%), accounting for approximately 29% of the total cardiomyocyte population. These findings highlight the diversity of cardiomyocyte lineages generated within eHO and emphasize their potential to better replicate in vivo cardiac development.

[0242] Figures 13a to 13h are diagrams showing that high concentrations of glucose cause morphogenesis abnormalities associated with cardiac differentiation disorders.

[0243] Figure 13a shows the morphology of eHO treated with a control group (left) and high-concentration glucose (right). This experiment can be used to reproduce congenital heart disease caused by gestational diabetes in cardiac organoids.

[0244] Figure 13b shows the results of measuring the size of the control group and the 17-day eHO (n=8) treated with high-concentration glucose. Table 4 shows the size of the control group and the 17-day eHO (n=8) treated with high-concentration glucose in Figure 13b. As shown in Table 4, the average size of the organoids in high-concentration glucose corresponds to approximately 71% of the control group, resulting in a size reduction of approximately -29%.

[0245] Size (μm 2 Organoid Control Group High Glucose HO_1645071505440HO_2695694536003HO_3660691524504HO_4736384433111HO_5743822582256HO_6719634513443HO_7710116427196HO_8755093488541Average 708313501312

[0246] As shown in Fig. 13b, eHO treated with high concentrations of glucose has a significantly smaller area, i.e., size, compared to the control group. This indicates that abnormalities in cardiac organoids are formed by high concentrations of glucose. The high concentration of glucose may be 22 mM or more, 25 mM or more, 30 mM or more, 35 mM or more, 40 mM or more, 22 mM to 100 mM, 25 mM to 100 mM, 30 mM to 100 mM, 35 mM to 100 mM, 40 mM to 100 mM, or about 42.50 mM. Fig. 13c is a figure showing the results of measuring the total length over time for the control group and eHO treated with high concentrations of glucose (n=8). Tables 5 and 6 show the total length over time for the control group and eHO treated with high concentrations of glucose (n=8), respectively.

[0247] Control Group (Total Length μm) Step (Day) HO_1 HO_2 HO_3 HO_4 HO_5 HO_6 HO_7 HO_8 Average 1326.7344.1339.9336.4344.2339.0327.5349.7338.42441.6501.8451.7503.0497.0451.0490.7485.7477.83674.2720.8648.2747. 6762.4833.6740.9576.8713.14799.21050.3856.9991.01024.41136.7896.3837.2949.051396.11588.01351.61632.01703.11754.11245.01544.91526.961963.81975.31724.31931. 92056.02188.71734.51874.71931.272102.51928.11769.32039.91998.52285.91894.41941.51995.081955.02063.41818.22173.32194.22206.31893.52033.42042.292016.02123.6 1893.22269.52219.72116.91875.92027.52067.8102025.82189.91866.92189.82208.62094.01906.92027.02063.6112056.32218.01808.12274.22294.32150.31678.82085.52070.7

[0248] High concentration glucose (Total length μm) Step(day) HO_1 HO_2 HO_3 HO_4 HO_5 HO_6 HO_7 HO_8 Average 1324.1363.0316.1300.3368.6329.7330.3310.2331.22442.1521.8440.0447.8493.2526.2453.5429.5473.13561.2536.0567.849 1.8492.0531.1568.7593.4540.14634.0777.9763.8615.0627.3692.5692.5759.9704.15902.31187.91388.5992.01000.61195.31001.51212.71139.861206.81469.11700.7893.51 283.61478.2898.41359.71297.671507.61586.61807.41154.81471.51571.31216.41691.41499.981682.01749.71926.51306.41599.41646.91303.11516.21578.391704.01852.21 796.91289.81705.31472.81856.91569.91649.1101561.81810.31898.81357.01743.91462.91954.11570.61685.4111646.31809.71885.01297.41650.01481.21908.21517.71649.9

[0249] As shown in Figs. 13b and 13c, the high-concentration glucose eHO has a significantly reduced size (Fig. 13b) and a reduced total length over time (Fig. 13c) measured on day 17. Fig. 13d is a diagram showing the results of examining the degree of cardiac tube bending based on the length between two poles over time. As shown in Fig. 13d, the high-concentration glucose-treated eHO has a significantly smaller length between two poles compared to the control group. This indicates that an abnormality is formed in which cardiac organoid elongation does not occur due to the high-concentration glucose. Tables 5 and 6 show the length between two poles over time for the control group and the high-concentration glucose-treated eHO (n=8), respectively, as described in Fig. 13d.

[0250] Control Group Distance between 2 poles (μm) Step (day) HO_1 HO_2 HO_3 HO_4 HO_5 HO_6 HO_7 HO_8 Average 1326.7344.1339.9336.4344.2339.0327.5349.7338.42441.6501.8451.7503.0497.0451.0490.7485.7477.83665.5682. 2645.8744.5729.7830.4740.4555.5699.34768.2872.0850.4945.2368.91125.6846.6824.0825.15649.41078.81122.61384.8906.31281.3766.11430.61077.56950.81012.2 1025.81313.2987.11037.3574.41626.21065.97997.5900.01003.51162.11062.0783.0555.71691.31019.481699.01093.7976.51135.5895.8757.5667.61890.41139.591700 .61025.3856.01107.7954.4832.2638.11882.21124.6101690.4933.2833.21108.2799.6800.0694.31808.71083.5111602.9785.4794.61114.5695.9794.4825.51755.21046.1

[0251] High concentration glucose Distance between 2 poles (μm) Step (day) HO_1 HO_2 HO_3 HO_4 HO_5 HO_6 HO_7 HO_8 Average 1324.1363.0316.1300.3368.6329.7330.3310.2330.32442.1521.8440.0447.8493.2526.2453.5429.5469.33429.3 517.5555.7483.3491.4507.3556.0590.8516.44389.3658.7760.3554.0625.4677.0689.2642.5624.65642.7802.3944.3163.5845.5841.355.1283.2572.26823.11289.2 1150.7323.5940.2874.4412.2208.2752.77590.61377.1976.9376.5932.51205.8278.3251.7748.78558.01464.71132.9315.71290.91129.7351.0492.1841.99566.3154 1.11558.7263.21263.61473.4698.5223.7948.610582.81499.01701.0256.51144.11450.4691.2217.5942.811554.31507.61729.3236.81087.11461.0739.4249.1945.6

[0252] Figure 13e shows the results of examining the degree of heart tube bending based on the final average curvature on day 17. As shown in Figure 13e, eHO treated with high-concentration glucose has a significantly larger curvature, i.e., a circular shape, compared to the control group. Table 9 shows the average curvature values ​​in Figure 13e.

[0253] Average Curvature (mm-1) Control Group High Concentration Glucose HO_11.71 33.848 HO_21.86 01.805 HO_34.05 33.820 HO_43.52 65.668 HO_52.73 22.946 HO_64.00 33.845 HO_73.74 58.586 HO_80.41 84.947 Average 2.75 64.433

[0254] Figure 13f shows the results of immunostaining on myocardial cells for eHO on day 5. Figure 13g shows the results of immunostaining on cardiac progenitor cells for eHO on day 5.

[0255] Figure 13h shows the qPCR analysis of cardiac marker expression for eHO (n=3) on day 5.

[0256] Statistical analysis was performed using Student's t-test (Figs. 13b, 13e, and 13h) and Sidak's multiple comparisons test following two-way ANOVA (Figs. 13c and 13d). *P < 0.05; **P < 0.01; ****P < 0.0001; ns, not significant. Data are expressed as mean ± SEM, and the scale bar is 200 μm.

[0257] To determine whether eHO could model morphogenesis defects associated with congenital heart disease, the inventors cultured eHO under high-glucose conditions mimicking the hyperglycemic environment of pre-pregnancy diabetes. eHO cultured under high-glucose conditions exhibited significantly smaller sizes compared to the control group (Fig. 13a,b), which is consistent with hyperglycemia-induced heart defects previously described in animals. The reduction in size was associated with clear abnormalities in coronary morphogenesis. Coronary extension was impaired, as evidenced by shorter coronary lengths in high-glucose eHO compared to the control group (Fig. 13c). In addition to extension defects, the inventors observed an abnormal looping process in high-glucose eHO, inferred from shorter straight-line distances between organoid poles (Fig. 13d). Furthermore, high-glucose eHO exhibited a greater degree of looping based on mean curvature measurements on day 17, which further highlighted the abnormal morphogenesis (Fig. 13e). Studies have shown that hyperglycemia inhibits cardiac differentiation and maturation. High glucose eHO also showed a severe reduction in cardiac regions and low expression of major cardiac markers (Fig. 13f-h). Taken together, these results demonstrate that eHO effectively models the morphogenesis defects observed in congenital heart disease and provides a powerful disease modeling platform that was previously unavailable.

[0258] As shown in Fig. 13, it was confirmed that morphological changes, including size and length, of the cardiac organoid under culture conditions containing a high concentration of glucose differed from those of the control group. Therefore, the elongated cardiac organoid of the present invention can be used to study congenital heart diseases, including gestational diabetes. The congenital heart disease may be a disease caused during the process of heart development.

[0259] FIGS. 14, and FIGS. 15a to 15c are drawings illustrating the reproducibility and robustness of the eHO-forming protocol.

[0260] Figure 14 shows a typical 96-well plate of eHO on day 10. The organoids show robust induction of contractile heart tube formation and elongation, and also show variability in the degree of elongation and bending at a fixed time point.

[0261] Figure 15a is a figure showing the 5th day eHO generated from three different hiPSC lines (designated as WC035i-SOD1-D90D; UWWC1-DS2U; and UWWC1-DS4) derived from three independent experiments.

[0262] Figure 15b shows the efficiency of cardiac organoid formation, defined as the percentage of organoids exhibiting regular cardiac contractions (n ​​= 109 for WC035i-SOD1-D90D; n = 104 for UWWC1-DS2U; n = 97 for UWWC1-DS4; 3 independent experiments per cell line). As shown in Figure 15b, the efficiency of cardiac organoid formation was 100%.

[0263] Figure 15c shows the results of examining the induction of the heart tube by the circularity of the eHO on day 5 (n = 109 for WC035i-SOD1-D90D; n = 104 for UWWC1-DS2U; n = 97 for UWWC1-DS4; 3 independent experiments per cell line). Spherical heart organoids (sHO; n=19) generated by 48-hour exposure to hiPSCs for pretreatment serve as a non-elongating reference. Figure 15c shows the average circularity of the 48-hour pretreated sHO, WC035i-SOD1-D90D, UWWC1-DS2U, and UWWC1-DS4.

[0264] sHO (48-h preprocessing)WC035i-SOD1-D90DUWWC1-DS2UUWWC1-DS4 Average sphericity 0.712 0.27 0.471 0.409

[0265] Here, sphericity is calculated by the following formula: Circularity = 4πxA / p 2

[0266] Here, A represents the area of ​​the organoid and p represents the perimeter. As shown in FIG. 15c, the eHO of the present invention has an average sphericity of 0.5 or less.

[0267] The box-and-whisker plot shows the minimum, first quartile, median, third quartile, and maximum values ​​for each group. Pairwise comparisons were performed between sHO and eHO obtained from each hiPSC line using the Student's t-test. ****P < 0.0001. Scale bar, 200 μm.

Claims

A step of obtaining pretreated PSCs by culturing pluripotent stem cells (PSCs) in a medium containing differentiation-inducing factors, wherein the differentiation-inducing factors include CHIR99201 and bFGF; A step of forming an embryoid body by culturing the above-mentioned pretreated PSC in an embryoid body (EB) forming medium; and A method for producing a cardiac organoid from a PSC through elongation and bending, comprising the step of forming a cardiac organoid by culturing the formed embryo in a cardiac organoid differentiation medium. The method of claim 1, wherein the concentrations of CHIR99201 and bFGF are each 2.0 μM to 4.0 μM and 30 ng / ml to 50 ng / ml. A method according to claim 1, wherein the culture in the step of obtaining the pretreated PSC is cultured for 24 to 48 hours. The method of claim 1, wherein the differentiation-inducing factor-containing medium is a medium containing a mixture of DMEM / F12, Neurobasal medium, N-2, B-27, Glutamax, beta-mercaptoethanol, and antibiotics penicillin and streptomycin in addition to the differentiation-inducing factor. The method of claim 1, wherein the differentiation-inducing factor-containing medium does not contain one or more of BMP4 and Activin A. In claim 1, the EB forming medium in the step of forming the embryonic body is A method that does not include one or more of CHIR99021, BMP4, Activin A, and Wnt-C59 / Wnt inhibitors. A method according to claim 1, wherein, at the step of forming the embryo, the pretreated PSC comprises 1,000 to 20,000 cells per culture compartment at the start of the culture. In claim 1, the EB forming medium in the step of forming the embryonic body is A method comprising a medium containing DMEM / F12, Neurobasal medium, N-2, B-27, Glutamax, beta-mercaptoethanol, a mixture of penicillin and streptomycin antibiotics, Y-27632 / ROCK inhibitor, bFGF, IGF-1, and HGF. The method of claim 8, wherein the concentrations of the Y-27632 / ROCK inhibitor, bFGF, IGF-1, and HGF are 40.0 μM to 60.0 μM, 5 ng / ml to 15 ng / ml, 1.0 ng / ml to 3.0 ng / ml, and 1.0 ng / ml to 3.0 ng / ml, respectively. A method according to claim 1, wherein the culture is performed for 1 to 3 days in the step of forming the embryo. A method according to claim 1, wherein, in the step of forming the cardiac organoid, the cardiac organoid differentiation medium is a medium containing N-2 and B-27. The method of claim 1, wherein the cardiac organoid differentiation medium does not contain one or more of CHIR99021, BMP4, Activin A, and Wnt-C59 / Wnt inhibitors. A method according to claim 1, wherein, in the step of forming the heart organoid, the culture is performed for 5 to 30 days. The method of claim 1, wherein the formed cardiac organoid has an elongated cardiac organoid shape, the ratio of width to total distance is 1.5 to 4, and the sphericity is 0.1 to 0.

5. The method of claim 14, wherein the heart organoid is a heart organoid on day 5 to 30 of culture. A method according to claim 1, wherein the formed cardiac organoid has one or more of the following: (i) an elongated shape, (ii) two or more chambers including one atrium and one ventricle, and (iii) being capable of beating. A cardiac organoid obtained by any one of the methods of claims 1 to 16. A cardiac organoid that has an elongated cardiac organoid form. A cardiac organoid according to claim 18, having one or more of (i) an elongated shape, (ii) two or more chambers including one atrium and one ventricle, and (iii) being capable of beating. A method for studying cardiac differentiation comprising the step of culturing a cardiac organoid of any one of claims 17 to 19 in a candidate condition or a medium containing a candidate substance. A method according to claim 20, further comprising the step of comparing with a control group. A method for using to search for a disease treatment condition or drug according to claim 20, comprising the step of selecting a candidate condition or candidate substance when a significant difference is shown compared with a control group. A method according to claim 20, wherein the cardiac organoid is derived from abnormal cell-derived pluripotent stem cells, and the control cardiac organoid is derived from normal cell-derived pluripotent stem cells. A step of obtaining pretreated PSCs by culturing pluripotent stem cells (PSCs) in a medium containing differentiation-inducing factors, wherein the differentiation-inducing factors include CHIR99201 and bFGF; A step of forming an embryoid body by culturing the above-mentioned pretreated PSC in an embryoid body (EB) forming medium; A step of forming a cardiac organoid by culturing the formed embryo in a cardiac organoid differentiation medium; and A method for studying cardiac differentiation comprising the step of comparing the degree of regeneration of a formed experimental group cardiac organoid with a control group cardiac organoid. In claim 24, in the step of comparing the degree of regeneration of the formed experimental group cardiac organoid with the control group cardiac organoid, A method comprising the step of determining that cardiac abnormalities are caused when the degree of elongation of the experimental group cardiac organoid is significantly reduced compared to the control group cardiac organoid. A method according to claim 25, wherein the control group cardiac organoid is derived from normal cell-derived pluripotent stem cells, and the experimental group cardiac organoid is derived from abnormal cell-derived pluripotent stem cells. A composition or kit comprising a cardiac organoid of any one of claims 17 to 19. A composition or kit according to claim 27, intended for use in screening drugs for treating or preventing diseases or in studying differentiation.